Five years of full-scale utility demonstration of pulsed energization of electric precipitators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schultz, S.A.; Jacobus, P.L.; Casey, P.J.

1996-11-01

In a conventional electrostatic precipitator (ESP) the applied dc voltage fulfills three functions: (1) generation of negative ions, (2) charging of particles, and (3) transport of the charged particles to the collecting plates. In the case of high resistivity fly-ash (often associated with the burning of low sulfur coal) the dc voltage is limited by repeated electrical discharges and in extreme cases by back-corona. Lowering the applied dc voltage reduces sparking and back-corona, but also reduces the field on the discharge wires and leads to poorly distributed ion generation as well as reduced charging and particle transport forces. Pulsed energization,more » which consists of superimposing high voltage pulses of short duration onto the existing base dc voltage, offers an attractive way to improve the collection efficiency of ESPs suffering from poor energization. The superimposed pulses become responsible for uniform ion generation while the underlying dc field continues to fulfill the function of particle charging and transport. This paper describes the five-year test of the ESP at Madison Gas and Electric`s Blount Station.« less

Carbon nanotube vacuum gauges with wide-dynamic range and processes thereof

NASA Technical Reports Server (NTRS)

Manohara, Harish (Inventor); Kaul, Anupama B. (Inventor)

2013-01-01

A miniature thermal conductivity gauge employs a carbon single-walled-nanotube. The gauge operates on the principle of thermal exchange between the voltage-biased nanotube and the surrounding gas at low levels of power and low temperatures to measure vacuum across a wide dynamic range. The gauge includes two terminals, a source of constant voltage to the terminals, a single-walled carbon nanotube between the terminals, a calibration of measured conductance of the nanotube to magnitudes of surrounding vacuum and a current meter in electrical communication with the source of constant voltage. Employment of the nanotube for measuring vacuum includes calibrating the electrical conductance of the nanotube to magnitudes of vacuum, exposing the nanotube to a vacuum, applying a constant voltage across the nanotube, measuring the electrical conductance of the nanotube in the vacuum with the constant voltage applied and converting the measured electrical conductance to the corresponding calibrated magnitude of vacuum using the calibration. The nanotube may be suspended to minimize heat dissipation through the substrate, increasing sensitivity at even tower pressures.

Voltage transfer function as an optical method to characterize electrical properties of liquid crystal devices.

PubMed

Bateman, J; Proctor, M; Buchnev, O; Podoliak, N; D'Alessandro, G; Kaczmarek, M

2014-07-01

The voltage transfer function is a rapid and visually effective method to determine the electrical response of liquid crystal (LC) systems using optical measurements. This method relies on crosspolarized intensity measurements as a function of the frequency and amplitude of the voltage applied to the device. Coupled with a mathematical model of the device it can be used to determine the device time constants and electrical properties. We validate the method using photorefractive LC cells and determine the main time constants and the voltage dropped across the layers using a simple nonlinear filter model.

Forecasting of high voltage insulation performance: Testing of recommended potting materials and of capacitors

NASA Technical Reports Server (NTRS)

Bever, R. S.

1984-01-01

Nondestructive high voltage test techniques (mostly electrical methods) are studied to prevent total or catastrophic breakdown of insulation systems under applied high voltage in space. Emphasis is on the phenomenon of partial breakdown or partial discharge (P.D.) as a symptom of insulation quality, notably partial discharge testing under D.C. applied voltage. Many of the electronic parts and high voltage instruments in space experience D.C. applied stress in service, and application of A.C. voltage to any portion thereof would be prohibited. Suggestions include: investigation of the ramp test method for D.C. partial discharge measurements; testing of actual flight-type insulation specimen; perfect plotting resin samples with controlled defects for test; several types of plotting resins and recommendations of the better ones from the electrical characteristics; thermal and elastic properties are also considered; testing of commercial capaciters; and approximate acceptance/rejection/rerating criteria for sample test elements for space use, based on D.C. partial discharge.

Pulsed source ion implantation apparatus and method

DOEpatents

Leung, K.N.

1996-09-24

A new pulsed plasma-immersion ion-implantation apparatus that implants ions in large irregularly shaped objects to controllable depth without overheating the target, minimizing voltage breakdown, and using a constant electrical bias applied to the target. Instead of pulsing the voltage applied to the target, the plasma source, for example a tungsten filament or a RF antenna, is pulsed. Both electrically conducting and insulating targets can be implanted. 16 figs.

Detecting electroporation by assessing the time constants in the exponential response of human skin to voltage controlled impulse electrical stimulation.

PubMed

Bîrlea, Sinziana I; Corley, Gavin J; Bîrlea, Nicolae M; Breen, Paul P; Quondamatteo, Fabio; OLaighin, Gearóid

2009-01-01

We propose a new method for extracting the electrical properties of human skin based on the time constant analysis of its exponential response to impulse stimulation. As a result of this analysis an adjacent finding has arisen. We have found that stratum corneum electroporation can be detected using this analysis method. We have observed that a one time-constant model is appropriate for describing the electrical properties of human skin at low amplitude applied voltages (<30V), and a two time-constant model best describes skin electrical properties at higher amplitude applied voltages (>30V). Higher voltage amplitudes (>30V) have been proven to create pores in the skin's stratum corneum which offer a new, lower resistance, pathway for the passage of current through the skin. Our data shows that when pores are formed in the stratum corneum they can be detected, in-vivo, due to the fact that a second time constant describes current flow through them.

Spin-dependent electrical conduction in a pentacene Schottky diode explored by electrically detected magnetic resonance

NASA Astrophysics Data System (ADS)

Fukuda, Kunito; Asakawa, Naoki

2017-02-01

Reported is the observation of dark spin-dependent electrical conduction in a Schottky barrier diode with pentacene (PSBD) using electrically detected magnetic resonance at room temperature. It is suggested that spin-dependent conduction exists in pentacene thin films, which is explored by examining the anisotropic linewidth of the EDMR signal and current density-voltage (J-V) measurements. The EDMR spectrum can be decomposed to Gaussian and Lorentzian components. The dependency of the two signals on the applied voltage was consistent with the current density-voltage (J-V) of the PSBD rather than that of the electron-only device of Al/pentacene/Al, indicating that the spin-dependent conduction is due to bipolaron formation associated with hole polaronic hopping processes. The applied-voltage dependence of the ratio of intensity of the Gaussian line to the Lorentzian may infer that increasing current density should make conducting paths more dispersive, thereby resulting in an increased fraction of the Gaussian line due to the higher dispersive g-factor.

9 CFR 307.7 - Safety requirements for electrical stimulating (EST) equipment.

Code of Federal Regulations, 2012 CFR

2012-01-01

... requirements for electrical stimulating (EST) equipment. (a) General. Electrical stimulating (EST) equipment is... of facilitating blood removal. These provisions do not apply to electrical equipment used to stun and... generate pulsed DC or AC voltage for stimulation and is separate from the equipment used to apply the...

9 CFR 307.7 - Safety requirements for electrical stimulating (EST) equipment.

Code of Federal Regulations, 2014 CFR

2014-01-01

... requirements for electrical stimulating (EST) equipment. (a) General. Electrical stimulating (EST) equipment is... of facilitating blood removal. These provisions do not apply to electrical equipment used to stun and... generate pulsed DC or AC voltage for stimulation and is separate from the equipment used to apply the...

Certain applied electrical signals during EPG cause negative effects on stylet probing behaviors by adult Lygus lineolaris (Hemiptera: Miridae).

PubMed

Backus, Elaine A; Cervantes, Felix A; Godfrey, Larry; Akbar, Waseem; Clark, Thomas L; Rojas, Maria G

This study is the first to fully evaluate whether electrical signals applied to large insects during electropenetrography (EPG; also called electrical penetration graph) negatively affect insect behavior. During EPG, electrical signals are applied to plants, and thus to the gold-wire-tethered insects feeding on them. The insect completes an electrical circuit whose changes in voltage reflect the insect's stylet probing/penetration behaviors, recorded as waveform output. For nearly 50 years of EPG science, evidence has supported that there are no or negligible effects on tiny insects from applied electricity during EPG. Recently however, EPG studies of large-bodied hemipterans such as heteropterans and sharpshooter leafhoppers have been published. The wider stylet diameters of such large insects cause them to have lower inherent resistances to applied signals compared with smaller insects, conveying more electrical current. The present study asked whether such increased currents would affect insect stylet probing, by comparing Lygus lineolaris behaviors on pin-head cotton squares using an AC-DC electropenetrograph. Effects of AC or DC applied signals were separately examined in two factorial studies, each comparing four input resistor (Ri) levels (10 6 , 10 7 , 10 8 and 10 9  Ω) and four applied voltage levels (2, 60, 150 and 250 mV). Results showed that changes in both probing and non-probing behaviors were indeed caused by changing signal type, Ri level, or applied voltage. Negative effects on feeding were numerically greater overall for DC than AC applied signals, perhaps due to muscular tetany from DC; however, AC versus DC could not be statistically tested. Results strongly support the need for flexible Ri and applied voltage levels and types, to tailor instrument settings to the size and special needs of each insect subject. Our findings will facilitate further EPG studies of Lygus spp., such as host plant resistance or insecticidal assays/bioassays to assess mode of action and appropriate dosage. It is hoped that this study will also inform EPG studies of similar, large heteropterans in the future. Published by Elsevier Ltd.

Strain-optic voltage monitor wherein strain causes a change in the optical absorption of a crystalline material

DOEpatents

Weiss, J.D.

1997-01-14

A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field. 6 figs.

ELECTRICAL CIRCUITS USING COLD-CATHODE TRIODE VALVES

DOEpatents

Goulding, F.S.

1957-11-26

An electrical circuit which may be utilized as a pulse generator or voltage stabilizer is presented. The circuit employs a cold-cathode triode valve arranged to oscillate between its on and off stages by the use of selected resistance-capacitance time constant components in the plate and trigger grid circuits. The magnitude of the d-c voltage applied to the trigger grid circuit effectively controls the repetition rate of the output pulses. In the voltage stabilizer arrangement the d-c control voltage is a portion of the supply voltage and the rectified output voltage is substantially constant.

Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

PubMed

Pervukhin, Viktor V; Sheven, Dmitriy G

2010-01-01

The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

Discharge processes and an electrical model of atmospheric pressure plasma jets in argon

NASA Astrophysics Data System (ADS)

Fang, Zhi; Shao, Tao; Yang, Jing; Zhang, Cheng

2016-01-01

In this paper, an atmospheric pressure plasma discharge in argon was generated using a needle-to-ring electrode configuration driven by a sinusoidal excitation voltage. The electric discharge processes and discharge characteristics were investigated by inspecting the voltage-current waveforms, Lissajous curves and lighting emission images. The change in discharge mode with applied voltage amplitude was studied and characterised, and three modes of corona discharge, dielectric barrier discharge (DBD) and jet discharge were identified, which appeared in turn with increasing applied voltage and can be distinguished clearly from the measured voltage-current waveforms, light-emission images and the changing gradient of discharge power with applied voltage. Based on the experimental results and discharge mechanism analysis, an equivalent electrical model and the corresponding equivalent circuit for characterising the whole discharge processes accurately was proposed, and the three discharge stages were characterised separately. A voltage-controlled current source (VCCS) associated with a resistance and a capacitance were used to represent the DBD stage, and the plasma plume and corona discharge were modelled by a variable capacitor in series with a variable resistor. Other factors that can influence the discharge, such as lead and stray capacitance values of the circuit, were also considered in the proposed model. Contribution to the Topical Issue "Recent Breakthroughs in Microplasma Science and Technology", edited by Kurt Becker, Jose Lopez, David Staack, Klaus-Dieter Weltmann and Wei Dong Zhu.

DC attenuation meter

DOEpatents

Hargrove, Douglas L.

2004-09-14

A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

Thermal Assisted In Vivo Gene Electrotransfer

PubMed Central

Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

2016-01-01

Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

Cellular defibrillation: interaction of micro-scale electric fields with voltage-gated ion channels.

PubMed

Kargol, Armin; Malkinski, Leszek; Eskandari, Rahmatollah; Carter, Maya; Livingston, Daniel

2015-09-01

We study the effect of micro-scale electric fields on voltage-gated ion channels in mammalian cell membranes. Such micro- and nano-scale electric fields mimic the effects of multiferroic nanoparticles that were recently proposed [1] as a novel way of controlling the function of voltage-sensing biomolecules such as ion channels. This article describes experimental procedures and initial results that reveal the effect of the electric field, in close proximity of cells, on the ion transport through voltage-gated ion channels. We present two configurations of the whole-cell patch-clamping apparatus that were used to detect the effect of external stimulation on ionic currents and discuss preliminary results that indicate modulation of the ionic currents consistent with the applied stimulus.

Voltage-Driven Magnetization Switching and Spin Pumping in Weyl Semimetals

NASA Astrophysics Data System (ADS)

Kurebayashi, Daichi; Nomura, Kentaro

2016-10-01

We demonstrate electrical magnetization switching and spin pumping in magnetically doped Weyl semimetals. The Weyl semimetal is a three-dimensional gapless topological material, known to have nontrivial coupling between the charge and the magnetization due to the chiral anomaly. By solving the Landau-Lifshitz-Gilbert equation for a multilayer structure of a Weyl semimetal, an insulator and a metal while taking the charge-magnetization coupling into account, magnetization dynamics is analyzed. It is shown that the magnetization dynamics can be driven by the electric voltage. Consequently, switching of the magnetization with a pulsed electric voltage can be achieved, as well as precession motion with an applied oscillating electric voltage. The effect requires only a short voltage pulse and may therefore be energetically favorable for us in spintronics devices compared to conventional spin-transfer torque switching.

Removal of phenol by activated alumina bed in pulsed high-voltage electric field.

PubMed

Zhu, Li-nan; Ma, Jun; Yang, Shi-dong

2007-01-01

A new process for removing the pollutants in aqueous solution-activated alumina bed in pulsed high-voltage electric field was investigated for the removal of phenol under different conditions. The experimental results indicated the increase in removal rate with increasing applied voltage, increasing pH value of the solution, aeration, and adding Fe2+. The removal rate of phenol could reach 72.1% when air aeration flow rate was 1200 ml/min, and 88.2% when 0.05 mmol/L Fe2+ was added into the solution under the conditions of applied voltage 25 kV, initial phenol concentration of 5 mg/L, and initial pH value 5.5. The addition of sodium carbonate reduced the phenol removal rate. In the pulsed high-voltage electric field, local discharge occurred at the surface of activated alumina, which promoted phenol degradation in the thin water film. At the same time, the space-time distribution of gas-liquid phases was more uniform and the contact areas of the activated species generated from the discharge and the pollutant molecules were much wider due to the effect of the activated alumina bed. The synthetical effects of the pulsed high-voltage electric field and the activated alumina particles accelerated phenol degradation.

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

PubMed

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-08-10

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

PubMed Central

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-01-01

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively. PMID:28773801

Reduction technique of drop voltage and power losses to improve power quality using ETAP Power Station simulation model

NASA Astrophysics Data System (ADS)

Satrio, Reza Indra; Subiyanto

2018-03-01

The effect of electric loads growth emerged direct impact in power systems distribution. Drop voltage and power losses one of the important things in power systems distribution. This paper presents modelling approach used to restructrure electrical network configuration, reduce drop voltage, reduce power losses and add new distribution transformer to enhance reliability of power systems distribution. Restructrure electrical network was aimed to analyse and investigate electric loads of a distribution transformer. Measurement of real voltage and real current were finished two times for each consumer, that were morning period and night period or when peak load. Design and simulation were conduct by using ETAP Power Station Software. Based on result of simulation and real measurement precentage of drop voltage and total power losses were mismatch with SPLN (Standard PLN) 72:1987. After added a new distribution transformer and restructrured electricity network configuration, the result of simulation could reduce drop voltage from 1.3 % - 31.3 % to 8.1 % - 9.6 % and power losses from 646.7 watt to 233.29 watt. Result showed, restructrure electricity network configuration and added new distribution transformer can be applied as an effective method to reduce drop voltage and reduce power losses.

Electric field-induced ferromagnetic resonance in a CoFeB/MgO magnetic tunnel junction under dc bias voltages

NASA Astrophysics Data System (ADS)

Kanai, Shun; Gajek, Martin; Worledge, D. C.; Matsukura, Fumihiro; Ohno, Hideo

2014-12-01

We measure homodyne-detected ferromagnetic resonance (FMR) induced by the electric-field effect in a CoFeB/MgO/CoFeB magnetic tunnel junction (MTJ) with perpendicular magnetic easy axis under dc bias voltages up to 0.1 V. From the bias dependence of the resonant frequency, we find that the first order perpendicular magnetic anisotropy is modulated by the applied electric field, whereas the second order component is virtually independent of the electric field. The lineshapes of the FMR spectra are bias dependent, which are explained by the combination of electric-field effect and reflection of the bias voltage from the MTJ.

Apparatuses and methods for generating electric fields

DOEpatents

Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L

2013-08-06

Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings

NASA Technical Reports Server (NTRS)

Desrosiers, M. F.; Bandurski, R. S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings.

PubMed

Desrosiers, M F; Bandurski, R S

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

Effect of a Longitudinally Applied Voltage Upon the Growth of Zea mays Seedlings 1

PubMed Central

Desrosiers, Mark F.; Bandurski, Robert S.

1988-01-01

The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage. Images Fig. 1 PMID:11537877

Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

NASA Astrophysics Data System (ADS)

Sakai, C.; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Ogata, Y.; Fujita, D.

2016-08-01

We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO3 dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.

Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

DOEpatents

Kikta, Thomas J.; Mitchell, Ronald D.

1992-01-01

A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.

Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

DOEpatents

Kikta, T.J.; Mitchell, R.D.

1992-11-24

A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet. 4 figs.

Validation of finite element model of transcranial electrical stimulation using scalp potentials: implications for clinical dose

NASA Astrophysics Data System (ADS)

Datta, Abhishek; Zhou, Xiang; Su, Yuzhou; Parra, Lucas C.; Bikson, Marom

2013-06-01

Objective. During transcranial electrical stimulation, current passage across the scalp generates voltage across the scalp surface. The goal was to characterize these scalp voltages for the purpose of validating subject-specific finite element method (FEM) models of current flow. Approach. Using a recording electrode array, we mapped skin voltages resulting from low-intensity transcranial electrical stimulation. These voltage recordings were used to compare the predictions obtained from the high-resolution model based on the subject undergoing transcranial stimulation. Main results. Each of the four stimulation electrode configurations tested resulted in a distinct distribution of scalp voltages; these spatial maps were linear with applied current amplitude (0.1 to 1 mA) over low frequencies (1 to 10 Hz). The FEM model accurately predicted the distinct voltage distributions and correlated the induced scalp voltages with current flow through cortex. Significance. Our results provide the first direct model validation for these subject-specific modeling approaches. In addition, the monitoring of scalp voltages may be used to verify electrode placement to increase transcranial electrical stimulation safety and reproducibility.

Electric-field induced surface instabilities of soft dielectrics and their effects on optical transmittance and scattering

NASA Astrophysics Data System (ADS)

Shian, Samuel; Kjeer, Peter; Clarke, David R.

2018-03-01

When a voltage is applied to a percolative, mechanically compliant mat of carbon nanotubes (CNTs) on a smooth elastomer bilayer attached to an ITO coated glass substrate, the in-line optical transmittance decreases with increasing voltage. Two regimes of behavior have been identified based on optical scattering, bright field optical microscopy, and confocal optical microscopy. In the low field regime, the electric field produces a spatially inhomogeneous surface deformation of the elastomer that causes local variations in optical refraction and modulates the light transmittance. The spatial variation is associated with the distribution of the CNTs over the surface. At higher fields, above a threshold voltage, an array of pits in the surface form by a nucleation and growth mechanism and these also scatter light. The formation of pits, and creases, in the thickness of the elastomer, is due to a previously identified electro-mechanical surface instability. When the applied voltage is decreased from its maximum, the transmittance returns to its original value although there is a transmittance hysteresis and a complicated time response. When the applied voltage exceeds the threshold voltage, there can be remnant optical contrast associated with creasing of the elastomer and the recovery time appears to be dependent on local jamming of CNTs in areas where the pits formed. A potential application of this work as an electrically tunable privacy window or camouflaging devices is demonstrated.

Ion manipulation device with electrical breakdown protection

DOEpatents

Chen, Tsung-Chi; Tang, Keqi; Ibrahim, Yehia M; Smith, Richard D; Anderson, Gordon A; Baker, Erin M

2014-12-02

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area. The surfaces are housed in a chamber, and at least one electrically insulative shield is coupled to an inner surface of the chamber for increasing a mean-free-path between two adjacent electrodes in the chamber.

Alternating current breakdown voltage of ice electret

NASA Astrophysics Data System (ADS)

Oshika, Y.; Tsuchiya, Y.; Okumura, T.; Muramoto, Y.

2017-09-01

Ice has low environmental impact. Our research objectives are to study the availability of ice as a dielectric insulating material at cryogenic temperatures. We focus on ferroelectric ice (iceXI) at cryogenic temperatures. The properties of iceXI, including its formation, are not clear. We attempted to obtain the polarized ice that was similar to iceXI under the applied voltage and cooling to 77 K. The polarized ice have a wide range of engineering applications as electronic materials at cryogenic temperatures. This polarized ice is called ice electret. The structural difference between ice electret and normal ice is only the positions of protons. The effects of the proton arrangement on the breakdown voltage of ice electret were shown because electrical properties are influenced by the structure of ice. We observed an alternating current (ac) breakdown voltage of ice electret and normal ice at 77 K. The mean and minimum ac breakdown voltage values of ice electret were higher than those of normal ice. We considered that the electrically weak part of the normal ice was improved by applied a direct electric field.

Oxygen Displacement in Cuprates under Ionic Liquid Field-Effect Gating

PubMed Central

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua; He, Xi; Bollinger, Anthony T.; Pavuna, Davor; Pindak, Ron; Božović, Ivan

2016-01-01

We studied structural changes in a 5 unit cell thick La1.96Sr0.04CuO4 film, epitaxially grown on a LaSrAlO4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film (ground) and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were: (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and equatorial oxygen atoms were displaced towards the surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of equatorial oxygen atoms. PMID:27578237

Zero temperature coefficient of resistance of the electrical-breakdown path in ultrathin hafnia

NASA Astrophysics Data System (ADS)

Zhang, H. Z.; Ang, D. S.

2017-09-01

The recent widespread attention on the use of the non-volatile resistance switching property of a microscopic oxide region after electrical breakdown for memory applications has prompted basic interest in the conduction properties of the breakdown region. Here, we report an interesting crossover from a negative to a positive temperature dependence of the resistance of a breakdown region in ultrathin hafnia as the applied voltage is increased. As a consequence, a near-zero temperature coefficient of resistance is obtained at the crossover voltage. The behavior may be modeled by (1) a tunneling-limited transport involving two farthest-spaced defects along the conduction path at low voltage and (2) a subsequent transition to a scattering-limited transport after the barrier is overcome by a larger applied voltage.

Demonstrations with a Liquid Crystal Shutter

ERIC Educational Resources Information Center

Kraftmakher, Yaakov

2012-01-01

The experiments presented show the response of a liquid crystal shutter to applied electric voltages and the delay of the operations. Both properties are important for liquid crystal displays of computers and television sets. Two characteristics of the shutter are determined: (i) the optical transmittance versus applied voltage of various…

Method of removing the effects of electrical shorts and shunts created during the fabrication process of a solar cell

DOEpatents

Nostrand, Gerald E.; Hanak, Joseph J.

1979-01-01

A method of removing the effects of electrical shorts and shunts created during the fabrication process and improving the performance of a solar cell with a thick film cermet electrode opposite to the incident surface by applying a reverse bias voltage of sufficient magnitude to burn out the electrical shorts and shunts but less than the break down voltage of the solar cell.

Demagnetization using a determined estimated magnetic state

DOEpatents

Denis, Ronald J; Makowski, Nathanael J

2015-01-13

A method for demagnetizing comprising positioning a core within the electromagnetic field generated by a first winding until the generated first electrical current is not substantially increasing, thereby determining a saturation current. A second voltage, having the opposite polarity, is then applied across the first winding until the generated second electrical current is approximately equal to the magnitude of the determined saturation current. The maximum magnetic flux within the core is then determined using the voltage across said first winding and the second current. A third voltage, having the opposite polarity, is then applied across the first winding until the core has a magnetic flux equal to approximately half of the determined maximum magnetic flux within the core.

Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakai, C., E-mail: SAKAI.Chikako@nims.go.jp; Ishida, N.; Masuda, H.

2016-08-01

We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO{sub 3} dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from themore » grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.« less

High density associative memory

NASA Technical Reports Server (NTRS)

Moopenn, Alexander W. (Inventor); Thakoor, Anilkumar P. (Inventor); Daud, Taher (Inventor); Lambe, John J. (Inventor)

1989-01-01

A multi-layered, thin-film, digital memory having associative recall. There is a first memory matrix and a second memory matrix. Each memory matrix comprises, a first layer comprising a plurality of electrically separated row conductors; a second layer comprising a plurality of electrically separated column conductors intersecting but electrically separated from the row conductors; and, a plurality of resistance elements electrically connected between the row condutors and the column conductors at respective intersections of the row conductors and the column conductors, each resistance element comprising, in series, a first resistor of sufficiently high ohmage to conduct a sensible element current therethrough with virtually no heat-generating power consumption when a low voltage as employed in thin-film applications is applied thereacross and a second resistor of sufficiently high ohmage to conduct no sensible current therethrough when a low voltage as employed in thin-film applications is applied thereacross, the second resistor having the quality of breaking down to create a short therethrough upon the application of a breakdown level voltage across the first and second resistors.

Electrical stimulation in white oyster mushroom (Pleurotus florida) production

NASA Astrophysics Data System (ADS)

Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

2017-09-01

White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

16 CFR 1505.6 - Performance.

Code of Federal Regulations, 2012 CFR

2012-01-01

... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

16 CFR 1505.6 - Performance.

Code of Federal Regulations, 2011 CFR

2011-01-01

... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

16 CFR 1505.6 - Performance.

Code of Federal Regulations, 2014 CFR

2014-01-01

... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

Oxygen Displacement in Cuprates under IonicLiquid Field-Effect Gating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua

We studied structural changes in a 5 unit cell thick La 1.96Sr 0.04CuO 4 film, epitaxially grown on a LaSrAlO 4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were:more » (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and planar oxygen atoms were displaced towards the sample surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of planar oxygen atoms.« less

Oxygen Displacement in Cuprates under IonicLiquid Field-Effect Gating

DOE PAGES

Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua; ...

2016-08-15

We studied structural changes in a 5 unit cell thick La 1.96Sr 0.04CuO 4 film, epitaxially grown on a LaSrAlO 4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were:more » (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and planar oxygen atoms were displaced towards the sample surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of planar oxygen atoms.« less

The Electrolytic Effect on the Catalytic Degradation of Dye and Nitrate Ion by New Ceramic Beads of Natural Minerals and TiO2

NASA Astrophysics Data System (ADS)

Sata, Akiyoshi; Sakai, Takako; Goto, Yusuke; Ohta, Toshiyuki; Hayakawa, Katumitu

2007-05-01

We have developed a new hybrid ceramic material "Taiyo" as a water processing catalyst. The porous ceramic has a core-shell structure. It decolorized completely the dye solutions as well as the wastewater output after primary water processing by microorganism in a pig farm. This new material showed the acceleration of water purification by applying electric voltage. The degradation of dyes and pig urine output from the primary treatments was accelerated by applying voltage. Nitrate in underground water was also decomposed only by applying voltage, while it was not decomposed without voltage.

Comparison of pulsed corona plasma and pulsed electric fields for the decontamination of water containing Legionella pneumophila as model organism.

PubMed

Banaschik, Robert; Burchhardt, Gerhard; Zocher, Katja; Hammerschmidt, Sven; Kolb, Juergen F; Weltmann, Klaus-Dieter

2016-12-01

Pulsed corona plasma and pulsed electric fields were assessed for their capacity to kill Legionella pneumophila in water. Electrical parameters such as in particular dissipated energy were equal for both treatments. This was accomplished by changing the polarity of the applied high voltage pulses in a coaxial electrode geometry resulting in the generation of corona plasma or an electric field. For corona plasma, generated by high voltage pulses with peak voltages of +80kV, Legionella were completely killed, corresponding to a log-reduction of 5.4 (CFU/ml) after a treatment time of 12.5min. For the application of pulsed electric fields from peak voltages of -80kV a survival of log 2.54 (CFU/ml) was still detectable after this treatment time. Scanning electron microscopy images of L. pneumophila showed rupture of cells after plasma treatment. In contrast, the morphology of bacteria seems to be intact after application of pulsed electric fields. The more efficient killing for the same energy input observed for pulsed corona plasma is likely due to induced chemical processes and the generation of reactive species as indicated by the evolution of hydrogen peroxide. This suggests that the higher efficacy and efficiency of pulsed corona plasma is primarily associated with the combined effect of the applied electric fields and the promoted reaction chemistry. Copyright © 2016 Elsevier B.V. All rights reserved.

Piezoelectric transformers for low-voltage generation of gas discharges and ionic winds in atmospheric air

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Michael J.; Go, David B., E-mail: dgo@nd.edu; Department of Chemical and Biomolecular Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556

To generate a gas discharge (plasma) in atmospheric air requires an electric field that exceeds the breakdown threshold of ∼30 kV/cm. Because of safety, size, or cost constraints, the large applied voltages required to generate such fields are often prohibitive for portable applications. In this work, piezoelectric transformers are used to amplify a low input applied voltage (<30 V) to generate breakdown in air without the need for conventional high-voltage electrical equipment. Piezoelectric transformers (PTs) use their inherent electromechanical resonance to produce a voltage amplification, such that the surface of the piezoelectric exhibits a large surface voltage that can generate corona-like dischargesmore » on its corners or on adjacent electrodes. In the proper configuration, these discharges can be used to generate a bulk air flow called an ionic wind. In this work, PT-driven discharges are characterized by measuring the discharge current and the velocity of the induced ionic wind with ionic winds generated using input voltages as low as 7 V. The characteristics of the discharge change as the input voltage increases; this modifies the resonance of the system and subsequent required operating parameters.« less

Fully depleted back illuminated CCD

DOEpatents

Holland, Stephen Edward

2001-01-01

A backside illuminated charge coupled device (CCD) is formed of a relatively thick high resistivity photon sensitive silicon substrate, with frontside electronic circuitry, and an optically transparent backside ohmic contact for applying a backside voltage which is at least sufficient to substantially fully deplete the substrate. A greater bias voltage which overdepletes the substrate may also be applied. One way of applying the bias voltage to the substrate is by physically connecting the voltage source to the ohmic contact. An alternate way of applying the bias voltage to the substrate is to physically connect the voltage source to the frontside of the substrate, at a point outside the depletion region. Thus both frontside and backside contacts can be used for backside biasing to fully deplete the substrate. Also, high resistivity gaps around the CCD channels and electrically floating channel stop regions can be provided in the CCD array around the CCD channels. The CCD array forms an imaging sensor useful in astronomy.

Voltage droop Coordinating Control applied in UPFC and STATCOM system

NASA Astrophysics Data System (ADS)

Junhui, Huang; Zhuyi, Peng; Chengjie, Ni; Yiqing, Xu; Jiliang, Xue

2018-04-01

When UPFC, unified power flow controller is applied with other FACTS into power grid, it is possible that the voltage controlled vibrates constantly to response to a sudden reactive power turbulent in grid if the parameters of these FACTS are not coordinating reasonably. Moreover, the reactive power generated by these equipment will intertwine unexpectedly. The article proposes a method named voltage-reactive power droop control to allow the reference voltage fluctuating around the rating voltage so that the vibration is reduced and the power distribution is improved. Finally, the article cite a electric-magnetic simulation by EMTDC models of east-China power grid to prove it effective when applied to improve the response characteristics to sudden turbulence in power grid.

Flexible electronic control system based on FPGA for liquid-crystal microlens

NASA Astrophysics Data System (ADS)

Zhang, Bo; Xin, Zhaowei; Li, Dapeng; Wei, Dong; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng

2018-02-01

Traditional imaging based on common optical lens can only be used to collect intensity information of incident beams, but actually lightwave also carries other mode information about targets and environment, including: spectrum, wavefront, and depth of target, and so on. It is very important to acquire those information mentioned for efficiently detecting and identifying targets in complex background. There is a urgent need to develop new high-performance optical imaging components. The liquid-crystal microlens (LCMs) only by applying spatial electrical field to change optical performance, have demonstrated remarkable advantages comparing conventional lenses, and therefore show a widely application prospect. Because the physical properties of the spatial electric fields between electrode plates in LCMs are directly related to the light-field performances of LCMs, the quality of voltage signal applied to LCMs needs high requirements. In this paper, we design and achieve a new type of digital voltage equipment with a wide adjustable voltage range and high precise voltage to effectively drive and adjust LCMs. More importantly, the device primarily based on field-programmable gate array(FPGA) can generate flexible and stable voltage signals to cooperate with the various functions of LCMs. Our experiments show that through the electronic control system, the LCMs already realize several significant functions including: electrically swing focus, wavefront imaging, electrically tunable spectral imaging and light-field imaging.

Mimosa pudica: Electrical and mechanical stimulation of plant movements.

PubMed

Volkov, Alexander G; Foster, Justin C; Ashby, Talitha A; Walker, Ronald K; Johnson, Jon A; Markin, Vladislav S

2010-02-01

Thigmonastic movements in the sensitive plant Mimosa pudica L., associated with fast responses to environmental stimuli, appear to be regulated through electrical and chemical signal transductions. The thigmonastic responses of M. pudica can be considered in three stages: stimulus perception, electrical signal transmission and induction of mechanical, hydrodynamical and biochemical responses. We investigated the mechanical movements of the pinnae and petioles in M. pudica induced by the electrical stimulation of a pulvinus, petiole, secondary pulvinus or pinna by a low electrical voltage and charge. The threshold value was 1.3-1.5 V of applied voltage and 2 to 10 microC of charge for the closing of the pinnules. Both voltage and electrical charge are responsible for the electro-stimulated closing of a leaf. The mechanism behind closing the leaf in M. pudica is discussed. The hydroelastic curvature mechanism closely describes the kinetics of M. pudica leaf movements.

Heat transport in electrically aligned multiwalled carbon nanotubes dispersed in water

NASA Astrophysics Data System (ADS)

Cervantes-Alvarez, F.; Macias, J. D.; Alvarado-Gil, J. J.

2018-02-01

A modified Ångström method was used to determine the thermal diffusivity and thermal conductivity of aqueous dispersions of multiwalled carbon nanotubes as a function of their weight fraction concentration and in the presence of an externally applied electric field. Measurements were performed in planar samples, with a fixed thickness of 3.18 mm applying an AC voltage in the range from 0 to 70~V_RMS and for concentrations of carbon nanotubes from 0 to 2 wf%. It is shown that this field induces the formation of clusters followed by their alignment along the electric field, which can favor heat transfer in that direction. Heat transfer measurements show two regimes, in the first one under 0.5 wf%, voltages lower than 30~V_RMS are not strong enough to induce the adequate order of the carbon nanostructures, and as a consequence, thermal diffusivity of the dispersion remains close to the thermal diffusivity of water. In contrast for higher concentrations (above 1.5 wf%), 10~V_RMS are enough to get a good alignment. Above such thresholds of concentrations and voltages, thermal diffusivity and conductivity increase, when the electric field is increased, in such a way that for an applied voltage of 20~V_RMS and for a concentration of 1.5 wf%, an increase of 49% of the thermal conductivity was obtained. It is also shown that this approach exhibits limits, due to the fact that the electric-field induced structure, can act as a heating element at high electric field intensities and carbon nanotubes concentrations, which can induce convection and evaporation of the liquid matrix.

Changes in behavioral responses of Lygus lineolaris (Hemiptera: Miridae) from various applied signal voltages during EPG recordings

USDA-ARS?s Scientific Manuscript database

A 3rd-generation AC-DC electrical penetration graph (EPG) monitor was used to study feeding behaviors of pre-reproductive adult Lygus lineolaris (Hemiptera: Miridae) on pinhead (<3mm) cotton squares, applying different signal voltages at several input impedances. The AC-DC monitor allows a user to s...

AC electrical breakdown phenomena of epoxy/layered silicate nanocomposite in needle-plate electrodes.

PubMed

Park, Jae-Jun; Lee, Jae-Young

2013-05-01

Epoxy/layered silicate nanocomposite for the insulation of heavy electric equipments were prepared by dispersing 1 wt% of a layered silicate into an epoxy matrix with a homogenizing mixer and then AC electrical treeing and breakdown tests were carried out. Wide-angle X-ray diffraction (WAXD) analysis and transmission electron microscopy (TEM) observation showed that nano-sized monolayers were exfoliated from a multilayered silicate in the epoxy matrix. When the nano-sized silicate layers were incorporated into the epoxy matrix, the breakdown rate in needle-plate electrode geometry was 10.6 times lowered than that of the neat epoxy resin under the applied electrical field of 520.9 kV/mm at 30 degrees C, and electrical tree propagated with much more branches in the epoxy/layered silicate nanocomposite. These results showed that well-dispersed nano-sized silicate layers retarded the electrical tree growth rate. The effects of applied voltage and ambient temperature on the tree initiation, growth, and breakdown rate were also studied, and it was found that the breakdown rate was largely increased, as the applied voltage and ambient temperature increased.

16 CFR § 1505.6 - Performance.

Code of Federal Regulations, 2013 CFR

2013-01-01

... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

Voltage-Rectified Current and Fluid Flow in Conical Nanopores.

PubMed

Lan, Wen-Jie; Edwards, Martin A; Luo, Long; Perera, Rukshan T; Wu, Xiaojian; Martin, Charles R; White, Henry S

2016-11-15

Ion current rectification (ICR) refers to the asymmetric potential-dependent rate of the passage of solution ions through a nanopore, giving rise to electrical current-voltage characteristics that mimic those of a solid-state electrical diode. Since the discovery of ICR in quartz nanopipettes two decades ago, synthetic nanopores and nanochannels of various geometries, fabricated in membranes and on wafers, have been extensively investigated to understand fundamental aspects of ion transport in highly confined geometries. It is now generally accepted that ICR requires an asymmetric electrical double layer within the nanopore, producing an accumulation or depletion of charge-carrying ions at opposite voltage polarities. Our research groups have recently explored how the voltage-dependent ion distributions and ICR within nanopores can induce novel nanoscale flow phenomena that have applications in understanding ionics in porous materials used in energy storage devices, chemical sensing, and low-cost electrical pumping of fluids. In this Account, we review our most recent investigations on this topic, based on experiments using conical nanopores (10-300 nm tip opening) fabricated in thin glass, mica, and polymer membranes. Measurable fluid flow in nanopores can be induced either using external pressure forces, electrically via electroosmotic forces, or by a combination of these two forces. We demonstrate that pressure-driven flow can greatly alter the electrical properties of nanopores and, vice versa, that the nonlinear electrical properties of conical nanopores can impart novel and useful flow phenomena. Electroosmotic flow (EOF), which depends on the magnitude of the ion fluxes within the double layer of the nanopore, is strongly coupled to the accumulation/depletion of ions. Thus, the same underlying cause of ICR also leads to EOF rectification, i.e., unequal flows occurring for the same voltage but opposite polarities. EOF rectification can be used to electrically pump fluids with very precise control across membranes containing conical pores via the application of a symmetric sinusoidal voltage. The combination of pressure and asymmetric EOF can also provide a means to generate new nanopore electrical behaviors, including negative differential resistance (NDR), in which the current through a conical pore decreases with increasing driving force (applied voltage), similar to solid-state tunnel diodes. NDR results from a positive feedback mechanism between the ion distributions and EOF, yielding a true bistability in both fluid flow and electrical current at a critical applied voltage. Nanopore-based NDR is extremely sensitive to the surface charge near the nanopore opening, suggesting possible applications in chemical sensing.

Method and system for operating an electric motor

DOEpatents

Gallegos-Lopez, Gabriel; Hiti, Silva; Perisic, Milun

2013-01-22

Methods and systems for operating an electric motor having a plurality of windings with an inverter having a plurality of switches coupled to a voltage source are provided. A first plurality of switching vectors is applied to the plurality of switches. The first plurality of switching vectors includes a first ratio of first magnitude switching vectors to second magnitude switching vectors. A direct current (DC) current associated with the voltage source is monitored during the applying of the first plurality of switching vectors to the plurality of switches. A second ratio of the first magnitude switching vectors to the second magnitude switching vectors is selected based on the monitoring of the DC current associated with the voltage source. A second plurality of switching vectors is applied to the plurality of switches. The second plurality of switching vectors includes the second ratio of the first magnitude switching vectors to the second magnitude switching vectors.

Miniaturized ultrafine particle sizer and monitor

NASA Technical Reports Server (NTRS)

Qi, Chaolong (Inventor); Chen, Da-Ren (Inventor)

2011-01-01

An apparatus for measuring particle size distribution includes a charging device and a precipitator. The charging device includes a corona that generates charged ions in response to a first applied voltage, and a charger body that generates a low energy electrical field in response to a second applied voltage in order to channel the charged ions out of the charging device. The corona tip and the charger body are arranged relative to each other to direct a flow of particles through the low energy electrical field in a direction parallel to a direction in which the charged ions are channeled out of the charging device. The precipitator receives the plurality of particles from the charging device, and includes a disk having a top surface and an opposite bottom surface, wherein a predetermined voltage is applied to the top surface and the bottom surface to precipitate the plurality of particles.

A numerical study on piezoelectric energy harvesting by combining transverse galloping and parametric instability phenomena

NASA Astrophysics Data System (ADS)

Franzini, Guilherme Rosa; Santos, Rebeca Caramêz Saraiva; Pesce, Celso Pupo

2017-12-01

This paper aims to numerically investigate the effects of parametric instability on piezoelectric energy harvesting from the transverse galloping of a square prism. A two degrees-of-freedom reduced-order model for this problem is proposed and numerically integrated. A usual quasi-steady galloping model is applied, where the transverse force coefficient is adopted as a cubic polynomial function with respect to the angle of attack. Time-histories of nondimensional prism displacement, electric voltage and power dissipated at both the dashpot and the electrical resistance are obtained as functions of the reduced velocity. Both, oscillation amplitude and electric voltage, increased with the reduced velocity for all parametric excitation conditions tested. For low values of reduced velocity, 2:1 parametric excitation enhances the electric voltage. On the other hand, for higher reduced velocities, a 1:1 parametric excitation (i.e., the same as the natural frequency) enhances both oscillation amplitude and electric voltage. It has been also found that, depending on the parametric excitation frequency, the harvested electrical power can be amplified in 70% when compared to the case under no parametric excitation.

Electrically tunable whispering gallery mode microresonator based on a grapefruit-microstructured optical fiber infiltrated with nematic liquid crystals.

PubMed

Yang, Chengkun; Zhang, Hao; Liu, Bo; Lin, Shiwei; Li, Yuetao; Liu, Haifeng

2017-08-01

An electrically tunable whispering gallery mode (WGM) microresonator based on an HF-etched microstructured optical fiber (MOF) infiltrated with nematic liquid crystals (NLCs) is proposed and experimentally demonstrated. Experimental results indicate that as the peak-to-peak voltage of the applied AC electric field increases from 160 to 220 V, WGM resonance peaks gradually move toward a shorter wavelength region by 0.527 nm with a wavelength sensitivity up to 0.01  nm/V for a TM1691 mode, and the Q-factor for each WGM resonance peak rapidly decreases with the increment of applied electric voltage. The proposed electrically controlled WGM tuning scheme shows a linear resonance wavelength shift with good spectral reversibility, which makes it a promising candidate to serve as an integrated functional photonic device in practical use and in related fundamental scientific studies.

Research and Experiments on a Unipolar Capacitive Voltage Sensor

PubMed Central

Zhou, Qiang; He, Wei; Li, Songnong; Hou, Xingzhe

2015-01-01

Voltage sensors are an important part of the electric system. In service, traditional voltage sensors need to directly contact a high-voltage charged body. Sensors involve a large volume, complex insulation structures, and high design costs. Typically an iron core structure is adopted. As a result, ferromagnetic resonance can occur easily during practical application. Moreover, owing to the multilevel capacitor divider, the sensor cannot reflect the changes of measured voltage in time. Based on the electric field coupling principle, this paper designs a new voltage sensor; the unipolar structure design solves many problems of traditional voltage sensors like the great insulation design difficulty and high costs caused by grounding electrodes. A differential signal input structure is adopted for the detection circuit, which effectively restrains the influence of the common-mode interference signal. Through sensor modeling, simulation and calculations, the structural design of the sensor electrode was optimized, miniaturization of the sensor was realized, the voltage division ratio of the sensor was enhanced, and the phase difference of sensor measurement was weakened. The voltage sensor is applied to a single-phase voltage class line of 10 kV for testing. According to the test results, the designed sensor is able to meet the requirements of accurate and real-time measurement for voltage of the charged conductor as well as to provide a new method for electricity larceny prevention and on-line monitoring of the power grid in an electric system. Therefore, it can satisfy the development demands of the smart power grid. PMID:26307992

Nanoparticle shuttle memory

DOEpatents

Zettl, Alex Karlwalter [Kensington, CA

2012-03-06

A device for storing data using nanoparticle shuttle memory having a nanotube. The nanotube has a first end and a second end. A first electrode is electrically connected to the first end of the nanotube. A second electrode is electrically connected to the second end of the nanotube. The nanotube has an enclosed nanoparticle shuttle. A switched voltage source is electrically connected to the first electrode and the second electrode, whereby a voltage may be controllably applied across the nanotube. A resistance meter is also connected to the first electrode and the second electrode, whereby the electrical resistance across the nanotube can be determined.

Dual-frequency glow discharges in atmospheric helium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Xiaojiang; Guo, Ying; Magnetic Confinement Fusion Research Center, Ministry of Education of the People's Republic of China, Shanghai 201620

2015-10-15

In this paper, the dual-frequency (DF) glow discharges in atmospheric helium were experimented by electrical and optical measurements in terms of current voltage characteristics and optical emission intensity. It is shown that the waveforms of applied voltages or discharge currents are the results of low frequency (LF) waveforms added to high frequency (HF) waveforms. The HF mainly influences discharge currents, and the LF mainly influences applied voltages. The gas temperatures of DF discharges are mainly affected by HF power rather than LF power.

Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line

PubMed Central

Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

2015-01-01

A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid. PMID:26729119

Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

PubMed

Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

2015-12-30

A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

NASA Astrophysics Data System (ADS)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

16 CFR 1204.2 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... the total rate at which electrical charge is transported through the antenna-mast system in response to the applied test voltage, including both capacitive and resistive components. (f) Electrical... can be measured by the current monitoring device. (g) Feed cable means the electrical cable that...

Evaluation of area strain response of dielectric elastomer actuator using image processing technique

NASA Astrophysics Data System (ADS)

Sahu, Raj K.; Sudarshan, Koyya; Patra, Karali; Bhaumik, Shovan

2014-03-01

Dielectric elastomer actuator (DEA) is a kind of soft actuators that can produce significantly large electric-field induced actuation strain and may be a basic unit of artificial muscles and robotic elements. Understanding strain development on a pre-stretched sample at different regimes of electrical field is essential for potential applications. In this paper, we report about ongoing work on determination of area strain using digital camera and image processing technique. The setup, developed in house consists of low cost digital camera, data acquisition and image processing algorithm. Samples have been prepared by biaxially stretched acrylic tape and supported between two cardboard frames. Carbon-grease has been pasted on the both sides of the sample, which will be compliant with electric field induced large deformation. Images have been grabbed before and after the application of high voltage. From incremental image area, strain has been calculated as a function of applied voltage on a pre-stretched dielectric elastomer (DE) sample. Area strain has been plotted with the applied voltage for different pre-stretched samples. Our study shows that the area strain exhibits nonlinear relationship with applied voltage. For same voltage higher area strain has been generated on a sample having higher pre-stretched value. Also our characterization matches well with previously published results which have been done with costly video extensometer. The study may be helpful for the designers to fabricate the biaxial pre-stretched planar actuator from similar kind of materials.

Differential effect of brief electrical stimulation on voltage-gated potassium channels

PubMed Central

Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H.; Morley, John W.

2017-01-01

Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (NaV channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (KV channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different KV-channel subtypes. Computational modeling reveals substantial differences in the response of specific KV-channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different KV-channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that KV-channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (KV channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between KV channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or “fading,” may be attributed to KV-channel activation. PMID:28202576

Effective screening length of isotropic liquid samples submitted to an applied voltage.

PubMed

Zola, R S; Evangelista, L R; Barbero, G

2006-05-25

A cell of isotropic liquid in the shape of a slab of thickness d and containing ionic impurities is considered. It is shown that the screening effect produced by the ionic charges on the external field is characterized by an effective surface length, lambda(S)(U), depending on the applied voltage U. The analysis indicates that lambda(S)(U)) < lambda(D) when the applied voltage is very large, and lambda(S)(U) --> lambda(D) for very small values of the applied voltage, where lambda(D) is the Debye screening length. The presence of the ions is responsible also for a counterpotential, v, that for small U is such to cancel the effective electric field in the sample, whereas in the opposite limit it is inversely proportional to the applied difference of potential.

A method for analyzing electrical impedance spectroscopy data from breast cancer patients

PubMed Central

Kim, Bong Seok; Isaacson, David; Xia, Hongjun; Kao, Tzu-Jen; Newell, Jonathan C; Saulnier, Gary J

2008-01-01

Research on freshly-excised malignant breast tissues and surrounding normal tissues in an in vitro impedance cell has shown that breast tumors have different conductivity and permittivity from normal or non-malignant tissues. This contrast may provide a basis for breast cancer detection using electrical impedance imaging. This paper describes a procedure for collecting electrical impedance spectroscopy data simultaneously and in register with tomosynthesis data from patients. We describe the methods used to analyze the data in order to determine if the electrodes are making contact with the breast of the patient. Canonical voltage patterns are applied and used to synthesize the data that would have resulted from constant voltage patterns applied to each of two parallel mammography plates. A type of Cole–Cole plot is generated and displayed from each of the currents measured on each of the electrodes for each of the frequencies (5, 10, 30, 100 and 300 kHz) of applied voltages. We illustrate the potential usefulness of these displays in distinguishing breast cancer from benign lesions with the Cole–Cole plots for two patients—one having cancer and one having a benign lesion—by comparing these graphs with electrical impedance spectra previously found by Jossinet and Schmitt in tissue samples taken from a variety of patients. PMID:17664638

A method for analyzing electrical impedance spectroscopy data from breast cancer patients.

PubMed

Kim, Bong Seok; Isaacson, David; Xia, Hongjun; Kao, Tzu-Jen; Newell, Jonathan C; Saulnier, Gary J

2007-07-01

Research on freshly-excised malignant breast tissues and surrounding normal tissues in an in vitro impedance cell has shown that breast tumors have different conductivity and permittivity from normal or non-malignant tissues. This contrast may provide a basis for breast cancer detection using electrical impedance imaging. This paper describes a procedure for collecting electrical impedance spectroscopy data simultaneously and in register with tomosynthesis data from patients. We describe the methods used to analyze the data in order to determine if the electrodes are making contact with the breast of the patient. Canonical voltage patterns are applied and used to synthesize the data that would have resulted from constant voltage patterns applied to each of two parallel mammography plates. A type of Cole-Cole plot is generated and displayed from each of the currents measured on each of the electrodes for each of the frequencies (5, 10, 30, 100 and 300 kHz) of applied voltages. We illustrate the potential usefulness of these displays in distinguishing breast cancer from benign lesions with the Cole-Cole plots for two patients--one having cancer and one having a benign lesion--by comparing these graphs with electrical impedance spectra previously found by Jossinet and Schmitt in tissue samples taken from a variety of patients.

A weak electric field-assisted ultrafast electrical switching dynamics in In3SbTe2 phase-change memory devices

NASA Astrophysics Data System (ADS)

Pandey, Shivendra Kumar; Manivannan, Anbarasu

2017-07-01

Prefixing a weak electric field (incubation) might enhance the crystallization speed via pre-structural ordering and thereby achieving faster programming of phase change memory (PCM) devices. We employed a weak electric field, equivalent to a constant small voltage (that is incubation voltage, Vi of 0.3 V) to the applied voltage pulse, VA (main pulse) for a systematic understanding of voltage-dependent rapid threshold switching characteristics and crystallization (set) process of In3SbTe2 (IST) PCM devices. Our experimental results on incubation-assisted switching elucidate strikingly one order faster threshold switching, with an extremely small delay time, td of 300 ps, as compared with no incubation voltage (Vi = 0 V) for the same VA. Also, the voltage dependent characteristics of incubation-assisted switching dynamics confirm that the initiation of threshold switching occurs at a lower voltage of 0.82 times of VA. Furthermore, we demonstrate an incubation assisted ultrafast set process of IST device for a low VA of 1.7 V (˜18 % lesser compared to without incubation) within a short pulse-width of 1.5 ns (full width half maximum, FWHM). These findings of ultrafast switching, yet low power set process would immensely be helpful towards designing high speed PCM devices with low power operation.

Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

NASA Astrophysics Data System (ADS)

Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

2017-11-01

Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

Modelling of piezoelectric actuator dynamics for active structural control

NASA Technical Reports Server (NTRS)

Hagood, Nesbitt W.; Chung, Walter H.; Von Flotow, Andreas

1990-01-01

The paper models the effects of dynamic coupling between a structure and an electrical network through the piezoelectric effect. The coupled equations of motion of an arbitrary elastic structure with piezoelectric elements and passive electronics are derived. State space models are developed for three important cases: direct voltage driven electrodes, direct charge driven electrodes, and an indirect drive case where the piezoelectric electrodes are connected to an arbitrary electrical circuit with embedded voltage and current sources. The equations are applied to the case of a cantilevered beam with surface mounted piezoceramics and indirect voltage and current drive. The theoretical derivations are validated experimentally on an actively controlled cantilevered beam test article with indirect voltage drive.

High-conductance low-voltage organic thin film transistor with locally rearranged poly(3-hexylthiophene) domain by current annealing on plastic substrate

NASA Astrophysics Data System (ADS)

Pei, Zingway; Tsai, Hsing-Wang; Lai, Hsin-Cheng

2016-02-01

The organic material based thin film transistors (TFTs) are attractive for flexible optoelectronics applications due to the ability of lager area fabrication by solution and low temperature process on plastic substrate. Recently, the research of organic TFT focus on low operation voltage and high output current to achieve a low power organic logic circuit for optoelectronic device,such as e-paper or OLED displayer. To obtain low voltage and high output current, high gate capacitance and high channel mobility are key factors. The well-arranged polymer chain by a high temperature postannealing, leading enhancement conductivity of polymer film was a general method. However, the thermal annealing applying heat for all device on the substrate and may not applicable to plastic substrate. Therefore, in this work, the low operation voltage and high output current of polymer TFTs was demonstrated by locally electrical bias annealing. The poly(styrene-comethyl methacrylate) (PS-r-PMMA) with ultra-thin thickness is used as gate dielectric that the thickness is controlled by thermal treatment after spin coated on organic electrode. In electrical bias-annealing process, the PS-r- PMMA is acted a heating layer. After electrical bias-annealing, the polymer TFTs obtain high channel mobility at low voltage that lead high output current by a locally annealing of P3HT film. In the future, the locally electrical biasannealing method could be applied on plastic substrate for flexible optoelectronic application.

Electrochromatographic retention of peptides on strong cation-exchange stationary phases.

PubMed

Nischang, Ivo; Höltzel, Alexandra; Tallarek, Ulrich

2010-03-01

We analyze the systematic and substantial electrical field-dependence of electrochromatographic retention for four counterionic peptides ([Met5]enkephalin, oxytocin, [Arg8]vasopressin, and luteinizing hormone releasing hormone (LHRH) ) on a strong cation-exchange (SCX) stationary phase. Our experiments show that retention behavior in the studied system depends on the charge-selectivity of the stationary phase particles, the applied voltage, and the peptides' net charge. Retention factors of twice positively charged peptides ([Arg8]vasopressin and LHRH at pH 2.7) decrease with increasing applied voltage, whereas lower charged peptides (oxytocin and [Met5]enkephalin at pH 2.7, [Arg8]vasopressin and LHRH at pH 7.0) show a concomitant increase in their retention factors. The observed behavior is explained on the basis of electrical field-induced concentration polarization (CP) that develops around the SCX particles of the packing. The intraparticle concentration of charged species (buffer ions, peptides) increases with increasing applied voltage due to diffusive backflux from the enriched CP zone associated with each SCX particle. For twice charged and on the SCX phase strongly retained peptides the local increase in mobile phase ionic strength reduces the electrostatic interactions with the stationary phase, which explains the decrease of retention factors with increasing applied voltage and CP intensity. Lower charged and weaker retained peptides experience a much stronger relative intraparticle enrichment than the twice-charged peptides, which results in a net increase of retention factors with increasing applied voltage. The CP-related contribution to electrochromatographic retention of peptides on the SCX stationary phase is modulated by the applied voltage, the mobile phase ionic strength, and the peptides' net charge and could be used for selectivity tuning in difficult separations.

Characterization of the Electric Double Layer Formation Dynamics of a Metal/Ionic Liquid/Metal Structure.

PubMed

Schmidt, Elliot; Shi, Sha; Ruden, P Paul; Frisbie, C Daniel

2016-06-15

Although ionic liquids (ILs) have been used extensively in recent years as a high-capacitance "dielectric" in electric double layer transistors, the dynamics of the double layer formation have remained relatively unexplored. Better understanding of the dynamics and relaxation processes involved in electric double layer formation will guide device optimization, particularly with regard to switching speed. In this paper, we explore the dynamical characteristics of an IL in a metal/ionic liquid/metal (M/IL/M) capacitor. In particular, we examine a Au/IL/Au structure where the IL is 1-butyl-1-methylpyrrolidinium tris(pentafluoroethyl)trifluorophosphate. The experiments consist of frequency-dependent impedance measurements and time-dependent current vs voltage measurements for applied linear voltage ramps and abrupt voltage steps. The parameters of an equivalent circuit model are determined by fits to the impedance vs frequency data and subsequently verified by calculating the current vs voltage characteristics for the applied potential profiles. The data analysis indicates that the dynamics of the structure are characterized by a wide distribution of relaxation times spanning the range of less than microseconds to longer than seconds. Possible causes for these time scales are discussed.

Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy

PubMed Central

Huang, Lei; Guo, Zhixiong

2011-01-01

Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041

High voltage power transistor development

NASA Technical Reports Server (NTRS)

Hower, P. L.

1981-01-01

Design considerations, fabrication procedures, and methods of evaluation for high-voltage power-transistor development are discussed. Technique improvements such as controlling the electric field at the surface and perserving lifetimes in the collector region which have advanced the state of the art in high-voltage transistors are discussed. These improvements can be applied directly to the development of 1200 volt, 200 ampere transistors.

Capacitance-voltage measurement in memory devices using ferroelectric polymer

NASA Astrophysics Data System (ADS)

Nguyen, Chien A.; Lee, Pooi See

2006-01-01

Application of thin polymer film as storing mean for non-volatile memory devices is investigated. Capacitance-voltage (C-V) measurement of metal-ferroelectric-metal device using ferroelectric copolymer P(VDF-TrFE) as dielectric layer shows stable 'butter-fly' curve. The two peaks in C-V measurement corresponding to the largest capacitance are coincidental at the coercive voltages that give rise to zero polarization in the polarization hysteresis measurement. By comparing data of C-V and P-E measurement, a correlation between two types of hysteresis is established in which it reveals simultaneous electrical processes occurring inside the device. These processes are caused by the response of irreversible and reversible polarization to the applied electric field that can be used to present a memory window. The memory effect of ferroelectric copolymer is further demonstrated for fabricating polymeric non-volatile memory devices using metal-ferroelectric-insulator-semiconductor structure (MFIS). By applying different sweeping voltages at the gate, bidirectional flat-band voltage shift is observed in the ferroelectric capacitor. The asymmetrical shift after negative sweeping is resulted from charge accumulation at the surface of Si substrate caused by the dipole direction in the polymer layer. The effect is reversed for positive voltage sweeping.

Instrumentation for measurement of aircraft noise and sonic boom

NASA Technical Reports Server (NTRS)

Zuckerwar, A. J. (Inventor)

1975-01-01

A jet aircraft noise and sonic boom measuring device which converts sound pressure into electric current is described. An electric current proportional to the sound pressure level at a condenser microphone is produced and transmitted over a cable, amplified by a zero drive amplifier and recorded on magnetic tape. The converter is comprised of a local oscillator, a dual-gate field-effect transistor (FET) mixer and a voltage regulator/impedance translator. A carrier voltage that is applied to one of the gates of the FET mixer is generated by the local oscillator. The microphone signal is mixed with the carrier to produce an electrical current at the frequency of vibration of the microphone diaphragm by the FET mixer. The voltage of the local oscillator and mixer stages is regulated, the carrier at the output is eliminated, and a low output impedance at the cable terminals is provided by the voltage regulator/impedance translator.

Radio-frequency powered glow discharge device and method with high voltage interface

DOEpatents

Duckworth, D.C.; Marcus, R.K.; Donohue, D.L.; Lewis, T.A.

1994-06-28

A high voltage accelerating potential, which is supplied by a high voltage direct current power supply, is applied to the electrically conducting interior wall of an RF powered glow discharge cell. The RF power supply desirably is electrically grounded, and the conductor carrying the RF power to the sample held by the probe is desirably shielded completely excepting only the conductor's terminal point of contact with the sample. The high voltage DC accelerating potential is not supplied to the sample. A high voltage capacitance is electrically connected in series between the sample on the one hand and the RF power supply and an impedance matching network on the other hand. The high voltage capacitance isolates the high DC voltage from the RF electronics, while the RF potential is passed across the high voltage capacitance to the plasma. An inductor protects at least the RF power supply, and desirably the impedance matching network as well, from a short that might occur across the high voltage capacitance. The discharge cell and the probe which holds the sample are configured and disposed to prevent the probe's components, which are maintained at ground potential, from bridging between the relatively low vacuum region in communication with the glow discharge maintained within the cell on the one hand, and the relatively high vacuum region surrounding the probe and cell on the other hand. The probe and cell also are configured and disposed to prevent the probe's components from electrically shorting the cell's components. 11 figures.

Radio-frequency powered glow discharge device and method with high voltage interface

DOEpatents

Duckworth, Douglas C.; Marcus, R. Kenneth; Donohue, David L.; Lewis, Trousdale A.

1994-01-01

A high voltage accelerating potential, which is supplied by a high voltage direct current power supply, is applied to the electrically conducting interior wall of an RF powered glow discharge cell. The RF power supply desirably is electrically grounded, and the conductor carrying the RF power to the sample held by the probe is desirably shielded completely excepting only the conductor's terminal point of contact with the sample. The high voltage DC accelerating potential is not supplied to the sample. A high voltage capacitance is electrically connected in series between the sample on the one hand and the RF power supply and an impedance matching network on the other hand. The high voltage capacitance isolates the high DC voltage from the RF electronics, while the RF potential is passed across the high voltage capacitance to the plasma. An inductor protects at least the RF power supply, and desirably the impedance matching network as well, from a short that might occur across the high voltage capacitance. The discharge cell and the probe which holds the sample are configured and disposed to prevent the probe's components, which are maintained at ground potential, from bridging between the relatively low vacuum region in communication with the glow discharge maintained within the cell on the one hand, and the relatively high vacuum region surrounding the probe and cell on the other hand. The probe and cell also are configured and disposed to prevent the probe's components from electrically shorting the cell's components.

Treatment of coking wastewater by a novel electric assisted micro-electrolysis filter.

PubMed

Xie, Ruosong; Wu, Miaomiao; Qu, Guangfei; Ning, Ping; Cai, Yingying; Lv, Pei

2018-04-01

A newly designed electric assisted micro-electrolysis filter (E-ME) was developed to investigate its degradation efficiency for coking wastewater and correlated characteristics. The performance of the E-ME system was compared with separate electrolysis (SE) and micro-electrolysis (ME) systems. The results showed a prominent synergistic effect on COD removal in E-ME systems. Gas chromatography/mass spectrometry (GC-MS) analysis confirmed that the applied electric field enhanced the degradation of phenolic compounds. Meanwhile, more biodegradable oxygen-bearing compounds were detected. SEM images of granular activated carbon (GAC) showed that inactivation and blocking were inhibited during the E-ME process. The effects of applied voltage and initial pH in E-ME systems were also studied. The best voltage value was 1V, but synergistic effects existed even with lower applied voltage. E-ME systems exhibited some pH buffering capacity and attained the best efficiency in neutral media, which means that there is no need to adjust pH prior to or during the treatment process. Therefore, E-ME systems were confirmed as a promising technology for treatment of coking wastewater and other refractory wastewater. Copyright © 2017. Published by Elsevier B.V.

Anti-Le-Chatelet behavior driven by strong natural light

NASA Astrophysics Data System (ADS)

Antonyuk, B. P.

2007-01-01

We show that strong incoherent broad band light causes positive feedback in response to a static electric field in random media: electric current flows in opposite to a voltage drop direction; static polarization is induced in opposition to an applied electric field. This type of the electron motion amplifies the external action revealing anti-Le-Chatelet behavior. The applied static electric field is amplified up to the domain of optical damage of a silica glass ≈10 7 V/cm.

Direct numerical simulation of the effect of an electric field on flame stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belhi, Memdouh; Domingo, Pascale; Vervisch, Pierre

2010-12-15

The role of electric fields in stabilising combustion is a well-known phenomenon. Among the possible mechanisms favouring the anchorage of the flame base, the ion-driven wind acting directly on flow momentum ahead of the flame base could be the leading one. Direct numerical simulation has been used to verify this hypothesis and lead to a better understanding of diffusion flame base anchoring in the presence of an externally applied voltage. In this context, a simplified modelling approach is proposed to describe combustion in the presence of electric body forces. The model reproduces the tendencies of experimental observations found in themore » literature. The sensitivity of the flame lift-off height to the applied voltage is studied and the modification of the velocity field ahead of the flame base induced by the electric volume forces is highlighted. (author)« less

Vacuum chamber for ion manipulation device

DOEpatents

Chen, Tsung-Chi; Tang, Keqi; Ibrahim, Yehia M; Smith, Richard D; Anderson, Gordon A; Baker, Erin M

2014-12-09

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area. A predetermined number of pairs of surfaces are disposed in one or more chambers, forming a multiple-layer ion mobility cyclotron device.

Protection of Electrical Systems from EM Hazards - Design Guide.

DTIC Science & Technology

1981-09-01

cm) Surface flashover Voltage (KV/cm) This criterion should be met for lighting voltage stresses of either polarity applied at up to 1000 KV/v sec rate...suppressor devices can be predicted. The part failure rate models in the handbook include the effects of part electrical stress , thermal stress , operating... stress . This test series contained over one million device hours of operation at temperatures uF to 145°C. The average duration of testing ranges from

Thermally Stable, Piezoelectric and Pyroelectric Polymeric Substrates and Method Relating Thereto

NASA Technical Reports Server (NTRS)

Simpson, Joycelyn O. (Inventor); St.Clair, Terry L. (Inventor)

1995-01-01

Production of an electric voltage in response to mechanical excitation (piezoelectricity) or thermal excitation (pyroelectricity) requires a material to have a preferred dipole orientation in its structure. This preferred orientation or polarization occurs naturally in some crystals such as quartz and can be induced into some ceramic and polymeric materials by application of strong electric or mechanical fields. For some materials, a combination of mechanical and electrical orientation is necessary to completely polarize the material. The only commercially available piezoelectric polymer is poly(vinylidene fluoride) (PVF2). However, this polymer has material and process limitations which prohibit its use in numerous device applications where thermal stability is a requirement. By the present invention, thermally stable, piezoelectric and pyroelectric polymeric substrates were prepared from polymers having a softening temperature greater than 1000C. A metal electrode material is deposited onto the polymer substrate and several electrical leads are attached to it. The polymer substrate is heated in a low dielectric medium to enhance molecular mobility of the polymer chains. A voltage is then applied to the polymer substrate inducing polarization. The voltage is then maintained while the polymer substrate is cooled 'freezing in' the molecular orientation. The novelty of the invention resides in the process of preparing the piezoelectric and pyroelectric polymeric substrate. The nonobviousness of the invention is found in heating the polymeric substrate in a low dielectric medium while applying a voltage.

[Determination of electric field distribution in dielectric barrier surface glow discharge by spectroscopic method].

PubMed

Li, Xue-chen; Jia, Peng-ying; Liu, Zhi-hui; Li, Li-chun; Dong, Li-fang

2008-12-01

In the present paper, stable glow discharges were obtained in air at low pressure with a dielectric barrier surface discharge device. Light emission from the discharge was detected by photomultiplier tubes and the research results show that the light signal exhibited one discharge pulse per half cycle of the applied voltage. The light pulses were asymmetric between the positive half cycle and the negative one of the applied voltage. The images of the glow surface discharge were processed by Photoshop software and the results indicate that the emission intensity remained almost constant for different places with the same distance from the powered electrode, while the emission intensity decreased with the distance from the powered electrode increasing. In dielectric barrier discharge, net electric field is determined by the applied voltage and the wall charges accumulated on the dielectric layer during the discharge, and consequently, it is important to obtain information about the net electric field distribution. For this purpose, optical emission spectroscopy method was used. The distribution of the net electric field can be deduced from the intensity ratio of spectral line 391.4 nm emitted from the first negative system of N2+ (B 2sigma u+ -->X 2sigma g+) to 337.1 nm emitted from the second positive system of N2 (C 3IIu-B 3IIg). The research results show that the electric field near the powered electric field is higher than at the edge of the discharge. These experimental results are very important for numerical study and industrial application of the surface discharge.

Application of Autonomous Smart Inverter Volt-VAR Function for Voltage Reduction Energy Savings and Power Quality in Electric Distribution Systems: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Fei; Nagarajan, Adarsh; Baggu, Murali

This paper evaluated the impact of smart inverter Volt-VAR function on voltage reduction energy saving and power quality in electric power distribution systems. A methodology to implement the voltage reduction optimization was developed by controlling the substation LTC and capacitor banks, and having smart inverters participate through their autonomous Volt-VAR control. In addition, a power quality scoring methodology was proposed and utilized to quantify the effect on power distribution system power quality. All of these methodologies were applied to a utility distribution system model to evaluate the voltage reduction energy saving and power quality under various PV penetrations and smartmore » inverter densities.« less

Power supply and impedance matching to drive technological radio-frequency plasmas with customized voltage waveforms.

PubMed

Franek, James; Brandt, Steven; Berger, Birk; Liese, Martin; Barthel, Matthias; Schüngel, Edmund; Schulze, Julian

2015-05-01

We present a novel radio-frequency (RF) power supply and impedance matching to drive technological plasmas with customized voltage waveforms. It is based on a system of phase-locked RF generators that output single frequency voltage waveforms corresponding to multiple consecutive harmonics of a fundamental frequency. These signals are matched individually and combined to drive a RF plasma. Electrical filters are used to prevent parasitic interactions between the matching branches. By adjusting the harmonics' phases and voltage amplitudes individually, any voltage waveform can be approximated as a customized finite Fourier series. This RF supply system is easily adaptable to any technological plasma for industrial applications and allows the commercial utilization of process optimization based on voltage waveform tailoring for the first time. Here, this system is tested on a capacitive discharge based on three consecutive harmonics of 13.56 MHz. According to the Electrical Asymmetry Effect, tuning the phases between the applied harmonics results in an electrical control of the DC self-bias and the mean ion energy at almost constant ion flux. A comparison with the reference case of an electrically asymmetric dual-frequency discharge reveals that the control range of the mean ion energy can be significantly enlarged by using more than two consecutive harmonics.

Fiber-optic voltage measuring system

NASA Astrophysics Data System (ADS)

Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

1993-09-01

A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

PEAK READING VOLTMETER

DOEpatents

Dyer, A.L.

1958-07-29

An improvement in peak reading voltmeters is described, which provides for storing an electrical charge representative of the magnitude of a transient voltage pulse and thereafter measuring the stored charge, drawing oniy negligible energy from the storage element. The incoming voltage is rectified and stored in a condenser. The voltage of the capacitor is applied across a piezoelectric crystal between two parallel plates. Amy change in the voltage of the capacitor is reflected in a change in the dielectric constant of the crystal and the capacitance between a second pair of plates affixed to the crystal is altered. The latter capacitor forms part of the frequency determlning circuit of an oscillator and means is provided for indicating the frequency deviation which is a measure of the peak voltage applied to the voltmeter.

The effects of interfacial recombination and injection barrier on the electrical characteristics of perovskite solar cells

NASA Astrophysics Data System (ADS)

Shi, Lin Xing; Wang, Zi Shuai; Huang, Zengguang; Sha, Wei E. I.; Wang, Haoran; Zhou, Zhen

2018-02-01

Charge carrier recombination in the perovskite solar cells (PSCs) has a deep influence on the electrical performance, such as open circuit voltage, short circuit current, fill factor and ultimately power conversion efficiency. The impacts of injection barrier, recombination channels, doping properties of carrier transport layers and light intensity on the performance of PSCs are theoretically investigated by drift-diffusion model in this work. The results indicate that due to the injection barrier at the interfaces of perovskite and carrier transport layer, the accumulated carriers modify the electric field distribution throughout the PSCs. Thus, a zero electric field is generated at a specific applied voltage, with greatly increases the interfacial recombination, resulting in a local kink of current density-voltage (J-V) curve. This work provides an effective strategy to improve the efficiency of PSCs by pertinently reducing both the injection barrier and interfacial recombination.

Electric characteristics of a surface barrier discharge with a plasma induction electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alemskii, I. N.; Lelevkin, V. M.; Tokarev, A. V.

2006-07-15

Static and dynamic current-voltage and charge-voltage characteristics of a surface barrier discharge with a plasma induction electrode have been investigated experimentally. The dependences of the discharge current on both the gas pressure in the induction electrode tube and the winding pitch of the corona electrode, as well as of the discharge power efficiency on the applied voltage, have been measured.

Breakdown voltage reduction by field emission in multi-walled carbon nanotubes based ionization gas sensor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saheed, M. Shuaib M.; Muti Mohamed, Norani; Arif Burhanudin, Zainal, E-mail: zainabh@petronas.com.my

2014-03-24

Ionization gas sensors using vertically aligned multi-wall carbon nanotubes (MWCNT) are demonstrated. The sharp tips of the nanotubes generate large non-uniform electric fields at relatively low applied voltage. The enhancement of the electric field results in field emission of electrons that dominates the breakdown mechanism in gas sensor with gap spacing below 14 μm. More than 90% reduction in breakdown voltage is observed for sensors with MWCNT and 7 μm gap spacing. Transition of breakdown mechanism, dominated by avalanche electrons to field emission electrons, as decreasing gap spacing is also observed and discussed.

Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors.

PubMed

Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae

2016-10-11

A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this 'electrical activation', the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully.

Active Piezoelectric Diaphragms

NASA Technical Reports Server (NTRS)

Bryant, Robert G.; Effinger, Robert T., IV; Aranda, Isaiah, Jr.; Copeland, Ben M.; Covington, Ed W., III

2002-01-01

Several active piezoelectric diaphragms were fabricated by placing unelectroded piezoelectric disks between copper clad films patterned with Inter-Circulating Electrodes "ICE". When a voltage potential is applied to the electrodes, the result is radially distributed electric field that mechanically strains the piezo-ceramic along the Z-axis (perpendicular to the applied electric field), rather than the expected in-plane (XY-axis) direction. Unlike other out of plane piezoelectric actuators, which are benders, these Radial Field Diaphragms (RFDs) strain concentrically yet afford high displacements while maintaining a constant circumference. This paper covers the fabrication and characterization of these diaphragms as a function of poling field strength, ceramic diameter and line spacing, as well as the surface topography, the resulting strain field and displacement as a function of applied voltage ranging from DC to 10 Hz.

Electrically tunable all-dielectric optical metasurfaces based on liquid crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komar, Andrei; Fang, Zheng; Bohn, Justus

2017-02-13

We demonstrate electrical tuning of the spectral response of a Mie-resonant dielectric metasurface consisting of silicon nanodisks embedded into liquid crystals. We use the reorientation of nematic liquid crystals in a moderate applied electric field to alter the anisotropic permittivity tensor around the metasurface. By switching a control voltage ‘on’ and ‘off’ we induce a large spectral shift of the metasurface resonances, resulting in an absolute transmission modulation up to 75%. To the best of our knowledge, this is the first experimental demonstration of voltage control of a dielectric metasurface, paving the way for new types of electrically tunable metadevices,more » including dynamic displays and holograms.« less

Effect of an electric field on the orientation of a liquid crystal in a cell with a nonuniform director distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aksenova, E. V., E-mail: e.aksenova@spbu.ru; Karetnikov, A. A.; Karetnikov, N. A.

2016-05-15

The electric field-induced reorientation of a nematic liquid crystal in cells with a planar helicoidal or a homeoplanar structure of a director field is studied theoretically and experimentally. The dependences of the capacitances of these systems on the voltage in an applied electric field below and above the Fréedericksz threshold are experimentally obtained and numerically calculated. The calculations use the director distribution in volume that is obtained by direct minimization of free energy at various voltages. The inhomogeneity of the electric field inside a cell is taken into account. The calculation results are shown to agree with the experimental data.

Differential effect of brief electrical stimulation on voltage-gated potassium channels.

PubMed

Cameron, Morven A; Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H; Morley, John W

2017-05-01

Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (Na V channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (K V channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different K V -channel subtypes. Computational modeling reveals substantial differences in the response of specific K V -channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different K V -channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that K V -channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (K V channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between K V channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or "fading," may be attributed to K V -channel activation. Copyright © 2017 the American Physiological Society.

Sulfonated polyaniline-based organic electrodes for controlled electrical stimulation of human osteosarcoma cells.

PubMed

Min, Yong; Yang, Yanyin; Poojari, Yadagiri; Liu, Yidong; Wu, Jen-Chieh; Hansford, Derek J; Epstein, Arthur J

2013-06-10

Electrically conducting polymers (CPs) were found to stimulate various cell types such as neurons, osteoblasts, and fibroblasts in both in vitro and in vivo studies. However, to our knowledge, no studies have been reported on the utility of CPs in stimulation of cancer or tumor cells in the literature. Here we report a facile fabrication method of self-doped sulfonated polyaniline (SPAN)-based interdigitated electrodes (IDEs) for controlled electrical stimulation of human osteosarcoma (HOS) cells. Increased degree of sulfonation was found to increase the SPAN conductivity, which in turn improved the cell attachment and cell growth without electrical stimulation. However, an enhanced cell growth was observed under controlled electrical (AC) stimulation at low applied voltage and frequency (≤800 mV and ≤1 kHz). The cell growth reached a maximum threshold at an applied voltage or frequency and beyond which pronounced cell death was observed. We believe that these organic electrodes may find utility in electrical stimulation of cancer or tumor cells for therapy and research and may also provide an alternative to the conventional metal-based electrodes.

Highly sensitive protein detection by combination of atomic force microscopy fishing with charge generation and mass spectrometry analysis.

PubMed

Ivanov, Yuri D; Pleshakova, Tatyana; Malsagova, Krystina; Kozlov, Andrey; Kaysheva, Anna; Kopylov, Arthur; Izotov, Alexander; Andreeva, Elena; Kanashenko, Sergey; Usanov, Sergey; Archakov, Alexander

2014-10-01

An approach combining atomic force microscopy (AFM) fishing and mass spectrometry (MS) analysis to detect proteins at ultra-low concentrations is proposed. Fishing out protein molecules onto a highly oriented pyrolytic graphite surface coated with polytetrafluoroethylene film was carried out with and without application of an external electric field. After that they were visualized by AFM and identified by MS. It was found that injection of solution leads to charge generation in the solution, and an electric potential within the measuring cell is induced. It was demonstrated that without an external electric field in the rapid injection input of diluted protein solution the fishing is efficient, as opposed to slow fluid input. The high sensitivity of this method was demonstrated by detection of human serum albumin and human cytochrome b5 in 10(-17) -10(-18) m water solutions. It was shown that an external negative voltage applied to highly oriented pyrolytic graphite hinders the protein fishing. The efficiency of fishing with an external positive voltage was similar to that obtained without applying any voltage. © 2014 FEBS.

Microscopic histological characteristics of soft tissue sarcomas: analysis of tissue features and electrical resistance.

PubMed

Tosi, A L; Campana, L G; Dughiero, F; Forzan, M; Rastrelli, M; Sieni, E; Rossi, C R

2017-07-01

Tissue electrical conductivity is correlated with tissue characteristics. In this work, some soft tissue sarcomas (STS) excised from patients have been evaluated in terms of histological characteristics (cell size and density) and electrical resistance. The electrical resistance has been measured using the ex vivo study on soft tissue tumors electrical characteristics (ESTTE) protocol proposed by the authors in order to study electrical resistance of surgical samples excised by patients in a fixed measurement setup. The measurement setup includes a voltage pulse generator (700 V, 100 µs long at 5 kHz, period 200 µs) and an electrode with 7 needles, 20 mm-long, with the same distance arranged in a fixed hexagonal geometry. In the ESTTE protocol, the same voltage pulse sequence is applied to each different tumor mass and the corresponding resistance has been evaluated from voltage and current recorded by the equipment. For each tumor mass, a histological sample of the volume treated by means of voltage pulses has been taken for histological analysis. Each mass has been studied in order to identify the sarcoma type. For each histological sample, an image at 20× or 40× of magnification was acquired. In this work, the electrical resistance measured for each tumor has been correlated with tissue characteristics like the type, size and density of cells. This work presents a preliminary study to explore possible correlations between tissue characteristics and electrical resistance of STS. These results can be helpful to adjust the pulse voltage intensity in order to improve the electrochemotherapy efficacy on some histotype of STS.

Molecule desorption induced by gate-voltage application in MOS structure

NASA Astrophysics Data System (ADS)

Hirota, Nozomu; Hattori, Ken; Daimon, Hiroshi; Hattori, Azusa N.; Tanaka, Hidekazu

2016-04-01

For the first time, we demonstrate desorption from a MOS surface by applying gate voltages (V G). We observed CH4, CO, and CO2 desorption from a MOS (Fe nanofilm/a-SiO2/Si) surface in vacuum only when applying negative V G, suggesting the occurrence of electronic excitation by hot-hole injection. This demonstration is the first step in the application of MOSs to electrically controlled catalysts.

Experimental investigation on On-Off current ratio behavior near onset voltage for a pentacene based organic thin film transistor

NASA Astrophysics Data System (ADS)

Amrani, Aumeur El; Es-saghiri, Abdeljabbar; Boufounas, El-Mahjoub; Lucas, Bruno

2018-06-01

The performance of a pentacene based organic thin film transistor (OTFT) with polymethylmethacrylate as a dielectric insulator and indium tin oxide based electrical gate is investigated. On the one hand, we showed that the threshold voltage increases with gate voltage, and on the other hand that it decreases with drain voltage. Thus, we noticed that the onset voltage shifts toward positive voltage values with the drain voltage increase. In addition, threshold-onset differential voltage (TODV) is proposed as an original approach to estimate an averaged carrier density in pentacene. Indeed, a value of about 4.5 × 1016 cm-3 is reached at relatively high gate voltage of -50 V; this value is in good agreement with that reported in literature with other technique measurements. However, at a low applied gate voltage, the averaged pentacene carrier density remains two orders of magnitude lower; it is of about 2.8 × 1014 cm-3 and remains similar to that obtained from space charge limited current approach for low applied bias voltage of about 2.2 × 1014 cm-3. Furthermore, high IOn/IOff and IOn/IOnset current ratios of 5 × 106 and 7.5 × 107 are reported for lower drain voltage, respectively. The investigated OTFTs also showed good electrical performance including carrier mobility increasing with gate voltage; mobility values of 4.5 × 10-2 cm2 V-1 s-1 and of 4.25 × 10-2 cm2 V-1 s-1 are reached for linear and saturation regimes, respectively. These results remain enough interesting since current modulation ratio exceeds a value of 107 that is a quite important requirement than high mobility for some particular logic gate applications.

Power-MOSFET Voltage Regulator

NASA Technical Reports Server (NTRS)

Miller, W. N.; Gray, O. E.

1982-01-01

Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

A Model for the Formation of Piezoelectric Single-Crystal Nanorings and Nanobows

ERIC Educational Resources Information Center

King, Angela G.

2004-01-01

The piezoelectric materials generate electricity or electric polarity in dielectric crystals when subjected to an applied voltage. The nanorings and nanobows are presented that can be used in nanoscale applications such as sensors, transducers, and electromechanical coupling devices.

Electrotonic and action potentials in the Venus flytrap.

PubMed

Volkov, Alexander G; Vilfranc, Chrystelle L; Murphy, Veronica A; Mitchell, Colee M; Volkova, Maia I; O'Neal, Lawrence; Markin, Vladislav S

2013-06-15

The electrical phenomena and morphing structures in the Venus flytrap have attracted researchers since the nineteenth century. We have observed that mechanical stimulation of trigger hairs on the lobes of the Venus flytrap induces electrotonic potentials in the lower leaf. Electrostimulation of electrical circuits in the Venus flytrap can induce electrotonic potentials propagating along the upper and lower leaves. The instantaneous increase or decrease in voltage of stimulating potential generates a nonlinear electrical response in plant tissues. Any electrostimulation that is not instantaneous, such as sinusoidal or triangular functions, results in linear responses in the form of small electrotonic potentials. The amplitude and sign of electrotonic potentials depend on the polarity and the amplitude of the applied voltage. Electrical stimulation of the lower leaf induces electrical signals, which resemble action potentials, in the trap between the lobes and the midrib. The trap closes if the stimulating voltage is above the threshold level of 4.4V. Electrical responses in the Venus flytrap were analyzed and reproduced in the discrete electrical circuit. The information gained from this study can be used to elucidate the coupling of intracellular and intercellular communications in the form of electrical signals within plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

Thermal Control Utilizing an Thermal Control Utilizing an Two-Phase Loop with High Heat Flux Source

NASA Technical Reports Server (NTRS)

Jeong, Seong-Il; Didion, Jeffrey

2004-01-01

The electric field applied in dielectric fluids causes an imbalance in the dissociation-recombination reaction generated free space charges. The generated charges are redistributed by the applied electric field resulting in the heterocharge layers in the Vicinity of the electrodes. Proper design of the electrodes generates net axial flow motion pumping the fluid. The electrohydrodynamic (EHD) conduction pump is a new device that pumps dielectric fluids utilizing heterocharge layers formed by imposition of electrostatic fields. This paper evaluates the experimental performance of a two-phase breadboard thermal control loop consisting of an EHD conduction pump, condenser, pre-heater, high heat flux evaporator (HE), transport lines, and reservoir (accumulator). The generated pressure head and the maximum applicable heat flux are experimentally determined at various applied voltages and sink temperatures. Recovery from dryout condition by increasing the applied voltage to the pump is also demonstrated.

Characterization of applied fields for ion mobility in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran Nair Syamala Amma, Aneesh; Garimella, Venkata BS

2018-03-21

Ion mobility (IM) is rapidly gaining attention for the analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM has limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. These can be readily obtainable in structures for lossless ion manipulations (SLIM), which are fabricated from electric fields that are generated by appropriate potentials applied to arrays of electrodes patterned on twomore » parallel surfaces. In this work we have investigated the relationship between the various SLIM variables, such as electrode dimensions, inter-surface gap, and the TW applied voltages, that directly impact the fields experienced by ions. Ion simulation and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric field. The variables explored impact both ion confinement and the observed IM resolution in Structures for Lossless Ion Manipulations (SLIM) modules.« less

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.

Ion mobility (IM) is rapidly gaining attention for the analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM has limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. These can be readily obtainable in structures for lossless ion manipulations (SLIM), which are fabricated from electric fields that are generated by appropriate potentials applied to arrays of electrodes patterned on twomore » parallel surfaces. In this work we have investigated the relationship between the various SLIM variables, such as electrode dimensions, inter-surface gap, and the TW applied voltages, that directly impact the fields experienced by ions. Ion simulation and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric field. The variables explored impact both ion confinement and the observed IM resolution in Structures for Lossless Ion Manipulations (SLIM) modules.« less

Voltage-step pulsed electromembrane as a novel view of electrical field-induced liquid-phase microextraction.

PubMed

Rezazadeh, Maryam; Yamini, Yadollah; Seidi, Shahram; Arjomandi-Behzad, Leila

2014-01-10

In the present work, the effect of application of voltage steps on extraction efficiency of pulsed electromembrane extraction (PEME) was investigated for the first time. The effects of voltage variations including initial and final voltages, number of steps between the initial and final voltages as well as their time durations were studied on the extraction efficiencies of three different classes of analytes. These classes include amitriptyline (AMI) and nortriptyline (NOR) as more hydrophobic analytes, diclofenac (DIC) and mefenamic acid (MEF) as acidic drugs and salbutamol (SB) and terbutaline (TB) as hydrophilic compounds. It was anticipated that the application of high voltages is not necessary at the beginning of the extraction, since large amounts of target analytes exist around the supported liquid membrane (SLM)/sample solution interface. So, they could be easily transferred into the acceptor phase utilizing lower voltages. Results showed that the benefits of voltage-step PEME (VS-PEME) are more obvious in systems with low electrical resistance (regarding the SLM composition). Efficiencies of VS-PEME for extraction of AMI and NOR (96% and 89% for AMI and NOR, respectively) were comparable with those achieved from applying a constant voltage (95% for AMI and 83% for NOR). However, recoveries from the VS-PEME of DIC and MEF (53% and 44% for DIC and MEF, respectively) were significantly higher than those from the application of a constant voltage (33% for DIC and 31% for MEF). Also, recoveries obtained from the VS-PEME for SB and TB were approximately 3 orders of magnitude greater than those from a constant voltage. Moreover, it was demonstrated that in all cases analytes could effectively be extracted at the beginning of extraction by applying low voltages. Copyright © 2013 Elsevier B.V. All rights reserved.

Impact of magnetite nanoparticle incorporation on optical and electrical properties of nanocomposite LbL assemblies.

PubMed

Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth

2010-09-21

Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.

Electric Discharge Sintering and Joining of Tungsten Carbide—Cobalt Composite with High-Speed Steel Substrate

NASA Astrophysics Data System (ADS)

Grigoryev, Evgeny G.

2011-01-01

Simultaneous electro discharge sintering of high strength structure of tungsten carbide—cobalt composite and connection it with high-speed steel substrate is investigated and suitable operating parameters are defined. Tungsten carbide—cobalt and high-speed steel joining was produced by the method of high voltage electrical discharge together with application of mechanical pressure to powder compact. It was found that the density and hardness of composite material reach its maximum values at certain magnitudes of applied pressure and high voltage electrical discharge parameters. We show that there is an upper level for the discharge voltage beyond which the powder of composite material disintegrates like an exploding wire. Due to our results it is possible to determine optimal parameters for simultaneous electro discharge sintering of WC-Co and bonding it with high-speed steel substrate.

Characterization of DBD Plasma Actuators Performance Without External Flow - Part I: Thrust-Voltage Quadratic Relationship in Logarithmic Space for Sinusoidal Excitation

NASA Technical Reports Server (NTRS)

Ashpis, David E.; Laun, Matthew C.

2016-01-01

Results of characterization of Dielectric Barrier Discharge (DBD) plasma actuators without external flow are presented. The results include aerodynamic and electric performance of the actuators without external flow for different geometrical parameters, dielectric materials and applied voltage level and wave form.

Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

NASA Astrophysics Data System (ADS)

Chuan, Lee Te; Rathi, Muhammad Fareez Mohamad; Abidin, Muhamad Yusuf Zainal; Abdullah, Hasan Zuhudi; Idris, Maizlinda Izwana

2015-07-01

Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm-2) at room temperature. Surface oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.

Dual-layer electrode-driven liquid crystal lens with electrically tunable focal length and focal plane

NASA Astrophysics Data System (ADS)

Zhang, Y. A.; Lin, C. F.; Lin, J. P.; Zeng, X. Y.; Yan, Q.; Zhou, X. T.; Guo, T. L.

2018-04-01

Electric-field-driven liquid crystal (ELC) lens with tunable focal length and their depth of field has been extensively applied in 3D display and imaging systems. In this work, a dual-layer electrode-driven liquid crystal (DELC) lens with electrically tunable focal length and controllable focal plane is demonstrated. ITO-SiO2-AZO electrodes with the dual-layer staggered structure on the top substrate are used as driven electrodes within a LC cell, which permits the establishment of an alternative controllability. The focal length of the DELC lens can be adjusted from 1.41 cm to 0.29 cm when the operating voltage changes from 15 V to 40 V. Furthermore, the focal plane of the DELC lens can selectively move by changing the driving method of the applied voltage to the next driven electrodes. This work demonstrates that the DELC lens has potential applications in imaging systems because of electrically tunable focal length and controllable focal plane.

Electron emission phenomena controlled by a transverse electric field in compound emitters

NASA Astrophysics Data System (ADS)

Olesik, Jadwiga; Calusinski, Bogdan; Olesik, Zygmunt

1996-09-01

Influence of an inner electric field on such emission phenomena like: secondary emission, photoemission and field emission has been investigated. The applied sample-emitter was a glass wafer (thickness 0.2 mm) covered on both sides by semiconducting films In2O3:Sn. A voltage (in the interval -2000V divided by 0V) generating transverse electric field was applied to one of the films. This film had a thickness of about 200 nm. The second film (emitting electrons) had a thickness 100 nm or 10 nm. The secondary emission measurements were made by the retarding field method using four grid retarding potential analyzer. It was found that the secondary emission coefficient changes non- monotonically with increasing field intensity. Electron emission measurements without using a primary electron beam were made with the electron multiplier cooperating with a multichannel pulse amplitude analyzer. The measurements were performed in the vacuum of about 2 multiplied by 10-6 Pa. Influence of film thickness on the intensity of field controlled emission and field controlled photoemission was also studied. It was also found that the frequency of counts (generated by electrons in the electron multiplier) depends on the polarizing voltage approximately in an exponential way. Some departures from this dependence can be observed at higher Upol voltages (above 1000 V). Thus, at an appropriate high voltage Upol conditions for a cascade emission are created. At lower voltages the conditions correspond to a semiconductor with a negative electron affinity.

Optical Voltage Sensing Using DNA Origami

PubMed Central

2018-01-01

We explore the potential of DNA nanotechnology for developing novel optical voltage sensing nanodevices that convert a local change of electric potential into optical signals. As a proof-of-concept of the sensing mechanism, we assembled voltage responsive DNA origami structures labeled with a single pair of FRET dyes. The DNA structures were reversibly immobilized on a nanocapillary tip and underwent controlled structural changes upon application of an electric field. The applied field was monitored through a change in FRET efficiency. By exchanging the position of a single dye, we could tune the voltage sensitivity of our DNA origami structure, demonstrating the flexibility and versatility of our approach. The experimental studies were complemented by coarse-grained simulations that characterized voltage-dependent elastic deformation of the DNA nanostructures and the associated change in the distance between the FRET pair. Our work opens a novel pathway for determining the mechanical properties of DNA origami structures and highlights potential applications of dynamic DNA nanostructures as voltage sensors. PMID:29430924

Nonlinear conductivity in silicon nitride

NASA Astrophysics Data System (ADS)

Tuncer, Enis

2017-08-01

To better comprehend electrical silicon-package interaction in high voltage applications requires full characterization of the electrical properties of dielectric materials employed in wafer and package level design. Not only the packaging but wafer level dielectrics, i.e. passivation layers, would experience high electric fields generated by the voltage applied pads. In addition the interface between the passivation layer and a mold compound might develop space charge because of the mismatch in electrical properties of the materials. In this contribution electrical properties of a thin silicon nitride (Si3N4) dielectric is reported as a function of temperature and electric field. The measured values later analyzed using different temperature dependent exponential expressions and found that the Mott variable range hopping conduction model was successful to express the data. A full temperature/electric field dependency of conductivity is generated. It was found that the conduction in Si3N4 could be expressed like a field ionization or Fowler-Nordheim mechanism.

Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

NASA Astrophysics Data System (ADS)

Komazaki, Y.; Hirama, H.; Torii, T.

2015-04-01

In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventional color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.

Study of electron mobility in small molecular SAlq by transient electroluminescence method

NASA Astrophysics Data System (ADS)

Kumar, Pankaj; Jain, S. C.; Kumar, Vikram; Chand, Suresh; Kamalasanan, M. N.; Tandon, R. P.

2007-12-01

The study of electron mobility of bis(2-methyl 8-hydroxyquinoline) (triphenyl siloxy) aluminium (SAlq) by transient electroluminescence (EL) is presented. An EL device is fabricated in bilayer, ITO/N,N'-diphenyl-N, N'-bis(3-methylphenyl)-(1,1'-biphenyl)-4,4'-diamine (TPD)/SAlq/LiF/Al configuration. The temporal evaluation of the EL with respect to the step voltage pulse is characterized by a delay time followed by a fast initial rise, which is followed by a slower rise. The delay time between the applied electrical pulse and the onset of EL is correlated with the carrier mobility (electron in our case). Transient EL studies for SAlq have been carried out at different temperatures and different applied electric fields. The electron mobility in SAlq is found to be field and temperature dependent and calculated to be 6.9 × 10-7 cm2 V-1 s-1 at 2.5 × 106 V cm-1 and 308 K. The EL decays immediately as the voltage is turned off and does not depend on the amplitude of the applied voltage pulse or dc offset.

Electric Drive Study. Volume 1

DTIC Science & Technology

1987-12-21

CONDITIONER HIGH VOLTAGE DC ICONDITIONER 3 ,300-50 VOLT5), dCONTROL! Figure 5-4. Typical AC Drive System 20 system usable with an induction motor. The...controlling component in an AC drive is the motor power conditioner . This component changes the high voltage DC power to controlled AC power of...selected voltage and frequency which is applied to the drive motors. Since the vehicle gains stored energy as it is accelerated, the motor power conditioner

Critical frequency for coalescence of emulsions in an AC electric field

NASA Astrophysics Data System (ADS)

Liu, Zhou; Ali, Faizi Hammad; Shum, Ho Cheung

2017-11-01

Applying an electric field to trigger the coalescence of emulsions has been applied in various applications which include crude oil recovery, emulsion stability characterization as well as pico-injection and droplet-based chemical reaction in microfluidics. In this work, we systematically investigated the responses of surfactant-stabilized emulsions to a controlled AC electric field using a customer-built chip. At a given amplitude of the AC voltage, we found a critical frequency beyond which the emulsions remain stable. When the frequency is decreased to below the critical value, emulsions coalesce immediately. Such critical frequency is found to be dependent of amplitude of the AC voltage, viscosity of the fluids, concentration and type of the surfactant as well as the electric conductivity of the droplet phase. Using a model based on the drainage of thin film, we have explored the mechanism behind and interpret this phenomenon systematically. Our work extends the understanding of the electro-coalescence of emulsions and can be beneficial for any applications involve the coalescence of droplets in an AC electric field.

Voltage-induced reduction of graphene oxide

NASA Astrophysics Data System (ADS)

Faucett, Austin C.

Graphene Oxide (GO) is being widely researched as a precursor for the mass production of graphene, and as a versatile material in its own right for flexible electronics, chemical sensors, and energy harvesting applications. Reduction of GO, an electrically insulating material, into reduced graphene oxide (rGO) restores electrical conductivity via removal of oxygen-containing functional groups. Here, a reduction method using an applied electrical bias, known as voltage-induced reduction, is explored. Voltage-induced reduction can be performed under ambient conditions and avoids the use of hazardous chemicals or high temperatures common with standard methods, but little is known about the reduction mechanisms and the quality of rGO produced with this method. This work performs extensive structural and electrical characterization of voltage-reduced GO (V-rGO) and shows that it is competitive with standard methods. Beyond its potential use as a facile and eco-friendly processing approach, V-rGO reduction also offers record high-resolution patterning capabilities. In this work, the spatial resolution limits of voltage-induced reduction, performed using a conductive atomic force microscope probe, are explored. It is shown that arbitrary V-rGO conductive features can be patterned into insulating GO with nanoscale resolution. The localization of voltage-induced reduction to length scales < 10 nm allows studies of reduction reaction kinetics, using electrical current obtained in-situ, with statistical robustness. Methods for patterning V-rGO nanoribbons are then developed. After presenting sub-10nm patterning of V-rGO nanoribbons in GO single sheets and films, the performance of V-rGO nanoribbon field effect transistors (FETs) are demonstrated. Preliminary measurements show an increase in electrical current on/off ratios as compared to large-area rGO FETs, indicating transport gap modulation that is possibly due to quantum confinement effects.

Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors

NASA Astrophysics Data System (ADS)

Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae

2016-10-01

A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this ‘electrical activation’, the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully.

Electric Field-aided Selective Activation for Indium-Gallium-Zinc-Oxide Thin Film Transistors

PubMed Central

Lee, Heesoo; Chang, Ki Soo; Tak, Young Jun; Jung, Tae Soo; Park, Jeong Woo; Kim, Won-Gi; Chung, Jusung; Jeong, Chan Bae; Kim, Hyun Jae

2016-01-01

A new technique is proposed for the activation of low temperature amorphous InGaZnO thin film transistor (a-IGZO TFT) backplanes through application of a bias voltage and annealing at 130 °C simultaneously. In this ‘electrical activation’, the effects of annealing under bias are selectively focused in the channel region. Therefore, electrical activation can be an effective method for lower backplane processing temperatures from 280 °C to 130 °C. Devices fabricated with this method exhibit equivalent electrical properties to those of conventionally-fabricated samples. These results are analyzed electrically and thermodynamically using infrared microthermography. Various bias voltages are applied to the gate, source, and drain electrodes while samples are annealed at 130 °C for 1 hour. Without conventional high temperature annealing or electrical activation, current-voltage curves do not show transfer characteristics. However, electrically activated a-IGZO TFTs show superior electrical characteristics, comparable to the reference TFTs annealed at 280 °C for 1 hour. This effect is a result of the lower activation energy, and efficient transfer of electrical and thermal energy to a-IGZO TFTs. With this approach, superior low-temperature a-IGZO TFTs are fabricated successfully. PMID:27725695

30 CFR 7.64 - Technical requirements.

Code of Federal Regulations, 2013 CFR

2013-07-01

... voltage that can be applied across an electric contact that discharges a capacitor shall not be greater...) Capacitor discharge. The blasting unit shall include an automatic means to dissipate any electric charge remaining in any capacitor after the blasting unit is deenergized and not in use. (j) Construction. Blasting...

30 CFR 7.64 - Technical requirements.

Code of Federal Regulations, 2012 CFR

2012-07-01

... voltage that can be applied across an electric contact that discharges a capacitor shall not be greater...) Capacitor discharge. The blasting unit shall include an automatic means to dissipate any electric charge remaining in any capacitor after the blasting unit is deenergized and not in use. (j) Construction. Blasting...

30 CFR 7.64 - Technical requirements.

Code of Federal Regulations, 2014 CFR

2014-07-01

... voltage that can be applied across an electric contact that discharges a capacitor shall not be greater...) Capacitor discharge. The blasting unit shall include an automatic means to dissipate any electric charge remaining in any capacitor after the blasting unit is deenergized and not in use. (j) Construction. Blasting...

Nanocrystal powered nanomotor

DOEpatents

Regan, Brian C [Los Angeles, CA; Zettl, Alexander K [Kensington, CA; Aloni, Shaul [Albany, CA

2011-01-04

A nanoscale nanocrystal which may be used as a reciprocating motor is provided, comprising a substrate having an energy differential across it, e.g. an electrical connection to a voltage source at a proximal end; an atom reservoir on the substrate distal to the electrical connection; a nanoparticle ram on the substrate distal to the atom reservoir; a nanolever contacting the nanoparticle ram and having an electrical connection to a voltage source, whereby a voltage applied between the electrical connections on the substrate and the nanolever causes movement of atoms between the reservoir and the ram. Movement of the ram causes movement of the nanolever relative to the substrate. The substrate and nanolever preferably comprise multiwalled carbon nanotubes (MWNTs) and the atom reservoir and nanoparticle ram are preferably metal (e.g. indium) deposited as small particles on the MWNTs. The substrate may comprise a silicon chip that has been fabricated to provide the necessary electrodes and other electromechanical structures, and further supports an atomic track, which may comprise an MWNT.

Memory Device and Nanofabrication Techniques Using Electrically Configurable Materials

NASA Astrophysics Data System (ADS)

Ascenso Simões, Bruno

Development of novel nanofabrication techniques and single-walled carbon nanotubes field configurable transistor (SWCNT-FCT) memory devices using electrically configurable materials is presented. A novel lithographic technique, electric lithography (EL), that uses electric field for pattern generation has been demonstrated. It can be used for patterning of biomolecules on a polymer surface and patterning of resist as well. Using electrical resist composed of a polymer having Boc protected amine group and iodonium salt, Boc group on the surface of polymer was modified to free amine by applying an electric field. On the modified surface of the polymer, Streptavidin pattern was fabricated with a sub-micron scale. Also patterning of polymer resin composed of epoxy monomers and diaryl iodonium salt by EL has been demonstrated. Reaction mechanism for electric resist configuration is believed to be induced by an acid generation via electrochemical reduction in the resist. We show a novel field configurable transistor (FCT) based on single-walled carbon nanotube network field-effect transistors in which poly (ethylene glycol) crosslinked by electron-beam is incorporated into the gate. The device conductance can be configured to arbitrary states reversibly and repeatedly by applying external gate voltages. Raman spectroscopy revealed that evolution of the ratio of D- to G-band intensity in the SWCNTs of the FCT progressively increases as the device is configured to lower conductance states. Electron transport studies at low temperatures showed a strong temperature dependence of the resistance. Band gap widening of CNTs up to ˜ 4 eV has been observed by examining the differential conductance-gate voltage-bias voltage relationship. The switching mechanism of the FCT is attributed a structural transformation of CNTs via reversible hydrogenation and dehydrogenations induced by gate voltages, which tunes the CNT bandgap continuously and reversibly to non-volatile analog values. The CNT transistors with field tunable band gaps would facilitate field programmable circuits based on the self-organized CNTs, and might also lead to novel analog memory, neuromorphic, and photonic devices.

Measuring Multi-Megavolt Diode Voltages

NASA Astrophysics Data System (ADS)

Pereira, N. R.; Swanekamp, S. B.; Weber, B. V.; Commisso, R. J.; Hinshelwood, D. D.; Stephanakis, S. J.

2002-12-01

The voltage in high-power diodes can be determined by measuring the Compton electrons generated by the diode's bremsstrahlung radiation. This technique is implemented with a Compton-Hall (C-H) voltmeter that collimates the bremsstrahlung onto a Compton target and bends the emitted Compton electron orbits off to the side with an applied magnetic field off to Si pin diode detectors. Voltage is determined from the ratio of the Compton electron dose to the forward x-ray dose. The instrument's calibration and response are determined from coupled electron/photon transport calculations. The applicable voltage range is tuned by adjusting the position of the electron detector relative to the Compton target or by varying the magnetic field strength. The instrument was used to obtain time-dependent voltage measurements for a pinched-beam diode whose voltage is enhanced by an upstream opening switch. In this case, plasmas and vacuum electron flow from the opening switch make it difficult to determine the voltage accurately from electrical measurements. The C-H voltmeter gives voltages that are significantly higher than those obtained from electrical measurements but are consistent with measurements of peak voltage based on nuclear activation of boron-nitride targets.

Discussion on optical response of liquid-crystal BPIII driven by an inclined electric field.

NASA Astrophysics Data System (ADS)

Chen, Hui-Yu; Wang, Yen-Wen

Three blue phases exist between the chiral nematic and the liquid phase. Compared with the electro-optical properties of BPI and BPII, BPIII is a fast response photonic device with no residual birefringence, and less hysteresis effect when an in-plane electric field is applied. However, the in-the-plane field is not uniform and then the electro-optical properties is more complicate than that we can image. This is a key point for further application of BP. In this paper, a grating-like vertical electric field is used to induce the two different optical phenomena of BPIII. As the electric field is turned on, the light transmittance rapidly increases to a stable value (<0.5 ms, Kerr effect). If the applied voltage is a dc, the transmittance will remind in this stable value. However, when the applied voltage is ac, the transmittance will oscillate with the frequency. The change in transmittance will be obvious in a low frequency. From our observation, we have known that the oscillation of the transmittance is not caused by the ion effect. It is induced by reorientation of the induced optical axis (flexoeletric effect). Thus, we can control the applied frequency and the amplitude to modulate the contribution of Kerr effect and flexoelectric effect. MOST 105-2112-M-005-010.

New approaches to provide ride-through for critical loads in electric power distribution systems

NASA Astrophysics Data System (ADS)

Montero-Hernandez, Oscar C.

2001-07-01

The extensive use of electronic circuits has enabled modernization, automation, miniaturization, high quality, low cost, and other achievements regarding electric loads in the last decades. However, modern electronic circuits and systems are extremely sensitive to disturbances from the electric power supply. In fact, the rate at which these disturbances happen is considerable as has been documented in recent years. In response to the power quality concerns presented previously, this dissertation is proposing new approaches to provide ride-through for critical loads during voltage disturbances with emphasis on voltage sags. In this dissertation, a new approach based on an AC-DC-AC system is proposed to provide ride-through for critical loads connected in buildings and/or an industrial system. In this approach, a three-phase IGBT inverter with a built in Dc-link voltage regulator is suitably controlled along with static by-pass switches to provide continuous power to critical loads. During a disturbance, the input utility source is disconnected and the power from the inverter is connected to the load. The remaining voltage in the AC supply is converted to DC and compensated before being applied to the inverter and the load. After detecting normal utility conditions, power from the utility is restored to the critical load. In order to achieve an extended ride-through capability a second approach is introduced. In this case, the Dc-link voltage regulator is performed by a DC-DC Buck-Boost converter. This new approach has the capability to mitigate voltage variations below and above the nominal value. In the third approach presented in this dissertation, a three-phase AC to AC boost converter is investigated. This converter provides a boosting action for the utility input voltages, right before they are applied to the load. The proposed Pulse Width Modulation (PWM) control strategy ensures independent control of each phase and compensates for both single-phase or poly-phase voltage sags. Algorithms capable of detecting voltage disturbances such as voltage sags, voltage swells, flicker, frequency change, and harmonics in a fast and reliable way are investigated and developed in this dissertation as an essential part of the approaches previously described. Simulation and experimental work has been done to validate the feasibility of all approaches under the most common voltage disturbances such as single-phase voltage sags and three-phase voltage sags.

Electrical control of superparamagnetism

NASA Astrophysics Data System (ADS)

Yamada, Kihiro T.; Koyama, Tomohiro; Kakizakai, Haruka; Miwa, Kazumoto; Ando, Fuyuki; Ishibashi, Mio; Kim, Kab-Jin; Moriyama, Takahiro; Ono, Shimpei; Chiba, Daichi; Ono, Teruo

2017-01-01

The electric field control of superparamagnetism is realized using a Cu/Ni system, in which the deposited Ni shows superparamagnetic behavior above the blocking temperature. An electric double-layer capacitor (EDLC) with the Cu/Ni electrode and a nonmagnetic counter electrode is fabricated to examine the electric field effect on magnetism in the magnetic electrode. By changing the voltage applied to the EDLC, the blocking temperature of the system is clearly modulated.

Catalytic devices

DOEpatents

Liu, Ming; Zhang, Xiang

2018-01-23

This disclosure provides systems, methods, and apparatus related to catalytic devices. In one aspect, a device includes a substrate, an electrically insulating layer disposed on the substrate, a layer of material disposed on the electrically insulating layer, and a catalyst disposed on the layer of material. The substrate comprises an electrically conductive material. The substrate and the layer of material are electrically coupled to one another and configured to have a voltage applied across them.

Vibration, buckling and smart control of microtubules using piezoelectric nanoshells under electric voltage in thermal environment

NASA Astrophysics Data System (ADS)

Farajpour, A.; Rastgoo, A.; Mohammadi, M.

2017-03-01

Piezoelectric nanomaterials such as zinc oxide (ZnO) are of low toxicity and have many biomedical applications including optical imaging, drug delivery, biosensing and harvesting biomechanical energy using hybrid nanogenerators. In this paper, the vibration, buckling and smart control of microtubules (MTs) embedded in an elastic medium in thermal environment using a piezoelectric nanoshell (PNS) are investigated. The MT and PNS are considered to be coupled by a filament network. The PNS is subjected to thermal loads and an external electric voltage which operates to control the mechanical behavior of the MT. Using the nonlocal continuum mechanics, the governing differential equations are derived. An exact solution is presented for simply supported boundary conditions. The differential quadrature method is also used to solve the governing equations for other boundary conditions. A detailed parametric study is conducted to investigate the effects of the elastic constants of surrounding medium and internal filament matrix, scale coefficient, electric voltage, the radius-to-thickness ratio of PNSs and temperature change on the smart control of MTs. It is found that the applied electric voltage can be used as an effective controlling parameter for the vibration and buckling of MTs.

Real time determination of the laser ablated mass by means of electric field-perturbation measurement

NASA Astrophysics Data System (ADS)

Pacheco, P.; Álvarez, J.; Sarmiento, R.; Bredice, F.; Sánchez-Aké, C.; Villagrán-Muniz, M.; Palleschi, V.

2018-04-01

A Nd:YAG ns-pulsed laser was used to ablate Al, Cd and Zn targets, which were placed between the plates of a planar charged capacitor. The plasma generates a transient redistribution of the electrical charges on the plates that can be measured as a voltage drop across a resistor connected to the ground plate. This signal is proportional to the capacitor applied voltage, the distance between the plates and the total number of ions produced in the ablation process which in turn is related to the laser energy and the ablated mass. After a series of pulses, the targets were weighed on a thermogravimetric balance to measure the ablated mass. Our results show that the electrical signal measured on the resistor is univocally related to the ablated mass from the target. Therefore, after a proper calibration depending on the material and the experimental geometry, the electrical signal can be used for real time quantitative measurement of the ablated mass in pulsed laser generated plasma experiments. The experiments were repeated on an aluminum target, with and without the presence of the external electric field in order to determine the possible influence of the applied electric field on the ablated mass.

SEM technique for imaging and measuring electronic transport in nanocomposites based on electric field induced contrast

DOEpatents

Jesse, Stephen [Knoxville, TN; Geohegan, David B [Knoxville, TN; Guillorn, Michael [Brooktondale, NY

2009-02-17

Methods and apparatus are described for SEM imaging and measuring electronic transport in nanocomposites based on electric field induced contrast. A method includes mounting a sample onto a sample holder, the sample including a sample material; wire bonding leads from the sample holder onto the sample; placing the sample holder in a vacuum chamber of a scanning electron microscope; connecting leads from the sample holder to a power source located outside the vacuum chamber; controlling secondary electron emission from the sample by applying a predetermined voltage to the sample through the leads; and generating an image of the secondary electron emission from the sample. An apparatus includes a sample holder for a scanning electron microscope having an electrical interconnect and leads on top of the sample holder electrically connected to the electrical interconnect; a power source and a controller connected to the electrical interconnect for applying voltage to the sample holder to control the secondary electron emission from a sample mounted on the sample holder; and a computer coupled to a secondary electron detector to generate images of the secondary electron emission from the sample.

Electrical properties of fullerenol C60(OH)10/Au interface

NASA Astrophysics Data System (ADS)

Sakaino, Masamichi; Sun, Yong; Morimoto, Fumio

2014-01-01

Electrical properties of the C60(OH)10/Au contact have been studied by measuring its current-voltage characteristics in the temperature range of 300-500 K. The Schottky barrier of the C60(OH)10/Au contact was confirmed to be 0.70±0.02 eV from Arrhenius plots of the current-voltage characteristics measured at various bias voltages as well as various preparation conditions of the C60(OH)10 material. Significant effect of the applied electric field on the barrier height has not been observed in the range of 0.1-2.0 MVm-1. The effects of both the charge transfer from C60 cage to OH groups and the crystallinity of the C60(OH)10 material on the Schottky barrier were discussed on the basis of x-ray photoemission spectroscopy and x-ray diffraction analyses.

Numerical investigation of the effect of driving voltage pulse shapes on the characteristics of low-pressure argon dielectric barrier discharge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eslami, E., E-mail: eeslami@iust.ac.ir; Barjasteh, A.; Morshedian, N.

2015-06-15

In this work, we numerically compare the effect of a sinusoidal, triangular, and rectangular pulsed voltage profile on the calculated particle production, electric current, and gas voltage in a dielectric barrier discharge. The total argon gas pressure of 400 Pa, the distance between dielectrics of 5 mm, the dielectric thickness of 0.7 mm, and the temperature of T = 300 K were considered as input parameters. The different driving voltage pulse shapes (triangular, rectangular, and sinusoidal) are considered as applied voltage with a frequency of 7 kHz and an amplitude of 700 V peak to peak. It is shown thatmore » applying a rectangular voltage, as compared with a sinusoidal or triangle voltage, increases the current peak, while the peak width is decreased. Higher current density is related to high production of charged particles, which leads to the generation of some highly active species, such as Ar* (4s level), and Ar** (4p level) in the gap.« less

Basic Electricity. Training Module 3.325.1.77.

ERIC Educational Resources Information Center

Kirkwood Community Coll., Cedar Rapids, IA.

This document is an instructional module package prepared in objective form for use by an instructor familiar with the basic concepts of electricity as applied to water and wastewater treatment. Included are objectives, instructor guides, student handouts, and transparency masters. This module considers definition of terms, voltage, current…

Ion detection device and method with compressing ion-beam shutter

DOEpatents

Sperline, Roger P [Tucson, AZ

2009-05-26

An ion detection device, method and computer readable medium storing instructions for applying voltages to shutter elements of the detection device to compress ions in a volume defined by the shutter elements and to output the compressed ions to a collector. The ion detection device has a chamber having an inlet and receives ions through the inlet, a shutter provided in the chamber opposite the inlet and configured to allow or prevent the ions to pass the shutter, the shutter having first and second shutter elements, a collector provided in the chamber opposite the shutter and configured to collect ions passed through the shutter, and a processing unit electrically connected to the first and second shutter elements. The processing unit applies, during a first predetermined time interval, a first voltage to the first shutter element and a second voltage to the second shutter element, the second voltage being lower than the first voltage such that ions from the inlet enter a volume defined by the first and second shutter elements, and during a second predetermined time interval, a third voltage to the first shutter element, higher than the first voltage, and a fourth voltage to the second shutter element, the third voltage being higher than the fourth voltage such that ions that entered the volume are compressed as the ions exit the volume and new ions coming from the inlet are prevented from entering the volume. The processing unit is electrically connected to the collector and configured to detect the compressed ions based at least on a current received from the collector and produced by the ions collected by the collector.

Investigation of surface charge density on solid-liquid interfaces by modulating the electrical double layer.

PubMed

Moon, Jong Kyun; Song, Myung Won; Pak, Hyuk Kyu

2015-05-20

A solid surface in contact with water or aqueous solution usually carries specific electric charges. These surface charges attract counter ions from the liquid side. Since the geometry of opposite charge distribution parallel to the solid-liquid interface is similar to that of a capacitor, it is called an electrical double layer capacitor (EDLC). Therefore, there is an electrical potential difference across an EDLC in equilibrium. When a liquid bridge is formed between two conducting plates, the system behaves as two serially connected EDLCs. In this work, we propose a new method for investigating the surface charge density on solid-liquid interfaces. By mechanically modulating the electrical double layers and simultaneously applying a dc bias voltage across the plates, an ac electric current can be generated. By measuring the voltage drop across a load resistor as a function of bias voltage, we can study the surface charge density on solid-liquid interfaces. Our experimental results agree very well with the simple equivalent electrical circuit model proposed here. Furthermore, using this method, one can determine the polarity of the adsorbed state on the solid surface depending on the material used. We expect this method to aid in the study of electrical phenomena on solid-liquid interfaces.

Electrical aging markers for EPR-based low-voltage cable insulation wiring of nuclear power plants

NASA Astrophysics Data System (ADS)

Verardi, L.; Fabiani, D.; Montanari, G. C.

2014-01-01

This paper presents results of electrical property measurements on EPR-based insulations of low-voltage power cables used in nuclear power plants. The specimens underwent accelerated aging through the simultaneous application of high temperature and gamma-radiation. Mechanical properties and the dielectric response at different frequencies were investigated. Results showed significant variation of the electrical and mechanical properties of aged cables at low frequencies, i.e. lower than 10-2 Hz. In particular, the real and imaginary parts of permittivity increase with aging time, accumulated dose and stress levels applied showing good correlation with elongation at break, which decreases as a function of extent of insulation aging.

Ferroelectric Emission Cathodes for Low-Power Electric Propulsion

NASA Technical Reports Server (NTRS)

Kovaleski, Scott D.; Burke, Tom (Technical Monitor)

2002-01-01

Low- or no-flow electron emitters are required for low-power electric thrusters, spacecraft plasma contactors, and electrodynamic tether systems to reduce or eliminate the need for propellant/expellant. Expellant-less neutralizers can improve the viability of very low-power colloid thrusters, field emission electric propulsion devices, ion engines, Hall thrusters, and gridded vacuum arc thrusters. The NASA Glenn Research Center (GRC) is evaluating ferroelectric emission (FEE) cathodes as zero expellant flow rate cathode sources for the applications listed above. At GRC, low voltage (100s to approx. 1500 V) operation of FEE cathodes is examined. Initial experiments, with unipolar, bipolar, and RF burst applied voltage, have produced current pulses 250 to 1000 ns in duration with peak currents of up to 2 A at voltages at or below 1500 V. In particular, FEE cathodes driven by RF burst voltages from 1400 to 2000 V peak to peak, at burst frequencies from 70 to 400 kHz, emitted average current densities from 0.1 to 0.7 A/sq cm. Pulse repeatability as a function of input voltage has been initially established. Reliable emission has been achieved in air background at pressures as high as 10(exp -6) Torr.

Electrical Properties and Power Considerations of a Piezoelectric Actuator

NASA Technical Reports Server (NTRS)

Jordan, T.; Ounaies, Z.; Tripp, J.; Tcheng, P.

1999-01-01

This paper assesses the electrical characteristics of piezoelectric wafers for use in aeronautical applications such as active noise control in aircraft. Determination of capacitive behavior and power consumption is necessary to optimize the system configuration and to design efficient driving electronics. Empirical relations are developed from experimental data to predict the capacitance and loss tangent of a PZT5A ceramic as nonlinear functions of both applied peak voltage and driving frequency. Power consumed by the PZT is the rate of energy required to excite the piezoelectric system along with power dissipated due to dielectric loss and mechanical and structural damping. Overall power consumption is thus quantified as a function of peak applied voltage and driving frequency. It was demonstrated that by incorporating the variation of capacitance and power loss with voltage and frequency, satisfactory estimates of power requirements can be obtained. These relations allow general guidelines in selection and application of piezoelectric actuators and driving electronics for active control applications.

The Role of Additional Pulses in Electropermeabilization Protocols

PubMed Central

Suárez, Cecilia; Soba, Alejandro; Maglietti, Felipe; Olaiz, Nahuel; Marshall, Guillermo

2014-01-01

Electropermeabilization (EP) based protocols such as those applied in medicine, food processing or environmental management, are well established and widely used. The applied voltage, as well as tissue electric conductivity, are of utmost importance for assessing final electropermeabilized area and thus EP effectiveness. Experimental results from literature report that, under certain EP protocols, consecutive pulses increase tissue electric conductivity and even the permeabilization amount. Here we introduce a theoretical model that takes into account this effect in the application of an EP-based protocol, and its validation with experimental measurements. The theoretical model describes the electric field distribution by a nonlinear Laplace equation with a variable conductivity coefficient depending on the electric field, the temperature and the quantity of pulses, and the Penne's Bioheat equation for temperature variations. In the experiments, a vegetable tissue model (potato slice) is used for measuring electric currents and tissue electropermeabilized area in different EP protocols. Experimental measurements show that, during sequential pulses and keeping constant the applied voltage, the electric current density and the blackened (electropermeabilized) area increase. This behavior can only be attributed to a rise in the electric conductivity due to a higher number of pulses. Accordingly, we present a theoretical modeling of an EP protocol that predicts correctly the increment in the electric current density observed experimentally during the addition of pulses. The model also demonstrates that the electric current increase is due to a rise in the electric conductivity, in turn induced by temperature and pulse number, with no significant changes in the electric field distribution. The EP model introduced, based on a novel formulation of the electric conductivity, leads to a more realistic description of the EP phenomenon, hopefully providing more accurate predictions of treatment outcomes. PMID:25437512

Effect of external electric and magnetic field on propagation of atmospheric pressure plasma jet

NASA Astrophysics Data System (ADS)

Zhu, Ping; Meng, Zhaozhong; Hu, Haixin; Ouyang, Jiting

2017-10-01

The behaviors of atmospheric pressure plasma jet produced by a coplanar dielectric barrier discharge (CDBD) in helium in external electrostatic and magnetic field are investigated experimentally. Time-resolved ICCD images of jet in electric field, magnetic field, and floating metal ring are recorded, respectively. The results show that the jet dynamics is affected significantly by a metal ring, an electric, and/or a magnetic field. In a transverse electric field, the jet shows behavior of deflection, broadening, and shortening according to the structure of electric field. In a transverse magnetic field, the jet deflects to up or down depending on the magnetic direction. The jet can be slowed down or obstructed by a floating metal ring on the jet path, but will still pass through the tube at higher applied voltages of DBD, without significant change in jet length or shape out of the tube compared with that without metal ring. A positive DC voltage on the metal ring helps to improve the jet length, but a negative voltage will reduce the length or completely stop the jet. The electric field to sustain the jet in helium is estimated to be about 24 ± 15 kV/cm from this experiment.

Magneto-acousto-electrical tomography: a potential method for imaging current density and electrical impedance.

PubMed

Haider, S; Hrbek, A; Xu, Y

2008-06-01

Primarily this report outlines our investigation on utilizing magneto-acousto-electrical-tomography (MAET) to image the lead field current density in volume conductors. A lead field current density distribution is obtained when a current/voltage source is applied to a sample via a pair of electrodes. This is the first time a high-spatial-resolution image of current density is presented using MAET. We also compare an experimental image of current density in a sample with its corresponding numerical simulation. To image the lead field current density, rather than applying a current/voltage source directly to the sample, we place the sample in a static magnetic field and focus an ultrasonic pulse on the sample to simulate a point-like current dipole source at the focal point. Then by using electrodes we measure the voltage/current signal which, based on the reciprocity theorem, is proportional to a component of the lead field current density. In the theory section, we derive the equation relating the measured voltage to the lead field current density and the displacement velocity caused by ultrasound. The experimental data include the MAET signal and an image of the lead field current density for a thin sample. In addition, we discuss the potential improvements for MAET especially to overcome the limitation created by the observation that no signal was detected from the interior of a region having a uniform conductivity. As an auxiliary we offer a mathematical formula whereby the lead field current density may be utilized to reconstruct the distribution of the electrical impedance in a piecewise smooth object.

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

NASA Astrophysics Data System (ADS)

Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.

In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.

Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuan, Lee Te, E-mail: gd130079@siswa.uthm.edu.my; Rathi, Muhammad Fareez Mohamad, E-mail: cd110238@siswa.uthm.edu.my; Abidin, Muhamad Yusuf Zainal, E-mail: cd110221@siswa.uthm.edu.my

Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm{sup −2}) at room temperature. Surfacemore » oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.« less

Coordinated Voltage Control of Transformer Taps on account of Hierarchical Structure in Power System

NASA Astrophysics Data System (ADS)

Nakachi, Yoshiki; Kato, Satoshi; Ukai, Hiroyuki

Participation of distributed generators (DG), such as wind turbines, co-generation system etc., is natural trend from ecological point of view and will increase more and more. The outputs of these DGs mainly depend on weather condition but don't correspond to the changes of electrical load demand necessarily. On the other hand, due to the deregulation of electric power market, the power flow in power system will uncertainly vary with several power transactions. Thus, complex power flow by DGs or transactions will cause the voltage deviation. It will be difficult to sustain the voltage quality by using the conventional voltage/reactive power control in near future. In this paper, in order to avoid such a voltage deviation and to decrease the frequency of transformer tap actions, the coordinated voltage control scheme of transformer taps on account of hierarchical structure in power system is proposed. In the proposed scheme, integral of voltage deviation at each layer bus is applied to decide the timing of each transformer tap action. It is confirmed by some numerical simulations that the proposed scheme is able to respond to every conditions on voltage deviation.

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE PAGES

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.; ...

2018-03-26

Ion mobility (IM) is rapidly gaining attention for the separation and analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM separations have limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. Both of these can be readily obtained in Structures for Lossless Ion Manipulations (SLIM), which are fabricated from arrays of electrodes patterned on two parallel surfaces where potentials aremore » applied to generate appropriate electric fields between the surfaces. Here we have investigated the relationship between the primary SLIM variables, such as electrode dimensions, inter-surface gap, and the applied TW voltages, that directly impact the fields experienced by ions. Ion trajectory simulations and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric fields on IM resolution. The variables explored impact both ion confinement and the observed IM resolution using SLIM modules.« less

Characterization of applied fields for ion mobility separations in traveling wave based structures for lossless ion manipulations (SLIM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamid, Ahmed M.; Prabhakaran, Aneesh; Garimella, Sandilya V. B.

Ion mobility (IM) is rapidly gaining attention for the separation and analysis of biomolecules due to the ability to distinguish the shapes of ions. However, conventional constant electric field drift tube IM separations have limited resolving power, constrained by practical limitations on the path length and maximum applied voltage. The implementation of traveling waves (TW) in IM removes the latter limitation, allowing higher resolution to be achieved using extended path lengths. Both of these can be readily obtained in Structures for Lossless Ion Manipulations (SLIM), which are fabricated from arrays of electrodes patterned on two parallel surfaces where potentials aremore » applied to generate appropriate electric fields between the surfaces. Here we have investigated the relationship between the primary SLIM variables, such as electrode dimensions, inter-surface gap, and the applied TW voltages, that directly impact the fields experienced by ions. Ion trajectory simulations and theoretical calculations have been utilized to understand the dependence of SLIM geometry and effective electric fields on IM resolution. The variables explored impact both ion confinement and the observed IM resolution using SLIM modules.« less

Transparent and Flexible Zinc Tin Oxide Thin Film Transistors and Inverters using Low-pressure Oxygen Annealing Process

NASA Astrophysics Data System (ADS)

Lee, Kimoon; Kim, Yong-Hoon; Kim, Jiwan; Oh, Min Suk

2018-05-01

We report on the transparent and flexible enhancement-load inverters which consist of zinc tin oxide (ZTO) thin film transistors (TFTs) fabricated at low process temperature. To control the electrical characteristics of oxide TFTs by oxygen vacancies, we applied low-pressure oxygen rapid thermal annealing (RTA) process to our devices. When we annealed the ZTO TFTs in oxygen ambient of 2 Torr, they showed better electrical characteristics than those of the devices annealed in the air ambient of 760 Torr. To realize oxide thin film transistor and simple inverter circuits on flexible substrate, we annealed the devices in O2 of 2 Torr at 150° C and could achieve the decent electrical properties. When we used transparent conductive oxide electrodes such as indium zinc oxide (IZO) and indium tin oxide (ITO), our transparent and flexible inverter showed the total transmittance of 68% in the visible range and the voltage gain of 5. And the transition voltage in voltage transfer curve was located well within the range of operation voltage.

Electrophysiology of connection current spikes.

PubMed

Fish, Raymond M; Geddes, Leslie A

2008-12-01

Connection to a 60-Hz or other voltage source can result in cardiac dysrhythmias, a startle reaction, muscle contractions, and a variety of other physiological responses. Such responses can lead to injury, especially if significant ventricular cardiac dysrhythmias occur, or if a person is working at some height above ground and falls as a result of a musculoskeletal response. Physiological reactions are known to relate to intensity and duration of current exposure. The connection current that flows is a function of the applied voltage at the instant of connection, and the electrical impedance encountered by the voltage source in contact with the skin or other body tissues. In this article we describe a rarely investigated phenomenon, namely a contact, or connection, current spike that is many times higher than the steady-state current. This current spike occurs when an electrical connection is made at a non-zero voltage time in a sine wave or other waveform. Such current spikes may occur when electronic or manual switching or connecting of conductors occurs in electronic instrumentation connected to a patient. These findings are relevant to medical devices and instrumentation and to electrical safety in general.

Hybrid electric vehicle power management system

DOEpatents

Bissontz, Jay E.

2015-08-25

Level voltage levels/states of charge are maintained among a plurality of high voltage DC electrical storage devices/traction battery packs that are arrayed in series to support operation of a hybrid electric vehicle drive train. Each high voltage DC electrical storage device supports a high voltage power bus, to which at least one controllable load is connected, and at least a first lower voltage level electrical distribution system. The rate of power transfer from the high voltage DC electrical storage devices to the at least first lower voltage electrical distribution system is controlled by DC-DC converters.

Evaluation of resistive switching properties of Si-rich oxide embedded with Ti nanodots by applying constant voltage and current

NASA Astrophysics Data System (ADS)

Ohta, Akio; Kato, Yusuke; Ikeda, Mitsuhisa; Makihara, Katsunori; Miyazaki, Seiichi

2018-06-01

We have studied the resistive switching behaviors of electron beam (EB) evaporated Si-rich oxide (SiO x ) sandwiched between Ni electrodes by applying a constant voltage and current. Additionally, the impact of Ti nanodots (NDs) embedded into SiO x on resistive switching behaviors was investigated because it is expected that NDs can trigger the formation of a conductive filament path in SiO x . The resistive switching behaviors of SiO x show that the response time during resistance switching was decreased by increasing the applied constant current or constant voltage. It was found that Ti-NDs in SiO x enhance the conductive filament path formation owing to electric field concentration by Ti-NDs.

The electrical performance and gate bias stability of an amorphous InGaZnO thin-film transistor with HfO2 high-k dielectrics

NASA Astrophysics Data System (ADS)

Wang, Ruo Zheng; Wu, Sheng Li; Li, Xin Yu; Zhang, Jin Tao

2017-07-01

In this study, we set out to fabricate an amorphous indium gallium zinc oxide (a-IGZO) thin-film transistor (TFT) with SiNx/HfO2/SiNx (SHS) sandwiched dielectrics. The J-V and C-V of this SHS film were extracted by the Au/p-Si/SHS/Ti structure. At room temperature the a-IGZO with SHS dielectrics showed the following electrical properties: a threshold voltage of 2.9 V, a subthreshold slope of 0.35 V/decade, an on/off current ratio of 3.5 × 107, and a mobility of 12.8 cm2 V-1 s-1. Finally, we tested the influence of gate bias stress on the TFT, and the result showed that the threshold voltage shifted to a positive voltage when applying a positive gate voltage to the TFT.

Decomposition of Composite Electric Field in a Three-Phase D-Dot Voltage Transducer Measuring System

PubMed Central

Hu, Xueqi; Wang, Jingang; Wei, Gang; Deng, Xudong

2016-01-01

In line with the wider application of non-contact voltage transducers in the engineering field, transducers are required to have better performance for different measuring environments. In the present study, the D-dot voltage transducer is further improved based on previous research in order to meet the requirements for long-distance measurement of electric transmission lines. When measuring three-phase electric transmission lines, problems such as synchronous data collection and composite electric field need to be resolved. A decomposition method is proposed with respect to the superimposed electric field generated between neighboring phases. The charge simulation method is utilized to deduce the decomposition equation of the composite electric field and the validity of the proposed method is verified by simulation calculation software. With the deduced equation as the algorithm foundation, this paper improves hardware circuits, establishes a measuring system and constructs an experimental platform for examination. Under experimental conditions, a 10 kV electric transmission line was tested for steady-state errors, and the measuring results of the transducer and the high-voltage detection head were compared. Ansoft Maxwell Stimulation Software was adopted to obtain the electric field intensity in different positions under transmission lines; its values and the measuring values of the transducer were also compared. Experimental results show that the three-phase transducer is characterized by a relatively good synchronization for data measurement, measuring results with high precision, and an error ratio within a prescribed limit. Therefore, the proposed three-phase transducer can be broadly applied and popularized in the engineering field. PMID:27754340

Modelling in conventional electroporation for model cell with organelles using COMSOL Multiphysics

NASA Astrophysics Data System (ADS)

Sulaeman, M. Y.; Widita, R.

2016-03-01

Conventional electroporation is a formation of pores in the membrane cell due to the external electric field applied to the cell. The purpose of creating pores in the cell using conventional electroporation are to increase the effectiveness of chemotherapy (electrochemotherapy) and to kill cancer tissue using irreversible electroporation. Modeling of electroporation phenomenon on a model cell had been done by using software COMSOL Multiphysics 4.3b with the applied external electric field with intensity at 1.1 kV/cm to find transmembrane voltage and pore density. It can be concluded from the results of potential distribution and transmembrane voltage, it show that pores formation only occurs in the membrane cells and it could not penetrate into inside the model cell so there is not pores formation in its organells.

Electric field measurements in nanosecond pulse discharges in air over liquid water surface

NASA Astrophysics Data System (ADS)

Simeni Simeni, Marien; Baratte, Edmond; Zhang, Cheng; Frederickson, Kraig; Adamovich, Igor V.

2018-01-01

Electric field in nanosecond pulse discharges in ambient air is measured by picosecond four-wave mixing, with absolute calibration by a known electrostatic field. The measurements are done in two geometries, (a) the discharge between two parallel cylinder electrodes placed inside quartz tubes, and (b) the discharge between a razor edge electrode and distilled water surface. In the first case, breakdown field exceeds DC breakdown threshold by approximately a factor of four, 140 ± 10 kV cm-1. In the second case, electric field is measured for both positive and negative pulse polarities, with pulse durations of ˜10 ns and ˜100 ns, respectively. In the short duration, positive polarity pulse, breakdown occurs at 85 kV cm-1, after which the electric field decreases over several ns due to charge separation in the plasma, with no field reversal detected when the applied voltage is reduced. In a long duration, negative polarity pulse, breakdown occurs at a lower electric field, 30 kV cm-1, after which the field decays over several tens of ns and reverses direction when the applied voltage is reduced at the end of the pulse. For both pulse polarities, electric field after the pulse decays on a microsecond time scale, due to residual surface charge neutralization by transport of opposite polarity charges from the plasma. Measurements 1 mm away from the discharge center plane, ˜100 μm from the water surface, show that during the voltage rise, horizontal field component (Ex ) lags in time behind the vertical component (Ey ). After breakdown, Ey is reduced to near zero and reverses direction. Further away from the water surface (≈0.9 mm), Ex is much higher compared to Ey during the entire voltage pulse. The results provide insight into air plasma kinetics and charge transport processes near plasma-liquid interface, over a wide range of time scales.

Reliability of ionic polymer metallic composite for opto-mechanical applications

NASA Astrophysics Data System (ADS)

Yu, Chung-Yi; Su, Guo-Dung J.

2014-09-01

Electroactive polymer (EAP) is capable of exhibiting large shape changes in response to electrical stimulation. EAPs can produce large deformation with lower applied voltage for actuation applications. IPMC (Ionic Polymer Metal Composite) is a well-known ionic EAPs. It has numerous attractive advantages, such as low electrical energy consumption and light weight. The mechanism of IPMC actuator is due to the ionic diffusion when the voltage gradient is applied, so that the type of ionic solution has a large impact on the physical properties of IPMC. In this paper, the reliability tests of IPMC with non-aqueous ionic solution are demonstrated. Pt-IPMC with LiOH aqueous solution exhibits the best maximum displacement, but the water in LiOH solution is electrolyzed because of the low electrolysis voltage 1.23 V of water. To improve electrolysis problems and the operation time in the air, proper solvents including high electrolysis voltage and low vapor pressure should be considered. The reliability tests focus on the durability of IPMC in the air. The surface resistance, tip displacement and response time of IPMC are presented. More improvements of IPMC fabrication, such as Ag-IPMC, was developed in this paper.

Irradiation apparatus

DOEpatents

Goldie, C.H.; Fernald, R.A.

1974-01-29

An apparatus for introducing ionizing radiation into compressed gas insulation systems, such as high-voltage generators or transmission lines to smooth out electrical discontinuities, particularly those caused by foreign particulates that produce high gradients, and to increase the voltage holding capability of the system is described. The apparatus of the invention may also be used to regulate and stabilize the voltage of the system by varying the amount of applied load. A corona discharge device may also be used in conjunction with the invention. (Official Gazette)

Macro Fiber Piezocomposite Actuator Poling Study

NASA Technical Reports Server (NTRS)

Werlink, Rudy J.; Bryant, Robert G.; Manos, Dennis

2002-01-01

The performance and advantages of Piezocomposite Actuators are to provide a low cost, in-situ actuator/sensor that is flexible, low profile and high strain per volt performance in the same plane of poled voltage. This paper extends reported data for the performance of these Macrofiber Composite (MFC) Actuators to include 4 progressively narrower Intedigitized electrode configurations with several line widths and spacing ratios. Data is reported for max free strain, average strain per applied volt, poling (alignment of the electric dipoles of the PZT ceramic) voltage vs. strain and capacitance, time to poling voltage 95% saturation. The output strain per volt progressively increases as electrode spacing decreases, with saturation occurring at lower poling voltages. The narrowest spacing ratio becomes prone to voltage breakdown or short circuits limiting the spacing width with current fabrication methods. The capacitance generally increases with increasing poling voltage level but has high sensitivity to factors such as temperature, moisture and time from poling which limit its usefulness as a simple indicator. The total time of applied poling voltage to saturate or fully line up the dipoles in the piezoceramic was generally on the order of 5-20 seconds. Less sensitivity to poling due to the applied rate of voltage increase over a 25 to 500 volt/second rate range was observed.

Dielectrophoretic systems without embedded electrodes

DOEpatents

Cummings, Eric B [Livermore, CA; Singh, Anup K [San Francisco, CA

2006-03-21

Method and apparatus for dielectrophoretic separation of particles in a fluid based using array of insulating structures arranged in a fluid flow channel. By utilizing an array of insulating structures, a spatially inhomogeneous electric field is created without the use of the embedded electrodes conventionally employed for dielectrophoretic separations. Moreover, by using these insulating structures a steady applied electric field has been shown to provide for dielectrophoresis in contrast to the conventional use of an alternating electric field. In a uniform array of posts, dielectrophoretic effects have been produced flows having significant pressure-driven and electrokinetic transport. Above a threshold applied electric field, filaments of concentrated and rarefied particles appear in the flow as a result of dielectrophoresis. Above a higher threshold applied voltage, dielectrophoresis produces zones of highly concentrated and immobilized particles. These patterns are strongly influenced by the angle of the array of insulating structures with respect to the mean applied electric field and the shape of the insulating structures.

Baseline tests of the EVA contractor electric passenger vehicle

NASA Technical Reports Server (NTRS)

Bozek, J. M.; Tryon, H. B.; Slavick, R. J.

1977-01-01

The EVA Contactor four door sedan, an electric passenger vehicle, was tested to characterize the state-of-the-art of electric vehicles. It is a four passenger sedan that was converted to an electric vehicle. It is powered by 16 series connected 6 volt electric vehicle batteries through a four step contactor controller actuated by a foot accelerator pedal. The controller changes the voltage applied to the separately excited DC motor. The braking system is a vacuum assisted hydraulic braking system. Regenerative braking was also provided.

Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komazaki, Y., E-mail: komazaki@dt.k.u-tokyo.ac.jp; Hirama, H.; Torii, T.

In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventionalmore » color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.« less

Towards plant wires.

PubMed

Adamatzky, Andrew

2014-08-01

In experimental laboratory studies we evaluate a possibility of making electrical wires from living plants. In scoping experiments we use lettuce seedlings as a prototype model of a plant wire. We approximate an electrical potential transfer function by applying direct current voltage to the lettuce seedlings and recording output voltage. We analyse oscillation frequencies of the output potential and assess noise immunity of the plant wires. Our findings will be used in future designs of self-growing wetware circuits and devices, and integration of plant-based electronic components into future and emergent bio-hybrid systems. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Feeding behavior of the stink bug Bagrada hilaris is changed by the electrical signals applied during EPG recordings

USDA-ARS?s Scientific Manuscript database

Feeding behavior of piercing-sucking insects is most rigorously studied using eletropenetrography (EPG). This technique utilizes an electrical circuit to record waveforms caused by voltage fluctuations when a wired insect inserts its stylet into an electrified plant. Past researchers have asserted t...

Experimenting with Electric Trains

ERIC Educational Resources Information Center

Wick, D. P.; Ramsdell, M. W.

2007-01-01

A simple experiment can be performed to characterize the relationship between applied voltage and velocity (steady state and transient) for an electric toy train. The results can be used by teams of students to solve a series of challenges in which they attempt to predict the performance of a particular train. Some sample challenges might include…

The electrical characteristics of the dielectric barrier discharges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yehia, Ashraf, E-mail: yehia30161@yahoo.com; Department of Physics, Faculty of Science, Assiut University, Assiut 71516

2016-06-15

The electrical characteristics of the dielectric barrier discharges have been studied in this paper under different operating conditions. The dielectric barrier discharges were formed inside two reactors composed of electrodes in the shape of two parallel plates. The dielectric layers inside these reactors were pasted on the surface of one electrode only in the first reactor and on the surfaces of the two electrodes in the second reactor. The reactor under study has been fed by atmospheric air that flowed inside it with a constant rate at the normal temperature and pressure, in parallel with applying a sinusoidal ac voltagemore » between the electrodes of the reactor. The amount of the electric charge that flows from the reactors to the external circuit has been studied experimentally versus the ac peak voltage applied to them. An analytical model has been obtained for calculating the electrical characteristics of the dielectric barrier discharges that were formed inside the reactors during a complete cycle of the ac voltage. The results that were calculated by using this model have agreed well with the experimental results under the different operating conditions.« less

Rapid and Checkable Electrical Post-Treatment Method for Organic Photovoltaic Devices

PubMed Central

Park, Sangheon; Seo, Yu-Seong; Shin, Won Suk; Moon, Sang-Jin; Hwang, Jungseek

2016-01-01

Post-treatment processes improve the performance of organic photovoltaic devices by changing the microscopic morphology and configuration of the vertical phase separation in the active layer. Thermal annealing and solvent vapor (or chemical) treatment processes have been extensively used to improve the performance of bulk-heterojunction (BHJ) organic photovoltaic (OPV) devices. In this work we introduce a new post-treatment process which we apply only electrical voltage to the BHJ-OPV devices. We used the commercially available P3HT [Poly(3-hexylthiophene)] and PC61BM (Phenyl-C61-Butyric acid Methyl ester) photovoltaic materials as donor and acceptor, respectively. We monitored the voltage and current applied to the device to check for when the post-treatment process had been completed. This electrical treatment process is simpler and faster than other post-treatment methods, and the performance of the electrically treated solar cell is comparable to that of a reference (thermally annealed) device. Our results indicate that the proposed treatment process can be used efficiently to fabricate high-performance BHJ-OPV devices. PMID:26932767

Electric-Field-Induced Degradation of Methylammonium Lead Iodide Perovskite Solar Cells.

PubMed

Bae, Soohyun; Kim, Seongtak; Lee, Sang-Won; Cho, Kyung Jin; Park, Sungeun; Lee, Seunghun; Kang, Yoonmook; Lee, Hae-Seok; Kim, Donghwan

2016-08-18

Perovskite solar cells have great potential for high efficiency generation but are subject to the impact of external environmental conditions such as humidity, UV and sun light, temperature, and electric fields. The long-term stability of perovskite solar cells is an important issue for their commercialization. Various studies on the stability of perovskite solar cells are currently being performed; however, the stability related to electric fields is rarely discussed. Here the electrical stability of perovskite solar cells is studied. Ion migration is confirmed using the temperature-dependent dark current decay. Changes in the power conversion efficiency according to the amount of the external bias are measured in the dark, and a significant drop is observed only at an applied voltage greater than 0.8 V. We demonstrate that perovskite solar cells are stable under an electric field up to the operating voltage.

Characterization of Intercalated Graphite Fibers for Microelectromechanical Systems (MEMS) Applications

DTIC Science & Technology

2007-03-01

electric charge to drive movement, eg. a micromirror . These two actuator types have different characteristics and apply dif- ferent forces. The thermal...actuators include micromirrors , comb drives, cantilevers and scratch drives. A scratch drive actuator uses an applied square wave voltage to operate, as

Apparatus for measuring the local void fraction in a flowing liquid containing a gas

DOEpatents

Dunn, P.F.

1979-07-17

The local void fraction in liquid containing a gas is measured by placing an impedance-variation probe in the liquid, applying a controlled voltage or current to the probe, and measuring the probe current or voltage. A circuit for applying the one electrical parameter and measuring the other includes a feedback amplifier that minimizes the effect of probe capacitance and a digitizer to provide a clean signal. Time integration of the signal provides a measure of the void fraction, and an oscilloscope display also shows bubble size and distribution.

Apparatus for measuring the local void fraction in a flowing liquid containing a gas

DOEpatents

Dunn, Patrick F.

1981-01-01

The local void fraction in liquid containing a gas is measured by placing an impedance-variation probe in the liquid, applying a controlled voltage or current to the probe, and measuring the probe current or voltage. A circuit for applying the one electrical parameter and measuring the other includes a feedback amplifier that minimizes the effect of probe capacitance and a digitizer to provide a clean signal. Time integration of the signal provides a measure of the void fraction, and an oscilloscope display also shows bubble size and distribution.

Battery charging and discharging research based on the interactive technology of smart grid and electric vehicle

NASA Astrophysics Data System (ADS)

Zhang, Mingyang

2018-06-01

To further study the bidirectional flow problem of V2G (Vehicle to Grid) charge and discharge motor, the mathematical model of AC/DC converter and bi-directional DC/DC converter was established. Then, lithium battery was chosen as the battery of electric vehicle and its mathematical model was established. In order to improve the service life of lithium battery, bidirectional DC/DC converter adopted constant current and constant voltage control strategy. In the initial stage of charging, constant current charging was adopted with current single closed loop control. After reaching a certain value, voltage was switched to constant voltage charging controlled by voltage and current. Subsequently, the V2G system simulation model was built in MATLAB/Simulink. The simulation results verified the correctness of the control strategy and showed that when charging, constant current and constant voltage charging was achieved, the grid side voltage and current were in the same phase, and the power factor was about 1. When discharging, the constant current discharge was applied, and the grid voltage and current phase difference was r. To sum up, the simulation results are correct and helpful.

Röntgen’s electrode-free elastomer actuators without electromechanical pull-in instability

PubMed Central

Keplinger, Christoph; Kaltenbrunner, Martin; Arnold, Nikita; Bauer, Siegfried

2010-01-01

Electrical actuators made from films of dielectric elastomers coated on both sides with stretchable electrodes may potentially be applied in microrobotics, tactile and haptic interfaces, as well as in adaptive optical elements. Such actuators with compliant electrodes are sensitive to the pull-in electromechanical instability, limiting operational voltages and attainable deformations. Electrode-free actuators driven by sprayed-on electrical charges were first studied by Röntgen in 1880. They withstand much higher voltages and deformations and allow for electrically clamped (charge-controlled) thermodynamic states preventing electromechanical instabilities. The absence of electrodes allows for direct optical monitoring of the actuated elastomer, as well as for designing new 3D actuator configurations and adaptive optical elements. PMID:20173097

Microalgae dewatering based on forward osmosis employing proton exchange membrane.

PubMed

Son, Jieun; Sung, Mina; Ryu, Hoyoung; Oh, You-Kwan; Han, Jong-In

2017-11-01

In this study, electrically-facilitated forward osmosis (FO) employing proton exchange membrane (PEM) was established for the purpose of microalgae dewatering. An increase in water flux was observed when an external voltage was applied to the FO equipped with the PEM; as expected, the trend became more dramatic with both concentration of draw solution and applied voltage raised. With this FO used for microalgae dewatering, 247% of increase in flux and 86% in final biomass concentration were observed. In addition to the effect on flux improvement, the electrically-facilitated FO exhibited the ability to remove chlorophyll from the dewatered biomass, down to 0.021±0015mg/g cell. All these suggest that the newly suggested electrically-facilitated FO, one particularly employed PEM, can indeed offer a workable way of dewatering of microalgae; it appeared to be so because it can also remove the ever-problematic chlorophyll from extracted lipids in a simultaneous fashion. Copyright © 2017 Elsevier Ltd. All rights reserved.

Electrically controllable liquid crystal random lasers below the Fréedericksz transition threshold.

PubMed

Lee, Chia-Rong; Lin, Jia-De; Huang, Bo-Yuang; Lin, Shih-Hung; Mo, Ting-Shan; Huang, Shuan-Yu; Kuo, Chie-Tong; Yeh, Hui-Chen

2011-01-31

This investigation elucidates for the first time electrically controllable random lasers below the threshold voltage in dye-doped liquid crystal (DDLC) cells with and without adding an azo-dye. Experimental results show that the lasing intensities and the energy thresholds of the random lasers can be decreased and increased, respectively, by increasing the applied voltage below the Fréedericksz transition threshold. The below-threshold-electric-controllability of the random lasers is attributable to the effective decrease of the spatial fluctuation of the orientational order and thus of the dielectric tensor of LCs by increasing the electric-field-aligned order of LCs below the threshold, thereby increasing the diffusion constant and decreasing the scattering strength of the fluorescence photons in their recurrent multiple scattering. This can result in the decrease in the lasing intensity of the random lasers and the increase in their energy thresholds. Furthermore, the addition of an azo-dye in DDLC cell can induce the range of the working voltage below the threshold for the control of the random laser to reduce.

Model analysis and electrical characterization of atmospheric pressure cold plasma jet in pin electrode configuration

NASA Astrophysics Data System (ADS)

Deepak, G. Divya; Joshi, N. K.; Prakash, Ram

2018-05-01

In this study, both model analysis and electrical characterization of a dielectric barrier discharge based argon plasma jet have been carried at atmospheric pressure in a pin electrode configuration. The plasma and fluid dynamics modules of COMSOL multi-physics code have been used for the modeling of the plasma jet. The plasma parameters, such as, electron density, electron temperature and electrical potential have been analyzed with respect to the electrical parameters, i.e., supply voltage and supply frequency with and without the flow of gas. In all the experiments, gas flow rate has been kept constant at 1 liter per minute. This electrode configuration is subjected to a range of supply frequencies (10-25 kHz) and supply voltages (3.5-6.5 kV). The power consumed by the device has been estimated at different applied combinations (supply voltage & frequency) for optimum power consumption at maximum jet length. The maximum power consumed by the device in this configuration for maximum jet length of ˜26 mm is just ˜1 W.

Localized electrical fine tuning of passive microwave and radio frequency devices

DOEpatents

Findikoglu, Alp T.

2001-04-10

A method and apparatus for the localized electrical fine tuning of passive multiple element microwave or RF devices in which a nonlinear dielectric material is deposited onto predetermined areas of a substrate containing the device. An appropriate electrically conductive material is deposited over predetermined areas of the nonlinear dielectric and the signal line of the device for providing electrical contact with the nonlinear dielectric. Individual, adjustable bias voltages are applied to the electrically conductive material allowing localized electrical fine tuning of the devices. The method of the present invention can be applied to manufactured devices, or can be incorporated into the design of the devices so that it is applied at the time the devices are manufactured. The invention can be configured to provide localized fine tuning for devices including but not limited to coplanar waveguides, slotline devices, stripline devices, and microstrip devices.

Magneto-acousto-electrical Measurement Based Electrical Conductivity Reconstruction for Tissues.

PubMed

Zhou, Yan; Ma, Qingyu; Guo, Gepu; Tu, Juan; Zhang, Dong

2018-05-01

Based on the interaction of ultrasonic excitation and magnetoelectrical induction, magneto-acousto-electrical (MAE) technology was demonstrated to have the capability of differentiating conductivity variations along the acoustic transmission. By applying the characteristics of the MAE voltage, a simplified algorithm of MAE measurement based conductivity reconstruction was developed. With the analyses of acoustic vibration, ultrasound propagation, Hall effect, and magnetoelectrical induction, theoretical and experimental studies of MAE measurement and conductivity reconstruction were performed. The formula of MAE voltage was derived and simplified for the transducer with strong directivity. MAE voltage was simulated for a three-layer gel phantom and the conductivity distribution was reconstructed using the modified Wiener inverse filter and Hilbert transform, which was also verified by experimental measurements. The experimental results are basically consistent with the simulations, and demonstrate that the wave packets of MAE voltage are generated at tissue interfaces with the amplitudes and vibration polarities representing the values and directions of conductivity variations. With the proposed algorithm, the amplitude and polarity of conductivity gradient can be restored and the conductivity distribution can also be reconstructed accurately. The favorable results demonstrate the feasibility of accurate conductivity reconstruction with improved spatial resolution using MAE measurement for tissues with conductivity variations, especially suitable for nondispersive tissues with abrupt conductivity changes. This study demonstrates that the MAE measurement based conductivity reconstruction algorithm can be applied as a new strategy for nondestructive real-time monitoring of conductivity variations in biomedical engineering.

Electro-optical phenomena based on ionic liquids in an optofluidic waveguide.

PubMed

He, Xiaodong; Shao, Qunfeng; Cao, Pengfei; Kong, Weijie; Sun, Jiqian; Zhang, Xiaoping; Deng, Youquan

2015-03-07

An optofluidic waveguide with a simple two-terminal electrode geometry, when filled with an ionic liquid (IL), forms a lateral electric double-layer capacitor under a direct current (DC) electric field, which allows the realization of an extremely high carrier density in the vicinity of the electrode surface and terminals to modulate optical transmission at room temperature under low voltage operation (0 to 4 V). The unique electro-optical phenomenon of ILs was investigated at three wavelengths (663, 1330 and 1530 nm) using two waveguide geometries. Strong electro-optical modulations with different efficiencies were observed at the two near-infrared (NIR) wavelengths, while no detectable modulation was observed at 663 nm. The first waveguide geometry was used to investigate the position-dependent modulation along the waveguide; the strongest modulation was observed in the vicinity of the electrode terminal. The modulation phase is associated with the applied voltage polarity, which increases in the vicinity of the negative electrode and decreases at the positive electrode. The second waveguide geometry was used to improve the modulation efficiency. Meanwhile, the electro-optical modulations of seven ILs were compared at an applied voltage ranging from ±2 V to ±3.5 V. The results reveal that the modulation amplitude and response speed increase with increasing applied voltage, as well as the electrical conductivity of ILs. Despite the fact that the response speed isn't fast due to the high ionic density of ILs, the modulation amplitude can reach up to 6.0 dB when a higher voltage (U = ±3.5 V) is applied for the IL [Emim][BF4]. Finally, the physical explanation of the phenomenon was discussed. The effect of the change in IL structure on the electro-optical phenomena was investigated in another new experiment. The results reveal that the electro-optical phenomenon is probably caused mainly by the change in carrier concentration (ion redistribution near charged electrodes), which induces the enhancement and suppression of NIR optical absorption (contributed by C-H and N-H groups) in the vicinity of the negative electrode and positive electrode, respectively.

Electric field around a dielectric elastomer actuator in proximity to the human body

NASA Astrophysics Data System (ADS)

McKenzie, Anita C.; Calius, Emilio P.; Anderson, Iain A.

2008-03-01

Dielectric elastomer actuators (DEAs) are a promising artificial muscle technology that will enable new kinds of prostheses and wearable rehabilitation devices. DEAs are driven by electric fields in the MV/m range and the dielectric elastomer itself is typically 30μm in thickness or more. Large operating voltages, in the order of several kilovolts, are then required to produce useful strains and these large voltages and the resulting electric fields could potentially pose problems when DEAs are used in close proximity to the human body. The fringing electric fields of a DEA in close association with the skin were modelled using finite element methods. The model was verified against a known analytic solution describing the electric field surrounding a capacitor in air. The agreement between the two is good, as the difference is less than 10% unless within 4.5mm of the DEA's lateral edges. As expected, it was found that for a DEA constructed with thinner dielectric layers, the fringe field strength dropped in direct proportion to the reduction in applied voltage, despite the internal field being maintained at the same level. More interestingly, modelling the electric field around stacked DEAs showed that for an even number of layers the electric field is an order of magnitude less than for an odd number of layers, due to the cancelling of opposing electric fields.

Effect of applied voltage and inter-pulse delay in spark-assisted LIBS

NASA Astrophysics Data System (ADS)

Robledo-Martinez, A.; Sobral, H.; Garcia-Villarreal, A.

2018-06-01

We report the results obtained in an investigation on the effect of the time delay between the laser and electrical pulses in a spark-assisted laser-induced breakdown spectroscopy (LIBS) experiment. The electrical discharge is produced by the discharge of a charged coaxial cable. This arrangement produces a fast unipolar current pulse (500 ns) that applies high power ( 600 kW) to the laser ablation plasma. The delay between the laser pulse and the electric pulse can be controlled at will in order to find the optimal time in terms of enhancement of the emitted lines. It was found that the application of the high voltage pulse enhances the ionic lines emitted by up to two orders of magnitude. An additional enhancement by a factor of 2-4 can be obtained delaying the application of the electric pulse by a time of 0.6-20 μs. In the tests it was noticed that the ionic lines were found to be clearly responsive to increments in the applied electric energy while the neutral lines did so marginally. Our results show that the intensification of the lines is mainly due to reheating of the ablation plasma as the application of the electrical pulse increments the temperature of the ablation plasma by about 50%. It is demonstrated that the present technique is an efficient way of intensifying the lines emitted without incurring in additional damage to the sample.

Increasing The Electric Field For An Improved Search For Time-Reversal Violation Using Radium-225

NASA Astrophysics Data System (ADS)

Powers, Adam

2017-09-01

Radium-225 atoms, because of their unusual pear-shaped nuclei, have an enhanced sensitivity to the violation of time reversal symmetry. A breakdown of this fundamental symmetry could help explain the apparent scarcity of antimatter in the Universe. Our goal is to improve the statistical sensitivity of an ongoing experiment that precisely measures the EDM of Radium-225. This can be done by increasing the electric field acting on the Radium atoms. We do this by increasing the voltage that can be reliably applied between two electrodes, and narrowing the gap between them. We use a varying high voltage system to condition the electrodes using incremental voltage ramp tests to achieve higher voltage potential differences. Using an adjustable gap mount to change the distance between the electrodes, specific metals for their composition, and a clean room procedure to keep particulates out of the system, we produce a higher and more stable electric field. Progress is marked by measurements of the leakage current between the electrodes during our incremental voltage ramp tests or emulated tests of the actual experiment, with low and constant current showing stability of the field. This project is supported by Michigan State University, and the US DOE, Office of Science, Office of Nuclear Physics, under Contract DE-AC02-06CH11357.

Positive temperature coefficient thermistors based on carbon nanotube/polymer composites

PubMed Central

Zeng, You; Lu, Guixia; Wang, Han; Du, Jinhong; Ying, Zhe; Liu, Chang

2014-01-01

In order to explore availability of carbon nanotube (CNT)-based positive temperature coefficient (PTC) thermistors in practical application, we prepared carbon nanotube (CNT) filled high density polyethylene (HDPE) composites by using conventional melt-mixing methods, and investigated their PTC effects in details. The CNT-based thermistors exhibit much larger hold current and higher hold voltage, increasing by 129% in comparison with the commercial carbon black (CB) filled HDPE thermistors. Such high current-bearing and voltage-bearing capacity for the CNT/HDPE thermistors is mainly attributed to high thermal conductivity and heat dissipation of entangled CNT networks. Moreover, the CNT/HDPE thermistors exhibit rapid electrical response to applied voltages, comparable to commercial CB-based thermistors. In light of their high current-bearing capacity and quick response, the CNT-based thermistors have great potential to be used as high-performance thermistors in practical application, especially in some critical circumstances of high temperature, large applied currents, and high applied voltages. PMID:25327951

Electrical properties of fullerenol C{sub 60}(OH){sub 10}/Au interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakaino, Masamichi, E-mail: sun@ele.kyutech.ac.jp; Sun, Yong; Morimoto, Fumio

Electrical properties of the C{sub 60}(OH){sub 10}/Au contact have been studied by measuring its current-voltage characteristics in the temperature range of 300–500 K. The Schottky barrier of the C{sub 60}(OH){sub 10}/Au contact was confirmed to be 0.70±0.02 eV from Arrhenius plots of the current-voltage characteristics measured at various bias voltages as well as various preparation conditions of the C{sub 60}(OH){sub 10} material. Significant effect of the applied electric field on the barrier height has not been observed in the range of 0.1–2.0 MVm{sup −1}. The effects of both the charge transfer from C{sub 60} cage to OH groups and the crystallinity of themore » C{sub 60}(OH){sub 10} material on the Schottky barrier were discussed on the basis of x-ray photoemission spectroscopy and x-ray diffraction analyses.« less

Electric generation and ratcheted transport of contact-charged drops

NASA Astrophysics Data System (ADS)

Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

Electric generation and ratcheted transport of contact-charged drops.

PubMed

Cartier, Charles A; Graybill, Jason R; Bishop, Kyle J M

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

Investigation on the influence of electrode geometry on characteristics of coaxial dielectric barrier discharge reactor driven by an oscillating microsecond pulsed power supply

NASA Astrophysics Data System (ADS)

Miao, Chuanrun; Liu, Feng; Wang, Qian; Cai, Meiling; Fang, Zhi

2018-03-01

In this paper, an oscillating microsecond pulsed power supply with rise time of several tens of nanosecond (ns) is used to excite a coaxial DBD with double layer dielectric barriers. The effects of various electrode geometries by changing the size of inner quartz tube (different electrode gaps) on the discharge uniformity, power deposition, energy efficiency, and operation temperature are investigated by electrical, optical, and temperature diagnostics. The electrical parameters of the coaxial DBD are obtained from the measured applied voltage and current using an equivalent electrical model. The energy efficiency and the power deposition in air gap of coaxial DBD with various electrode geometries are also obtained with the obtained electrical parameters, and the heat loss and operation temperature are analyzed by a heat conduction model. It is found that at the same applied voltage, with the increasing of the air gap, the discharge uniformity becomes worse and the discharge power deposition and the energy efficiency decrease. At 2.5 mm air gap and 24 kV applied voltage, the energy efficiency of the coaxial DBD reaches the maximum value of 68.4%, and the power deposition in air gap is 23.6 W and the discharge uniformity is the best at this case. The corresponding operation temperature of the coaxial DBD reaches 64.3 °C after 900 s operation and the temperature of the inner dielectric barrier is 114.4 °C under thermal balance. The experimental results provide important experimental references and are important to optimize the design and the performance of coaxial DBD reactor.

Spatial orientation and electric-field-driven transport of hypericin inside of bilayer lipid membranes.

PubMed

Strejčková, Alena; Staničová, Jana; Jancura, Daniel; Miškovský, Pavol; Bánó, Gregor

2013-02-07

Fluorescence experiments were carried out to investigate the interaction of hypericin (Hyp), a natural hydrophobic photosensitizer, with artificial bilayer lipid membranes. The spatial orientation of Hyp monomers incorporated in diphytanoyl phosphatidylcholine (DPhPC) membranes was determined by measuring the dependence of the Hyp fluorescence intensity on the angle of incidence of p- and s-polarized excitation laser beams. Inside of the membrane, Hyp monomers are preferentially located in the layers near the membrane/water interface and are oriented with the S(1) ← S(0) transition dipole moments perpendicular to the membrane surface. Transport of Hyp anions between the two opposite sides of the lipid bilayer was induced by applying rectangular electric field pulses to the membrane. The characteristic time for Hyp transport through the membrane center was evaluated by the analysis of the Hyp fluorescence signal during the voltage pulses. In the zero-voltage limit, the transport time approached 70 ms and gradually decreased with higher voltage applied to the membrane. In addition, our measurements indicated an apparent pK(a) constant of 8 for Hyp deprotonation in the membrane.

New design of a passive type RADFET reader for enhanced sensitivity

NASA Astrophysics Data System (ADS)

Lee, Dae-Hee

2016-07-01

We present a new design of a passive type RADFET reader with enhanced radiation sensitivity. Using a electostatic plate, we have applied a static electric field to the gate voltage, which impacts a positive biasing on the p-type MOSFET. The resultant effect shows that 1.8 times of radiation sensitivity increased when we measured the threshold voltage shift of the RADFET exposed to 30 krad irradiation. We discuss further about the characteristic changes of a RADFET according to the positive biasing on the gate voltage.

Results of an electrical power system fault study

NASA Technical Reports Server (NTRS)

Dugal-Whitehead, Norma R.; Johnson, Yvette B.

1992-01-01

NASA-Marshall conducted a study of electrical power system faults with a view to the development of AI control systems for a spacecraft power system breadboard. The results of this study have been applied to a multichannel high voltage dc spacecraft power system, the Large Autonomous Spacecraft Electrical Power System (LASEPS) breadboard. Some of the faults encountered in testing LASEPS included the shorting of a bus an a falloff in battery cell capacity.

Bias voltage induced resistance switching effect in single-molecule magnets' tunneling junction.

PubMed

Zhang, Zhengzhong; Jiang, Liang

2014-09-12

An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be 'read out' by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

Quadratic Electro-optic Effect in a Novel Nonconjugated Conductive Polymer, iodine-doped Polynorbornene

NASA Astrophysics Data System (ADS)

Narayanan, Ananthakrishnan; Thakur, Mrinal

2009-03-01

Quadratic electro-optic effect in a novel nonconjugated conductive polymer, iodine-doped polynorbornene has been measured using field-induced birefringence at 633 nm. The electrical conductivity^1 of polynorbornene increases by twelve orders of magnitude to about 0.01 S/cm upon doping with iodine. The electro-optic measurement has been made in a film doped at the medium doping-level. The electro-optic modulation signal was recorded using a lock-in amplifier for various applied ac voltages (4 kHz) and the quadratic dependence of the modulation on the applied voltage was observed. A modulation of about 0.01% was observed for an applied electric field of 3 V/micron for a 100 nm thick film The Kerr coefficient as determined is about 1.77x10-11m/V^2. This exceptionally large quadratic electro-optic effect has been attributed to the confinement of this charge-transfer system within a sub-nanometer dimension. 1. A. Narayanan, A. Palthi and M. Thakur, J. Macromol. Sci. -- PAC, accepted.

Low voltage electrophoresis chip with multi-segments synchronized scanning

NASA Astrophysics Data System (ADS)

Gu, Wenwen; Wen, Zhiyu; Xu, Yi

2017-03-01

For low voltage electrophoresis chip, there is always a problem that the samples are truncated and peaks are broadened, as well as longer time for separation. In this paper, a low voltage electrophoresis separation model was established, and the separation conditions were discussed. A new driving mode was proposed for applying low voltage, which was called multi-segments synchronized scanning. By using this driving mode, the reversed electric field that existed between the multi-segments can enrich samples and shorten the sample zone. The low voltage electrophoresis experiments using multi-segments synchronized scanning were carried out by home-made silicon-PDMS-based chip. The fluorescein isothiocyanate (FITC) labeled lysine and phenylalanine mixed samples with the concentration of 10-4 mol/L were successfully separated under the optimal conditions of 10 mmol/L borax buffer (pH = 10.0), 200 V/cm separation electric field and electrode switch time of 2.5 s. The separation was completed with a resolution of 2.0, and the peak time for lysine and phenylalanine was 4 min and 6 min, respectively.

Higher success rate with transcranial electrical stimulation of motor-evoked potentials using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery.

PubMed

Shigematsu, Hideki; Kawaguchi, Masahiko; Hayashi, Hironobu; Takatani, Tsunenori; Iwata, Eiichiro; Tanaka, Masato; Okuda, Akinori; Morimoto, Yasuhiko; Masuda, Keisuke; Tanaka, Yuu; Tanaka, Yasuhito

2017-10-01

During spine surgery, the spinal cord is electrophysiologically monitored via transcranial electrical stimulation of motor-evoked potentials (TES-MEPs) to prevent injury. Transcranial electrical stimulation of motor-evoked potential involves the use of either constant-current or constant-voltage stimulation; however, there are few comparative data available regarding their ability to adequately elicit compound motor action potentials. We hypothesized that the success rates of TES-MEP recordings would be similar between constant-current and constant-voltage stimulations in patients undergoing spine surgery. The objective of this study was to compare the success rates of TES-MEP recordings between constant-current and constant-voltage stimulation. This is a prospective, within-subject study. Data from 100 patients undergoing spinal surgery at the cervical, thoracic, or lumbar level were analyzed. The success rates of the TES-MEP recordings from each muscle were examined. Transcranial electrical stimulation with constant-current and constant-voltage stimulations at the C3 and C4 electrode positions (international "10-20" system) was applied to each patient. Compound muscle action potentials were bilaterally recorded from the abductor pollicis brevis (APB), deltoid (Del), abductor hallucis (AH), tibialis anterior (TA), gastrocnemius (GC), and quadriceps (Quad) muscles. The success rates of the TES-MEP recordings from the right Del, right APB, bilateral Quad, right TA, right GC, and bilateral AH muscles were significantly higher using constant-voltage stimulation than those using constant-current stimulation. The overall success rates with constant-voltage and constant-current stimulations were 86.3% and 68.8%, respectively (risk ratio 1.25 [95% confidence interval: 1.20-1.31]). The success rates of TES-MEP recordings were higher using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery. Copyright © 2017 Elsevier Inc. All rights reserved.

Driving Method for Compensating Reliability Problem of Hydrogenated Amorphous Silicon Thin Film Transistors and Image Sticking Phenomenon in Active Matrix Organic Light-Emitting Diode Displays

NASA Astrophysics Data System (ADS)

Shin, Min-Seok; Jo, Yun-Rae; Kwon, Oh-Kyong

2011-03-01

In this paper, we propose a driving method for compensating the electrical instability of hydrogenated amorphous silicon (a-Si:H) thin film transistors (TFTs) and the luminance degradation of organic light-emitting diode (OLED) devices for large active matrix OLED (AMOLED) displays. The proposed driving method senses the electrical characteristics of a-Si:H TFTs and OLEDs using current integrators and compensates them by an external compensation method. Threshold voltage shift is controlled a using negative bias voltage. After applying the proposed driving method, the measured error of the maximum emission current ranges from -1.23 to +1.59 least significant bit (LSB) of a 10-bit gray scale under the threshold voltage shift ranging from -0.16 to 0.17 V.

Effect of Electric Field in the Stabilized Premixed Flame on Combustion Process Emissions

NASA Astrophysics Data System (ADS)

Otto, Krickis

2017-10-01

The effect of the AC and DC electrical field on combustion processes has been investigated by various researchers. The results of these experiments do not always correlate, due to different experiment conditions and experiment equipment variations. The observed effects of the electrical field impact on the combustion process depends on the applied voltage polarity, flame speed and combustion physics. During the experiment was defined that starting from 1000 V the ionic wind takes the effect on emissions in flue gases, flame shape and combustion instabilities. Simulation combustion process in hermetically sealed chamber with excess oxygen amount 3 % in flue gases showed that the positive effect of electrical field on emissions lies in region from 30 to 400 V. In aforementioned voltage range carbon monoxide emissions were reduced by 6 % and at the same time the nitrogen oxide emissions were increased by 3.5 %.

High voltage design structure for high temperature superconducting device

DOEpatents

Tekletsadik, Kasegn D [Rexford, NY

2008-05-20

In accordance with the present invention, modular corona shields are employed in a HTS device to reduce the electric field surrounding the HTS device. In a exemplary embodiment a fault current limiter module in the insulation region of a cryogenic cooling system has at least one fault current limiter set which employs a first corona shield disposed along the top portion of the fault current limiter set and is electrically coupled to the fault current limiter set. A second corona shield is disposed along the bottom portion of the fault current limiter set and is electrically coupled to the fault current limiter set. An insulation barrier is disposed within the insulation region along at least one side of the fault current limiter set. The first corona shield and the second corona shield act together to reduce the electric field surrounding the fault limiter set when voltage is applied to the fault limiter set.

A Dielectric Rod Antenna for Picosecond Pulse Stimulation of Neurological Tissue

PubMed Central

Petrella, Ross A.; Schoenbach, Karl H.; Xiao, Shu

2016-01-01

A dielectrically loaded wideband rod antenna has been studied as a pulse delivery system to subcutaneous tissues. Simulation results applying 100 ps electrical pulse show that it allows us to generate critical electric field for biological effects, such as brain stimulation, in the range of several centimeters. In order to reach the critical electric field for biological effects, which is approximately 20 kV/cm, at a depth of 2 cm, the input voltage needs to be 175 kV. The electric field spot size in the brain at this position is approximately 1 cm2. Experimental studies in free space with a conical antenna (part of the antenna system) with aluminum nitride as the dielectric have confirmed the accuracy of the simulation. These results set the foundation for high voltage in situ experiments on the complete antenna system and the delivery of pulses to biological tissue. PMID:27563160

Dynamics modeling and vibration analysis of a piezoelectric diaphragm applied in valveless micropump

NASA Astrophysics Data System (ADS)

He, Xiuhua; Xu, Wei; Lin, Nan; Uzoejinwa, B. B.; Deng, Zhidan

2017-09-01

This paper presents the dynamical model involved with load of fluid pressure, electric-solid coupling simulation and experimental performance of the piezoelectric diaphragm fabricated and applied in valveless micropump. The model is based on the theory of plate-shell with small deflection, considering the two-layer structure of piezoelectric ceramic and elastic substrate. The high-order non-homogeneous vibration equation of the piezoelectric diaphragm, derived in the course of the study, was solved by being divided into a homogeneous Bessel equation and a non-homogeneous static equation according to the superposition principle. The amplitude of the piezoelectric diaphragm driven by sinusoidal voltage against the load of fluid pressure was obtained from the solution of the vibration equation. Also, finite element simulation of electric-solid coupling between displacement of piezoelectric diaphragm due to an applied voltage and resulting deformation of membrane was considered. The simulation result showed that the maximum deflection of diaphragm is 9.51 μm at a quarter cycle time when applied a peak-to-peak voltage of 150VP-P with a frequency of 90 Hz, and the displacement distribution according to the direction of the radius was demonstrated. Experiments were performed to verify the prediction of the dynamic modeling and the coupling simulation, the experimental data showed a good agreement with the dynamical model and simulation.

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions

PubMed Central

Freites, J. Alfredo; Tobias, Douglas J.

2015-01-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na+, K+, Ca2+, and H+ selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1–S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here. PMID:25972106

Zoom system without moving element by using two liquid crystal lenses with spherical electrode

NASA Astrophysics Data System (ADS)

Yang, Ren-Kai; Lin, Chia-Ping; Su, Guo-Dung J.

2017-08-01

A traditional zoom system is composed of several elements moving relatively toward other components to achieve zooming. Unlike tradition system, an electrically control zoom system with liquid crystal (LC) lenses is demonstrated in this paper. To achieve zooming, we apply two LC lenses whose optical power is controlled by voltage to replace two moving lenses in traditional zoom system. The mechanism of zoom system is to use two LC lenses to form a simple zoom system. We found that with such spherical electrodes, we could operate LC lens at voltage range from 31V to 53 V for 3X tunability in optical power. For each LC lens, we use concave spherical electrode which provide lower operating voltage and great tunability in optical power, respectively. For such operating voltage and compact size, this zoom system with zoom ratio approximate 3:1 could be applied to mobile phone, camera and other applications.

Aligned Carbon Nanotube Tape for Sensor Applications

NASA Technical Reports Server (NTRS)

Tucker, Dennis S.

2013-01-01

For this effort, will concentrate on three applications: Vibration Gyroscope utilizes piezoelectric properties of the tape and Coriolis effect Accelerometer utilizes the piezoresistive property Strain Gauge utilizes piezoresistive property Accelerometer and Strain Gauge can also utilize piezoelectric effect Test piezoelectric properties using facilities at the Microfabrication Laboratory (AMRDEC) . Enhance piezoelectric effect using polyvinylidine fluoride and P(VDF ]TrFE) which is readily polarizable .Spray matrix solution while winding fiber; Sandwich of CNT tape and PVDF film (DOE .Two Level) . Construct and test prototype vibration gyroscope . Construct and test prototype accelerometer using cantilever design . Test strain sensitivity of CNT tape against industrial strain gauge . Embed CNT tape in composite samples as well as on surface and test to failure (4 ]point bend) A piezoelectric device exhibits an electrical response from a mechanical applied stress. . A piezoelectric device has both capacitance and resistance properties in which by applying an electric field from a waveform will exert a mechanical stress that can be monitored for a response. . The typical waveform applied is a sinusoidal waveform of a defined voltage for a defined period. The defined voltage is driven from 0 volts to the positive defined volts then back to 0 and driven to negative defined volts then back to 0. . Example. Vmax set to 10V and period set to 10 ms. . Voltage will start at zero, go to 10 volts, return to zero, go to ]10 volts and return to zero during 10 ms. . Applying this electrical field to a DUT, the capacitance response and resistance response can be observed. CNT tape is easier to manufacture and cheaper than micromachining silicon or other ceramic piezoelectric used in gyroscopes and accelerometers CNT tape properties can be modified during manufacture for specific application CNT tape has enhanced mechanical and thermal properties in addition to unique electrical properties CNT tape as a strain gauge in Structural Health Monitoring will provide an excellent material to embed within composite structures

The effects of cathodic micro-voltage combined with hydrothermal pretreatment on methane fermentation of lignocellulose substrate

NASA Astrophysics Data System (ADS)

Liu, Dianxin; Ning, Ping; Qu, Guangfei; Huang, Xi; Liu, Yuhuan; Zhang, Jian

2017-05-01

The methane fermentation study assisted with cathodic micro-voltage was carried out to investigate the electric field effects on the fermentation of hydrothermally pretreated lignocellulose substrate. It was illustrated that a 0.25V cathode voltage and hydrothermal pretreatment could improve the biogas production, biogas quality and lignocellulose degradation ratio significantly. The cumulative biogas productions in the fermentation of hydrothermally pretreated cow dungs at 50°C, 150°C and 200°C with a 0.25V cathode voltage were observed in a total of 6640mL, 9218mL and 9456mL respectively over a detention time of 33 days. In comparison with the fermentation pretreated at 200°C without any voltage, nearly doubled of cumulative biogas production was obtained in the process of cathode-assisted fermentation. It was also observed that the daily methane content greater than or equal to 70% in the biogas generated with cathode voltage were clearly greater than that without voltages. Furthermore, the fermentation applied with a 0.25V cathode voltage had resulted into significant increases of 12.64% and 9.44% in lignin and cellulose degradation ratio relative to voltage free fermentation. And in the process of fermentation applied with cathode voltage, the final lignocellulose degradation ratio increased with the hydrothermal pretreatment temperature. Thus, the hydrothermal pretreatment and assisting fermentation with low cathode voltage can effectively promote the lignocellulose degradation. All results revealed that cathodic micro-voltage combined with hydrothermal pretreatment can remarkably improve the fermentation of lignocellulosic materials, indicating that a more effective fermentation technology can be developed by applying with cathodic micro-voltage.

Circuits Protect Against Incorrect Power Connections

NASA Technical Reports Server (NTRS)

Delombard, Richard

1992-01-01

Simple circuits prevent application of incorrectly polarized or excessive voltages. Connected temporarily or permanently at power-connecting terminals. Devised to protect electrical and electronic equipment installed in spacecraft and subjected to variety of tests in different facilities prior to installation. Basic concept of protective circuits also applied easily to many kinds of electrical and electronic equipment that must be protected against incorrect power connections.

Ion manipulation method and device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Gordon A.; Baker, Erin M.; Smith, Richard D.

2017-11-07

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electricmore » field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area.« less

Ion manipulation device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Gordon A.; Baker, Erin M.; Smith, Richard D.

2018-05-08

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electricmore » field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area.« less

Secondary ion collection and transport system for ion microprobe

DOEpatents

Ward, James W.; Schlanger, Herbert; McNulty, Jr., Hugh; Parker, Norman W.

1985-01-01

A secondary ion collection and transport system, for use with an ion microprobe, which is very compact and occupies only a small working distance, thereby enabling the primary ion beam to have a short focal length and high resolution. Ions sputtered from the target surface by the primary beam's impact are collected between two arcuate members having radii of curvature and applied voltages that cause only ions within a specified energy band to be collected. The collected ions are accelerated and focused in a transport section consisting of a plurality of spaced conductive members which are coaxial with and distributed along the desired ion path. Relatively high voltages are applied to alternate transport sections to produce accelerating electric fields sufficient to transport the ions through the section to an ion mass analyzer, while lower voltages are applied to the other transport sections to focus the ions and bring their velocity to a level compatible with the analyzing apparatus.

High Efficient THz Emission From Unbiased and Biased Semiconductor Nanowires Fabricated Using Electron Beam Lithography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balci, Soner; Czaplewski, David A.; Jung, Il Woong

Besides having perfect control on structural features, such as vertical alignment and uniform distribution by fabricating the wires via e-beam lithography and etching process, we also investigated the THz emission from these fabricated nanowires when they are applied DC bias voltage. To be able to apply a voltage bias, an interdigitated gold (Au) electrode was patterned on the high-quality InGaAs epilayer grown on InP substrate bymolecular beam epitaxy. Afterwards, perfect vertically aligned and uniformly distributed nanowires were fabricated in between the electrodes of this interdigitated pattern so that we could apply voltage bias to improve the THz emission. As amore » result, we achieved enhancement in the emitted THz radiation by ~four times, about 12 dB increase in power ratio at 0.25 THz with a DC biased electric field compared with unbiased NWs.« less

Characterization of Unimorph-Membrane Microactuators and Error-Analysis of the Characterization Process

NASA Technical Reports Server (NTRS)

Wright, Matthew W.

2005-01-01

Microactuators are versatile, low-cost, low-mass electrical-mechanical devices that can be used in many applications. Microactuators consist of two electrodes sandwiching a PZT (piezo-electric) film between them. The centers of the microactuators deflect when a voltage is applied across the electrodes. In order to correctly apply this technology for use, it is important to fully characterize the actuation behavior. Measuring the deflection profile as a function of the voltage of various microactuators is crucial. This measurement process has errors associated with it, so it is being studied to determine the accuracy of the data. In certain applications, microactuators may undergo many cycles of deflection; testing various microactuators through many cycles of deflection simulates these circumstances. However, due to an unknown issue, many of the microactuators exhibit defects that cause them to fail when voltage is applied to their electrodes. These defects do not allow for the acquisition of significant deflection profiles. Vibrations are the largest cause of error in deflection measurements, and the microactuators withstand continuous cycles of deflection, yet the cause of damage is still to be determined. Future projects will be needed to characterize the deflection profiles of various microactuators and to overcome the defects in the microactuators that are currently present.

Negative differential electrolyte resistance in a solid-state nanopore resulting from electroosmotic flow bistability.

PubMed

Luo, Long; Holden, Deric A; White, Henry S

2014-03-25

A solid-state nanopore separating two aqueous solutions containing different concentrations of KCl is demonstrated to exhibit negative differential resistance (NDR) when a constant pressure is applied across the nanopore. NDR refers to a decrease in electrical current when the voltage applied across the nanopore is increased. NDR results from the interdependence of solution flow (electroosmotic and pressure-engendered) with the distributions of K+ and Cl- within the nanopore. A switch from a high-conductivity state to a low-conductivity state occurs over a very narrow voltage window (<2 mV) that depends on the nanopore geometry, electrolyte concentration, and nanopore surface charge density. Finite element simulations based on a simultaneous solution of the Navier-Stokes, Poisson, and Nernst-Planck equations demonstrate that NDR results from a positive feedback mechanism between the ion distributions and electroosmotic flow, yielding a true bistability in fluid flow and electrical current at a critical applied voltage, i.e., the NDR "switching potential". Solution pH and Ca2+ were separately employed as chemical stimuli to investigate the dependence of the NDR on the surface charge density. The NDR switching potential is remarkably sensitive to the surface charge density, and thus to pH and the presence of Ca2+, suggesting possible applications in chemical sensing.

Application of constant current, low voltage electrical stimulation systems to pig carcasses and its effects on pork quality.

PubMed

Channon, H A; Walker, P J; Kerr, M G; Baud, S R

2003-12-01

This study examined the effectiveness of a constant current, low voltage electrical stimulation system on improving pork quality when applied to pigs at 2 min post-exsanguination. A total of 48 female Duroc×Large White/Landrace pigs of 85-90 kg liveweight were randomly allocated immediately prior to slaughter to one of four constant current electrical stimulation treatments: control (no electrical stimulation), 50, 200 and 400 mA. Stimulation was applied to pig carcasses at 2 min post-exsanguination for 30 s. No differences (P>0.05) in WB shear force values, muscle lightness or PSE incidence of pork M. longissimus lumborum (LL) was found due to electrical stimulation treatment. Muscle pH of the LL muscle was lower (P<0.001) in carcasses in the 200 and 400 mA treatments compared to those from carcasses in both the 50 mA and control treatment groups, when measured at the various time points from 40 min to 8 h post-slaughter. Although carcasses stimulated with 200 and 400 mA had higher percentage drip loss (P<0.05) and purge (P<0.001), this was not found to impact WB shear force values, muscle lightness or PSE incidence.

Continuous-flow multi-pulse electroporation at low DC voltages by microfluidic flipping of the voltage space topology

NASA Astrophysics Data System (ADS)

Bhattacharjee, N.; Horowitz, L. F.; Folch, A.

2016-10-01

Concerns over biosafety, cost, and carrying capacity of viral vectors have accelerated research into physical techniques for gene delivery such as electroporation and mechanoporation. Advances in microfabrication have made it possible to create high electric fields over microscales, resulting in more efficient DNA delivery and higher cell viability. Continuous-flow microfluidic methods are typically more suitable for cellular therapies where a large number of cells need to be transfected under sterile conditions. However, the existing continuous-flow designs used to generate multiple pulses either require expensive peripherals such as high-voltage (>400 V) sources or function generators, or result in reduced cell viability due to the proximity of the cells to the electrodes. In this paper, we report a continuous-flow microfluidic device whose channel geometry reduces instrumentation demands and minimizes cellular toxicity. Our design can generate multiple pulses of high DC electric field strength using significantly lower voltages (15-60 V) than previous designs. The cells flow along a serpentine channel that repeatedly flips the cells between a cathode and an anode at high throughput. The cells must flow through a constriction each time they pass from an anode to a cathode, exposing them to high electric field strength for short durations of time (the "pulse-width"). A conductive biocompatible poly-aniline hydrogel network formed in situ is used to apply the DC voltage without bringing the metal electrodes close to the cells, further sheltering cells from the already low voltage electrodes. The device was used to electroporate multiple cell lines using electric field strengths between 700 and 800 V/cm with transfection efficiencies superior than previous flow-through designs.

Continuous-flow multi-pulse electroporation at low DC voltages by microfluidic flipping of the voltage space topology.

PubMed

Bhattacharjee, N; Horowitz, L F; Folch, A

2016-10-17

Concerns over biosafety, cost, and carrying capacity of viral vectors have accelerated research into physical techniques for gene delivery such as electroporation and mechanoporation. Advances in microfabrication have made it possible to create high electric fields over microscales, resulting in more efficient DNA delivery and higher cell viability. Continuous-flow microfluidic methods are typically more suitable for cellular therapies where a large number of cells need to be transfected under sterile conditions. However, the existing continuous-flow designs used to generate multiple pulses either require expensive peripherals such as high-voltage (>400 V) sources or function generators, or result in reduced cell viability due to the proximity of the cells to the electrodes. In this paper, we report a continuous-flow microfluidic device whose channel geometry reduces instrumentation demands and minimizes cellular toxicity. Our design can generate multiple pulses of high DC electric field strength using significantly lower voltages (15-60 V) than previous designs. The cells flow along a serpentine channel that repeatedly flips the cells between a cathode and an anode at high throughput. The cells must flow through a constriction each time they pass from an anode to a cathode, exposing them to high electric field strength for short durations of time (the "pulse-width"). A conductive biocompatible poly-aniline hydrogel network formed in situ is used to apply the DC voltage without bringing the metal electrodes close to the cells, further sheltering cells from the already low voltage electrodes. The device was used to electroporate multiple cell lines using electric field strengths between 700 and 800 V/cm with transfection efficiencies superior than previous flow-through designs.

Electric field effects on current–voltage relationships in microfluidic channels presenting multiple working electrodes in the weak-coupling limit

DOE PAGES

Contento, Nicholas M.; Bohn, Paul W.

2014-05-23

While electrochemical methods are well suited for lab-on-a-chip applications, reliably coupling multiple, electrode-controlled processes in a single microfluidic channel remains a considerable challenge, because the electric fields driving electrokinetic flow make it difficult to establish a precisely known potential at the working electrode(s). The challenge of coupling electrochemical detection with microchip electrophoresis is well known; however, the problem is general, arising in other multielectrode arrangements with applications in enhanced detection and chemical processing. Here, we study the effects of induced electric fields on voltammetric behavior in a microchannel containing multiple in-channel electrodes, using a Fe(CN) 6 3/4- model system. Whenmore » an electric field is induced by applying a cathodic potential at one inchannel electrode, the half-wave potential (E 1/2) for the oxidation of ferrocyanide at an adjacent electrode shifts to more negative potentials. The E 1/2 value depends linearly on the electric field current at a separate in-channel electrode. The observed shift in E 1/2 is quantitatively described by a model, which accounts for the change in solution potential caused by the iR drop along the length of the microchannel. The model, which reliably captures changes in electrode location and solution conductivity, apportions the electric field potential between iR drop and electrochemical potential components, enabling the study of microchannel electric field magnitudes at low applied potentials. In the system studied, the iR component of the electric field potential increases exponentially with applied current before reaching an asymptotic value near 80 % of the total applied potential. The methods described will aid in the development and interpretation of future microchip electrochemistry methods, particularly those that benefit from the coupling of electrokinetic and electrochemical phenomena at low voltages.« less

Inverted Fuel Cell: Room-Temperature Hydrogen Separation from an Exhaust Gas by Using a Commercial Short-Circuited PEM Fuel Cell without Applying any Electrical Voltage.

PubMed

Friebe, Sebastian; Geppert, Benjamin; Caro, Jürgen

2015-06-26

A short-circuited PEM fuel cell with a Nafion membrane has been evaluated in the room-temperature separation of hydrogen from exhaust gas streams. The separated hydrogen can be recovered or consumed in an in situ olefin hydrogenation when the fuel cell is operated as catalytic membrane reactor. Without applying an outer electrical voltage, there is a continuous hydrogen flux from the higher to the lower hydrogen partial pressure side through the Nafion membrane. On the feed side of the Nafion membrane, hydrogen is catalytically split into protons and electrons by the Pt/C electrocatalyst. The protons diffuse through the Nafion membrane, the electrons follow the short-circuit between the two brass current collectors. On the cathode side, protons and electrons recombine, and hydrogen is released. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrical response of liquid crystal cells doped with multi-walled carbon nanotubes.

PubMed

García-García, Amanda; Vergaz, Ricardo; Algorri, José Francisco; Quintana, Xabier; Otón, José Manuel

2015-01-01

The inclusion of nanoparticles modifies a number of fundamental properties of many materials. Doping of nanoparticles in self-organized materials such as liquid crystals may be of interest for the reciprocal interaction between the matrix and the nanoparticles. Elongated nanoparticles and nanotubes can be aligned and reoriented by the liquid crystal, inducing noticeable changes in their optical and electrical properties. In this work, cells of liquid crystal doped with high aspect ratio multi-walled carbon nanotubes have been prepared, and their characteristic impedance has been studied at different frequencies and excitation voltages. The results demonstrate alterations in the anisotropic conductivity of the samples with the applied electric field, which can be followed by monitoring the impedance evolution with the excitation voltage. Results are consistent with a possible electric contact between the coated substrates of the LC cell caused by the reorientation of the nanotubes. The reversibility of the doped system upon removal of the electric field is quite low.

Electrical conduction hysteresis in carbon black-filled butyl rubber compounds

NASA Astrophysics Data System (ADS)

Alzamil, M. A.; Alfaramawi, K.; Abboudy, S.; Abulnasr, L.

2018-04-01

Temperature and concentration dependence of electrical resistance of butyl rubber filled with GPF carbon black was carried out. Current-voltage (I-V) characteristics at room-temperature were also investigated. The I-V characteristics show that the behavior is linear at small voltages up to approximately 0.15 V and currents up to 0.05 mA indicating that the conduction mechanism was probably due to electron tunneling from the end of conductive path to the other one under the action of the applied electric field. At higher voltages, a nonlinear behavior was noticed. The nonlinearity was attributed to the joule heating effects. Electrical resistance of the butyl/GPF composites was measured as a function of temperature during heating and cooling cycles from 300 K and upward to a specific temperature. When the specimens were heated up, the resistance was observed to increase continuously with the rise of temperature. However, when the samples were cooled down, the resistance was observed to decrease following a different path. The presence of conduction hysteresis behavior in the resistance-temperature curves during the heating and cooling cycles was then verified. The electrical conduction of the composite system is supposed to follow an activation conduction mechanism. Activation energy was calculated at different filler concentrations for both the heating and cooling processes.

Study on the streamer inception characteristics under positive lightning impulse voltage

NASA Astrophysics Data System (ADS)

Wang, Zezhong; Geng, Yinan

2017-11-01

The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

Gas separation device based on electrical swing adsorption

DOEpatents

Judkins, Roddie R.; Burchell, Timothy D.

1999-10-26

A method and apparatus for separating one constituent, especially carbon dioxide, from a fluid mixture, such as natural gas. The fluid mixture flows through an adsorbent member having an affinity for molecules of the one constituent, the molecules being adsorbed on the adsorbent member. A voltage is applied to the adsorbent member, the voltage imparting a current flow which causes the molecules of the one constituent to be desorbed from the adsorbent member.

TIME CALIBRATED OSCILLOSCOPE SWEEP

DOEpatents

Owren, H.M.; Johnson, B.M.; Smith, V.L.

1958-04-22

The time calibrator of an electric signal displayed on an oscilloscope is described. In contrast to the conventional technique of using time-calibrated divisions on the face of the oscilloscope, this invention provides means for directly superimposing equal time spaced markers upon a signal displayed upon an oscilloscope. More explicitly, the present invention includes generally a generator for developing a linear saw-tooth voltage and a circuit for combining a high-frequency sinusoidal voltage of a suitable amplitude and frequency with the saw-tooth voltage to produce a resultant sweep deflection voltage having a wave shape which is substantially linear with respect to time between equal time spaced incremental plateau regions occurring once each cycle of the sinusoidal voltage. The foregoing sweep voltage when applied to the horizontal deflection plates in combination with a signal to be observed applied to the vertical deflection plates of a cathode ray oscilloscope produces an image on the viewing screen which is essentially a display of the signal to be observed with respect to time. Intensified spots, or certain other conspicuous indications corresponding to the equal time spaced plateau regions of said sweep voltage, appear superimposed upon said displayed signal, which indications are therefore suitable for direct time calibration purposes.

Experimental study on the responsivity enhancement of Mn1.56Co0.96Ni0.48O4 detector under moderate bias field

NASA Astrophysics Data System (ADS)

Zhou, Wei; Hou, Yun; Gao, Yan Qing; Zhang, Leibo; Huang, Zhi Ming

2011-08-01

As a typical thermal sensitive material, Mn1.56Co0.96Ni0.48O4 (MCN) has achieved widely applications in uncooled bolometer. In this paper, we report that a large increase in electrical conductivity of MCN is obtained with moderate electric-field strengths (E~103V/cm) applied at room temperature (about 300K). Great enhancement in the responsivity is observed when operating with a proper electric bias field, which corresponds to a threshold voltage VTh. MCN bulk materials are prepared by using the sintering method. Micro MCN detector is fabricated by scribing the bulk material into pieces sized 200×100×10μm. The detector is clinged to an Al2O3 substrate with some electrical insulated epoxy glue which is mounted onto a Cu sink. The surrounding temperature is controlled precisely by a temperature controller with a precision of 1mK. Voltage-current characteristics at 270-330K are carefully examined. Different sweeping speeds of the bias-voltage are applied in different orders so as to find out a proper scanning rate, in which the electrical measurement is proceeded in a state of quasi-thermal equilibrium. According to quasi-thermal equilibrium and the time dependent nominal D.C. power, the temperature increase during the measurement is estimated. The conduction mechanism can be well explained with small polaron theory. Empirical equations are used to describe the thermal dynamic process in the pulsed mode, and the process is also simply simulated via numerical calculations. The experimental results and simulation works will be of some referential value to future studies in uncooled microbolometer made in transition metal oxides.

Influence of gas flow and applied voltage on interaction of jets in a cross-field helium plasma jet array

NASA Astrophysics Data System (ADS)

Wan, Meng; Liu, Feng; Fang, Zhi; Zhang, Bo; Wan, Hui

2017-09-01

Atmospheric Pressure Plasma Jet arrays can greatly enhance the treatment area to fulfill the need for large-scale surface processing, while the spatial uniformity of the plasma jet array is closely related to the interactions of the adjacent jets. In this paper, a three-tube one-dimensional (1D) He plasma jet array with a cross-field needle-ring electrode structure is used to investigate the influences of the gas flow rate and applied voltage on the interactions of the adjacent jets through electrical, optical, and fluid measurements. The repulsion of the adjacent plume channels is observed using an intensified charge-coupled device (ICCD) and the influence of the gas flow rate and applied voltage on the electrostatic repulsion force, Coulomb force, is discussed. It is found that electrical coupling, mainly electrostatic repulsion force, exists among the jets in the array, which causes both the divergence of the lateral plumes and the nonlinear changes of the discharge power and the transport charge. The deflection angle of the lateral plumes with respect to the central plume in the optical images increases with the increase of applied voltage and decreases with the increase of gas flow rate. The deflection angle of the lateral plumes in the optical images is obviously larger than that of the lateral gas streams in the Schlieren images under the same experimental conditions, and the unconformity of the deflection angles is mainly attributed to the electrostatic repulsion force in adjacent plasma plume channels. The experimental results can help understand the interaction mechanisms of jets in the array and design controllable and scalable plasma jet arrays.

Baseline tests of the EVA change-of-pace coupe electric passenger vehicle

NASA Technical Reports Server (NTRS)

Bozek, J. M.; Maslowski, E. A.; Dustin, M. O.

1977-01-01

The EVA Change-of-Pace Coupe, is an electric passenger vehicle, to characterize the state-of-the-art of electric vehicles. The EVA Change-of-Pace Coupe is a four passenger sedan that has been coverted to an electric vehicle. It is powered by twenty 6 volt traction batteries through a silicon controlled rectifier chopper controller actuated by a foot throttle to change the voltage applied to the series wound, direct current motor. Braking is accomplished with a vacuum assist hydraulic braking system. Regenerative braking is also provided.

Optical and Electric Multifunctional CMOS Image Sensors for On-Chip Biosensing Applications.

PubMed

Tokuda, Takashi; Noda, Toshihiko; Sasagawa, Kiyotaka; Ohta, Jun

2010-12-29

In this review, the concept, design, performance, and a functional demonstration of multifunctional complementary metal-oxide-semiconductor (CMOS) image sensors dedicated to on-chip biosensing applications are described. We developed a sensor architecture that allows flexible configuration of a sensing pixel array consisting of optical and electric sensing pixels, and designed multifunctional CMOS image sensors that can sense light intensity and electric potential or apply a voltage to an on-chip measurement target. We describe the sensors' architecture on the basis of the type of electric measurement or imaging functionalities.

Wind Generators

NASA Technical Reports Server (NTRS)

1989-01-01

When Enerpro, Inc. president, Frank J. Bourbeau, attempted to file a patent on a system for synchronizing a wind generator to the electric utility grid, he discovered Marshall Space Flight Center's Frank Nola's power factor controller. Bourbeau advanced the technology and received a NASA license and a patent for his Auto Synchronous Controller (ASC). The ASC reduces generator "inrush current," which occurs when large generators are abruptly brought on line. It controls voltage so the generator is smoothly connected to the utility grid when it reaches its synchronous speed, protecting the components from inrush current damage. Generator efficiency is also increased in light winds by applying lower than rated voltage. Wind energy is utilized to drive turbines to generate electricity for utility companies.

Study on the influence of applied voltage and feed concentration on the performance of electrodeionization in nickel recovery from electroplating wastewater

NASA Astrophysics Data System (ADS)

Wardani, Anita K.; Hakim, Ahmad N.; Khoiruddin, Destifen, Welsen; Goenawan, Albertus; Wenten, I. G.

2017-01-01

Wastewaters from electroplating industries are usually contaminated with nickel up to 1000 mg/L. According to environmental regulations worldwide, nickel concentration on wastewaters must be controlled to an acceptable level before being discharged to the environment. This paper offers an alternative way to develop an efficient effluent-free technology to reduce the nickel content of rinse water so that the treated water could be recycled for rinsing and subsequently to workout methodology to recover nickel by electrodeionization (EDI). Electrical voltage and initial nickel concentration were varied to study the effect of the parameters. Results showed that EDI could remove nickel effectively which gives an outstanding result in terms of product quality. Nickel concentration on diluate chamber decreased up to 99% after 60 and 180 minutes for nickel concentration of 300 and 1000 mg/L, respectively. Meanwhile, the increase of electrical voltage led to faster nickel removal.

Adaptive microlens array based on electrically charged polyvinyl chloride/dibutyl phthalate gel

NASA Astrophysics Data System (ADS)

Xu, Miao; Ren, Hongwen

2016-09-01

We prepared an adaptive microlens array (MLA) using a polyvinyl chloride/dibutyl phthalate gel and an indium-tin-oxide (ITO) glass substrate. The gel forms a membrane on the glass substrate and the ITO electrode has a ring array pattern. When the membrane is electrically charged by a DC voltage, the surface of the membrane above each circular electrode in the ring array can be deformed with a convex shape. As a result, the membrane functions as an MLA. By applying a voltage from 20 to ˜65 V to the electrode, the focal length of each microlens can be tuned from 300 to ˜160 μm. The dynamic response time can by reduced largely by changing the polarity of the DC voltage. Due to the advantages of optical isotropy, compact structure, and good stability, our MLA has potential applications in imaging, biometrics, and electronic displays.

Visualization of Electrical Field of Electrode Using Voltage-Controlled Fluorescence Release

PubMed Central

Jia, Wenyan; Wu, Jiamin; Gao, Di; Wang, Hao; Sun, Mingui

2016-01-01

In this study we propose an approach to directly visualize electrical current distribution at the electrode-electrolyte interface of a biopotential electrode. High-speed fluorescent microscopic images are acquired when an electric potential is applied across the interface to trigger the release of fluorescent material from the surface of the electrode. These images are analyzed computationally to obtain the distribution of the electric field from the fluorescent intensity of each pixel. Our approach allows direct observation of microscopic electrical current distribution around the electrode. Experiments are conducted to validate the feasibility of the fluorescent imaging method. PMID:27253615

Overvoltage effect on electrical discharge type in medium-conductivity water in inhomogeneous pulsed electric field

NASA Astrophysics Data System (ADS)

Panov, V. A.; Vasilyak, L. M.; Pecherkin, V. Ya; Vetchinin, S. P.; Son, E. E.

2018-01-01

The transition between thermal and streamer discharges has been observed experimentally in water solution with conductivity 100 μS/cm applying positive voltage pulses to pin-to-rod electrodes. The transition happens at five-fold pulse amplitude. Considering streamer propagation as an ionization wave helped to establish relation between the parameters governing transition from one to another discharge mechanism.

Research of Influence of Noise Pollution on the Value of the Threshold Current Tangible

NASA Astrophysics Data System (ADS)

Khanzhina, Olga; Sidorov, Alexander; Zykina, Ekaterina

2017-12-01

Stable safety while working on electrical installations can be achieved by following the rules of the electrical safety. Today maximum permissible levels of touch voltage and electric current flow through any part of a person’s body are established by Russian Federation GOST system 12.1.038-82. Unfortunately, recommended by International Electrotechnical Commission (IEC) maximum allowable amount of electric current and voltage level do not take into account interaction between said electric current and other physical factors; noise, in particular. The influence of sound frequency and its pressure level on body resistance has been proven earlier in thesis by V.V. Katz. Studies of the noise effects on the value of the threshold current tangible have been renewed in laboratories of Life Safety Department in South Ural State University. To obtain reliable results, testing facility that includes anechoic chamber, sources of simulated voltages and noise and a set of recording instruments was designed and built. As a rule, noise influence on electrotechnical personnel varies depending on noise level or/and the duration of its impact. According to modern theories, indirect noise influence on various organs and systems through central nervous system has to be considered. Differential evaluation of noise pollution and its correlation with emerged effects can be obtained with the usage of the dose approach. First of all, there were conducted studies, in which frequency of the applied voltage (f) was to 50 Hz. Voltages and currents that caused sensations before and during 97 dB noise affections were measured. Obtained dependence led to questioning previous researches results of the necessity of reducing the amperage of tripping protection devices. At the same time electrical resistance changes of human body were being studied. According to those researches, no functional dependence between fluctuations in the magnitude of the resistance of human body to electric current flow and constant noise affection were found. Taking into account that contradiction, additional studies of primary electrical safety criteria for cases when exposed to high frequency noise pollution were conducted.

Stimulation of the hydrolytic stage for biogas production from cattle manure in an electrochemical bioreactor.

PubMed

Samani, Saeed; Abdoli, Mohammad Ali; Karbassi, Abdolreza; Amin, Mohammad Mehdi

Electrical current in the hydrolytic phase of the biogas process might affect biogas yield. In this study, four 1,150 mL single membrane-less chamber electrochemical bioreactors, containing two parallel titanium plates were connected to the electrical source with voltages of 0, -0.5, -1 and -1.5 V, respectively. Reactor 1 with 0 V was considered as a control reactor. The trend of biogas production was precisely checked against pH, oxidation reduction potential and electrical power at a temperature of 37 ± 0.5°C amid cattle manure as substrate for 120 days. Biogas production increased by voltage applied to Reactors 2 and 3 when compared with the control reactor. In addition, the electricity in Reactors 2 and 3 caused more biogas production than Reactor 4. Acetogenic phase occurred more quickly in Reactor 3 than in the other reactors. The obtained results from Reactor 4 were indicative of acidogenic domination and its continuous behavior under electrical stimulation. The results of the present investigation clearly revealed that phasic electrical current could enhance the efficiency of biogas production.

The Breakdown Characteristics of the Silicone Oil for Electric Power Apparatus

NASA Astrophysics Data System (ADS)

Yoshida, Hisashi; Yanabu, Satoru

The basic breakdown characteristics of the silicone oil as an insulating medium was studied with aim of realization of electric power apparatus which may be considered to be SF6 free and flame-retarding. As the first step, the impulse breakdown characteristics was measured with three kinds of electrodes whose electric field distributions differed. The breakdown characteristics in silicone oil was explained in relation to stressed oil volume (SOV) and the breakdown stress. At the second step the surface breakdown characteristic for impulse voltage was measured with two kinds of insulators which was set to between plane electrodes. The surface breakdown characteristic for impulse voltage was explained in relation to the ratio of the relative permittivity of oil and insulator. And on the third step, the breakdown characteristics of oil gap after interrupting small capacitive current was studied. In this experiment, the disconnecting switch to interrupt capacitive current was simulated by oil gap after interrupting impulse current, and to measure breakdown characteristics the high impulse voltage was subsequently applied. The breakdown stress in silicone oil after application of impulse current was discussed for insulation recovery characteristics.

Gas Composition Sensing Using Carbon Nanotube Arrays

NASA Technical Reports Server (NTRS)

Li, Jing; Meyyappan, Meyya

2012-01-01

This innovation is a lightweight, small sensor for inert gases that consumes a relatively small amount of power and provides measurements that are as accurate as conventional approaches. The sensing approach is based on generating an electrical discharge and measuring the specific gas breakdown voltage associated with each gas present in a sample. An array of carbon nanotubes (CNTs) in a substrate is connected to a variable-pulse voltage source. The CNT tips are spaced appropriately from the second electrode maintained at a constant voltage. A sequence of voltage pulses is applied and a pulse discharge breakdown threshold voltage is estimated for one or more gas components, from an analysis of the current-voltage characteristics. Each estimated pulse discharge breakdown threshold voltage is compared with known threshold voltages for candidate gas components to estimate whether at least one candidate gas component is present in the gas. The procedure can be repeated at higher pulse voltages to estimate a pulse discharge breakdown threshold voltage for a second component present in the gas. The CNTs in the gas sensor have a sharp (low radius of curvature) tip; they are preferably multi-wall carbon nanotubes (MWCNTs) or carbon nanofibers (CNFs), to generate high-strength electrical fields adjacent to the tips for breakdown of the gas components with lower voltage application and generation of high current. The sensor system can provide a high-sensitivity, low-power-consumption tool that is very specific for identification of one or more gas components. The sensor can be multiplexed to measure current from multiple CNT arrays for simultaneous detection of several gas components.

Systems and methods for providing power to a load based upon a control strategy

DOEpatents

Perisic, Milun; Lawrence, Christopher P; Ransom, Ray M; Kajouke, Lateef A

2014-11-04

Systems and methods are provided for an electrical system. The electrical system, for example, includes a first load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage through the interface and to provide a voltage and current to the first load. The controller may be further configured to, receive information on a second load electrically connected to the voltage source, determine an amount of reactive current to return to the voltage source such that a current drawn by the electrical system and the second load from the voltage source is substantially real, and provide the determined reactive current to the voltage source.

Impact of Distribution Feeders that do not have Voltage Regulators on the number of Charged Electric Vehicles using IEEE 34 Bus Test Feeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allehyani, Ahmed; Beshir, Mohammed

Voltage regulators help maintain an acceptable voltage profile for the system. This paper discusses the effect of installing voltage regulators to the system to fix the voltage drop resulting from the electrical vehicles loading increase when they are being charged. The effect will be studied in the afternoon, when the peak load occurs, using the IEEE 34 bus test feeder. First, only one spot node is used to charge the electric vehicles while a voltage regulator is present. Second, five spot nodes are loaded at the same time to charge the electric vehicles while voltage regulators are installed at eachmore » node. After that, the impact of electric vehicles on distribution feeders that do not have voltage regulators will appear.« less

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

PubMed

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

Electroosmotically enhanced drying of biomass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, S.; Law, S.E.

A laboratory system for experimentally characterizing electroosmotic dewatering of biomass has been developed. The system was used to investigate the dewatering at both constant voltage and constant current of two biomass materials, organic humus with peat and composted wastewater sludge (WWS). The moisture content of humus decreased to 22.5% from an initial value of 44.3% wet basis (wb) after 2 h 10 min of electroosmosis at 50 V across a 2.9-cm-thick bed, whereas that of sludge decreased to 54.5% from an initial value of 68.4% after 2 h 20 min at 40 V across the bed. The electrical energy requiredmore » to remove 1 kg of water by constant-voltage electroosmosis of humus varied from 23% to 61%, in the voltage range of 10--50 V, of the thermal energy required to change the same quantity of free water from liquid to vapor state. For WWS, the energy remained constant at a higher value of 88% over the 20--40-V range studied. The flowrate of liquid water out of the bed at constant voltage linearly increased with the applied electric field, and the electrical energy expended in the constant-current dewatering mode was seen to be a quadratic function of time as predicted by classical electrokinetic theory.« less

Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

NASA Astrophysics Data System (ADS)

Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel; Sebastian, Abu

2016-01-01

In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current in doped Ge2Sb2Te5 nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.

Thin film ferroelectric electro-optic memory

NASA Technical Reports Server (NTRS)

Thakoor, Sarita (Inventor); Thakoor, Anilkumar P. (Inventor)

1993-01-01

An electrically programmable, optically readable data or memory cell is configured from a thin film of ferroelectric material, such as PZT, sandwiched between a transparent top electrode and a bottom electrode. The output photoresponse, which may be a photocurrent or photo-emf, is a function of the product of the remanent polarization from a previously applied polarization voltage and the incident light intensity. The cell is useful for analog and digital data storage as well as opto-electric computing. The optical read operation is non-destructive of the remanent polarization. The cell provides a method for computing the product of stored data and incident optical data by applying an electrical signal to store data by polarizing the thin film ferroelectric material, and then applying an intensity modulated optical signal incident onto the thin film material to generate a photoresponse therein related to the product of the electrical and optical signals.

Review of adult electrical burn injury outcomes worldwide: An analysis of low- voltage versus high-voltage electrical injury

PubMed Central

Shih, Jessica G; Shahrokhi, Shahriar; Jeschke, Marc G

2016-01-01

Objective To review low-voltage versus high-voltage electrical burn complications in adults, and to identify novel areas that are not recognized to improve outcomes. Methods An extensive literature search on electrical burn injuries was performed using OVID Medline, PubMed and EMBASE databases from 1946–2015. Studies relating to outcomes of electrical injury in the adult population (≥18 years of age) were included in the study. Results Forty-one single-institution publications with a total of 5485 electrical injury patients were identified and included in the present study. 18.0% of these patients were low-voltage injuries (LVI), 38.3% high-voltage injuries (HVI) and 43.7% with voltage not otherwise specified (NOS). Forty-four percent of studies did not characterize outcomes according to low versus high-voltage injuries. Reported outcomes include surgical, medical, post-traumatic, and other (long-term/psychological/rehabilitative), all of which report greater incidence rates in HVI compared to LVI. Only two studies report on psychological outcomes such as post-traumatic stress disorder. Mortality from electrical injuries are 2.6% in LVI, 5.2% in HVI and 3.7% in NOS. Coroner’s reports reveal a ratio of 2.4:1 for deaths caused by low-voltage injury compared to high voltage-injury. Conclusions High-voltage injuries lead to greater morbidity and mortality than low-voltage injuries. However, the results of the coroner’s reports suggest that immediate mortality from low-voltage injury may be underestimated. Furthermore, based on the data of this analysis we conclude that the majority of studies report electrical injury outcomes, however, the majority of them do not analyze complications by low versus high voltage and often lack long-term psychological and rehabilitation outcomes post-electrical injury indicating that a variety of central aspects are not being evaluated or assessed. PMID:27359191

Ion transport and softening in a polymerized ionic liquid

DOE PAGES

Kumar, Rajeev; Bocharova, Vera; Strelcov, Evgheni; ...

2014-11-13

Polymerized ionic liquids (PolyILs) are promising materials for various solid state electronic applications such as dye-sensitized solar cells, lithium batteries, actuators, field-effect transistors, light emitting electrochemical cells, and electrochromic devices. However, fundamental understanding of interconnection between ionic transport and mechanical properties in PolyILs is far from complete. In this paper, local charge transport and structural changes in films of a PolyIL are studied using an integrated experiment-theory based approach. Experimental data for the kinetics of charging and steady state current–voltage relations can be explained by taking into account the dissociation of ions under an applied electric field (known as themore » Wien effect). Onsager's theory of the Wien effect coupled with the Poisson–Nernst–Planck formalism for the charge transport is found to be in excellent agreement with the experimental results. The agreement between the theory and experiments allows us to predict structural properties of the PolyIL films. We have observed significant softening of the PolyIL films beyond certain threshold voltages and formation of holes under a scanning probe microscopy (SPM) tip, through which an electric field was applied. Finally, the observed softening is explained by the theory of depression in glass transition temperature resulting from enhanced dissociation of ions with an increase in applied electric field.« less

Rapid Microfluidic Mixers Utilizing Dispersion Effect and Interactively Time-Pulsed Injection

NASA Astrophysics Data System (ADS)

Leong, Jik-Chang; Tsai, Chien-Hsiung; Chang, Chin-Lung; Lin, Chiu-Feng; Fu, Lung-Ming

2007-08-01

In this paper, we present a novel active microfluidic mixer utilizing a dispersion effect in an expansion chamber and applying interactively time-pulsed driving voltages to the respective inlet fluid flows to induce electroosmotic flow velocity variations for developing a rapid mixing effect in a microchannel. Without using any additional equipment to induce flow perturbations, only a single high-voltage power source is required for simultaneously driving and mixing sample fluids, which results in a simple and low-cost system for mixing. The effects of the applied main electrical field, interactive frequency, and expansion ratio on the mixing performance are thoroughly examined experimentally and numerically. The mixing ratio can be as high as 95% within a mixing length of 3000 μm downstream from the secondary T-form when a driving electric field strength of 250 V/cm, a periodic switching frequency of 5 Hz, and the expansion ratio M=1:10 are applied. In addition, the optimization of the driving electric field, switching frequency, expansion ratio, expansion entry length, and expansion chamber length for achieving a maximum mixing ratio is also discussed in this study. The novel method proposed in this study can be used for solving the mixing problem in the field of micro-total-analysis systems in a simple manner.

Electric-Field Instrument With Ac-Biased Corona Point

NASA Technical Reports Server (NTRS)

Markson, R.; Anderson, B.; Govaert, J.

1993-01-01

Measurements indicative of incipient lightning yield additional information. New instrument gives reliable readings. High-voltage ac bias applied to needle point through high-resistance capacitance network provides corona discharge at all times, enabling more-slowly-varying component of electrostatic potential of needle to come to equilibrium with surrounding air. High resistance of high-voltage coupling makes instrument insensitive to wind. Improved corona-point instrument expected to yield additional information assisting in safety-oriented forecasting of lighting.

Controlling charge current through a DNA based molecular transistor

NASA Astrophysics Data System (ADS)

Behnia, S.; Fathizadeh, S.; Ziaei, J.

2017-01-01

Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

Apparatus for combinatorial screening of electrochemical materials

DOEpatents

Kepler, Keith Douglas [Belmont, CA; Wang, Yu [Foster City, CA

2009-12-15

A high throughput combinatorial screening method and apparatus for the evaluation of electrochemical materials using a single voltage source (2) is disclosed wherein temperature changes arising from the application of an electrical load to a cell array (1) are used to evaluate the relative electrochemical efficiency of the materials comprising the array. The apparatus may include an array of electrochemical cells (1) that are connected to each other in parallel or in series, an electronic load (2) for applying a voltage or current to the electrochemical cells (1), and a device (3), external to the cells, for monitoring the relative temperature of each cell when the load is applied.

The dependency of adhesion and friction on electrostatic attraction

NASA Astrophysics Data System (ADS)

Persson, B. N. J.

2018-04-01

I develop a general mean-field theory for the influence of electrostatic attraction between two solids on the contact mechanics. I assume elastic solids with random surface roughness. I consider two cases, namely, with and without an electrically insulating layer between the conducting solids. The former case is important for, e.g., the finger-touch screen interaction. I study how the electrostatic attraction influences the adhesion and friction. For the case of an insulating layer, I find that when the applied nominal contact pressure is relatively small, as the applied voltage increases, there is a sharp increase in the contact area, and hence in the friction, at a critical voltage.

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.

PubMed

Freites, J Alfredo; Tobias, Douglas J

2015-06-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.

Nonlinear space charge dynamics in mixed ionic-electronic conductors: Resistive switching and ferroelectric-like hysteresis of electromechanical response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morozovska, Anna N.; Morozovsky, Nicholas V.; Eliseev, Eugene A.

We performed self-consistent modelling of nonlinear electrotransport and electromechanical response of thin films of mixed ionic-electronic conductors (MIEC) allowing for steric effects of mobile charged defects (ions, protons, or vacancies), electron degeneration, and Vegard stresses. We establish correlations between the features of the nonlinear space-charge dynamics, current-voltage, and bending-voltage curves for different types of the film electrodes. A pronounced ferroelectric-like hysteresis of the bending-voltage loops and current maxima on the double hysteresis current-voltage loops appear for the electron-transport electrodes. The double hysteresis loop with pronounced humps indicates a memristor-type resistive switching. The switching occurs due to the strong nonlinear couplingmore » between the electronic and ionic subsystems. A sharp meta-stable maximum of the electron density appears near one open electrode and moves to another one during the periodic change of applied voltage. Our results can explain the nonlinear nature and correlation of electrical and mechanical memory effects in thin MIEC films. The analytical expression proving that the electrically induced bending of MIEC films can be detected by interferometric methods is derived.« less

Electrical treeing behaviors in silicone rubber under an impulse voltage considering high temperature

NASA Astrophysics Data System (ADS)

Yunxiao, ZHANG; Yuanxiang, ZHOU; Ling, ZHANG; Zhen, LIN; Jie, LIU; Zhongliu, ZHOU

2018-05-01

In this paper, work was conducted to reveal electrical tree behaviors (initiation and propagation) of silicone rubber (SIR) under an impulse voltage with high temperature. Impulse frequencies ranging from 10 Hz to 1 kHz were applied and the temperature was controlled between 30 °C and 90 °C. Experimental results show that tree initiation voltage decreases with increasing pulse frequency, and the descending amplitude is different in different frequency bands. As the pulse frequency increases, more frequent partial discharges occur in the channel, increasing the tree growth rate and the final shape intensity. As for temperature, the initiation voltage decreases and the tree shape becomes denser as the temperature gets higher. Based on differential scanning calorimetry results, we believe that partial segment relaxation of SIR at high temperature leads to a decrease in the initiation voltage. However, the tree growth rate decreases with increasing temperature. Carbonization deposition in the channel under high temperature was observed under microscope and proven by Raman analysis. Different tree growth models considering tree channel characteristics are proposed. It is believed that increasing the conductivity in the tree channel restrains the partial discharge, holding back the tree growth at high temperature.

Noise-enhanced chaos in a weakly coupled GaAs/(Al,Ga)As superlattice.

PubMed

Yin, Zhizhen; Song, Helun; Zhang, Yaohui; Ruiz-García, Miguel; Carretero, Manuel; Bonilla, Luis L; Biermann, Klaus; Grahn, Holger T

2017-01-01

Noise-enhanced chaos in a doped, weakly coupled GaAs/Al_{0.45}Ga_{0.55}As superlattice has been observed at room temperature in experiments as well as in the results of the simulation of nonlinear transport based on a discrete tunneling model. When external noise is added, both the measured and simulated current-versus-time traces contain irregularly spaced spikes for particular applied voltages, which separate a regime of periodic current oscillations from a region of no current oscillations at all. In the voltage region without current oscillations, the electric-field profile consist of a low-field domain near the emitter contact separated by a domain wall consisting of a charge accumulation layer from a high-field regime closer to the collector contact. With increasing noise amplitude, spontaneous chaotic current oscillations appear over a wider bias voltage range. For these bias voltages, the domain boundary between the two electric-field domains becomes unstable and very small current or voltage fluctuations can trigger the domain boundary to move toward the collector and induce chaotic current spikes. The experimentally observed features are qualitatively very well reproduced by the simulations. Increased noise can consequently enhance chaotic current oscillations in semiconductor superlattices.

Noise-enhanced chaos in a weakly coupled GaAs/(Al,Ga)As superlattice

NASA Astrophysics Data System (ADS)

Yin, Zhizhen; Song, Helun; Zhang, Yaohui; Ruiz-García, Miguel; Carretero, Manuel; Bonilla, Luis L.; Biermann, Klaus; Grahn, Holger T.

2017-01-01

Noise-enhanced chaos in a doped, weakly coupled GaAs /Al0.45Ga0.55As superlattice has been observed at room temperature in experiments as well as in the results of the simulation of nonlinear transport based on a discrete tunneling model. When external noise is added, both the measured and simulated current-versus-time traces contain irregularly spaced spikes for particular applied voltages, which separate a regime of periodic current oscillations from a region of no current oscillations at all. In the voltage region without current oscillations, the electric-field profile consist of a low-field domain near the emitter contact separated by a domain wall consisting of a charge accumulation layer from a high-field regime closer to the collector contact. With increasing noise amplitude, spontaneous chaotic current oscillations appear over a wider bias voltage range. For these bias voltages, the domain boundary between the two electric-field domains becomes unstable and very small current or voltage fluctuations can trigger the domain boundary to move toward the collector and induce chaotic current spikes. The experimentally observed features are qualitatively very well reproduced by the simulations. Increased noise can consequently enhance chaotic current oscillations in semiconductor superlattices.

Elimination of image flicker in a fringe-field switching liquid crystal display by applying a bipolar voltage wave.

PubMed

Oh, Seung-Won; Park, Jun-Hee; Lee, Ji-Hoon; Yoon, Tae-Hoon

2015-09-07

Recently, low-frequency driving of liquid crystal display (LCD) panels to minimize power consumption has drawn much attention. In the case in which an LCD panel is driven by a fringe-field at a low frequency, the image flickering phenomenon occurs when the sign of the applied electric field is reversed. We investigated image flickering induced by the flexoelectric effect in a fringe-field switching (FFS) liquid crystal cell in terms of the transmittance difference between frames and the ripple phenomenon. Experimental results show that image flicker due to transmittance difference can be eliminated completely and that the ripple phenomena can be reduced significantly by applying a bipolar voltage wave to the FFS cell.

Apparatus and method for maximizing power delivered by a photovoltaic array

DOEpatents

Muljadi, Eduard; Taylor, Roger W.

1998-01-01

A method and apparatus for maximizing the electric power output of a photovoltaic array connected to a battery where the voltage across the photovoltaic array is adjusted through a range of voltages to find the voltage across the photovoltaic array that maximizes the electric power generated by the photovoltaic array and then is held constant for a period of time. After the period of time has elapsed, the electric voltage across the photovoltaic array is again adjusted through a range of voltages and the process is repeated. The electric energy and the electric power generated by the photovoltaic array is delivered to the battery which stores the electric energy and the electric power for later delivery to a load.

Apparatus and method for maximizing power delivered by a photovoltaic array

DOEpatents

Muljadi, E.; Taylor, R.W.

1998-05-05

A method and apparatus for maximizing the electric power output of a photovoltaic array connected to a battery where the voltage across the photovoltaic array is adjusted through a range of voltages to find the voltage across the photovoltaic array that maximizes the electric power generated by the photovoltaic array and then is held constant for a period of time. After the period of time has elapsed, the electric voltage across the photovoltaic array is again adjusted through a range of voltages and the process is repeated. The electric energy and the electric power generated by the photovoltaic array is delivered to the battery which stores the electric energy and the electric power for later delivery to a load. 20 figs.

Comparative study of electrical breakdown properties of deionized water and heavy water under pulsed power conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Veda Prakash, G.; Kumar, R.; Saurabh, K.

A comparative study of electrical breakdown properties of deionized water (H{sub 2}O) and heavy water (D{sub 2}O) is presented with two different electrode materials (stainless steel (SS) and brass) and polarity (positive and negative) combinations. The pulsed (∼a few tens of nanoseconds) discharges are conducted by applying high voltage (∼a few hundred kV) pulse between two hemisphere electrodes of the same material, spaced 3 mm apart, at room temperature (∼26-28 °C) with the help of Tesla based pulse generator. It is observed that breakdown occurred in heavy water at lesser voltage and in short duration compared to deionized water irrespective ofmore » the electrode material and applied voltage polarity chosen. SS electrodes are seen to perform better in terms of the voltage withstanding capacity of the liquid dielectric as compared to brass electrodes. Further, discharges with negative polarity are found to give slightly enhanced discharge breakdown voltage when compared with those with positive polarity. The observations corroborate well with conductivity measurements carried out on original and post-treated liquid samples. An interpretation of the observations is attempted using Fourier transform infrared measurements on original and post-treated liquids as well as in situ emission spectra studies. A yet another important observation from the emission spectra has been that even short (nanosecond) duration discharges result in the formation of a considerable amount of ions injected into the liquid from the electrodes in a similar manner as reported for long (microseconds) discharges. The experimental observations show that deionised water is better suited for high voltage applications and also offer a comparison of the discharge behaviour with different electrodes and polarities.« less

Nitrate removal from pharmaceutical wastewater using microbial electrochemical system supplied through low frequency-low voltage alternating electric current.

PubMed

Hoseinzadeh, Edris; Rezaee, Abbas; Farzadkia, Mahdi

2018-04-01

In this study, a microbial electrochemical system (MES) was designed to evaluate the effects of a low frequency-low voltage alternating electrical current on denitrification efficacy in the presence of ibuprofen as a low biodegradable organic carbon source. Cylindrical carbon cloth and stainless steel mesh electrodes containing a consortium of heterotrophic and autotrophic bacteria were mounted in the wall of the designed laboratory-scale bioreactor. The effects of inlet nitrate concentration (50-800mgL -1 ), retention time (2.5-24h), waveform magnitude (0.1-9.6V p-p ), adjustable direct current voltage added to offset voltage (0.1-4.9V), alternating current frequency (10-60Hz), and waveforms (sinusoidal, square, and ramp) were studied in this work. The results showed that the proposed system removes 800mgL -1 nitrate up to 95% during 6.5h. Optimum conditions were obtained in the 8V p-p using a frequency of 10Hz of a sinusoidal waveform. The morphology studies confirmed bacterial morphology change when applying the alternating current. Dehydrogenase activity of biofilms formed on surface of stainless steel electrodes increased to 15.24μgTFmg biomass cm -2 d. The maximum bacterial activity was obtained at a voltage of 8V p-p . The experimental results revealed that the MES using a low frequency-low voltage alternating electrical current is a promising technique for nitrate removal from pharmaceutical wastewaters in the presence of low biodegradability of carbon sources such as ibuprofen. Copyright © 2017 Elsevier B.V. All rights reserved.

Voltage and frequency dependence of prestin-associated charge transfer

PubMed Central

Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.

2009-01-01

Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917

Conversion of NO to NO(2) in air by a micro electric NO(x) converter based on a corona discharge process.

PubMed

Yoon, Seung-Il; Heo, Sungmoo; Song, Soonho; Kim, Yong-Jun

2010-06-01

A micro-electric-NO(x)-converter based on volume treatment is proposed for the evaluation of NO(x) concentrations in air. It can electrically convert NO(x) mixture from variable mixing rates into a fixed-mixing rate of 25% NO(2) and 75% NO using the corona discharge process with stable conversion efficiency and high throughput (space velocity = 6.3 x 10(4) h(-1)). The micro-electric-NO(x)-converter is based on a volume process. Applying high voltage to the electrodes of the micro-electric-NO(x)-converter generates a corona discharge. This discharge creates high-energy electrons, which collide with gas molecules. After these collisions, NO and O(2) are broken into single atoms, and they are re-combined as a balanced form, NO(2) in this case. The fabricated micro-electric-NO(x)-converter converted NO into NO(2) at conversion efficiency of 25.63%, when 5.5 kV (the applied corona power = 0.196 W) was applied to the micro-electric-NO(x)-converter.

The effect of applied control strategy on the current-voltage correlation of a solid oxide fuel cell stack during dynamic operation

NASA Astrophysics Data System (ADS)

Szmyd, Janusz S.; Komatsu, Yosuke; Brus, Grzegorz; Ghigliazza, Francesco; Kimijima, Shinji; Ściążko, Anna

2014-09-01

This paper discusses the transient characteristics of the planar type SOFC cell stack, of which the standard output is 300 W. The transient response of the voltage to the manipulation of an electric current was investigated. The effects of the response and of the operating condition determined by the operating temperature of the stack were studied by mapping a current-voltage (I-V) correlation. The current-based fuel control (CBFC) was adopted for keeping the fuel utilization factor at constant while the value of the electric current was ramped at the constant rate. The present experimental study shows that the transient characteristics of the cell voltage are determined by primarily the operating temperature caused by the manipulation of the current. Particularly, the slope of the I-V curve and the overshoot found on the voltage was remarkably influenced by the operating temperature. The different values of the fuel utilization factor influence the height of the settled voltages. The CBFC has significance in determining the slope of the I-V characteristic, but the different values ofthe fuel utilization factor does not affect the slope as the operating temperature does. The CBFC essentially does not alter the amplitude of the overshoot on the voltage response, since this is dominated by the operating temperature and its change is caused by manipulating the current.

High-intensity pulsed beam source with tunable operation mode

NASA Astrophysics Data System (ADS)

Nashilevskiy, A. V.; Kanaev, G. G.; Ezhov, V. V.; Shamanin, V. I.

2017-05-01

The report presents the design of an electron and an ion pulsed accelerator. The powerful high-voltage pulse generator of the accelerator and the vacuum bushing insulator is able to change the polarity of the output voltage. The low-inductance matching transformer provides an increase in the DFL output impedance by 4 times. The generator based on a high voltage pulse transformer and a pseudo spark switch is applied for DFL charging. The high-impedance magnetically insulated focusing diode with Br magnetic field and the “passive” anode was used to realize the ion beam generation mode. The plasma is formed on the surface of the anode caused by an electrical breakdown at the voltage edge pulse; as a result, the carbon ion and proton beam is generated. This beam has the following parameters: the current density is about 400 A/cm2 (in focus): the applied voltage is up to 450 kV. The accelerator is designed for the research on the interaction of the charged particle pulsed beams with materials and for the development of technological processes of a material modification.

Behavior of neutral solutes in pressurized flow driven electrochromatography using a mixed stationary phase of ODS and anion-exchange.

PubMed

Kitagawa, Shinya; Tsuda, Takao

2003-05-02

The behavior of neutral sample solutes in pressurized flow driven electrochromatography using a mixed stationary phase, which consisted of ODS and anion-exchange (ODS-SAX), was studied. Applications of both positive and negative voltage on a column induced increases in retention factors of sample solutes. The direction of an electroosmotic flow under applications of positive and negative voltage were the same, therefore, the sign of the surface charge density under positive and negative voltage was opposite. We proposed a new equation for the relationship between applied voltage and surface charge density, and the practical electroosmotic flow conformed to this equation. Studying the electroosmotic flow using our proposed equation revealed that the applied negative voltage accelerates the protonation of the quaternary ammonium group and dissociation of the silanol group on packing materials. The retention behavior of a neutral solute was affected by the existence of the charged functional groups. We propose that this phenomenon is applicable to the control of the retention behavior of a sample solute using an electric field.

Microbial Attachment Inhibition through Low-Voltage Electrochemical Reactions on Electrically Conducting Membranes.

PubMed

Ronen, Avner; Duan, Wenyan; Wheeldon, Ian; Walker, Sharon; Jassby, David

2015-11-03

Bacterial biofilm formation on membrane surfaces remains a serious challenge in water treatment systems. The impact of low voltages on microbial attachment to electrically conducting ultrafiltration membranes was investigated using a direct observation cross-flow membrane system mounted on a fluorescence microscope. Escherichia coli and microparticle deposition and detachment rates were measured as a function of the applied electrical potential to the membrane surface. Selecting bacteria and particles with low surface charge minimized electrostatic interactions between the bacteria and charged membrane surface. Application of an electrical potential had a significant impact on the detachment of live bacteria in comparison to dead bacteria and particles. Image analysis indicated that when a potential of 1.5 V was applied to the membrane/counter electrode pair, the percent of dead bacteria was 32±2.1 and 67±3.6% when the membrane was used as a cathode or anode, respectively, while at a potential of 1 V, 92±2.4% were alive. The application of low electrical potentials resulted in the production of low (μM) concentrations of hydrogen peroxide (HP) through the electroreduction of oxygen. The electrochemically produced HP reduced microbial cell viability and increased cellular permeability. Exposure to low concentrations of electrochemically produced HP on the membrane surface prevents bacterial attachment, thus ensuring biofilm-free conditions during membrane filtration operations.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

A Critical Analysis and Assessment of High Power Switches

DTIC Science & Technology

1978-09-01

applications. Because of field-distorting corona discharges in high voltage gas gaps it is difficult to predict the exact break- down strength of a nonuniform ...applied field. The streamer velocity is a/R Vs =E 2 a/R (A-9) i n i - laiR -i e o 411 where S= mobility of electrons E = applied electric field a = length

Energy harvesting efficiency of piezoelectric polymer film with graphene and metal electrodes.

PubMed

Park, Sanghoon; Kim, Yura; Jung, Hyosub; Park, Jun-Young; Lee, Naesung; Seo, Yongho

2017-12-11

In this study, we investigated an energy harvesting effect of tensile stress using piezoelectric polymers and flexible electrodes. A chemical-vapor-deposition grown graphene film was transferred onto both sides of the PVDF and P(VDF-TrFE) films simultaneously by means of a conventional wet chemical method. Output voltage induced by sound waves was measured and analyzed when a mechanical tension was applied to the device. Another energy harvester was made with a metallic electrode, where Al and Ag were deposited by using an electron-beam evaporator. When acoustic vibrations (105 dB) were applied to the graphene/PVDF/graphene device, an induced voltage of 7.6 V pp was measured with a tensile stress of 1.75 MPa, and this was increased up to 9.1 V pp with a stress of 2.18 MPa for the metal/P(VDF-TrFE)/metal device. The 9 metal/PVDF/metal layers were stacked as an energy harvester, and tension was applied by using springs. Also, we fabricated a full-wave rectifying circuit to store the electrical energy in a 100 μF capacitor, and external vibration generated the electrical charges. As a result, the stored voltage at the capacitor, obtained from the harvester via a bridge diode rectifier, was saturated to ~7.04 V after 180 s charging time.

A Sinusoidal Applied Electric Potential can Induce a Long-Range, Steady Electrophoretic Force

NASA Astrophysics Data System (ADS)

Amrei, Seyyed Hashemi; Ristenpart, William D.; Miller, Greg R.

2017-11-01

We use the standard electrokinetic model to numerically investigate the electric field in aqueous solutions between parallel electrodes under AC polarization. In contrast to prior work, we invoke no simplifying assumptions regarding the applied voltage, frequency, or mismatch in ionic mobilities. We find that the nonlinear electromigration terms significantly contribute to the overall shape of the electric potential vs. time, which at sufficiently high applied potentials develops multi-modal peaks. More surprisingly, we find that electrolytes with non-equal mobilities yield an electric field with non-zero time average at large distances from the electrodes. Our calculations indicate this long-range electric field suffices to levitate colloidal particles many microns away from the electrode against the gravitational field, in accord with experimental observations of such behavior (Woehl et al., PRX, 2015). Moreover, the results indicate that particles will aggregate laterally near electrodes in some electrolytes but separate in others, helping explain a longstanding but not well understood phenomenon.

Softened Mechanical Properties of Graphene Induced by Electric Field.

PubMed

Huang, Peng; Guo, Dan; Xie, Guoxin; Li, Jian

2017-10-11

The understanding on the mechanical properties of graphene under the applications of physical fields is highly relevant to the reliability and lifetime of graphene-based nanodevices. In this work, we demonstrate that the application of electric field could soften the mechanical properties of graphene dramatically on the basis of the conductive AFM nanoindentation method. It has been found that the Young's modulus and fracture strength of graphene nanosheets suspended on the holes almost stay the same initially and then exhibit a sharp drop when the normalized electric field strength increases to be 0.18 ± 0.03 V/nm. The threshold voltage of graphene nanosheets before the onset of fracture under the fixed applied load increases with the thickness. Supported graphene nanosheets can sustain larger electric field under the same applied load than the suspended ones. The excessively regional Joule heating caused by the high electric current under the applied load is responsible for the electromechanical failure of graphene. These findings can provide a beneficial guideline for the electromechanical applications of graphene-based nanodevices.

Electric field induced sheeting and breakup of dielectric liquid jets

NASA Astrophysics Data System (ADS)

Khoshnevis, Ahmad; Tsai, Scott S. H.; Esmaeilzadeh, Esmaeil

2014-01-01

We report experimental observations of the controlled deformation of a dielectric liquid jet subjected to a local high-voltage electrostatic field in the direction normal to the jet. The jet deforms to the shape of an elliptic cylinder upon application of a normal electrostatic field. As the applied electric field strength is increased, the elliptic cylindrical jet deforms permanently into a flat sheet, and eventually breaks-up into droplets. We interpret this observation—the stretch of the jet is in the normal direction to the applied electric field—qualitatively using the Taylor-Melcher leaky dielectric theory, and develop a simple scaling model that predicts the critical electric field strength for the jet-to-sheet transition. Our model shows a good agreement with experimental results, and has a form that is consistent with the classical drop deformation criterion in the Taylor-Melcher theory. Finally, we statistically analyze the resultant droplets from sheet breakup, and find that increasing the applied electric field strength improves droplet uniformity and reduces droplet size.

Electric-field control of conductance in metal quantum point contacts by electric-double-layer gating

NASA Astrophysics Data System (ADS)

Shibata, K.; Yoshida, K.; Daiguji, K.; Sato, H.; , T., Ii; Hirakawa, K.

2017-10-01

An electric-field control of quantized conductance in metal (gold) quantum point contacts (QPCs) is demonstrated by adopting a liquid-gated electric-double-layer (EDL) transistor geometry. Atomic-scale gold QPCs were fabricated by applying the feedback-controlled electrical break junction method to the gold nanojunction. The electric conductance in gold QPCs shows quantized conductance plateaus and step-wise increase/decrease by the conductance quantum, G0 = 2e2/h, as EDL-gate voltage is swept, demonstrating a modulation of the conductance of gold QPCs by EDL gating. The electric-field control of conductance in metal QPCs may open a way for their application to local charge sensing at room temperature.

Process for the production of hydrogen from water

DOEpatents

Miller, William E [Naperville, IL; Maroni, Victor A [Naperville, IL; Willit, James L [Batavia, IL

2010-05-25

A method and device for the production of hydrogen from water and electricity using an active metal alloy. The active metal alloy reacts with water producing hydrogen and a metal hydroxide. The metal hydroxide is consumed, restoring the active metal alloy, by applying a voltage between the active metal alloy and the metal hydroxide. As the process is sustainable, only water and electricity is required to sustain the reaction generating hydrogen.

Determination of electrical properties of degraded mixed ionic conductors: Impedance studies with applied dc voltage

NASA Astrophysics Data System (ADS)

Bayer, T. J. M.; Carter, J. J.; Wang, Jian-Jun; Klein, Andreas; Chen, Long-Qing; Randall, C. A.

2017-12-01

Under electrical bias, mixed ionic conductors such as SrTiO3 are characterized by oxygen vacancy migration which leads to resistance degradation. The defect chemistry to describe the relationship between conductivity and oxygen vacancies is usually obtained by high temperature conductivity data or quenching experiments. These techniques can investigate the equilibrated state only. Here, we introduce a new approach using in-situ impedance studies with applied dc voltage to analyze the temperature dependent electrical properties of degraded SrTiO3 single crystals. This procedure is most beneficial since it includes electric field driven effects. The benefits of the approach are highlighted by comparing acceptor doped and undoped SrTiO3. This approach allows the determination of the temperature activation of both anodic and cathodic conductivity of Fe-doped SrTiO3 in the degraded state. The anodic activation energy matches well with the published results, while the activation energy of the degraded cathode region reported here is not in agreement with earlier assumptions. The specific discrepancies of the experimental data and the published defect chemistry are discussed, and a defect chemistry model that includes the strong temperature dependence of the electron conductivity in the cathode region is proposed.

Evaluation of the shock-wave pattern for endoscopic electrohydraulic lithotripsy.

PubMed

Vorreuther, R; Engelmann, Y

1995-01-01

We evaluated the electrical events and the resulting shock waves of the spark discharge for electrohydraulic lithotripsy at the tip of a 3.3F probe. Spark generation was achieved by variable combinations of voltage and capacity. The effective electrical output was determined by means of a high-voltage probe, a current coil, and a digital oscilloscope. Peak pressures, rise times, and pulse width of the pressure profiles were recorded using a polyvinylidene difluoride needle hydrophone in 0.9% NaCl solution at a distance of 10 mm. The peak pressure and the slope of the shock front depend solely on the voltage, while the pulse width was correlated with the capacity. Pulses of less than 1-microsecond duration can be obtained when low capacity is applied and the inductivity of the cables and plugs is kept at a low level. Using chalk as a stone model it was proven that short pulses of high peak pressure provided by a low capacity and a high voltage have a greater impact on fragmentation than the corresponding broader shock waves of lower peak pressure carrying the same energy.

Methods and apparatus for measurement of the resistivity of geological formations from within cased wells in presence of acoustic and magnetic energy sources

DOEpatents

Vail, W.B. III.

1991-08-27

Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation. 9 figures.

Methods and apparatus for measurement of the resistivity of geological formations from within cased wells in presence of acoustic and magnetic energy sources

DOEpatents

Vail, III, William B.

1991-01-01

Methods and apparatus are provided for measuring the acoustically modulated electronic properties of geological formations and cement layers adjacent to cased boreholes. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. Voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the leakage current conducted into formation in the vicinity of those electrodes. Simultaneously subjecting the casing and formation to an acoustic source acoustically modulates the leakage current measured thereby providing a measure of the acoustically modulated electronic properties of the adjacent formation. Similarly, methods and apparatus are also described which measure the leakage current into formation while simultaneously subjecting the casing to an applied magnetic field which therefore allows measurement of the magnetically modulated electronic properties of the casing and the adjacent formation.

The effect of the geomagnetic field on negative voltage spheres in the ionospheric plasma: Fluid simulation

NASA Astrophysics Data System (ADS)

Ma, T.-Z.; Schunk, R. W.

1994-07-01

Experiments involving the interaction of spherical conducting objects biases with hight voltages in the Low-Earth-Orbit (LEO) environment have been conducted and designed. In these experiments, both positive and negative voltages have been applied to the spheres. Previously, there have been theoretical and numerical studies of positive voltage spheres in plasmas with and without magnetic fields. There also have been studies of negative voltage objects in unmagnetized plasmas. Here, we used a fluid model to study the plasma response to a negative voltage sphere immersed in a magnetized plasma. Our main purpose was to investigate the role of the magnetic field during the early-time interaction between the negative voltage sphere and the ambient plasma in the LEO environment. In this study, different applied voltages, magnetic field strengths, and rise-times of the applied voltages were considered. It was found that with the strength of the geomagnetic field the ions are basically not affected by the magnetic field on the time scale of hundreds of plasma periods considered in this study. The ion density distribution around the sphere and the collected ion flux by the sphere are basically the same as in the case without the magnetic field. The electron motion is strongly affected by the magnetic field. One effect is to change the nature of the electron over-shoot oscillation from regular to somewhat turbulent. Although the electrons move along the magnetic field much more easily than across the magnetic field, some redirection effect causes the electron density to distribute as if the magnetic field effect is minimal. The sheath struture and the electric field around the sphere tend to be spherical. A finite rise-time of the applied voltage reduces the oscillatory activities and delays the ion acceleration. However, the effect of the rise-time depends on both the duration of the rise-time and the ion plasma period.

Damage Diagnosis in Semiconductive Materials Using Electrical Impedance Measurements

NASA Technical Reports Server (NTRS)

Ross, Richard W.; Hinton, Yolanda L.

2008-01-01

Recent aerospace industry trends have resulted in an increased demand for real-time, effective techniques for in-flight structural health monitoring. A promising technique for damage diagnosis uses electrical impedance measurements of semiconductive materials. By applying a small electrical current into a material specimen and measuring the corresponding voltages at various locations on the specimen, changes in the electrical characteristics due to the presence of damage can be assessed. An artificial neural network uses these changes in electrical properties to provide an inverse solution that estimates the location and magnitude of the damage. The advantage of the electrical impedance method over other damage diagnosis techniques is that it uses the material as the sensor. Simple voltage measurements can be used instead of discrete sensors, resulting in a reduction in weight and system complexity. This research effort extends previous work by employing finite element method models to improve accuracy of complex models with anisotropic conductivities and by enhancing the computational efficiency of the inverse techniques. The paper demonstrates a proof of concept of a damage diagnosis approach using electrical impedance methods and a neural network as an effective tool for in-flight diagnosis of structural damage to aircraft components.

Electric field measurements in a near atmospheric pressure nanosecond pulse discharge with picosecond electric field induced second harmonic generation

NASA Astrophysics Data System (ADS)

Goldberg, Benjamin M.; Chng, Tat Loon; Dogariu, Arthur; Miles, Richard B.

2018-02-01

We present an optical electric field measurement method for use in high pressure plasma discharges. The method is based upon the field induced second harmonic generation technique and can be used for localized electric field measurements with sub-nanosecond resolution in any gaseous species. When an external electric field is present, a dipole is induced in the typically centrosymmetric medium, allowing for second harmonic generation with signal intensities which scale by the square of the electric field. Calibrations have been carried out in 100 Torr room air, and a minimum sensitivity of 450 V/cm is demonstrated. Measurements were performed with nanosecond or faster temporal resolution in a 100 Torr room air environment both with and without a plasma present. It was shown that with no plasma present, the field follows the applied voltage to gap ratio, as measured using the back current shunt method. When the electric field is strong enough to exceed the breakdown threshold, the measured field was shown to exceed the anticipated voltage to gap ratio which is taken as an indication of the ionization wave front as it sweeps through the plasma volume.

A flex-compressive-mode piezoelectric transducer for mechanical vibration/strain energy harvesting.

PubMed

Li, Xiaotian; Guo, Mingsen; Dong, Shuxiang

2011-04-01

A piezoelectric transducer for harvesting energy from ambient mechanical vibrations/strains under pressure condition was developed. The proposed transducer was made of two ring-type piezoelectric stacks, one pair of bow-shaped elastic plates, and one shaft that pre-compresses them. This transducer works in flex-compressive (F-C) mode, which is different from a conventional flex-tensional (F-T) one, to transfer a transversely applied force F into an amplified longitudinal force N pressing against the two piezo-stacks via the two bowshaped elastic plates, generating a large electric voltage output via piezoelectric effect. Our experimental results show that without an electric load, an F-C mode piezo-transducer could generate a maximum electric voltage output of up to 110 Vpp, and with an electric load of 40 κΩ, it a maximum power output of 14.6 mW under an acceleration excitation of 1 g peak-peak at the resonance frequency of 87 Hz. © 2011 IEEE

Maximizing fluid delivered by bubble-free electroosmotic pump with optimum pulse voltage waveform.

PubMed

Tawfik, Mena E; Diez, Francisco J

2017-03-01

In generating high electroosmotic (EO) flows for use in microfluidic pumps, a limiting factor is faradaic reactions that are more pronounced at high electric fields. These reactions lead to bubble generation at the electrodes and pump efficiency reduction. The onset of gas generation for high current density EO pumping depends on many parameters including applied voltage, working fluid, and pulse duration. The onset of gas generation can be delayed and optimized for maximum volume pumped in the minimum time possible. This has been achieved through the use of a novel numerical model that predicts the onset of gas generation during EO pumping using an optimized pulse voltage waveform. This method allows applying current densities higher than previously reported. Optimal pulse voltage waveforms are calculated based on the previous theories for different current densities and electrolyte molarity. The electroosmotic pump performance is investigated by experimentally measuring the fluid volume displaced and flow rate. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Preparation of nanocomposites resin from seed Pterodon emarginatus doped maghemite nanoparticles.

PubMed

Silveira, L B; Martins, Q S; Maia, J C; Santos, J G

2012-06-01

Electrical characterization and magnetic nanocomposite resin seeds Pterodon emarginatus (PE) doped with nanoparticles of maghemite and treated by different chemical processes is reported in this paper. The pure PE resin showed semiconducting characteristics probably the presence of natural iron oxide in its molecular structure. The analysis of Mössbauer spectra pure resin showed two magnetic sites presented on measurements made at temperature of 300 K. Six "LEDs" to have been doped maghemite nanoparticles forming concentrations of 2.6 x 10(15) to 1.56 x 10(16) particles/cm2 forming the LED-PEMN. In the presence of the applied current versus voltage (0 to 0.9 V) LED-PEMN shown semiconducting properties. In the presence of frequency versus voltage sample of pure resin and LED features small decrease. While samples of LED-PEMN suffers loss frequency linearly with concentration and voltage. The pure PE resin shows high resistance to the applied voltage while the LED-PEMN is observed linear increase with the strength and concentration of nanoparticles of maghemite.

Driving Force of Plasma Bullet in Atmospheric-Pressure Plasma

NASA Astrophysics Data System (ADS)

Yambe, Kiyoyuki; Masuda, Seiya; Kondo, Shoma

2018-06-01

When plasma is generated by applying high-voltage alternating current (AC), the driving force of the temporally and spatially varying electric field is applied to the plasma. The strength of the driving force of the plasma at each spatial position is different because the electrons constituting the atmospheric-pressure nonequilibrium (cold) plasma move at a high speed in space. If the force applied to the plasma is accelerated only by the driving force, the plasma will be accelerated infinitely. The equilibrium between the driving force and the restricting force due to the collision between the plasma and neutral particles determines the inertial force and the drift velocity of the plasma. Consequently, the drift velocity depends on the strength of the time-averaged AC electric field. The pressure applied by the AC electric field equilibrates with the plasma pressure. From the law of conservation of energy, the pressure equilibrium is maintained by varying the drift velocity of the plasma.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of onemore » or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.« less

ELECTRICAL LEAK LOCATION METHOD FOR GEOMEMBRANE LINERS

EPA Science Inventory

Geomembrane liners are sheets of polymeric materials used to prevent leakage of waste from and infiltration of rainwater into solid waste landfills and surface impoundments. The method described consists of voltage applied between the liner and the earth under the liner which pro...

Electrical Polarization of Titanium Surfaces for the Enhancement of Osteoblast Differentiation

PubMed Central

Gittens, Rolando A.; Olivares-Navarrete, Rene; Rettew, Robert; Butera, Robert J.; Alamgir, Faisal M.; Boyan, Barbara D.; Schwartz, Zvi

2014-01-01

Electrical stimulation has been used clinically to promote bone regeneration in cases of fractures with delayed union or nonunion, with several in vitro and in vivo reports suggesting its beneficial effects on bone formation. However, the use of electrical stimulation of titanium (Ti) implants to enhance osseointegration is less understood, in part because of the few in vitro models that attempt to represent the in vivo environment. In this article, the design of a new in vitro system that allows direct electrical stimulation of osteoblasts through their Ti substrates without the flow of exogenous currents through the media is presented, and the effect of applied electrical polarization on osteoblast differentiation and local factor production was evaluated. A custom-made polycarbonate tissue culture plate was designed to allow electrical connections directly underneath Ti disks placed inside the wells, which were supplied with electrical polarization ranging from 100 to 500 mV to stimulate MG63 osteoblasts. Our results show that electrical polarization applied directly through Ti substrates on which the cells are growing in the absence of applied electrical currents may increase osteoblast differentiation and local factor production in a voltage-dependent manner. PMID:23996899

Experimental investigation on a vectorized aerodynamic dielectric barrier discharge plasma actuator array

NASA Astrophysics Data System (ADS)

Neretti, Gabriele; Cristofolini, Andrea; Borghi, Carlo A.

2014-04-01

The Electro-Hydro-Dynamics (EHD) interaction, induced in atmospheric pressure still air by a surface dielectric barrier discharge (DBD) actuator, had been experimentally studied. A plasma aerodynamic actuator array, able to produce a vectorized jet, with the induced airflow oriented toward the desired direction, had been developed. The array was constituted by a sequence of single surface DBD actuators with kapton as dielectric material. An ac voltage in the range of 0-6 kV peak at 15 kHz had been used. The vectorization had been obtained by feeding the upper electrodes with different voltages and by varying the electrical connections. The lower electrodes had been connected either to ground or to the high voltage source, to produce the desired jet orientation and to avoid plasma formation acting in an undesired direction. Voltage and current measurements had been carried out to evaluate waveforms and to estimate the active power delivered to the discharge. Schlieren imaging allowed to visualize the induced jet and to estimate its orientation. Pitot measurements had been performed to obtain velocity profiles for all jet configurations. A proportional relation between the jet deflection angle and the applied voltage had been found. Moreover, a linear relation had been obtained between the maximum speed in the jet direction and the applied voltage. The active power of the discharge is approximated by both a power law function and an exponential function of the applied voltage.

Voltage regulation and power losses reduction in a wind farm integrated MV distribution network

NASA Astrophysics Data System (ADS)

Fandi, Ghaeth; Igbinovia, Famous Omar; Tlusty, Josef; Mahmoud, Rateb

2018-01-01

A medium-voltage (MV) wind production system is proposed in this paper. The system applies a medium-voltage permanent magnet synchronous generator (PMSG) as well as MV interconnection and distribution networks. The simulation scheme of an existing commercial electric-power system (Case A) and a proposed wind farm with a gearless PMSG insulated gate bipolar transistor (IGBT) power electronics converter scheme (Case B) is compared. The analyses carried out in MATLAB/Simulink environment shows an enhanced voltage profile and reduced power losses, thus, efficiency in installed IGBT power electronics devices in the wind farm. The resulting wind energy transformation scheme is a simple and controllable medium voltage application since it is not restrained by the IGBT power electronics voltage source converter (VSC) arrangement. Active and reactive power control is made possible with the aid of the gearless PMSG IGBT power converters.

Method and apparatus for controlling a microturbine

DOEpatents

Garces, Luis Jose; Cardinal, Mark Edward; Sinha, Gautam; Dame, Mark Edward

2005-08-02

An apparatus for controlling a microturbine, the apparatus including: a rectifier adapted for converting at least one generated voltage from the microturbine to a DC link voltage; an inverter adapted for converting the DC link voltage to at least one inverter output voltage, the at least one inverter output voltage being electrically coupled to an external power bus; a starter drive adapted for converting at least one starter input voltage to at least one starter output voltage, the at least one starter input voltage being electrically coupled to the external power bus, the at least one starter output voltage being electrically coupled to the microturbine.

Low-voltage, high-extinction-ratio, Mach-Zehnder silicon optical modulator for CMOS-compatible integration.

PubMed

Ding, Jianfeng; Chen, Hongtao; Yang, Lin; Zhang, Lei; Ji, Ruiqiang; Tian, Yonghui; Zhu, Weiwei; Lu, Yangyang; Zhou, Ping; Min, Rui

2012-01-30

We demonstrate a carrier-depletion Mach-Zehnder silicon optical modulator, which is compatible with CMOS fabrication process and works well at a low driving voltage. This is achieved by the optimization of the coplanar waveguide electrode to reduce the electrical signal transmission loss. At the same time, the velocity and impedance matching are both considered. The 12.5 Gbit/s data transmission experiment of the fabricated device with a 2-mm-long phase shifter is performed. The driving voltages with the swing amplitudes of 1 V and 2 V and the reverse bias voltages of 0.5 V and 0.8 V are applied to the device, respectively. The corresponding extinction ratios are 7.67 and 12.79 dB.

Plasma-enhanced atomic layer deposition of titanium oxynitrides films: A comparative spectroscopic and electrical study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sowińska, Małgorzata, E-mail: malgorzata.sowinska@b-tu.de; Henkel, Karsten; Schmeißer, Dieter

2016-01-15

The process parameters' impact of the plasma-enhanced atomic layer deposition (PE-ALD) method on the oxygen to nitrogen (O/N) ratio in titanium oxynitride (TiO{sub x}N{sub y}) films was studied. Titanium(IV)isopropoxide in combination with NH{sub 3} plasma and tetrakis(dimethylamino)titanium by applying N{sub 2} plasma processes were investigated. Samples were characterized by the in situ spectroscopic ellipsometry, x-ray photoelectron spectroscopy, and electrical characterization (current–voltage: I-V and capacitance–voltage: C-V) methods. The O/N ratio in the TiO{sub x}N{sub y} films is found to be very sensitive for their electric properties such as conductivity, dielectric breakdown, and permittivity. Our results indicate that these PE-ALD film propertiesmore » can be tuned, via the O/N ratio, by the selection of the process parameters and precursor/coreactant combination.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Zhemin; Department of Physical Electronics, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8552; Taguchi, Dai

The details of turnover process of spontaneous polarization and associated carrier motions in indium-tin oxide/poly-(vinylidene-trifluoroethylene)/pentacene/Au capacitor were analyzed by coupling displacement current measurement (DCM) and electric-field-induced optical second-harmonic generation (EFISHG) measurement. A model was set up from DCM results to depict the relationship between electric field in semiconductor layer and applied external voltage, proving that photo illumination effect on the spontaneous polarization process lied in variation of semiconductor conductivity. The EFISHG measurement directly and selectively probed the electric field distribution in semiconductor layer, modifying the model and revealing detailed carrier behaviors involving photo illumination effect, dipole reversal, and interfacial chargingmore » in the device. A further decrease of DCM current in the low voltage region under illumination was found as the result of illumination effect, and the result was argued based on the changing of the total capacitance of the double-layer capacitors.« less

Electric field induced metal-insulator transition in VO2 thin film based on FTO/VO2/FTO structure

NASA Astrophysics Data System (ADS)

Hao, Rulong; Li, Yi; Liu, Fei; Sun, Yao; Tang, Jiayin; Chen, Peizu; Jiang, Wei; Wu, Zhengyi; Xu, Tingting; Fang, Baoying

2016-03-01

A VO2 thin film has been prepared using a DC magnetron sputtering method and annealing on an F-doped SnO2 (FTO) conductive glass substrate. The FTO/VO2/FTO structure was fabricated using photolithography and a chemical etching process. The temperature dependence of the I-V hysteresis loop for the FTO/VO2/FTO structure has been analyzed. The threshold voltage decreases with increasing temperature, with a value of 9.2 V at 20 °C. The maximum transmission modulation value of the FTO/VO2/FTO structure is 31.4% under various temperatures and voltages. Optical modulation can be realized in the structure by applying an electric field.

Electric-field-driven phase transition in vanadium dioxide

NASA Astrophysics Data System (ADS)

Wu, B.; Zimmers, A.; Aubin, H.; Gosh, R.; Liu, Y.; Lopez, R.

2011-03-01

In recent years, various strongly correlated materials have shown sharp switching from insulator to metallic state in their I(V) transport curves. Determining if this is purely an out of equilibrium phenomena (due to the strong electric field applied throughout the sample) or simply a Joule heating issue is still an open question. To address this issue, we have first measured local I(V) curves in vanadium dioxide (VO2) Mott insulator at various temperatures using a conducting AFM setup and determined the voltage threshold of the insulator to metal switching. By lifting the tip above the surface (> 35 nm) , wehavethenmeasuredthepurelyelectrostaticforcebetweenthetipandsamplesurfaceasthevoltagebetweenthesetwowasincreased . Inaverynarrowtemperaturerange (below 360 K) , atipheightrange (below 60 nm) andavoltageappliedrange (above 8 V) , weobservedswitchingintheelectrostaticforce (telegraphicnoisevs . timeandvs . voltage) . ThispurelyelectricfieldeffectshowsthattheswitchingphenomenonisstillpresentevenwithoutJouleheatinginVO 2 .

Frequency, thermal and voltage supercapacitor characterization and modeling

NASA Astrophysics Data System (ADS)

Rafik, F.; Gualous, H.; Gallay, R.; Crausaz, A.; Berthon, A.

A simple electrical model has been established to describe supercapacitor behaviour as a function of frequency, voltage and temperature for hybrid vehicle applications. The electrical model consists of 14 RLC elements, which have been determined from experimental data using electrochemical impedance spectroscopy (EIS) applied on a commercial supercapacitor. The frequency analysis has been extended for the first time to the millihertz range to take into account the leakage current and the charge redistribution on the electrode. Simulation and experimental results of supercapacitor charge and discharge have been compared and analysed. A good correlation between the model and the EIS results has been demonstrated from 1 mHz to 1 kHz, from -20 to 60 °C and from 0 to 2.5 V.

Electromechanical Displacement Detection With an On-Chip High Electron Mobility Transistor Amplifier

NASA Astrophysics Data System (ADS)

Oda, Yasuhiko; Onomitsu, Koji; Kometani, Reo; Warisawa, Shin-ichi; Ishihara, Sunao; Yamaguchi, Hiroshi

2011-06-01

We developed a highly sensitive displacement detection scheme for a GaAs-based electromechanical resonator using an integrated high electron mobility transistor (HEMT). Piezoelectric voltage generated by the vibration of the resonator is applied to the gate of the HEMT, resulting in the on-chip amplification of the signal voltage. This detection scheme achieves a displacement sensitivity of ˜9 pm·Hz-1/2, which is one of the highest among on-chip purely electrical displacement detection schemes at room temperature.

Optical and Electric Multifunctional CMOS Image Sensors for On-Chip Biosensing Applications

PubMed Central

Tokuda, Takashi; Noda, Toshihiko; Sasagawa, Kiyotaka; Ohta, Jun

2010-01-01

In this review, the concept, design, performance, and a functional demonstration of multifunctional complementary metal-oxide-semiconductor (CMOS) image sensors dedicated to on-chip biosensing applications are described. We developed a sensor architecture that allows flexible configuration of a sensing pixel array consisting of optical and electric sensing pixels, and designed multifunctional CMOS image sensors that can sense light intensity and electric potential or apply a voltage to an on-chip measurement target. We describe the sensors’ architecture on the basis of the type of electric measurement or imaging functionalities. PMID:28879978

Electrical Behavior of Copper Mine Tailings During EKR with Modified Electric Fields.

PubMed

Rojo, Adrian; Hansen, Henrik K; Monárdez, Omara; Jorquera, Carlos; Santis, Paulina; Inostroza, Paula

2017-03-01

Electro-kinetic remediation (EKR) with sinusoidal electric field obtained simultaneously with DC/AC voltage reduce the polarization of the EKR with DC voltage. The DC voltage value defines the presence of a periodic polarity reversal of the cell and the electrical charge for electro-kinetic transport. In this case, the AC frequency favors the breaking of polarization conditions resulting from the EKR with DC voltage. However, with high frequencies a negative effect occurs where the tailings behave as a filter circuit, discriminating frequencies of an electric signal. The goal of this work is to analyse the electrical behaviour of tailings in EKR experiments. The conditions selected were: DC/AC voltages: 10/15 and 20/25 V (peak values), and AC voltage frequencies 50-2000 Hz. When the AC frequency reaches 2000 Hz, the copper removal tends to zero, indicating that the tailing behaves as a high-pass filter in which the DC voltage was filtered out.

Baseline tests of the Volkswagen transporter electric delivery van

NASA Technical Reports Server (NTRS)

Soltis, R. F.; Mcbrien, E. F.; Bozek, J. M.; Gourash, F.

1978-01-01

The Volkswagen Transporter, an electric delivery van, was tested as part of an Energy Research and Development Administration (ERDA) project to characterize the state of the art of electric vehicles. The Volkswagen Transporter is a standard Volkswagen van that has been converted to an electric vehicle. It is powered by a 144-volt traction battery. A direct current (dc) chopper controller, actuated by a conventional accelerator pedal, regulates the voltage or power applied to the 16-kilowatt (21-hp) motor. The braking system uses conventional hydraulic braking in combination with an electric regenerative braking system. The Volkswagen vehicle performance test results are presented.

Electric field effect on exchange interaction in ultrathin Co films with ionic liquids

NASA Astrophysics Data System (ADS)

Ishibashi, Mio; Yamada, Kihiro T.; Shiota, Yoichi; Ando, Fuyuki; Koyama, Tomohiro; Kakizakai, Haruka; Mizuno, Hayato; Miwa, Kazumoto; Ono, Shimpei; Moriyama, Takahiro; Chiba, Daichi; Ono, Teruo

2018-06-01

Electric-field modulations of magnetic properties have been extensively studied not only for practical applications but also for fundamental interest. In this study, we investigated the electric field effect on the exchange interaction in ultrathin Co films with ionic liquids. The exchange coupling J was characterized from the direct magnetization measurement as a function of temperature using Pt/ultrathin Co/MgO structures. The trend of the electric field effect on J is in good agreement with that of the theoretical prediction, and a large change in J by applying a gate voltage was observed by forming an electric double layer using ionic liquids.

Electrode assembly for a fluidized bed apparatus

DOEpatents

Schora, Jr., Frank C.; Matthews, Charles W.; Knowlton, Ted M.

1976-11-23

An electrode assembly comprising a high voltage electrode having a generally cylindrical shape and being electrically connected to a high voltage source, where the cylinder walls may be open to flow of fluids and solids; an electrically grounded support electrode supporting said high voltage electrode by an electrically insulating support where both of the electrically grounded and electrically insulating support may be hollow; and an electrically grounded liner electrode arranged concentrically around both the high voltage and support electrodes. This assembly is specifically adapted for use in a fluidized bed chemical reactor as an improved heating means therefor.

Time varying voltage combustion control and diagnostics sensor

DOEpatents

Chorpening, Benjamin T [Morgantown, WV; Thornton, Jimmy D [Morgantown, WV; Huckaby, E David [Morgantown, WV; Fincham, William [Fairmont, WV

2011-04-19

A time-varying voltage is applied to an electrode, or a pair of electrodes, of a sensor installed in a fuel nozzle disposed adjacent the combustion zone of a continuous combustion system, such as of the gas turbine engine type. The time-varying voltage induces a time-varying current in the flame which is measured and used to determine flame capacitance using AC electrical circuit analysis. Flame capacitance is used to accurately determine the position of the flame from the sensor and the fuel/air ratio. The fuel and/or air flow rate (s) is/are then adjusted to provide reduced flame instability problems such as flashback, combustion dynamics and lean blowout, as well as reduced emissions. The time-varying voltage may be an alternating voltage and the time-varying current may be an alternating current.

On the reliability of voltage and power as input parameters for the characterization of high power ultrasound applications

NASA Astrophysics Data System (ADS)

Haller, Julian; Wilkens, Volker

2012-11-01

For power levels up to 200 W and sonication times up to 60 s, the electrical power, the voltage and the electrical impedance (more exactly: the ratio of RMS voltage and RMS current) have been measured for a piezocomposite high intensity therapeutic ultrasound (HITU) transducer with integrated matching network, two piezoceramic HITU transducers with external matching networks and for a passive dummy 50 Ω load. The electrical power and the voltage were measured during high power application with an inline power meter and an RMS voltage meter, respectively, and the complex electrical impedance was indirectly measured with a current probe, a 100:1 voltage probe and a digital scope. The results clearly show that the input RMS voltage and the input RMS power change unequally during the application. Hence, the indication of only the electrical input power or only the voltage as the input parameter may not be sufficient for reliable characterizations of ultrasound transducers for high power applications in some cases.

Viscous properties of aluminum oxide nanotubes and aluminium oxide nanoparticles - silicone oil suspensions

NASA Astrophysics Data System (ADS)

Thapa, Ram; French, Steven; Delgado, Adrian; Ramos, Carlos; Gutierrez, Jose; Chipara, Mircea; Lozano, Karen

2010-03-01

Electrorheological (ER) fluids consisting of γ-aluminum oxide nanotubes and γ-aluminum oxide nanoparticles dispersed within silicone oil were prepared. The relationship between shear stress and shear rate was measured and theoretically simulated by using an extended Bingham model for both the rheological and electrorheological features of these systems. Shear stress and viscosity showed a sharp increase for the aluminum oxide nanotubes suspensions subjected to applied electric fields whereas aluminum oxide nanoparticles suspensions showed a moderate change. It was found that the transition from liquid to solid state (mediated by the applied electric field) can be described by a power law and that for low applied voltages the relationship is almost linear.

Electric current distribution of a multiwall carbon nanotube

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Li-Ying; Chang, Chia-Seng, E-mail: jasonc@phys.sinica.edu.tw; Institute of Physics, Academia Sinica, Taipei 11529, Taiwan

2016-07-15

The electric current distribution in a multiwall carbon nanotube (MWCNT) was studied by in situ measuring the electric potential along an individual MWCNT in the ultra-high vacuum transmission electron microscope (TEM). The current induced voltage drop along each section of a side-bonded MWCNT was measured by a potentiometric probe in TEM. We have quantitatively derived that the current on the outermost shell depends on the applied current and the shell diameter. More proportion of the total electronic carriers hop into the inner shells when the applied current is increased. The larger a MWCNT’s diameter is, the easier the electronic carriersmore » can hop into the inner shells. We observed that, for an 8 nm MWCNT with 10 μA current applied, 99% of the total current was distributed on the outer two shells.« less

Electron density in surface barrier discharge emerging at argon/water interface: quantification for streamers and leaders

NASA Astrophysics Data System (ADS)

Cvetanović, Nikola; Galmiz, Oleksandr; Synek, Petr; Zemánek, Miroslav; Brablec, Antonín; Hoder, Tomáš

2018-02-01

Optical emission spectroscopy, fast intensified CCD imaging and electrical measurements were applied to investigate the basic plasma parameters of surface barrier discharge emerging from a conductive water electrode. The discharge was generated at the triple-line interface of atmospheric pressure argon gas and conductive water solution at the fused silica dielectrics using a sinusoidal high-voltage waveform. The spectroscopic methods of atomic line broadening and molecular spectroscopy were used to determine the electron densities and the gas temperature in the active plasma. These parameters were obtained for both applied voltage polarities and resolved spatially. Two different spectral signatures were identified in the spatially resolved spectra resulting in electron densities differing by two orders of magnitude. It is shown that two discharge mechanisms take a place: the streamer and the leader one, with electron densities of 1014 and 1016 cm-3, respectively. This spectroscopic evidence is supported by the combined diagnostics of electrical current measurements and phase-resolved intensified CCD camera imaging.

Dielectrophoretic immobilization of proteins: Quantification by atomic force microscopy.

PubMed

Laux, Eva-Maria; Knigge, Xenia; Bier, Frank F; Wenger, Christian; Hölzel, Ralph

2015-09-01

The combination of alternating electric fields with nanometer-sized electrodes allows the permanent immobilization of proteins by dielectrophoretic force. Here, atomic force microscopy is introduced as a quantification method, and results are compared with fluorescence microscopy. Experimental parameters, for example the applied voltage and duration of field application, are varied systematically, and the influence on the amount of immobilized proteins is investigated. A linear correlation to the duration of field application was found by atomic force microscopy, and both microscopical methods yield a square dependence of the amount of immobilized proteins on the applied voltage. While fluorescence microscopy allows real-time imaging, atomic force microscopy reveals immobilized proteins obscured in fluorescence images due to low S/N. Furthermore, the higher spatial resolution of the atomic force microscope enables the visualization of the protein distribution on single nanoelectrodes. The electric field distribution is calculated and compared to experimental results with very good agreement to atomic force microscopy measurements. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of anode-cathode geometry on performance of the HIP-1 hot ion plasma. [magnetic mirrors

NASA Technical Reports Server (NTRS)

Lauver, M. R.

1978-01-01

Hot-ion hydrogen plasma experiments were conducted in the NASA Lewis HIP-1 magnetic mirror facility to determine how the ion temperature was influenced by the axial position of the cathode tips relative to the anodes. A steady-state EXB plasma was formed by applying a strong radially inward dc electric field near the throats of the magnetic mirrors. The dc electric field was created between hollow cathode rods inside hollow anode cylinders, both concentric with the magnetic axis. The highest ion temperatures, 900 eV, were attained when the tip of each cathode was in the same plane as the end of its anode. These temperatures were reached with 22 kV applied to the electrodes in a field of 1.1 tesla. Scaling relations were empirically determined for ion temperature and the product of ion density and neutral particle density as a function of cathode voltage, discharge current, and electrode positions. Plasma discharge current vs voltage (I-V) characteristics were determined.

Flow characterization of electroconvective micromixer with a nanoporous polymer membrane in-situ fabricated using a laser polymerization technique

PubMed Central

Hwang, Sangbeom; Song, Simon

2015-01-01

Electroconvection is known to cause strong convective mixing in a microchannel near a nanoporous membrane or a nanochannel in contact with an electrolyte solution due to the external electric field. This study addresses micromixer behavior subject to electroconvection occurring near a nanoporous membrane in-situ fabricated by a laser polymerization technique on a microfluidic chip. We found that the micromixer behavior can be categorized into three regimes. Briefly, the weak electroconvection regime is characterized by weak mixing performance at a low applied voltage and KCl concentration, whereas the strong electroconvection regime has a high mixing performance when the applied voltage and KCl concentration are moderately high. Finally, the incomplete electroconvection regime has an incomplete electric double-layer overlap in the nanopores of the membrane when the electrolyte concentration is very high. The mixing index reached 0.92 in the strong electroconvection regime. The detailed fabrication methods for the micromixer and characterization results are discussed in this paper. PMID:26064195

Flow characterization of electroconvective micromixer with a nanoporous polymer membrane in-situ fabricated using a laser polymerization technique.

PubMed

Hwang, Sangbeom; Song, Simon

2015-05-01

Electroconvection is known to cause strong convective mixing in a microchannel near a nanoporous membrane or a nanochannel in contact with an electrolyte solution due to the external electric field. This study addresses micromixer behavior subject to electroconvection occurring near a nanoporous membrane in-situ fabricated by a laser polymerization technique on a microfluidic chip. We found that the micromixer behavior can be categorized into three regimes. Briefly, the weak electroconvection regime is characterized by weak mixing performance at a low applied voltage and KCl concentration, whereas the strong electroconvection regime has a high mixing performance when the applied voltage and KCl concentration are moderately high. Finally, the incomplete electroconvection regime has an incomplete electric double-layer overlap in the nanopores of the membrane when the electrolyte concentration is very high. The mixing index reached 0.92 in the strong electroconvection regime. The detailed fabrication methods for the micromixer and characterization results are discussed in this paper.

Three dimensional measurement with an electrically tunable focused plenoptic camera

NASA Astrophysics Data System (ADS)

Lei, Yu; Tong, Qing; Xin, Zhaowei; Wei, Dong; Zhang, Xinyu; Liao, Jing; Wang, Haiwei; Xie, Changsheng

2017-03-01

A liquid crystal microlens array (LCMLA) with an arrayed microhole pattern electrode based on nematic liquid crystal materials using a fabrication method including traditional UV-photolithography and wet etching is presented. Its focusing performance is measured under different voltage signals applied between the electrodes of the LCMLA. The experimental outcome shows that the focal length of the LCMLA can be tuned easily by only changing the root mean square value of the voltage signal applied. The developed LCMLA is further integrated with a main lens and an imaging sensor to construct a LCMLA-based focused plenoptic camera (LCFPC) prototype. The focused range of the LCFPC can be shifted electrically along the optical axis of the imaging system. The principles and methods for acquiring several key parameters such as three dimensional (3D) depth, positioning, and motion expression are given. The depth resolution is discussed in detail. Experiments are carried out to obtain the static and dynamic 3D information of objects chosen.

Three dimensional measurement with an electrically tunable focused plenoptic camera.

PubMed

Lei, Yu; Tong, Qing; Xin, Zhaowei; Wei, Dong; Zhang, Xinyu; Liao, Jing; Wang, Haiwei; Xie, Changsheng

2017-03-01

A liquid crystal microlens array (LCMLA) with an arrayed microhole pattern electrode based on nematic liquid crystal materials using a fabrication method including traditional UV-photolithography and wet etching is presented. Its focusing performance is measured under different voltage signals applied between the electrodes of the LCMLA. The experimental outcome shows that the focal length of the LCMLA can be tuned easily by only changing the root mean square value of the voltage signal applied. The developed LCMLA is further integrated with a main lens and an imaging sensor to construct a LCMLA-based focused plenoptic camera (LCFPC) prototype. The focused range of the LCFPC can be shifted electrically along the optical axis of the imaging system. The principles and methods for acquiring several key parameters such as three dimensional (3D) depth, positioning, and motion expression are given. The depth resolution is discussed in detail. Experiments are carried out to obtain the static and dynamic 3D information of objects chosen.

Modeling in conventional and supra electroporation for model cell with organelles

NASA Astrophysics Data System (ADS)

Sulaeman, Muhammad Yangki; Widita, Rena

2015-09-01

Electroporation is a formation of pores in the membrane cell due to the external electric field applied to the cell. There are two types of electroporation, conventional and supra-electroporation. The purpose of creating pores in the cell using conventional electroporation are to increase the effectiveness of chemotherapy (electrochemotherapy) and to kill cancer tissue using irreversible electroporation. Supra-electroporation shows that it can induce electroporation in the organell inside the cell, so it can kill the cell by apoptosis mechanism. Modeling of electroporation phenomenon on a model cell had been done by using software COMSOL Multiphysics 4.3b with the applied external electric field used are 1.1 kV/cm for conventional electroporation and 60 kV/cm for supra-electroporation to find the difference between transmembrane voltage and pore density for both electroporation. It can be concluded from the results that there is a big difference between transmembrane voltage and pores density on conventional and supra electroporation on model cell.

Optical switch based on the electrically controlled liquid crystal interface.

PubMed

Komar, Andrei A; Tolstik, Alexei L; Melnikova, Elena A; Muravsky, Alexander A

2015-06-01

The peculiarities of the linearly polarized light beam reflection at the interface within the bulk of a nematic liquid crystal (NLC) cell with different orientations of the director are analyzed. Two methods to create the interface are considered. Combination of the planar and homeotropic orientations of the NLC director is realized by means of a spatially structured electrode under the applied voltage. In-plane patterned azimuthal alignment of the NLC director is created by the patterned rubbing alignment technique. All possible orthogonal orientations of the LC director are considered; the configurations for realization of total internal reflection are determined. The revealed relationship between the propagation of optical beams in a liquid crystal material and polarization of laser radiation has enabled realization of the spatial separation for the orthogonally polarized light beams at the interface between two regions of NLC with different director orientations (domains). Owing to variations in the applied voltage and, hence, in the refractive index gradient, the light beam propagation directions may be controlled electrically.

Effects of cyclic impacts on the performance of a piezo-composite electricity generating element in a d33 mode energy harvesting.

PubMed

Pham, Van Lai; Ha, Ngoc San; Goo, Nam Seo; Choo, Jinkyo F

2014-10-01

The increasing use of piezoelectric generators to harvest energy from various ambient sources requires the establishment of durability data for piezoelectric materials. In this paper, a d3 mode piezocomposite electricity generating element (PCGE) was tested for its durability under cyclic impact loading. For this purpose, a motor driven lever system was designed to apply constant impact force on PCGEs. To investigate the durability of PCGEs, the output voltage of the PCGEs was observed upon repeated application of an impact force until eventual loss of the generated voltage. The experimental results enabled to determine the number of cycles until which PCGEs can be used without loss of their electricity generation performance with respect to the stress level applied on the PCGEs. At low stress level (around 0.76 MPa or lower), the PCGE showed almost insignificant degradation even after 2 million cycles whereas degradation occurred sooner (after 8 x 10(5) cycles) at higher stress levels (around 0.92 MPa or higher). The effects of impact loading on the durability of the PCGEs were also examined by X-ray photographs of the specimens.

Mesoscopic Field-Effect-Induced Devices in Depleted Two-Dimensional Electron Systems

NASA Astrophysics Data System (ADS)

Bachsoliani, N.; Platonov, S.; Wieck, A. D.; Ludwig, S.

2017-12-01

Nanoelectronic devices embedded in the two-dimensional electron system (2DES) of a GaAs /(Al ,Ga )As heterostructure enable a large variety of applications ranging from fundamental research to high-speed transistors. Electrical circuits are thereby commonly defined by creating barriers for carriers by the selective depletion of a preexisting 2DES. We explore an alternative approach: we deplete the 2DES globally by applying a negative voltage to a global top gate and screen the electric field of the top gate only locally using nanoscale gates placed on the wafer surface between the plane of the 2DES and the top gate. Free carriers are located beneath the screen gates, and their properties can be controlled by means of geometry and applied voltages. This method promises considerable advantages for the definition of complex circuits by the electric-field effect, as it allows us to reduce the number of gates and simplify gate geometries. Examples are carrier systems with ring topology or large arrays of quantum dots. We present a first exploration of this method pursuing field effect, Hall effect, and Aharonov-Bohm measurements to study electrostatic, dynamic, and coherent properties.

NREL Studies Voltage Regulation Strategies for Hawaiian Electric Companies

Science.gov Websites

, electric vehicles, and electric water heater control to understand their potential in supporting voltage locally. Meanwhile, NREL has also completed a pilot inverter control study, in which data from advanced voltage regulation, such as battery storage, water heater control, and electric vehicles, will be done

NREL Partners With General Electric, Duke Energy on Grid Voltage Regulation

Science.gov Websites

Study | Energy Systems Integration Facility | NREL NREL Partners With General Electric, Duke Energy on Grid Voltage Regulation Study NREL Partners With General Electric, Duke Energy on Grid Voltage Regulation Study When a large solar photovoltaic (PV) system is connected to the electric grid, a utility's

Modeling and simulation of deformation of hydrogels responding to electric stimulus.

PubMed

Li, Hua; Luo, Rongmo; Lam, K Y

2007-01-01

A model for simulation of pH-sensitive hydrogels is refined in this paper to extend its application to electric-sensitive hydrogels, termed the refined multi-effect-coupling electric-stimulus (rMECe) model. By reformulation of the fixed-charge density and consideration of finite deformation, the rMECe model is able to predict the responsive deformations of the hydrogels when they are immersed in a bath solution subject to externally applied electric field. The rMECe model consists of nonlinear partial differential governing equations with chemo-electro-mechanical coupling effects and the fixed-charge density with electric-field effect. By comparison between simulation and experiment extracted from literature, the model is verified to be accurate and stable. The rMECe model performs quantitatively for deformation analysis of the electric-sensitive hydrogels. The influences of several physical parameters, including the externally applied electric voltage, initial fixed-charge density, hydrogel strip thickness, ionic strength and valence of surrounding solution, are discussed in detail on the displacement and average curvature of the hydrogels.

Low temperature nano-spin filtering using a diluted magnetic semiconductor core-shell quantum dot

NASA Astrophysics Data System (ADS)

Chattopadhyay, Saikat; Sen, Pratima; Andrews, Joshep Thomas; Sen, Pranay Kumar

2014-07-01

The spin polarized electron transport properties and spin polarized tunneling current have been investigated analytically in a diluted magnetic semiconductor core-shell quantum dot in the presence of applied electric and magnetic fields. Assuming the electron wave function to satisfy WKB approximation, the electron energy eigenvalues have been calculated. The spin polarized tunneling current and the spin dependent tunneling coefficient are obtained by taking into account the exchange interaction and Zeeman splitting. Numerical estimates made for a specific diluted magnetic semiconductor, viz., Zn1-xMnxSe/ZnS core-shell quantum dot establishes the possibility of a nano-spin filter for a particular biasing voltage and applied magnetic field. Influence of applied voltage on spin polarized electron transport has been investigated in a CSQD.

Electrical pulse generator

DOEpatents

Norris, Neil J.

1979-01-01

A technique for generating high-voltage, wide dynamic range, shaped electrical pulses in the nanosecond range. Two transmission lines are coupled together by resistive elements distributed along the length of the lines. The conductance of each coupling resistive element as a function of its position along the line is selected to produce the desired pulse shape in the output line when an easily produced pulse, such as a step function pulse, is applied to the input line.

Baseline tests of the C. H. Waterman DAF electric passenger vehicle

NASA Technical Reports Server (NTRS)

Sargent, N. B.; Maslowski, E. A.; Soltis, R. F.; Schuh, R. M.

1977-01-01

An electric vehicle was tested as part of an Energy Research Development Administration (ERDA) project to characterize the state-of-the-art of electric vehicles. The Waterman vehicle performance test results are presented in this report. The vehicle is a converted four-passenger DAF 46 sedan. It is powered by sixteen 6-volt traction batteries through a three-step contactor controller actuated by a foot throttle to change the voltage applied to the 6.7 kW motor. The braking system is a conventional hydraulic braking system.

Liquid metal electric pump

DOEpatents

Abbin, J.P.; Andraka, C.E.; Lukens, L.L.; Moreno, J.B.

1992-01-14

An electrical pump for pumping liquid metals to high pressures in high temperature environments without the use of magnets or moving mechanical parts. The pump employs a non-porous solid electrolyte membrane, typically ceramic, specific to the liquid metal to be pumped. A DC voltage is applied across the thickness of the membrane causing ions to form and enter the membrane on the electrically positive surface, with the ions being neutralized on the opposite surface. This action provides pumping of the liquid metal from one side of the non-porous solid electrolyte membrane to the other. 3 figs.

Liquid metal electric pump

DOEpatents

Abbin, Joseph P.; Andraka, Charles E.; Lukens, Laurance L.; Moreno, James B.

1992-01-01

An electrical pump for pumping liquid metals to high pressures in high temperature environments without the use of magnets or moving mechanical parts. The pump employs a non-porous solid electrolyte membrane, typically ceramic, specific to the liquid metal to be pumped. A DC voltage is applied across the thickness of the membrane causing ions to form and enter the membrane on the electrically positive surface, with the ions being neutralized on the opposite surface. This action provides pumping of the liquid metal from one side of the non-porous solid electrolyte membrane to the other.

Voltage-controlled magnetization switching in MRAMs in conjunction with spin-transfer torque and applied magnetic field

NASA Astrophysics Data System (ADS)

Munira, Kamaram; Pandey, Sumeet C.; Kula, Witold; Sandhu, Gurtej S.

2016-11-01

Voltage-controlled magnetic anisotropy (VCMA) effect has attracted a significant amount of attention in recent years because of its low cell power consumption during the anisotropy modulation of a thin ferromagnetic film. However, the applied voltage or electric field alone is not enough to completely and reliably reverse the magnetization of the free layer of a magnetic random access memory (MRAM) cell from anti-parallel to parallel configuration or vice versa. An additional symmetry-breaking mechanism needs to be employed to ensure the deterministic writing process. Combinations of voltage-controlled magnetic anisotropy together with spin-transfer torque (STT) and with an applied magnetic field (Happ) were evaluated for switching reliability, time taken to switch with low error rate, and energy consumption during the switching process. In order to get a low write error rate in the MRAM cell with VCMA switching mechanism, a spin-transfer torque current or an applied magnetic field comparable to the critical current and field of the free layer is necessary. In the hybrid processes, the VCMA effect lowers the duration during which the higher power hungry secondary mechanism is in place. Therefore, the total energy consumed during the hybrid writing processes, VCMA + STT or VCMA + Happ, is less than the energy consumed during pure spin-transfer torque or applied magnetic field switching.

Maximum power point tracking analysis of a coreless ironless electric generator for renewable energy application

NASA Astrophysics Data System (ADS)

Razali, Akhtar; Rahman, Fadhlur; Leong, Yap Wee; Razali Hanipah, Mohd; Azri Hizami, Mohd

2018-04-01

The magnetism attraction between permanent magnets and soft ironcore lamination in a conventional electric ironcore generator is often known as cogging. Cogging requires an additional input power to overcome, hence became one of the power loss sources. With the increasing of power output, the cogging is also proportionally increased. This leads to the increasing of the supplied power of the driver motor to overcome the cog. Therefore, this research is embarked to study fundamentally about the possibility of removing ironcore lamination in an electric generator to see its performance characteristic. In the maximum power point tracking test, the fabricated ironless coreless electricity generator was tested by applying the load on the ironless coreless electricity generator optimization to maximize the power generated, voltage and the current produced by the ironless coreless electricity generator when the rotational speed of the rotor increased throughout the test. The rotational torque and power output are measured, and efficiency is then analyzed. Results indicated that the generator produced RMS voltage of 200VAC at rotational speed of 318 RPM. Torque required to rotate the generator was at 10.8Nm. The generator had working efficiency of 77.73% and the power generated was at 280W.

Simultaneous control of thermoelectric properties in p- and n-type materials by electric double-layer gating: New design for thermoelectric device

NASA Astrophysics Data System (ADS)

Takayanagi, Ryohei; Fujii, Takenori; Asamitsu, Atsushi

2015-05-01

We report a novel design of a thermoelectric device that can control the thermoelectric properties of p- and n-type materials simultaneously by electric double-layer gating. Here, p-type Cu2O and n-type ZnO were used as the positive and negative electrodes of the electric double-layer capacitor structure. When a gate voltage was applied between the two electrodes, holes and electrons accumulated on the surfaces of Cu2O and ZnO, respectively. The thermopower was measured by applying a thermal gradient along the accumulated layer on the electrodes. We demonstrate here that the accumulated layers worked as a p-n pair of the thermoelectric device.

Electrically tunable zero dispersion wavelengths in photonic crystal fibers filled with a dual frequency addressable liquid crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahle, Markus, E-mail: markus.wahle@uni-paderborn.de; Kitzerow, Heinz-Siegfried

2015-11-16

We present a liquid crystal (LC) infiltrated photonic crystal fiber, which enables the electrical tuning of the position of zero dispersion wavelengths (ZDWs). A dual frequency addressable liquid crystal is aligned perpendicular on the inclusion walls of a photonic crystal fiber, which results in an escaped radial director field. The orientation of the LC is controlled by applying an external electric field. Due to the high index of the liquid crystal the fiber guides light by the photonic band gap effect. Multiple ZDWs exist in the visible and near infrared. The positions of the ZDWs can be either blue ormore » red shifted depending on the frequency of the applied voltage.« less

Ozone generation by negative corona discharge: the effect of Joule heating

NASA Astrophysics Data System (ADS)

Yanallah, K.; Pontiga, F.; Fernández-Rueda, A.; Castellanos, A.; Belasri, A.

2008-10-01

Ozone generation in pure oxygen using a wire-to-cylinder corona discharge reactor is experimentally and numerically investigated. Ozone concentration is determined by means of direct UV spectroscopy and the effects of Joule heating and ozone decomposition on the electrodes are analysed for different discharge gaps. The numerical model combines the physical processes in the corona discharge with the chemistry of ozone formation and destruction. The chemical kinetics model and the electrical model are coupled through Poisson's equation, and the current-voltage (CV) characteristic measured in experiments is used as input data to the numerical simulation. The numerical model is able to predict the radial distributions of electrons, ions, atoms and molecules for each applied voltage of the CV characteristic. In particular, the evolution of ozone density inside the discharge cell has been investigated as a function of current intensity and applied voltage.

Ionic liquid versus SiO 2 gated a-IGZO thin film transistors: A direct comparison

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony T.

Here, ionic liquid gated field effect transistors have been extensively studied due to their low operation voltage, ease of processing and the realization of high electric fields at low bias voltages. Here, we report ionic liquid (IL) gated thin film transistors (TFTs) based on amorphous Indium Gallium Zinc Oxide (a-IGZO) active layers and directly compare the characteristics with a standard SiO 2 gated device. The transport measurements of the top IL gated device revealed the n-channel property of the IGZO thin film with a current ON/OFF ratio ~10 5, a promising field effect mobility of 14.20 cm 2V –1s –1,more » and a threshold voltage of 0.5 V. Comparable measurements on the bottom SiO2 gate insulator revealed a current ON/OFF ratio >108, a field effect mobility of 13.89 cm 2V –1s –1 and a threshold voltage of 2.5 V. Furthermore, temperature-dependent measurements revealed that the ionic liquid electric double layer can be “frozen-in” by cooling below the glass transition temperature with an applied electrical bias. Positive and negative freezing bias locks-in the IGZO TFT “ON” and “OFF” state, respectively, which could lead to new switching and possibly non-volatile memory applications.« less

Ionic liquid versus SiO 2 gated a-IGZO thin film transistors: A direct comparison

DOE PAGES

Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony T.; ...

2015-08-12

Here, ionic liquid gated field effect transistors have been extensively studied due to their low operation voltage, ease of processing and the realization of high electric fields at low bias voltages. Here, we report ionic liquid (IL) gated thin film transistors (TFTs) based on amorphous Indium Gallium Zinc Oxide (a-IGZO) active layers and directly compare the characteristics with a standard SiO 2 gated device. The transport measurements of the top IL gated device revealed the n-channel property of the IGZO thin film with a current ON/OFF ratio ~10 5, a promising field effect mobility of 14.20 cm 2V –1s –1,more » and a threshold voltage of 0.5 V. Comparable measurements on the bottom SiO2 gate insulator revealed a current ON/OFF ratio >108, a field effect mobility of 13.89 cm 2V –1s –1 and a threshold voltage of 2.5 V. Furthermore, temperature-dependent measurements revealed that the ionic liquid electric double layer can be “frozen-in” by cooling below the glass transition temperature with an applied electrical bias. Positive and negative freezing bias locks-in the IGZO TFT “ON” and “OFF” state, respectively, which could lead to new switching and possibly non-volatile memory applications.« less

The eGo grid model: An open-source and open-data based synthetic medium-voltage grid model for distribution power supply systems

NASA Astrophysics Data System (ADS)

Amme, J.; Pleßmann, G.; Bühler, J.; Hülk, L.; Kötter, E.; Schwaegerl, P.

2018-02-01

The increasing integration of renewable energy into the electricity supply system creates new challenges for distribution grids. The planning and operation of distribution systems requires appropriate grid models that consider the heterogeneity of existing grids. In this paper, we describe a novel method to generate synthetic medium-voltage (MV) grids, which we applied in our DIstribution Network GeneratOr (DINGO). DINGO is open-source software and uses freely available data. Medium-voltage grid topologies are synthesized based on location and electricity demand in defined demand areas. For this purpose, we use GIS data containing demand areas with high-resolution spatial data on physical properties, land use, energy, and demography. The grid topology is treated as a capacitated vehicle routing problem (CVRP) combined with a local search metaheuristics. We also consider the current planning principles for MV distribution networks, paying special attention to line congestion and voltage limit violations. In the modelling process, we included power flow calculations for validation. The resulting grid model datasets contain 3608 synthetic MV grids in high resolution, covering all of Germany and taking local characteristics into account. We compared the modelled networks with real network data. In terms of number of transformers and total cable length, we conclude that the method presented in this paper generates realistic grids that could be used to implement a cost-optimised electrical energy system.

Characterization of electrically-active defects in ultraviolet light-emitting diodes with laser-based failure analysis techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Mary A.; Tangyunyong, Paiboon; Cole, Edward I.

2016-01-14

Laser-based failure analysis techniques demonstrate the ability to quickly and non-intrusively screen deep ultraviolet light-emitting diodes (LEDs) for electrically-active defects. In particular, two laser-based techniques, light-induced voltage alteration and thermally-induced voltage alteration, generate applied voltage maps (AVMs) that provide information on electrically-active defect behavior including turn-on bias, density, and spatial location. Here, multiple commercial LEDs were examined and found to have dark defect signals in the AVM indicating a site of reduced resistance or leakage through the diode. The existence of the dark defect signals in the AVM correlates strongly with an increased forward-bias leakage current. This increased leakage ismore » not present in devices without AVM signals. Transmission electron microscopy analysis of a dark defect signal site revealed a dislocation cluster through the pn junction. The cluster included an open core dislocation. Even though LEDs with few dark AVM defect signals did not correlate strongly with power loss, direct association between increased open core dislocation densities and reduced LED device performance has been presented elsewhere [M. W. Moseley et al., J. Appl. Phys. 117, 095301 (2015)].« less

Parameters design of the dielectric elastomer spring-roll bending actuator (Conference Presentation)

NASA Astrophysics Data System (ADS)

Li, Jinrong; Liu, Liwu; Liu, Yanju; Leng, Jinsong

2017-04-01

Dielectric elastomers are novel soft smart material that could deform sustainably when subjected to external electric field. That makes dielectric elastomers promising materials for actuators. In this paper, a spring-roll actuator that would bend when a high voltage is applied was fabricated based on dielectric elastomer. Using such actuators as active parts, the flexible grippers and inchworm-inspired crawling robots were manufactured, which demonstrated some examples of applications in soft robotics. To guide the parameters design of dielectric elastomer based spring-roll bending actuators, the theoretical model of such actuators was established based on thermodynamic theories. The initial deformation and electrical induced bending angle of actuators were formulated. The failure of actuators was also analyzed considering some typical failure modes like electromechanical instability, electrical breakdown, loss of tension and maximum tolerant stretch. Thus the allowable region of actuators was determined. Then the bending angle-voltage relations and failure voltages of actuators with different parameters, including stretches of the dielectric elastomer film, number of active layers, and dimensions of spring, were investigated. The influences of each parameter on the actuator performances were discussed, providing meaningful guidance to the optical design of the spring-roll bending actuators.

Characterization of electrically-active defects in ultraviolet light-emitting diodes with laser-based failure analysis techniques

DOE PAGES

Miller, Mary A.; Tangyunyong, Paiboon; Edward I. Cole, Jr.

2016-01-12

In this study, laser-based failure analysis techniques demonstrate the ability to quickly and non-intrusively screen deep ultraviolet light-emitting diodes(LEDs) for electrically-active defects. In particular, two laser-based techniques, light-induced voltage alteration and thermally-induced voltage alteration, generate applied voltage maps (AVMs) that provide information on electrically-active defect behavior including turn-on bias, density, and spatial location. Here, multiple commercial LEDs were examined and found to have dark defect signals in the AVM indicating a site of reduced resistance or leakage through the diode. The existence of the dark defect signals in the AVM correlates strongly with an increased forward-bias leakage current. This increasedmore » leakage is not present in devices without AVM signals. Transmission electron microscopyanalysis of a dark defect signal site revealed a dislocation cluster through the pn junction. The cluster included an open core dislocation. Even though LEDs with few dark AVM defect signals did not correlate strongly with power loss, direct association between increased open core dislocation densities and reduced LED device performance has been presented elsewhere [M. W. Moseley et al., J. Appl. Phys. 117, 095301 (2015)].« less

Modeling of a Ne/Xe dielectric barrier discharge excilamp for improvement of VUV radiation production

NASA Astrophysics Data System (ADS)

Khodja, K.; Belasri, A.; Loukil, H.

2017-08-01

This work is devoted to excimer lamp efficiency optimization by using a homogenous discharge model of a dielectric barrier discharge in a Ne-Xe mixture. The model includes the plasma chemistry, electrical circuit, and Boltzmann equation. In this paper, we are particularly interested in the electrical and kinetic properties and light output generated by the DBD. Xenon is chosen for its high luminescence in the range of vacuum UV radiation around 173 nm. Our study is motivated by interest in this type of discharge in many industrial applications, including the achievement of high light output lamps. In this work, we used an applied sinusoidal voltage, frequency, gas pressure, and concentration in the ranges of 2-8 kV, 10-200 kHz, 100-800 Torr, and 10-50%, respectively. The analyzed results concern the voltage V p across the gap, the dielectric voltage V d, the discharge current I, and the particles densities. We also investigated the effect of the electric parameters and xenon concentration on the lamp efficiency. This investigation will allow one to find out the appropriate parameters for Ne/Xe DBD excilamps to improve their efficiency.

Voltage-induced Interface Reconstruction and Electrical Instability of the Ferromagnet-Semiconductor Device.

PubMed

Chang, Shu-Jui; Chang, Po-Chun; Lin, Wen-Chin; Lo, Shao-Hua; Chang, Liang-Chun; Lee, Shang-Fan; Tseng, Yuan-Chieh

2017-03-23

Using x-ray magnetic spectroscopy with in-situ electrical characterizations, we investigated the effects of external voltage on the spin-electronic and transport properties at the interface of a Fe/ZnO device. Layer-, element-, and spin-resolved information of the device was obtained by cross-tuning of the x-ray mode and photon energy, when voltage was applied. At the early stage of the operation, the device exhibited a low-resistance state featuring robust Fe-O bonds. However, the Fe-O bonds were broken with increasing voltage. Breaking of the Fe-O bonds caused the formation of oxygen vacancies and resulted in a high-resistance state. Such interface reconstruction was coupled to a charge-transfer effect via Fe-O hybridization, which suppressed/enhanced the magnetization/coercivity of Fe electronically. Nevertheless, the interface became stabilized with the metallic phase if the device was continuously polarized. During this stage, the spin-polarization of Fe was enhanced whereas the coercivity was lowered by voltage, but changes of both characteristics were reversible. This stage is desirable for spintronic device applications, owing to a different voltage-induced electronic transition compared to the first stage. The study enabled a straightforward detection of the spin-electronic state at the ferromagnet-semiconductor interface in relation to the transport and reversal properties during operation process of the device.

Pediatric electrical burns: management strategies.

PubMed

Zubair, M; Besner, G E

1997-08-01

The purpose of the present study was to analyse the course of patients hospitalised with electrical burn wounds in the past 25 years at a major children's hospital in the United States in order to devise safe and cost effective management strategies for these patients. The study was a retrospective chart review of patients with electrical injuries admitted to the hospital between 1971 and 1995. We identified 127 children who were included in the study. Injuries resulted from biting an electrical cord (oral injury) (n = 48), placing an object into an electrical socket (outlet injury) (n = 33), contacting a low voltage wire or appliance indoors (low voltage household injury) (n = 25), contacting a high voltage wire outdoors (high voltage wire injury) (n = 18), or being struck by lightning (n = 3). A retrospective review revealed that the great majority of patients with low voltage electrical injuries did not need admission to the hospital and could have been cared for on an outpatient basis. Almost every patient with high voltage injury had a justified admission due to the severity of the injury. On the basis of these results we conclude that we can safely reduce the number of admissions to the hospital for children with low voltage minor electrical injuries.

Application of Superconducting Power Cables to DC Electric Railway Systems

NASA Astrophysics Data System (ADS)

Ohsaki, Hiroyuki; Lv, Zhen; Sekino, Masaki; Tomita, Masaru

For novel design and efficient operation of next-generation DC electric railway systems, especially for their substantial energy saving, we have studied the feasibility of applying superconducting power cables to them. In this paper it is assumed that a superconducting power cable is applied to connect substations supplying electric power to trains. An analysis model line was described by an electric circuit, which was analyzed with MATLAB-Simulink. From the calculated voltages and currents of the circuit, the regenerative brake and the energy losses were estimated. In addition, assuming the heat loads of superconducting power cables and the cryogenic efficiency, the energy saving of the total system was evaluated. The results show that the introduction of superconducting power cables could achieve the improved use of regenerative brake, the loss reduction, the decreased number of substations, the reduced maintenance, etc.

Oil leakage detection for electric power equipment based on ultraviolet fluorescence effect

NASA Astrophysics Data System (ADS)

Zhang, Jing; Wang, Jian-hui; Xu, Bin; Huang, Zhi-dong; Huang, Lan-tao

2018-03-01

This paper presents a method to detect the oil leakage of high voltage power equipment based on ultraviolet fluorescence effect. The method exploits the principle that the insulating oil has the fluorescent effect under the irradiation of specific ultraviolet light. The emission spectrum of insulating oil under excitation light with different wavelengths is measured and analyzed first. On this basis, a portable oil leakage detective device for high voltage power equipment is designed and developed with a selected 365 nm ultraviolet as the excitation light and the low light level camera as the fluorescence image collector. Then, the feasibility of the proposed method and device in different conditions is experimentally verified in the laboratory environment. Finally, the developed oil leakage detective device is applied to 500 kV Xiamen substation and Quanzhou substation. And the results show that the device can detect the oil leakage of high voltage electrical equipment quickly and conveniently even under the condition of a slight oil leakage especially in the low light environment.

O the Electrohydrodynamics of Drop Extraction from a Conductive Liquid Meniscus

NASA Astrophysics Data System (ADS)

Wright, Graham Scott

This thesis is concerned with the use of an electric field in the extraction of liquid drops from a capillary orifice or nozzle. The motivating application is ink jet printing. Current drop-on-demand ink jets use pressure pulses to eject drops. Literature on electrostatic spraying suggests that by using an electric field, drops could be produced with a wider range of sizes and speeds than is possible with pressure ejection. Previous efforts to apply electric spraying to printing or similar selective coating tasks have taken an experimental approach based on steady or periodic spraying phenomena, without attempting cycle -by-cycle drop control. The centerpiece of this thesis is a simulation tool developed to explore such possibilities. A simplified analytic model is developed as a preliminary step, yielding formulas for force and time scales that provide an appropriate basis for nondimensionalization of the governing differential equations; important dimensionless parameters are identified. The complete self-consistent model permits simulation of meniscus behavior under time -varying applied voltage or pressure, with the electric field solution continually updated as the surface changes shape. The model uses a quasi-one-dimensional hydrodynamic formulation and a two-dimensional axisymmetric boundary element solution for the electric field. The simulation is checked against experimental results for meniscus stability, resonant modes, and drop emission under electric field. The simulation faithfully captures important qualitative aspects of meniscus behavior and gives reasonable quantitative agreement within the limitations of the model. Insights gained in simulation point the way to a successful laboratory demonstration of drop extraction using a shaped voltage pulse. Drop size control is pursued in simulation using pressure and voltage pulses both alone and in combination, for both light and viscous liquids. Combining pressure and field pulses is shown to be synergistic; drop volumes over a range of 175 to 1 were obtained, while maintaining good drop velocity. The differing strategies for obtaining large and small drops are described. Drop extraction using only the electric field is more difficult, but promising approaches remain open.

High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC

NASA Technical Reports Server (NTRS)

Lizcano, M.

2017-01-01

High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.

Imaging Neuronal Seal Resistance on Silicon Chip using Fluorescent Voltage-Sensitive Dye

PubMed Central

Braun, Dieter; Fromherz, Peter

2004-01-01

The electrical sheet resistance between living cells grown on planar electronic contacts of semiconductors or metals is a crucial parameter for bioelectronic devices. It determines the strength of electrical signal transduction from cells to chips and from chips to cells. We measured the sheet resistance by applying AC voltage to oxidized silicon chips and by imaging the voltage change across the attached cell membrane with a fluorescent voltage-sensitive dye. The phase map of voltage change was fitted with a planar core-coat conductor model using the sheet resistance as a free parameter. For nerve cells from rat brain on polylysine as well as for HEK293 cells and MDCK cells on fibronectin we find a similar sheet resistance of 10 MΩ. Taking into account the independently measured distance of 50 nm between chip and membrane for these cells, we obtain a specific resistance of 50 Ωcm that is indistinguishable from bulk electrolyte. On the other hand, the sheet resistance for erythrocytes on polylysine is far higher, at ∼1.5 GΩ. Considering the distance of 10 nm, the specific resistance in the narrow cleft is enhanced to 1500 Ωcm. We find this novel optical method to be a convenient tool to optimize the interface between cells and chips for bioelectronic devices. PMID:15298937

Imaging neuronal seal resistance on silicon chip using fluorescent voltage-sensitive dye.

PubMed

Braun, Dieter; Fromherz, Peter

2004-08-01

The electrical sheet resistance between living cells grown on planar electronic contacts of semiconductors or metals is a crucial parameter for bioelectronic devices. It determines the strength of electrical signal transduction from cells to chips and from chips to cells. We measured the sheet resistance by applying AC voltage to oxidized silicon chips and by imaging the voltage change across the attached cell membrane with a fluorescent voltage-sensitive dye. The phase map of voltage change was fitted with a planar core-coat conductor model using the sheet resistance as a free parameter. For nerve cells from rat brain on polylysine as well as for HEK293 cells and MDCK cells on fibronectin we find a similar sheet resistance of 10 MOmega. Taking into account the independently measured distance of 50 nm between chip and membrane for these cells, we obtain a specific resistance of 50 Omegacm that is indistinguishable from bulk electrolyte. On the other hand, the sheet resistance for erythrocytes on polylysine is far higher, at approximately 1.5 GOmega. Considering the distance of 10 nm, the specific resistance in the narrow cleft is enhanced to 1500 Omegacm. We find this novel optical method to be a convenient tool to optimize the interface between cells and chips for bioelectronic devices.

Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel

2016-01-14

In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current inmore » doped Ge{sub 2}Sb{sub 2}Te{sub 5} nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.« less

Defect design of insulation systems for photovoltaic modules

NASA Technical Reports Server (NTRS)

Mon, G. R.

1981-01-01

A defect-design approach to sizing electrical insulation systems for terrestrial photovoltaic modules is presented. It consists of gathering voltage-breakdown statistics on various thicknesses of candidate insulation films where, for a designated voltage, module failure probabilities for enumerated thickness and number-of-layer film combinations are calculated. Cost analysis then selects the most economical insulation system. A manufacturing yield problem is solved to exemplify the technique. Results for unaged Mylar suggest using fewer layers of thicker films. Defect design incorporates effects of flaws in optimal insulation system selection, and obviates choosing a tolerable failure rate, since the optimization process accomplishes that. Exposure to weathering and voltage stress reduces the voltage-withstanding capability of module insulation films. Defect design, applied to aged polyester films, promises to yield reliable, cost-optimal insulation systems.

Voltage-dependent blockade of muscle Na+ channels by guanidinium toxins

PubMed Central

1984-01-01

Na+ channels from rat muscle plasma membrane vesicles were inserted into neutral planar phospholipid bilayers and were activated by batrachotoxin. Single channel blocking events induced by the addition of various guanidinium toxins were analyzed to derive the rates of channel-toxin association and dissociation. Blocking by tetrodotoxin, saxitoxin, and six natural saxitoxin derivatives containing sulfate or hydroxyl groups were studied. Although the binding affinities vary over 2,000-fold, all of the toxins exhibit identical voltage dependence of the blocking reactions, regardless of the toxin's net charge. The results suggest that the voltage dependence of toxin binding is due to a voltage-dependent conformational equilibrium of the toxin receptor, rather than to direct entry of the charged toxin molecule into the applied transmembrane electric field. PMID:6096479

The New NASA-STD-4005 and NASA-HDBK-4006, Essentials for Direct-Drive Solar Electric Propulsion

NASA Technical Reports Server (NTRS)

Ferguson, Dale C.

2007-01-01

High voltage solar arrays are necessary for direct-drive solar electric propulsion, which has many advantages, including simplicity and high efficiency. Even when direct-drive is not used, the use of high voltage solar arrays leads to power transmission and conversion efficiencies in electric propulsion Power Management and Distribution. Nevertheless, high voltage solar arrays may lead to temporary power disruptions, through the so-called primary electrostatic discharges, and may permanently damage arrays, through the so-called permanent sustained discharges between array strings. Design guidance is needed to prevent these solar array discharges, and to prevent high power drains through coupling between the electric propulsion devices and the high voltage solar arrays. While most electric propulsion systems may operate outside of Low Earth Orbit, the plasmas produced by their thrusters may interact with the high voltage solar arrays in many ways similarly to Low Earth Orbit plasmas. A brief description of previous experiences with high voltage electric propulsion systems will be given in this paper. There are two new official NASA documents available free through the NASA Standards website to help in designing and testing high voltage solar arrays for electric propulsion. They are NASA-STD-4005, the Low Earth Orbit Spacecraft Charging Design Standard, and NASA-HDBK-4006, the Low Earth Orbit Spacecraft Charging Design Handbook. Taken together, they can both educate the high voltage array designer in the engineering and science of spacecraft charging in the presence of dense plasmas and provide techniques for designing and testing high voltage solar arrays to prevent electrical discharges and power drains.

Morphology effect on the light scattering and dynamic response of polymer network liquid crystal phase modulator.

PubMed

Xiangjie, Zhao; Cangli, Liu; Jiazhu, Duan; Jiancheng, Zeng; Dayong, Zhang; Yongquan, Luo

2014-06-16

Polymer network liquid crystal (PNLC) was one of the most potential liquid crystal for submillisecond response phase modulation, which was possible to be applied in submillisecond response phase only spatial light modulator. But until now the light scattering when liquid crystal director was reoriented by external electric field limited its phase modulation application. Dynamic response of phase change when high voltage was applied was also not elucidated. The mechanism that determines the light scattering was studied by analyzing the polymer network morphology by SEM method. Samples were prepared by varying the polymerization temperature, UV curing intensity and polymerization time. The morphology effect on the dynamic response of phase change was studied, in which high voltage was usually applied and electro-striction effect was often induced. The experimental results indicate that the polymer network morphology was mainly characterized by cross linked single fibrils, cross linked fibril bundles or even both. Although the formation of fibril bundle usually induced large light scattering, such a polymer network could endure higher voltage. In contrast, although the formation of cross linked single fibrils induced small light scattering, such a polymer network cannot endure higher voltage. There is a tradeoff between the light scattering and high voltage endurance. The electro-optical properties such as threshold voltage and response time were taken to verify our conclusion. For future application, the monomer molecular structure, the liquid crystal solvent and the polymerization conditions should be optimized to generate optimal polymer network morphology.

Voltage Sensor

NASA Technical Reports Server (NTRS)

1996-01-01

Under a Lewis Research Center Small Business Innovation Research contract, SRICO, Inc. developed a fiber optic voltage sensor to measure voltage in electronic systems in spacecraft. The sensor uses glass and light to sense and transmit electricity, and is relatively safe and accurate. SRICO then commercialized the sensor for measurement of electric field and voltage in applications such as electric power systems and hazardous environments, lightning detection, and fiber optic communication systems.

Measurement of microchannel fluidic resistance with a standard voltage meter.

PubMed

Godwin, Leah A; Deal, Kennon S; Hoepfner, Lauren D; Jackson, Louis A; Easley, Christopher J

2013-01-03

A simplified method for measuring the fluidic resistance (R(fluidic)) of microfluidic channels is presented, in which the electrical resistance (R(elec)) of a channel filled with a conductivity standard solution can be measured and directly correlated to R(fluidic) using a simple equation. Although a slight correction factor could be applied in this system to improve accuracy, results showed that a standard voltage meter could be used without calibration to determine R(fluidic) to within 12% error. Results accurate to within 2% were obtained when a geometric correction factor was applied using these particular channels. When compared to standard flow rate measurements, such as meniscus tracking in outlet tubing, this approach provided a more straightforward alternative and resulted in lower measurement error. The method was validated using 9 different fluidic resistance values (from ∼40 to 600kPa smm(-3)) and over 30 separately fabricated microfluidic devices. Furthermore, since the method is analogous to resistance measurements with a voltage meter in electrical circuits, dynamic R(fluidic) measurements were possible in more complex microfluidic designs. Microchannel R(elec) was shown to dynamically mimic pressure waveforms applied to a membrane in a variable microfluidic resistor. The variable resistor was then used to dynamically control aqueous-in-oil droplet sizes and spacing, providing a unique and convenient control system for droplet-generating devices. This conductivity-based method for fluidic resistance measurement is thus a useful tool for static or real-time characterization of microfluidic systems. Copyright © 2012 Elsevier B.V. All rights reserved.

Measurement of Microchannel Fluidic Resistance with a Standard Voltage Meter

PubMed Central

Godwin, Leah A.; Deal, Kennon S.; Hoepfner, Lauren D.; Jackson, Louis A.; Easley, Christopher J.

2012-01-01

A simplified method for measuring the fluidic resistance (Rfluidic) of microfluidic channels is presented, in which the electrical resistance (Relec) of a channel filled with a conductivity standard solution can be measured and directly correlated to Rfluidic using a simple equation. Although a slight correction factor could be applied in this system to improve accuracy, results showed that a standard voltage meter could be used without calibration to determine Rfluidic to within 12% error. Results accurate to within 2% were obtained when a geometric correction factor was applied using these particular channels. When compared to standard flow rate measurements, such as meniscus tracking in outlet tubing, this approach provided a more straightforward alternative and resulted in lower measurement error. The method was validated using 9 different fluidic resistance values (from ~40 – 600 kPa s mm−3) and over 30 separately fabricated microfluidic devices. Furthermore, since the method is analogous to resistance measurements with a voltage meter in electrical circuits, dynamic Rfluidic measurements were possible in more complex microfluidic designs. Microchannel Relec was shown to dynamically mimic pressure waveforms applied to a membrane in a variable microfluidic resistor. The variable resistor was then used to dynamically control aqueous-in-oil droplet sizes and spacing, providing a unique and convenient control system for droplet-generating devices. This conductivity-based method for fluidic resistance measurement is thus a useful tool for static or real-time characterization of microfluidic systems. PMID:23245901

Electrically erasable non-volatile memory via electrochemical deposition of multifractal aggregates

NASA Astrophysics Data System (ADS)

West, William Clark

An electrically erasable non-volatile memory system based on the electrochemical deposition of Ag or Cu from a solid electrolyte is presented. This memory system, referred to as Metal Dendrite Memory, is characterized by its simplicity of design and operation, low power consumption, and potentially high cell density. By applying a small DC voltage (2.5-5V) across a Cu or Ag doped As-S amorphous chalcogenide film sandwiched between two metal electrodes, a metal filament can be electrodeposited, shorting the large impedance solid electrolyte ("on" state). Application of smaller amplitude voltage pulses (1-1.5V) across the metal filament ruptures the short, returning the cell to the high impedance state ("off" state). The state of the cell is read by applying very small amplitude voltage pulses (0.25V). These "read" voltage pulses do not disturb the state of the cell even after 10sp7 pulses. Due to difficulties in characterizing this solid electrolyte system via conventional techniques, the MDM cells have been examined using low excitation characterization methods such as Impedance Spectroscopy (IS) and polarization measurements. These studies have yielded a self-consistent equivalent circuit model as well as parameters such as ionic diffusivity and conductivity, double layer and geometric capacitances. In addition to materials characterization, the speed at which the MDM cells operate has been systematically studied using a series of statistically designed experiments, demonstrating the importance of photodoping time and applied voltage on device speed. These results were further examined using IS and Rutherford Backscattering Spectrometry (RBS). The morphology of the growing electrodeposit was studied in several different electrode arrangements and excitation conditions. Under migrationally limited conditions, the electrodeposit grew in multifractal patterns, as measured using lacunarity analysis. If a conducting film was deposited parallel to the growth direction, the electrodeposition could be driven from Diffusion Limited Aggregation (DLA) to Densely Branched Morphology (DBM) modes by changing the voltage applied to the cell. In summary, this study has laid the groundwork for future research and development of MDM memory systems by identifying many important characteristics of the MDM cell. These findings include quantitative measurement of ionic transport values, identification of the electrochemical mechanisms involved in MDM data storage, determination of parameters that are statistically significant in affecting data storage speed, and determination of the effect of cell geometry and bias on electrodeposit morphology.

Optimum Operating Conditions for PZT Actuators for Vibrotactile Wearables

NASA Astrophysics Data System (ADS)

Logothetis, Irini; Matsouka, Dimitra; Vassiliadis, Savvas; Vossou, Clio; Siores, Elias

2018-04-01

Recently, vibrotactile wearables have received much attention in fields such as medicine, psychology, athletics and video gaming. The electrical components presently used to generate vibration are rigid; hence, the design and creation of ergonomical wearables are limited. Significant advances in piezoelectric components have led to the production of flexible actuators such as piezoceramic lead zirconate titanate (PZT) film. To verify the functionality of PZT actuators for use in vibrotactile wearables, the factors influencing the electromechanical conversion were analysed and tested. This was achieved through theoretical and experimental analyses of a monomorph clamped-free structure for the PZT actuator. The research performed for this article is a three-step process. First, a theoretical analysis presents the equations governing the actuator. In addition, the eigenfrequency of the film was analysed preceding the experimental section. For this stage, by applying an electric voltage and varying the stimulating electrical characteristics (i.e., voltage, electrical waveform and frequency), the optimum operating conditions for a PZT film were determined. The tip displacement was measured referring to the mechanical energy converted from electrical energy. From the results obtained, an equation for the mechanical behaviour of PZT films as actuators was deduced. It was observed that the square waveform generated larger tip displacements. In conjunction with large voltage inputs at the predetermined eigenfrequency, the optimum operating conditions for the actuator were achieved. To conclude, PZT films can be adapted to assist designers in creating comfortable vibrotactile wearables.

Optimum Operating Conditions for PZT Actuators for Vibrotactile Wearables

NASA Astrophysics Data System (ADS)

Logothetis, Irini; Matsouka, Dimitra; Vassiliadis, Savvas; Vossou, Clio; Siores, Elias

2018-07-01

Recently, vibrotactile wearables have received much attention in fields such as medicine, psychology, athletics and video gaming. The electrical components presently used to generate vibration are rigid; hence, the design and creation of ergonomical wearables are limited. Significant advances in piezoelectric components have led to the production of flexible actuators such as piezoceramic lead zirconate titanate (PZT) film. To verify the functionality of PZT actuators for use in vibrotactile wearables, the factors influencing the electromechanical conversion were analysed and tested. This was achieved through theoretical and experimental analyses of a monomorph clamped-free structure for the PZT actuator. The research performed for this article is a three-step process. First, a theoretical analysis presents the equations governing the actuator. In addition, the eigenfrequency of the film was analysed preceding the experimental section. For this stage, by applying an electric voltage and varying the stimulating electrical characteristics (i.e., voltage, electrical waveform and frequency), the optimum operating conditions for a PZT film were determined. The tip displacement was measured referring to the mechanical energy converted from electrical energy. From the results obtained, an equation for the mechanical behaviour of PZT films as actuators was deduced. It was observed that the square waveform generated larger tip displacements. In conjunction with large voltage inputs at the predetermined eigenfrequency, the optimum operating conditions for the actuator were achieved. To conclude, PZT films can be adapted to assist designers in creating comfortable vibrotactile wearables.

A Novel Series Connected Batteries State of High Voltage Safety Monitor System for Electric Vehicle Application

PubMed Central

Jiaxi, Qiang; Lin, Yang; Jianhui, He; Qisheng, Zhou

2013-01-01

Batteries, as the main or assistant power source of EV (Electric Vehicle), are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS), the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application. PMID:24194677

A novel series connected batteries state of high voltage safety monitor system for electric vehicle application.

PubMed

Jiaxi, Qiang; Lin, Yang; Jianhui, He; Qisheng, Zhou

2013-01-01

Batteries, as the main or assistant power source of EV (Electric Vehicle), are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS), the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application.

Magnetic field-modulated photo-thermo-electric effect in Fe/GaAs film

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiao, Shuang; Liu, Jihong; Yan, Guoying

2015-11-02

Ferromagnet/semiconductor heterostructure, such as Fe/GaAs, is always one of the key issues in spintronics due to its prerequisite for the realization of spin sensitive devices. In this letter, a lateral photoelectric effect (LPE) was observed in Fe/GaAs. Our results show that the sensitivity was not related to laser wavelength, but only proportional to laser power, suggesting that the lateral photovoltage was induced by photo-thermo-electric effect. Moreover, we also observe that the voltage signal increases with the increase in applied field due to decreasing scattering probability for spin-polarized electrons. Our finding of LPE adds another functionality to the Fe/GaAs system andmore » will be useful in development of spin-polarized voltage devices.« less

Effects of Asymmetric Local Joule Heating on Silicon Nanowire-Based Devices Formed by Dielectrophoresis Alignment Across Pt Electrodes

NASA Astrophysics Data System (ADS)

Ho, Hsiang-Hsi; Lin, Chun-Lung; Tsai, Wei-Che; Hong, Liang-Zheng; Lyu, Cheng-Han; Hsu, Hsun-Feng

2018-01-01

We demonstrate the fabrication and characterization of silicon nanowire-based devices in metal-nanowire-metal configuration using direct current dielectrophoresis. The current-voltage characteristics of the devices were found rectifying, and their direction of rectification could be determined by voltage sweep direction due to the asymmetric Joule heating effect that occurred in the electrical measurement process. The photosensing properties of the rectifying devices were investigated. It reveals that when the rectifying device was in reverse-biased mode, the excellent photoresponse was achieved due to the strong built-in electric field at the junction interface. It is expected that rectifying silicon nanowire-based devices through this novel and facile method can be potentially applied to other applications such as logic gates and sensors.

Application of bias voltage to tune the resonant frequency of membrane-based electroactive polymer energy harvesters

NASA Astrophysics Data System (ADS)

Dong, Lin; Grissom, Michael; Fisher, Frank T.

2016-05-01

Vibration-based energy harvesting has been widely investigated to as a means to generate low levels of electrical energy for applications such as wireless sensor networks. However, for optimal performance it is necessary to ensure that resonant frequencies of the device match the ambient vibration frequencies for maximum energy harvested. Here a novel resonant frequency tuning approach is proposed by applying a bias voltage to a pre-stretched electroactive polymer (EAP) membrane, such that the resulting changes in membrane tension can tune the device to match the environmental vibration source. First, a material model which accounts for the change in properties due to the pre-stretch of a VHB 4910 EAP membrane is presented. The effect of the bias voltage on the EAP membrane, which induces an electrostatic pressure and corresponding reduction in membrane thickness, are then determined. The FEM results from ANSYS agree well with an analytical hyperelastic model of the activation response of the EAP membrane. Lastly, through a mass-loaded circular membrane vibration model, the effective resonant frequency of the energy harvester can be determined as a function of changes in membrane tension due to the applied bias voltage. In the case of an EAP membrane, pre-stretch contributes to the pre-stretch stiffness of the system while the applied bias voltage contributes to a change in bias voltage stiffness of the membrane. Preliminary experiments verified the resonant frequencies corresponding to the bias voltages predicted from the appropriate models. The proposed bias voltage tuning approach for the EAP membrane may provide a novel tuning strategy to enable energy harvesting from various ambient vibration sources in various application environments.

How voltage drops are manifested by lithium ion configurations at interfaces and in thin films on battery electrodes

DOE PAGES

Leung, Kevin; Leenheer, Andrew Jay

2015-04-09

Battery electrode surfaces are generally coated with electronically insulating solid films of thickness 1-50 nm. Both electrons and Li + can move at the electrode–surface film interface in response to the voltage, which adds complexity to the “electric double layer” (EDL). We also apply Density Functional Theory (DFT) to investigate how the applied voltage is manifested as changes in the EDL at atomic length scales, including charge separation and interfacial dipole moments. Illustrating examples include Li 3PO 4, Li 2CO 3, and Li xMn 2O 4 thin films on Au(111) surfaces under ultrahigh vacuum conditions. Adsorbed organic solvent molecules canmore » strongly reduce voltages predicted in vacuum. We propose that manipulating surface dipoles, seldom discussed in battery studies, may be a viable strategy to improve electrode passivation. We also distinguish the computed potential governing electrons, which is the actual or instantaneous voltage, and the “lithium cohesive energy”-based voltage governing Li content widely reported in DFT calculations, which is a slower-responding self-consistency criterion at interfaces. Furthermore, this distinction is critical for a comprehensive description of electrochemical activities on electrode surfaces, including Li + insertion dynamics, parasitic electrolyte decomposition, and electrodeposition at overpotentials.« less

Naval electrochemical corrosion reducer

DOEpatents

Clark, Howard L.

1991-10-01

A corrosion reducer for use with ships having a hull, a propeller mounted a propeller shaft and extending through the hull, bearings supporting the shaft, at least one thrust bearing and one seal. The improvement includes a current collector and a current reduction assembly for reducing the voltage between the hull and shaft in order to reduce corrosion due to electrolytic action. The current reduction assembly includes an electrical contact, the current collector, and the hull. The current reduction assembly further includes a device for sensing and measuring the voltage between the hull and the shaft and a device for applying a reverse voltage between the hull and the shaft so that the resulting voltage differential is from 0 to 0.05 volts. The current reduction assembly further includes a differential amplifier having a voltage differential between the hull and the shaft. The current reduction assembly further includes an amplifier and a power output circuit receiving signals from the differential amplifier and being supplied by at least one current supply. The current selector includes a brush assembly in contact with a slip ring over the shaft so that its potential may be applied to the differential amplifier.

Redefining the Speed Limit of Phase Change Memory Revealed by Time-resolved Steep Threshold-Switching Dynamics of AgInSbTe Devices

NASA Astrophysics Data System (ADS)

Shukla, Krishna Dayal; Saxena, Nishant; Durai, Suresh; Manivannan, Anbarasu

2016-11-01

Although phase-change memory (PCM) offers promising features for a ‘universal memory’ owing to high-speed and non-volatility, achieving fast electrical switching remains a key challenge. In this work, a correlation between the rate of applied voltage and the dynamics of threshold-switching is investigated at picosecond-timescale. A distinct characteristic feature of enabling a rapid threshold-switching at a critical voltage known as the threshold voltage as validated by an instantaneous response of steep current rise from an amorphous off to on state is achieved within 250 picoseconds and this is followed by a slower current rise leading to crystallization. Also, we demonstrate that the extraordinary nature of threshold-switching dynamics in AgInSbTe cells is independent to the rate of applied voltage unlike other chalcogenide-based phase change materials exhibiting the voltage dependent transient switching characteristics. Furthermore, numerical solutions of time-dependent conduction process validate the experimental results, which reveal the electronic nature of threshold-switching. These findings of steep threshold-switching of ‘sub-50 ps delay time’, opens up a new way for achieving high-speed non-volatile memory for mainstream computing.

Pulse shaping system

DOEpatents

Skeldon, Mark D.; Letzring, Samuel A.

1999-03-23

Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses.

Pulse shaping system

DOEpatents

Skeldon, M.D.; Letzring, S.A.

1999-03-23

Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses. 8 figs.

Method for electrostatic deposition of graphene on a substrate

NASA Technical Reports Server (NTRS)

Sumanasekera, Gamini (Inventor); Sidorov, Anton N. (Inventor); Ouseph, P. John (Inventor); Yazdanpanah, Mehdi M. (Inventor); Cohn, Robert W. (Inventor); Jalilian, Romaneh (Inventor)

2010-01-01

A method for electrostatic deposition of graphene on a substrate comprises the steps of securing a graphite sample to a first electrode; electrically connecting the first electrode to a positive terminal of a power source; electrically connecting a second electrode to a ground terminal of the power source; placing the substrate over the second electrode; and using the power source to apply a voltage, such that graphene is removed from the graphite sample and deposited on the substrate.

Materials Research of Novel Organic Piezoelectric/Ferroelectric Compounds at a H.S.I

DTIC Science & Technology

2015-07-06

analysis 4. http://wavefun.com 5. MOPAC2012, James J. P. Stewart, Stewart Computational Chemistry, Colorado Springs, CO, USA, HTTP://OpenMOPAC. net ... petri dish of mineral oil (to prevent electrical arcing) ripples in the mineral oil are clearly visible when a voltage is applied to the sample. We...acid. It does not appear to be ferroelectric. However, it is piezoelectric. When placed in a petri dish of mineral oil (to prevent electrical arcing

Cadmium (II) removal mechanisms in microbial electrolysis cells.

PubMed

Colantonio, Natalie; Kim, Younggy

2016-07-05

Cadmium is a toxic heavy metal, causing serious environmental and human health problems. Conventional methods for removing cadmium from wastewater are expensive and inefficient for low concentrations. Microbial electrolysis cells (MECs) can simultaneously treat wastewater, produce hydrogen gas, and remove heavy metals with low energy requirements. Lab-scale MECs were operated to remove cadmium under various electric conditions: applied voltages of 0.4, 0.6, 0.8, and 1.0 V; and a fixed cathode potential of -1.0 V vs. Ag/AgCl. Regardless of the electric condition, rapid removal of cadmium was demonstrated (50-67% in 24 h); however, cadmium concentration in solution increased after the electric current dropped with depleted organic substrate under applied voltage conditions. For the fixed cathode potential, the electric current was maintained even after substrate depletion and thus cadmium concentration did not increase. These results can be explained by three different removal mechanisms: cathodic reduction; Cd(OH)2 precipitation; and CdCO3 precipitation. When the current decreased with depleted substrates, local pH at the cathode was no longer high due to slowed hydrogen evolution reaction (2H(+)+2e(-)→H2); thus, the precipitated Cd(OH)2 and CdCO3 started dissolving. To prevent their dissolution, sufficient organic substrates should be provided when MECs are used for cadmium removal. Copyright © 2016 Elsevier B.V. All rights reserved.

An 11 cm long atmospheric pressure cold plasma plume for applications of plasma medicine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu Xinpei; Jiang Zhonghe; Xiong Qing

2008-02-25

In this letter, a room temperature atmospheric pressure plasma jet device is reported. The high voltage electrode of the device is covered by a quartz tube with one end closed. The device, which is driven by a kilohertz ac power supply, is capable of generating a plasma plume up to 11 cm long in the surrounding room air. The rotational and vibrational temperatures of the plasma plume are 300 and 2300 K, respectively. A simple electrical model shows that, when the plasma plume is contacted with a human, the voltage drop on the human is less than 66 V formore » applied voltage of 5 kV (rms)« less

Characterization of a Piezoelectric Buzzer Using a Michelson Interferometer

ERIC Educational Resources Information Center

Lloyd, S.; Paetkau, M.

2010-01-01

A piezoelectric material generates an electric potential across its surface when subjected to mechanical stress; conversely, the inverse piezoelectric effect describes the expansion or contraction of the material when subjected to some applied voltage. Piezoelectric materials are used in devices such as doorbell buzzers, barbeque igniters, and…

An EPG waveform library for sharpshooters and preliminary effects of applied voltage on behaviors controlling Xylella fastidiosa inoculation

USDA-ARS?s Scientific Manuscript database

Electropenetrography (EPG) waveforms represent electrical conductivity of fluids flowing through an insect’s mouthparts. Over the 50 years since its invention, EPG has undergone three major electronic transformations. The newest, third generation of electropenetrograph, the AC-DC EPG monitor, offers...

A General Approach to Kirchhoff's Laws

ERIC Educational Resources Information Center

Quintela, F. R.; Redondo, R. C.; Melchor, N. R.; Redondo, M.

2009-01-01

Kirchhoff's laws are usually considered as electrical current and voltage properties. Nevertheless, they are sometimes applied to nonelectrical systems. One way to increase their efficacy and range of applicability would be to show Kirchhoff's laws, and the properties deriving from them, as being independent of any physical system as far as…

Non-electrolytic synthesis of copper oxide/carbon nanocomposite by surface plasma in super-dehydrated ethanol

NASA Astrophysics Data System (ADS)

Kozak, Dmytro S.; Sergiienko, Ruslan A.; Shibata, Etsuro; Iizuka, Atsushi; Nakamura, Takashi

2016-02-01

Electrolytic processes are widely used to synthesize different nanomaterials and it does not depend on what kind of the method has been applied (wet-chemistry, sonochemistry, plasma chemistry, electrolysis and so on). Generally, the reactions in the electrolyte are considered to be reduction/oxidation (REDOX) reactions between chemical reagents or the deposition of matter on the electrodes, in line with Faraday’s law. Due to the presence of electroconductive additives in any electrolyte, the polarization effect of polar molecules conducting an electrical current disappears, when external high-strength electric field is induced. Because initially of the charge transfer always belongs of electroconductive additive and it does not depend on applied voltage. The polarization of ethanol molecules has been applied to conduct an electric current by surface plasma interaction for the synthesis of a copper oxide/carbon nanocomposite material.

Carrier Propagation Dependence on Applied Potentials in Pentacene Organic Field Effect Transistors Investigated by Impedance Spectroscopy and Electrical Time-of-Flight Techniques

NASA Astrophysics Data System (ADS)

Lin, Jack; Weis, Martin; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa

2011-04-01

Transient measurements of impedance spectroscopy and electrical time-of-flight (TOF) techniques were used for the evaluation of carrier propagation dependence on applied potentials in a pentacene organic field effect transistor (OFET). These techniques are based on carrier propagation, thus isolates the effect of charge density. The intrinsic mobility which is free from contact resistance effects was obtained by measurement of various channel lengths. The obtained intrinsic mobility shows good correspondence with steady-state current-voltage measurement's saturation mobility. However, their power law relations on mobility vs applied potential resulted in different exponents, suggesting different carrier propagation mechanisms, which is attributable to filling of traps or space charge field in the channel region. The hypothesis was verified by a modified electrical TOF experiment which demonstrated how the accumulated charges in the channel influence the effective mobility.

Does voltage predict return to work and neuropsychiatric sequelae following electrical burn injury?

PubMed

Chudasama, Shruti; Goverman, Jeremy; Donaldson, Jeffrey H; van Aalst, John; Cairns, Bruce A; Hultman, Charles Scott

2010-05-01

Voltage has historically guided the acute management and long-term prognosis of physical morbidity in electrical injury patients; however, few large studies exist that include neuropsychiatric morbidity in final outcome analysis. This review compares high (>1000 V) to low (<1000 V) voltage injuries, focusing on return to work and neuropsychiatric sequelae following electrical burn injury. Patients with electrical injuries admitted to the University of North Carolina Jaycee Burn Center between 2000 and 2005 were prospectively entered into a trauma database, then retrospectively reviewed. Patients were divided into 4 cohorts: high voltage (>1000 V), low voltage (<1000 V), flash arc, and lightning. Demographics, hospital course, and follow-up were recorded to determine physical and neuropsychiatric morbidity. Differences among cohorts were tested for statistical significance. Over 5 years, 2548 patients were admitted to the burn center, including 115 patients with electrical injuries. There were 110 males and 5 females, with a mean age of 35 years (range, 0.75-65 years). The cause of the electrical injury was high voltage in 60 cases, low voltage in 25 cases, flash arc in 29 cases and lightning in 1 case. The mean total body surface area burn was 8% (range, 0%-52%). The etiology was work-related electrical injury in 85 patients. Mean follow-up period was 352 days with 13 (11%) patients lost to follow-up. Patients with high voltage injuries had significantly larger total body surface area burn, longer ICU stays, longer hospitalizations, and significantly higher rates of fasciotomy, amputation, nerve decompression and outpatient reconstruction, with 4 cases of renal failure and 2 deaths. In spite of these differences, high and low voltage groups experienced similar rates of neuropsychiatric sequelae, limited return to work and delays in return to work. Final impairment ratings for the high and low voltage groups were 17.5% and 5.3%, respectively. Electrical injuries often incur severe morbidity despite relatively small burn size and/or low voltage. When comparing high and low voltage injuries, similarities in endpoints such as neuropsychiatric sequelae, the need for late reconstruction, and failure to return to work challenge previous notions that voltage predicts outcome.

Radial Field Piezoelectric Diaphragms

NASA Technical Reports Server (NTRS)

Bryant, R. G.; Effinger, R. T., IV; Copeland, B. M., Jr.

2002-01-01

A series of active piezoelectric diaphragms were fabricated and patterned with several geometrically defined Inter-Circulating Electrodes "ICE" and Interdigitated Ring Electrodes "ICE". When a voltage potential is applied to the electrodes, the result is a radially distributed electric field that mechanically strains the piezoceramic along the Z-axis (perpendicular to the applied electric field). Unlike other piezoelectric bender actuators, these Radial Field Diaphragms (RFDs) strain concentrically yet afford high displacements (several times that of the equivalent Unimorph) while maintaining a constant circumference. One of the more intriguing aspects is that the radial strain field reverses itself along the radius of the RFD while the tangential strain remains relatively constant. The result is a Z-deflection that has a conical profile. This paper covers the fabrication and characterization of the 5 cm. (2 in.) diaphragms as a function of poling field strength, ceramic thickness, electrode type and line spacing, as well as the surface topography, the resulting strain field and displacement as a function of applied voltage at low frequencies. The unique features of these RFDs include the ability to be clamped about their perimeter with little or no change in displacement, the environmentally insulated packaging, and a highly repeatable fabrication process that uses commodity materials.

Hydrodynamic flow in the vicinity of a nanopore induced by an applied voltage

PubMed Central

Mao, Mao; Ghosal, Sandip; Hu, Guohui

2013-01-01

Continuum simulation is employed to study ion transport and fluid flow through a nanopore in a solid-state membrane under an applied potential drop. Results show the existence of concentration polarization layers on the surfaces of the membrane. The nonuniformity of the ionic distribution gives rise to an electric pressure that drives vortical motion in the fluid. There is also a net hydrodynamic flow through the nanopore due to an asymmetry induced by the membrane surface charge. The qualitative behavior is similar to that observed in a previous study using molecular dynamic simulations. The current–voltage characteristics show some nonlinear features but are not greatly affected by the hydrodynamic flow in the parameter regime studied. In the limit of thin Debye layers, the electric resistance of the system can be characterized using an equivalent circuit with lumped parameters. Generation of vorticity can be understood qualitatively from elementary considerations of the Maxwell stresses. However, the flow strength is a strongly nonlinear function of the applied field. Combination of electrophoretic and hydrodynamic effects can lead to ion selectivity in terms of valences and this could have some practical applications in separations. PMID:23689946

Extracting current induced spins from topological insulator wires: gate control of extracted spin polarization

NASA Astrophysics Data System (ADS)

Adagideli, Inanc

Spin-momentum locking featured by the surface states of 3D topological insulators (TIs) allows electrical generation of spin accumulations and provides a new avenue for spintronics applications. In this work, we explore how to extract electrically induced spins from topological insulator surfaces, where they are generated into topologically trivial metallic leads that are commonly used in conventional electronic devices. We first focus on an effective surface theory of current induced spin accumulation in topological insulators. Then we focus on a particular geometry: a metallic pocket attached to top and side faces of a 3D topological insulator quantum wire with a rectangular cross section, and explore spin extraction into topologically non-trivial materials. We find surprisingly that the doping in and/or a gate voltage applied to the metallic side pocket can control the direction of the extracted spin polarization opening the possibility for a spin transistor operation of these device geometries. We also perform numerical simulations of nonequilibrium spin accumulations generated by an applied bias in the same geometry and demonstrate the spin polarization control via applied gate voltages. Work funded by TUBITAK Grant No 114F163.

A novel technique to measure interface trap density in a GaAs MOS capacitor using time-varying magnetic fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choudhury, Aditya N. Roy, E-mail: aditya@physics.iisc.ernet.in; Venkataraman, V.

Interface trap density (D{sub it}) in a GaAs metal-oxide-semiconductor (MOS) capacitor can be measured electrically by measuring its impedance, i.e. by exciting it with a small signal voltage source and measuring the resulting current through the circuit. We propose a new method of measuring D{sub it} where the MOS capacitor is subjected to a (time-varying) magnetic field instead, which produces an effect equivalent to a (time-varying) voltage drop across the sample. This happens because the electron chemical potential of GaAs changes with a change in an externally applied magnetic field (unlike that of the gate metal); this is not themore » voltage induced by Faraday’s law of electromagnetic induction. So, by measuring the current through the MOS, D{sub it} can be found similarly. Energy band diagrams and equivalent circuits of a MOS capacitor are drawn in the presence of a magnetic field, and analyzed. The way in which a magnetic field affects a MOS structure is shown to be fundamentally different compared to an electrical voltage source.« less

GaN light-emitting device based on ionic liquid electrolyte

NASA Astrophysics Data System (ADS)

Hirai, Tomoaki; Sakanoue, Tomo; Takenobu, Taishi

2018-06-01

Ionic liquids (ILs) are attractive materials for fabricating unique hybrid devices based on electronics and electrochemistry; thus, IL-gated transistors and organic light-emitting devices of light-emitting electrochemical cells (LECs) are investigated for future low-voltage and high-performance devices. In LECs, voltage application induces the formation of electrochemically doped p–n homojunctions owing to ion rearrangements in composites of semiconductors and electrolytes, and achieves electron–hole recombination for light emission at the homojunctions. In this work, we applied this concept of IL-induced electrochemical doping to the fabrication of GaN-based light-emitting devices. We found that voltage application to the layered IL/GaN structure accumulated electrons on the GaN surface owing to ion rearrangements and improved the conductivity of GaN. The ion rearrangement also enabled holes to be injected by the strong electric field of electric double layers on hole injection contacts. This simultaneous injection of holes and electrons into GaN mediated by ions achieves light emission at a low voltage of around 3.4 V. The light emission from the simple IL/GaN structure indicates the usefulness of an electrochemical technique in generating light emission with great ease of fabrication.

Assembly of Colloidal Aggregates by Electrohydrodynamic Flow: Kinetic Experiments and Scaling Analysis

NASA Technical Reports Server (NTRS)

Ristenpart, W. D.; Aksay, I. A.; Saville, D. A.

2004-01-01

Electric fields generate transverse flows near electrodes that sweep colloidal particles into densely packed assemblies. We interpret this behavior in terms of electrohydrodynamic motion stemming from distortions of the field by the particles that alter the body force distribution in the electrode charge polarization layer. A scaling analysis shows how the action of the applied electric field generates fluid motion that carries particles toward one another. The resulting fluid velocity is proportional to the square of the applied field and decreases inversely with frequency. Experimental measurements of the particle aggregation rate accord with the electrohydrodynamic theory over a wide range of voltages and frequencies.

Analysis and Testing of Plates with Piezoelectric Sensors and Actuators

NASA Technical Reports Server (NTRS)

Bevan, Jeffrey S.

1998-01-01

Piezoelectric material inherently possesses coupling between electrostatics and structural dynamics. Utilizing linear piezoelectric theory results in an intrinsically coupled pair of piezoelectric constitutive equations. One equation describes the direct piezoelectric effect where strains produce an electric field and the other describes the converse effect where an applied electrical field produces strain. The purpose of this study is to compare finite element analysis and experiments of a thin plate with bonded piezoelectric material. Since an isotropic plate in combination with a thin piezoelectric layer constitutes a special case of a laminated composite, the classical laminated plate theory is used in the formulation to accommodated generic laminated composite panels with multiple bonded and embedded piezoelectric layers. Additionally, the von Karman large deflection plate theory is incorporated. The formulation results in laminate constitutive equations that are amiable to the inclusion of the piezoelectric constitutive equations yielding in a fully electro-mechanically coupled composite laminate. Using the finite element formulation, the governing differential equations of motion of a composite laminate with embedded piezoelectric layers are derived. The finite element model not only considers structural degrees of freedom (d.o.f.) but an additional electrical d.o.f. for each piezoelectric layer. Comparison between experiment and numerical prediction is performed by first treating the piezoelectric as a sensor and then again treating it as an actuator. To assess the piezoelectric layer as a sensor, various uniformly distributed pressure loads were simulated in the analysis and the corresponding generated voltages were calculated using both linear and nonlinear finite element analyses. Experiments were carried out by applying the same uniformly distributed loads and measuring the resulting generated voltages and corresponding maximum plate deflections. It is found that a highly nonlinear relationship exists between maximum deflection and voltage versus pressure loading. In order to assess comparisons of predicted and measured piezoelectric actuation, sinusoidal excitation voltages are simulated/applied and maximum deflections are calculated/measured. The maximum deflection as a function of time was determined using the linear finite elements analysis. Good correlation between prediction and measurement was achieved in all cases.

Liquid-crystal microlenses with patterned ring-electrode arrays for multiple-mode two-dimensional imaging

NASA Astrophysics Data System (ADS)

Xie, Xingwang; Han, Xinjie; Long, Huabao; Dai, Wanwan; Xin, Zhaowei; Wei, Dong; Zhang, Xinyu; Wang, Haiwei; Xie, Changsheng

2018-02-01

In this paper, a new liquid-crystal microlens array (LCMLA) with patterned ring-electrode arrays (PREAs) is investigated, which has an ability to acquire multiple-mode two-dimensional images with better electrically tunable efficiency than common liquid-crystal devices. The new type of LCMLA can be used to overcome several remarkable disadvantage of conventional liquid-crystal microlens arrays switched and adjusted electrically by relatively complex mechanism. There are two layer electrodes in the LCMLA developed by us. The top electrode layer consists of PREAs with different featured diameter but the same center for each single cell, and the bottom is a plate electrode. When both electrode structures are driven independently by variable AC voltage signal, a gradient electric field distribution could be obtained, which can drive liquid-crystal molecules to reorient themselves along the gradient electric field shaped, so as to demonstrate a satisfactory refractive index distribution. The common experiments are carried out to validate the performances needed. As shown, the focal length of the LCMLA can be adjusted continuously according to the variable voltage signal applied. According to designing, the LCMLA will be integrated continuously with an image sensors to set up a camera with desired performances. The test results indicate that our camera based on the LCMLA can obtain distinct multiple-mode two-dimensional images under the condition of using relatively low driving signal voltage.

Carbon nanotubes for voltage reduction and throughput enhancement of electrical cell lysis on a lab-on-a-chip.

PubMed

Shahini, Mehdi; Yeow, John T W

2011-08-12

We report on the enhancement of electrical cell lysis using carbon nanotubes (CNTs). Electrical cell lysis systems are widely utilized in microchips as they are well suited to integration into lab-on-a-chip devices. However, cell lysis based on electrical mechanisms has high voltage requirements. Here, we demonstrate that by incorporating CNTs into microfluidic electrolysis systems, the required voltage for lysis is reduced by half and the lysis throughput at low voltages is improved by ten times, compared to non-CNT microchips. In our experiment, E. coli cells are lysed while passing through an electric field in a microchannel. Based on the lightning rod effect, the electric field strengthened at the tip of the CNTs enhances cell lysis at lower voltage and higher throughput. This approach enables easy integration of cell lysis with other on-chip high-throughput sample-preparation processes.

Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

NASA Astrophysics Data System (ADS)

E, Lotfi; H, Rezania; B, Arghavaninia; M, Yarmohammadi

2016-07-01

We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength.

Network based management for multiplexed electric vehicle charging

DOEpatents

Gadh, Rajit; Chung, Ching Yen; Qui, Li

2017-04-11

A system for multiplexing charging of electric vehicles, comprising a server coupled to a plurality of charging control modules over a network. Each of said charging modules being connected to a voltage source such that each charging control module is configured to regulate distribution of voltage from the voltage source to an electric vehicle coupled to the charging control module. Data collection and control software is provided on the server for identifying a plurality of electric vehicles coupled to the plurality of charging control modules and selectively distributing charging of the plurality of charging control modules to multiplex distribution of voltage to the plurality of electric vehicles.

Novel non-equilibrium modelling of a DC electric arc in argon

NASA Astrophysics Data System (ADS)

Baeva, M.; Benilov, M. S.; Almeida, N. A.; Uhrlandt, D.

2016-06-01

A novel non-equilibrium model has been developed to describe the interplay of heat and mass transfer and electric and magnetic fields in a DC electric arc. A complete diffusion treatment of particle fluxes, a generalized form of Ohm’s law, and numerical matching of the arc plasma with the space-charge sheaths adjacent to the electrodes are applied to analyze in detail the plasma parameters and the phenomena occurring in the plasma column and the near-electrode regions of a DC arc generated in atmospheric pressure argon for current levels from 20 A up to 200 A. Results comprising electric field and potential, current density, heating of the electrodes, and effects of thermal and chemical non-equilibrium are presented and discussed. The current-voltage characteristic obtained is in fair agreement with known experimental data. It indicates a minimum for arc current of about 80 A. For all current levels, a field reversal in front of the anode accompanied by a voltage drop of (0.7-2.6) V is observed. Another field reversal is observed near the cathode for arc currents below 80 A.

Determination of the electric field strength of filamentary DBDs by CARS-based four-wave mixing

NASA Astrophysics Data System (ADS)

Böhm, P.; Kettlitz, M.; Brandenburg, R.; Höft, H.; Czarnetzki, U.

2016-10-01

It is demonstrated that a four-wave mixing technique based on coherent anti-Stokes Raman spectroscopy (CARS) can determine the electric field strength of a pulsed-driven filamentary dielectric barrier discharge (DBD) of 1 mm gap, using hydrogen as a tracer medium in nitrogen at atmospheric pressure. The measurements are presented for a hydrogen admixture of 10%, but even 5% H2 admixture delivers sufficient infrared signals. The lasers do not affect the discharge by photoionization or by other radiation-induced processes. The absolute values of the electric field strength can be determined by the calibration of the CARS setup with high voltage amplitudes below the ignition threshold of the arrangement. This procedure also enables the determination of the applied breakdown voltage. The alteration of the electric field is observed during the internal polarity reversal and the breakdown process. One advantage of the CARS technique over emission-based methods is that it can be used independently of emission, e.g. in the pre-phase and in between two consecutive discharges, where no emission occurs at all.

Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

PubMed

Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

2015-01-01

The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

Electrofluid hydrolysis enhances the production of fermentable sugars from corncob via in/reverse-phase induced voltage.

PubMed

Wu, Fengfeng; Jin, Yamei; Li, Dandan; Zhou, Yuyi; Guo, Lunan; Zhang, Mengyue; Xu, Xueming; Yang, Na

2017-06-01

To improve the economic value of lignocellulosic biomasses, an innovative electrofluidic technology has been applied to the efficient hydrolysis of corncob. The system combines fluidic reactors and induced voltages via magnetoelectric coupling effect. The excitation voltage had a positive impact on reducing sugar content (RSC). But, the increase of voltage frequency at 400-700Hz caused a slight decline of the RSC. Higher temperature limits the electrical effect on the hydrolysis at 70-80°C. The energy efficiency increased under the addition of metallic ions and series of in-phase induced voltage to promote hydrolysis. In addition, the 4-series system with in-phase and reverse-phase induced voltages under the synchronous magnetic flux, exhibited a significant influence on the RSC with a maximum increase of 56%. High throughput could be achieved by increasing series in a compact system. Electrofluid hydrolysis avoids electrochemical reaction, electrode corrosion, and sample contamination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of double-pulse lasers ablation system for generating gold ion source under applying an electric field

NASA Astrophysics Data System (ADS)

Khalil, A. A. I.

2015-12-01

Double-pulse lasers ablation (DPLA) technique was developed to generate gold (Au) ion source and produce high current under applying an electric potential in an argon ambient gas environment. Two Q-switched Nd:YAG lasers operating at 1064 and 266 nm wavelengths are combined in an unconventional orthogonal (crossed-beam) double-pulse configuration with 45° angle to focus on a gold target along with a spectrometer for spectral analysis of gold plasma. The properties of gold plasma produced under double-pulse lasers excitation were studied. The velocity distribution function (VDF) of the emitted plasma was studied using a dedicated Faraday-cup ion probe (FCIP) under argon gas discharge. The experimental parameters were optimized to attain the best signal to noise (S/N) ratio. The results depicted that the VDF and current signals depend on the discharge applied voltage, laser intensity, laser wavelength and ambient argon gas pressure. A seven-fold increases in the current signal by increasing the discharge applied voltage and ion velocity under applying double-pulse lasers field. The plasma parameters (electron temperature and density) were also studied and their dependence on the delay (times between the excitation laser pulse and the opening of camera shutter) was investigated as well. This study could provide significant reference data for the optimization and design of DPLA systems engaged in laser induced plasma deposition thin films and facing components diagnostics.

Chaotic mixing in microchannels via low frequency switching transverse electroosmotic flow generated on integrated microelectrodes.

PubMed

Song, Hongjun; Cai, Ziliang; Noh, Hongseok Moses; Bennett, Dawn J

2010-03-21

In this paper we present a numerical and experimental investigation of a chaotic mixer in a microchannel via low frequency switching transverse electroosmotic flow. By applying a low frequency, square-wave electric field to a pair of parallel electrodes placed at the bottom of the channel, a complex 3D spatial and time-dependence flow was generated to stretch and fold the fluid. This significantly enhanced the mixing effect. The mixing mechanism was first investigated by numerical and experimental analysis. The effects of operational parameters such as flow rate, frequency, and amplitude of the applied voltage have also been investigated. It is found that the best mixing performance is achieved when the frequency is around 1 Hz, and the required mixing length is about 1.5 mm for the case of applied electric potential 5 V peak-to-peak and flow rate 75 microL h(-1). The mixing performance was significantly enhanced when the applied electric potential increased or the flow rate of fluids decreased.

Fast gray-to-gray switching of a hybrid-aligned liquid crystal cell

NASA Astrophysics Data System (ADS)

Choi, Tae-Hoon; Kim, Jung-Wook; Yoon, Tae-Hoon

2015-03-01

We demonstrate fast gray-to-gray (GTG) switching of a hybrid-aligned liquid crystal cell by applying both vertical and inplane electric fields to liquid crystals (LCs) using a four-terminal electrode structure. The LCs are switched to the bright state through downward tilting and twist deformation initiated by applying an in-plane electric field, whereas they are switched back to the initial dark state through optically hidden relaxation initiated by applying a vertical electric field for a short duration. The top electrode in the proposed device is grounded, which requires a much higher voltage to be applied for in-plane rotation of LCs. Thus, ultrafast turn-on switching of the device is achieved, whereas the turn-off switching of the proposed device is independent of the elastic constants and the viscosity of the LCs so that fast turn-off switching can be achieved. We experimentally obtained a total response time of 0.75 ms. Furthermore, fast GTG response within 3 ms could be achieved.

Surface streamer propagations on an alumina bead: experimental observation and numerical modeling

NASA Astrophysics Data System (ADS)

Kang, Woo Seok; Kim, Hyun-Ha; Teramoto, Yoshiyuki; Ogata, Atsushi; Lee, Jin Young; Kim, Dae-Woong; Hur, Min; Song, Young-Hoon

2018-01-01

A surface streamer in a simplified packed-bed reactor has been studied both experimentally (through time-resolved ICCD imaging) and theoretically (through two-dimensional numerical modeling). The propagation of streamers on an alumina spherical bead without catalytic coating shows three distinct phases—the generation and propagation of a primary streamer (PS) with a moderate velocity and electric field, fast PS acceleration with an enhanced electric field, and slow secondary streamer (SS) propagation. The velocity of the streamer is less than that of propagation in a gaseous media. The electric field and velocity at the streamer front are maximized when a PS propagates during the interval from the midpoint of the bead to the bottom electrode. The SS exhibits a much lower velocity and electric field compared with the PS. The PS velocity is affected by an external applied voltage, especially when it approaches the ground electrode. However, that of the SS remains constant regardless of the voltage change. The simulation shows that the PS exhibits a high electric field mainly created by the space charge induced by electrons, whereas the SS relies on ion movement with electron decay in a charge-filled thin streamer body.

Influence of high-power nonlinear consumers on electric energy losses in mining high-voltage power line

NASA Astrophysics Data System (ADS)

Averbukh, M. A.; Prasol, D. A.

2018-03-01

The article elucidates the influence of high-power nonlinear consumers on electric energy losses in a mining high-voltage power line. The object of the study was a fragment of a power supply system of a mining enterprise with hoists. The investigation has assessed the electric energy losses conditioned by nonsinusoidal currents and voltages of the power line over a single hoist operation cycle. Also, the total electric energy losses in a high-voltage power line of a mining enterprise was calculated. The energy losses due to nonsinusoidal currents and voltages over single operation cycle of the cage hoist amount to 36.358 kWh. The presence of such losses increases total technological power and energy losses in the mining high-voltage power line by approximately 5-15%. The total energy losses in the components of the mining enterprise high-voltage power line caused by nonsinusoidal voltage are significant and lead to additional expenses of the company.

High-Throughput Fabrication of Quality Nanofibers Using a Modified Free Surface Electrospinning.

PubMed

Shao, Zhongbiao; Yu, Liang; Xu, Lan; Wang, Mingdi

2017-12-01

Based on bubble electrospinning (BE), a modified free surface electrospinning (MFSE) using a cone-shaped air nozzle combined with a solution reservoir made of copper tubes was presented to increase the production of quality nanofibers. In the MFSE process, sodium dodecyl benzene sulfonates (SDBS) were added in the electrospun solution to generate bubbles on a liquid surface. The effects of applied voltage and generated bubbles on the morphology and production of nanofibers were investigated experimentally and theoretically. The theoretical analysis results of the electric field were in good agreement with the experimental data and showed that the quality and production of nanofibers were improved with the increase of applied voltage, and the generated bubbles would decrease the quality and production of nanofibers.

High-Throughput Fabrication of Quality Nanofibers Using a Modified Free Surface Electrospinning

NASA Astrophysics Data System (ADS)

Shao, Zhongbiao; Yu, Liang; Xu, Lan; Wang, Mingdi

2017-07-01

Based on bubble electrospinning (BE), a modified free surface electrospinning (MFSE) using a cone-shaped air nozzle combined with a solution reservoir made of copper tubes was presented to increase the production of quality nanofibers. In the MFSE process, sodium dodecyl benzene sulfonates (SDBS) were added in the electrospun solution to generate bubbles on a liquid surface. The effects of applied voltage and generated bubbles on the morphology and production of nanofibers were investigated experimentally and theoretically. The theoretical analysis results of the electric field were in good agreement with the experimental data and showed that the quality and production of nanofibers were improved with the increase of applied voltage, and the generated bubbles would decrease the quality and production of nanofibers.

Forced Ion Migration for Chalcogenide Phase Change Memory Device

NASA Technical Reports Server (NTRS)

Campbell, Kristy A (Inventor)

2013-01-01

Non-volatile memory devices with two stacked layers of chalcogenide materials comprising the active memory device have been investigated for their potential as phase-change memories. The devices tested included GeTe/SnTe, Ge2Se3/SnTe, and Ge2Se3/SnSe stacks. All devices exhibited resistance switching behavior. The polarity of the applied voltage with respect to the SnTe or SnSe layer was critical to the memory switching properties, due to the electric field induced movement of either Sn or Te into the Ge-chalcogenide layer. One embodiment of the invention is a device comprising a stack of chalcogenide-containing layers which exhibit phase-change switching only after a reverse polarity voltage potential is applied across the stack causing ion movement into an adjacent layer and thus "activating" the device to act as a phase-change random access memory device or a reconfigurable electronics device when the applied voltage potential is returned to the normal polarity. Another embodiment of the invention is a device that is capable of exhibiting more than two data states.

Forced ion migration for chalcogenide phase change memory device

NASA Technical Reports Server (NTRS)

Campbell, Kristy A. (Inventor)

2011-01-01

Non-volatile memory devices with two stacked layers of chalcogenide materials comprising the active memory device have been investigated for their potential as phase change memories. The devices tested included GeTe/SnTe, Ge.sub.2Se.sub.3/SnTe, and Ge.sub.2Se.sub.3/SnSe stacks. All devices exhibited resistance switching behavior. The polarity of the applied voltage with respect to the SnTe or SnSe layer was critical to the memory switching properties, due to the electric field induced movement of either Sn or Te into the Ge-chalcogenide layer. One embodiment of the invention is a device comprising a stack of chalcogenide-containing layers which exhibit phase change switching only after a reverse polarity voltage potential is applied across the stack causing ion movement into an adjacent layer and thus "activating" the device to act as a phase change random access memory device or a reconfigurable electronics device when the applied voltage potential is returned to the normal polarity. Another embodiment of the invention is a device that is capable of exhibiting more that two data states.

Forced ion migration for chalcogenide phase change memory device

NASA Technical Reports Server (NTRS)

Campbell, Kristy A. (Inventor)

2012-01-01

Non-volatile memory devices with two stacked layers of chalcogenide materials comprising the active memory device have been investigated for their potential as phase-change memories. The devices tested included GeTe/SnTe, Ge.sub.2Se.sub.3/SnTe, and Ge.sub.2Se.sub.3/SnSe stacks. All devices exhibited resistance switching behavior. The polarity of the applied voltage with respect to the SnTe or SnSe layer was critical to the memory switching properties, due to the electric field induced movement of either Sn or Te into the Ge-chalcogenide layer. One embodiment of the invention is a device comprising a stack of chalcogenide-containing layers which exhibit phase-change switching only after a reverse polarity voltage potential is applied across the stack causing ion movement into an adjacent layer and thus "activating" the device to act as a phase-change random access memory device or a reconfigurable electronics device when the applied voltage potential is returned to the normal polarity. Another embodiment of the invention is a device that is capable of exhibiting more than two data states.

Review of Adult Electrical Burn Injury Outcomes Worldwide: An Analysis of Low-Voltage vs High-Voltage Electrical Injury.

PubMed

Shih, Jessica G; Shahrokhi, Shahriar; Jeschke, Marc G

The aims of this article are to review low-voltage vs high-voltage electrical burn complications in adults and to identify novel areas that are not recognized to improve outcomes. An extensive literature search on electrical burn injuries was performed using OVID MEDLINE, PubMed, and EMBASE databases from 1946 to 2015. Studies relating to outcomes of electrical injury in the adult population (≥18 years of age) were included in the study. Forty-one single-institution publications with a total of 5485 electrical injury patients were identified and included in the present study. Fourty-four percent of these patients were low-voltage injuries (LVIs), 38.3% high-voltage injuries (HVIs), and 43.7% with voltage not otherwise specified. Forty-four percentage of studies did not characterize outcomes according to LHIs vs HVIs. Reported outcomes include surgical, medical, posttraumatic, and others (long-term/psychological/rehabilitative), all of which report greater incidence rates in HVI than in LVI. Only two studies report on psychological outcomes such as posttraumatic stress disorder. Mortality rates from electrical injuries are 2.6% in LVI, 5.2% in HVI, and 3.7% in not otherwise specified. Coroner's reports revealed a ratio of 2.4:1 for deaths caused by LVI compared with HVI. HVIs lead to greater morbidity and mortality than LVIs. However, the results of the coroner's reports suggest that immediate mortality from LVI may be underestimated. Furthermore, on the basis of this analysis, we conclude that the majority of studies report electrical injury outcomes; however, the majority of them do not analyze complications by low vs high voltage and often lack long-term psychological and rehabilitation outcomes after electrical injury indicating that a variety of central aspects are not being evaluated or assessed.

Saturation of VCMA in out-of-plane magnetized CoFeB/MgO/CoFeB magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Williamson, M.; de Rozieres, M.; Almasi, H.; Chao, X.; Wang, W.; Wang, J.-P.; Tsoi, M.

2018-05-01

Voltage controlled magnetic anisotropy (VCMA) currently attracts considerable attention as a novel method to control and manipulate magnetic moments in high-speed and low-power spintronic applications based on magnetic tunnel junctions (MTJs). In our experiments, we use ferromagnetic resonance (FMR) to study and quantify VCMA in out-of-plane magnetized CoFeB/MgO/CoFeB MTJ pillars. FMR is excited by applying a microwave current and detected via a small rectified voltage which develops across MTJ at resonance. The VCMA effective field can be extracted from the measured resonance field and was found to vary as a function of electrical bias applied to MTJ. At low applied biases, we observe a linear shift of the VCMA field as a function of the applied voltage which is consistent with the VCMA picture based on the bias-induced electron migration across the MgO/CoFeB interface. At higher biases, both positive and negative, we observe a deviation from the linear behavior which may indicate a saturation of the VCMA effect. These results are important for the design of MTJ-based applications.

Droplet electric separator microfluidic device for cell sorting

NASA Astrophysics Data System (ADS)

Guo, Feng; Ji, Xing-Hu; Liu, Kan; He, Rong-Xiang; Zhao, Li-Bo; Guo, Zhi-Xiao; Liu, Wei; Guo, Shi-Shang; Zhao, Xing-Zhong

2010-05-01

A simple and effective droplet electric separator microfluidic device was developed for cell sorting. The aqueous droplet without precharging operation was influenced to move a distance in the channel along the electric field direction by applying dc voltage on the electrodes beside the channel, which made the target droplet flowing to the collector. Single droplet can be isolated in a sorting rate of ˜100 Hz with microelectrodes under a required pulse. Single or multiple mammalian cell (HePG2) encapsulated in the surfactant free alginate droplet could be sorted out respectively. This method may be used for single cell operation or analysis.

Chern structure in the Bose-insulating phase of Sr2RuO4 nanofilms

NASA Astrophysics Data System (ADS)

Nobukane, Hiroyoshi; Matsuyama, Toyoki; Tanda, Satoshi

2017-01-01

The quantum anomaly that breaks the symmetry, for example the parity and the chirality, in the quantization leads to a physical quantity with a topological Chern invariant. We report the observation of a Chern structure in the Bose-insulating phase of Sr2RuO4 nanofilms by employing electric transport. We observed the superconductor-to-insulator transition by reducing the thickness of Sr2RuO4 single crystals. The appearance of a gap structure in the insulating phase implies local superconductivity. Fractional quantized conductance was observed without an external magnetic field. We found an anomalous induced voltage with temperature and thickness dependence, and the induced voltage exhibited switching behavior when we applied a magnetic field. We suggest that there was fractional magnetic-field-induced electric polarization in the interlayer. These anomalous results are related to topological invariance. The fractional axion angle Θ = π/6 was determined by observing the topological magneto-electric effect in the Bose-insulating phase of Sr2RuO4 nanofilms.

Observation of turnover of spontaneous polarization in ferroelectric layer of pentacene/poly-(vinylidene-trifluoroethylene) double-layer capacitor under photo illumination by optical second-harmonic generation measurement

NASA Astrophysics Data System (ADS)

Shi, Zhemin; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa

2016-04-01

The details of turnover process of spontaneous polarization and associated carrier motions in indium-tin oxide/poly-(vinylidene-trifluoroethylene)/pentacene/Au capacitor were analyzed by coupling displacement current measurement (DCM) and electric-field-induced optical second-harmonic generation (EFISHG) measurement. A model was set up from DCM results to depict the relationship between electric field in semiconductor layer and applied external voltage, proving that photo illumination effect on the spontaneous polarization process lied in variation of semiconductor conductivity. The EFISHG measurement directly and selectively probed the electric field distribution in semiconductor layer, modifying the model and revealing detailed carrier behaviors involving photo illumination effect, dipole reversal, and interfacial charging in the device. A further decrease of DCM current in the low voltage region under illumination was found as the result of illumination effect, and the result was argued based on the changing of the total capacitance of the double-layer capacitors.

Non-Volatile Ferroelectric Switching of Ferromagnetic Resonance in NiFe/PLZT Multiferroic Thin Film Heterostructures.

PubMed

Hu, Zhongqiang; Wang, Xinjun; Nan, Tianxiang; Zhou, Ziyao; Ma, Beihai; Chen, Xiaoqin; Jones, John G; Howe, Brandon M; Brown, Gail J; Gao, Yuan; Lin, Hwaider; Wang, Zhiguang; Guo, Rongdi; Chen, Shuiyuan; Shi, Xiaoling; Shi, Wei; Sun, Hongzhi; Budil, David; Liu, Ming; Sun, Nian X

2016-09-01

Magnetoelectric effect, arising from the interfacial coupling between magnetic and electrical order parameters, has recently emerged as a robust means to electrically manipulate the magnetic properties in multiferroic heterostructures. Challenge remains as finding an energy efficient way to modify the distinct magnetic states in a reliable, reversible, and non-volatile manner. Here we report ferroelectric switching of ferromagnetic resonance in multiferroic bilayers consisting of ultrathin ferromagnetic NiFe and ferroelectric Pb0.92La0.08Zr0.52Ti0.48O3 (PLZT) films, where the magnetic anisotropy of NiFe can be electrically modified by low voltages. Ferromagnetic resonance measurements confirm that the interfacial charge-mediated magnetoelectric effect is dominant in NiFe/PLZT heterostructures. Non-volatile modification of ferromagnetic resonance field is demonstrated by applying voltage pulses. The ferroelectric switching of magnetic anisotropy exhibits extensive applications in energy-efficient electronic devices such as magnetoelectric random access memories, magnetic field sensors, and tunable radio frequency (RF)/microwave devices.

Non-Volatile Ferroelectric Switching of Ferromagnetic Resonance in NiFe/PLZT Multiferroic Thin Film Heterostructures

PubMed Central

Hu, Zhongqiang; Wang, Xinjun; Nan, Tianxiang; Zhou, Ziyao; Ma, Beihai; Chen, Xiaoqin; Jones, John G.; Howe, Brandon M.; Brown, Gail J.; Gao, Yuan; Lin, Hwaider; Wang, Zhiguang; Guo, Rongdi; Chen, Shuiyuan; Shi, Xiaoling; Shi, Wei; Sun, Hongzhi; Budil, David; Liu, Ming; Sun, Nian X.

2016-01-01

Magnetoelectric effect, arising from the interfacial coupling between magnetic and electrical order parameters, has recently emerged as a robust means to electrically manipulate the magnetic properties in multiferroic heterostructures. Challenge remains as finding an energy efficient way to modify the distinct magnetic states in a reliable, reversible, and non-volatile manner. Here we report ferroelectric switching of ferromagnetic resonance in multiferroic bilayers consisting of ultrathin ferromagnetic NiFe and ferroelectric Pb0.92La0.08Zr0.52Ti0.48O3 (PLZT) films, where the magnetic anisotropy of NiFe can be electrically modified by low voltages. Ferromagnetic resonance measurements confirm that the interfacial charge-mediated magnetoelectric effect is dominant in NiFe/PLZT heterostructures. Non-volatile modification of ferromagnetic resonance field is demonstrated by applying voltage pulses. The ferroelectric switching of magnetic anisotropy exhibits extensive applications in energy-efficient electronic devices such as magnetoelectric random access memories, magnetic field sensors, and tunable radio frequency (RF)/microwave devices. PMID:27581071

Non-Volatile Ferroelectric Switching of Ferromagnetic Resonance in NiFe/PLZT Multiferroic Thin Film Heterostructures

NASA Astrophysics Data System (ADS)

Hu, Zhongqiang; Wang, Xinjun; Nan, Tianxiang; Zhou, Ziyao; Ma, Beihai; Chen, Xiaoqin; Jones, John G.; Howe, Brandon M.; Brown, Gail J.; Gao, Yuan; Lin, Hwaider; Wang, Zhiguang; Guo, Rongdi; Chen, Shuiyuan; Shi, Xiaoling; Shi, Wei; Sun, Hongzhi; Budil, David; Liu, Ming; Sun, Nian X.

2016-09-01

Magnetoelectric effect, arising from the interfacial coupling between magnetic and electrical order parameters, has recently emerged as a robust means to electrically manipulate the magnetic properties in multiferroic heterostructures. Challenge remains as finding an energy efficient way to modify the distinct magnetic states in a reliable, reversible, and non-volatile manner. Here we report ferroelectric switching of ferromagnetic resonance in multiferroic bilayers consisting of ultrathin ferromagnetic NiFe and ferroelectric Pb0.92La0.08Zr0.52Ti0.48O3 (PLZT) films, where the magnetic anisotropy of NiFe can be electrically modified by low voltages. Ferromagnetic resonance measurements confirm that the interfacial charge-mediated magnetoelectric effect is dominant in NiFe/PLZT heterostructures. Non-volatile modification of ferromagnetic resonance field is demonstrated by applying voltage pulses. The ferroelectric switching of magnetic anisotropy exhibits extensive applications in energy-efficient electronic devices such as magnetoelectric random access memories, magnetic field sensors, and tunable radio frequency (RF)/microwave devices.

The roles of ozone and zeolite on reactive dye degradation in electrical discharge reactors.

PubMed

Peternel, L; Kusic, H; Koprivanac, N; Locke, B R

2006-05-01

In this study high voltage pulsed corona electrical discharge advanced oxidation processes (AOPs) were applied to bleach and degrade C.I. Reactive Green 8 and C.I. Reactive Red 45 organic dyes in water solutions. Two types of hybrid gas/liquid high voltage electrical discharge (corona) reactors, known as hybrid series and hybrid parallel were studied. The difference between these reactors relates to electrode configuration, which affects the amounts of ozone, hydrogen peroxide and hydroxyl radicals produced. Experiments were conducted using dye concentrations of 20 mgl(-1) and 75 mgl(-1), with and without NH4ZSM5 zeolite addition in order to determine possible effects of added solid particles to total process efficiency. The role of ozone in combination with zeolites was assessed through comparative direct ozonation experiments with ozone supplied by an ozone generator. UV/VIS spectrophotometric measurements and measurements of total organic carbon (TOC) were used for the determination of decolorization and mineralization rates.

Tunable liquid crystal photonic devices

NASA Astrophysics Data System (ADS)

Fan, Yun-Hsing

2005-07-01

Liquid crystal (LC)-based adaptive optics are important for information processing, optical interconnections, photonics, integrated optics, and optical communications due to their tunable optical properties. In this dissertation, we describe novel liquid crystal photonic devices. In Chap. 3, we demonstrate a novel electrically tunable-efficiency Fresnel lens which is devised for the first time using nanoscale PDLC. The tunable Fresnel lens is very desirable to eliminate the need of external spatial light modulator. The nanoscale LC devices are polarization independent and exhibit a fast response time. Because of the small droplet sizes, the operating voltage is higher than 100 Vrms. To lower the driving voltage, in Chap. 2 and Chap. 3, we have investigated tunable Fresnel lens using polymer-network liquid crystal (PNLC) and phase-separated composite film (PSCOF). The operating voltage is below 12 Vrms. The PNLC and PSCOF devices are polarization dependent. To overcome this shortcoming, stacking two cells with orthogonal alignment directions is a possibility. Using PNLC, we also demonstrated LC blazed grating. The diffraction efficiency of these devices is continuously controlled by the electric field. We also develop a system with continuously tunable focal length. A conventional mechanical zooming system is bulky and power hungry. In Chap. 4, we developed an electrically tunable-focus flat LC spherical lens and microlens array. A huge tunable range from 0.6 m to infinity is achieved by the applied voltage. In Chap. 5, we describe a LC microlens array whose focal length can be switched from positive to negative by the applied voltage. The fast response time feature of our LC microlens array will be very helpful in developing 3-D animated images. In Chap. 6, we demonstrate polymer network liquid crystals for switchable polarizers and optical shutters. The use of dual-frequency liquid crystal and special driving scheme leads to a sub-millisecond response time. In Chap. 7, for the first time, we demonstrate a fast-response and scattering-free homogeneously-aligned PNLC light modulator. The PNLC response time is ˜300x faster than that of a pure LC mixture. The PNLC cell also holds promise for mid and long infrared applications where response time is a critical issue.

The application of the barrier-type anodic oxidation method to thickness testing of aluminum films

NASA Astrophysics Data System (ADS)

Chen, Jianwen; Yao, Manwen; Xiao, Ruihua; Yang, Pengfei; Hu, Baofu; Yao, Xi

2014-09-01

The thickness of the active metal oxide film formed from a barrier-type anodizing process is directly proportional to its formation voltage. The thickness of the consumed portion of the metal film is also corresponding to the formation voltage. This principle can be applied to the thickness test of the metal films. If the metal film is growing on a dielectric substrate, when the metal film is exhausted in an anodizing process, because of the high electrical resistance of the formed oxide film, a sudden increase of the recorded voltage during the anodizing process would occur. Then, the thickness of the metal film can be determined from this voltage. As an example, aluminum films are tested and discussed in this work. This method is quite simple and is easy to perform with high precision.

Electron beam method and apparatus for obtaining uniform discharges in electrically pumped gas lasers

DOEpatents

Fenstermacher, Charles A.; Boyer, Keith

1986-01-01

A method and apparatus for obtaining uniform, high-energy, large-volume electrical discharges in the lasing medium of a gas laser whereby a high-energy electron beam is used as an external ionization source to ionize substantially the entire volume of the lasing medium which is then readily pumped by means of an applied potential less than the breakdown voltage of the medium. The method and apparatus are particularly useful in CO.sub.2 laser systems.

Resonant optical device with a microheater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lentine, Anthony L.; DeRose, Christopher

2017-04-04

A resonant photonic device is provided. The device comprises an optical waveguiding element, such as an optical resonator, that includes a diode junction region, two signal terminals configured to apply a bias voltage across the junction region, and a heater laterally separated from the optical waveguiding element. A semiconductor electrical barrier element is juxtaposed to the heater. A metallic strip is electrically and thermally connected at one end to a signal terminal of the optical waveguiding element and thermally connected at another end to the barrier element.

Apparatus for detecting alpha radiation in difficult access areas

DOEpatents

Steadman, Peter; MacArthur, Duncan W.

1997-09-02

An electrostatic alpha radiation detector for measuring alpha radiation emitted from inside an enclosure comprising an electrically conductive expandable electrode for insertion into the enclosure. After insertion, the electrically conductive expandable electrode is insulated from the enclosure and defines a decay cavity between the electrically conductive expandable electrode and the enclosure so that air ions generated in the decay cavity are electrostatically captured by the electrically conductive expandable electrode and the enclosure when an electric potential is applied between the electrically conductive expandable electrode and the enclosure. Indicator means are attached to the electrically conductive expandable electrode for indicating an electrical current produced by generation of the air ions generated in the decay cavity by collisions between air molecules and the alpha particles emitted from the enclosure. A voltage source is connected between the indicator means and the electrically conductive enclosure for creating an electric field between the electrically conductive expandable electrode and the enclosure.

High voltage bus and auxiliary heater control system for an electric or hybrid vehicle

DOEpatents

Murty, Balarama Vempaty

2000-01-01

A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.

Electro-optical effects in porous PET films filled with liquid crystal: new possibilities for fiber optics and THZ applications.

PubMed

Chopik, A; Pasechnik, S; Semerenko, D; Shmeliova, D; Dubtsov, A; Srivastava, A K; Chigrinov, V

2014-03-15

The results of investigation of electro-optical properties of porous polyethylene terephthalate films filled with a nematic liquid crystal (5 CB) are presented. It is established that the optical response of the samples on the applied voltage drastically depends on the frequency range. At low frequencies of applied electrical field (ffc) electric field induces an overall change in the light intensity, which is typical for an electro-optical response of a liquid crystal (LC) layer in a conventional "sandwich"-like cell. The dependences of critical frequency fc, threshold voltages, and characteristic times on a pore diameter d were established. The peculiarities of electro-optical effects can be explained in the framework of the approach which connects the variations of light intensity with the corresponding changes of the effective refractive index n(eff) of a composite LC media. The unusual behavior of the electro-optical response at low frequencies is assigned to the orienting action of the specific shear flow typical for electrokinetic phenomena in polar liquids.

Nanoscale electrical characteristics of metal (Au, Pd)-graphene-metal (Cu) contacts

NASA Astrophysics Data System (ADS)

Ruffino, F.; Meli, G.; Grimaldi, M. G.

2016-01-01

Free-standing graphene presents exceptional physical properties (as a high carrier mobility) making it the ideal candidate for the next generation nanoelectronics. However, when graphene layers are inserted in real electronics devices, metal contacting is required. The metal-graphene interaction significantly affects the graphene electrical properties, drastically changing its behavior with respect to the free-standing configuration. So, this work presents an experimental study on the nanoscale electric characteristics of metal/graphene/metal contacts. In particular, starting from single-layer graphene grown on Cu foil we deposited on the graphene surface two different metal films (Au or Pd) and the Au/graphene/Cu and Pd/graphene/Cu current-voltage characteristics are acquired, on the nanometric scale, by the conductive atomic force microscopy. Both systems presented a current voltage rectifying behavior. However, the Au/graphene/Cu system conducts significantly at negative applied bias (graphene behaves as a p-type semiconductor in a meta/semiconductor contact), while in the Pd/graphene/Cu at positive applied bias (graphene behaves as a n-type semiconductor in a metal/semiconductor contact). This difference is discussed on the basis of the band energy diagram at the metal/graphene interface and the modification of the graphene Fermi level due to the Au/graphene or Pd/graphene interaction.

Tunable microlens arrays using polymer network liquid crystal

NASA Astrophysics Data System (ADS)

Ren, Hongwen; Fan, Yun-Hsing; Gauza, Sebastian; Wu, Shin-Tson

2004-02-01

A tunable-focus microlens array based on polymer network liquid crystal (PNLC) is demonstrated. The PNLC was prepared using an ultraviolet (UV) light exposure through a patterned photomask. The photocurable monomer in each of the UV exposed spot forms an inhomogeneous centro-symmetrical polymer network which acts as a lens when a homogeneous electric field is applied to the cell. The focal length of the microlens arrays is tunable with the applied voltage.

Reduced voltage sensitivity in a K+-channel voltage sensor by electric field remodeling

PubMed Central

González-Pérez, Vivian; Stack, Katherine; Boric, Katica; Naranjo, David

2010-01-01

Propagation of the nerve impulse relies on the extreme voltage sensitivity of Na+ and K+ channels. The transmembrane movement of four arginine residues, located at the fourth transmembrane segment (S4), in each of their four voltage-sensing domains is mostly responsible for the translocation of 12 to 13 eo across the transmembrane electric field. Inserting additional positively charged residues between the voltage-sensing arginines in S4 would, in principle, increase voltage sensitivity. Here we show that either positively or negatively charged residues added between the two most external sensing arginines of S4 decreased voltage sensitivity of a Shaker voltage-gated K+-channel by up to ≈50%. The replacement of Val363 with a charged residue displaced inwardly the external boundaries of the electric field by at least 6 Å, leaving the most external arginine of S4 constitutively exposed to the extracellular space and permanently excluded from the electric field. Both the physical trajectory of S4 and its electromechanical coupling to open the pore gate seemed unchanged. We propose that the separation between the first two sensing charges at resting is comparable to the thickness of the low dielectric transmembrane barrier they must cross. Thus, at most a single sensing arginine side chain could be found within the field. The conserved hydrophobic nature of the residues located between the voltage-sensing arginines in S4 may shape the electric field geometry for optimal voltage sensitivity in voltage-gated ion channels. PMID:20194763

Multilayered Functional Insulation System (MFIS) for AC Power Transmission in High Voltage Hybrid Electrical Propulsion

NASA Technical Reports Server (NTRS)

Lizcano, Maricela

2017-01-01

High voltage hybrid electric propulsion systems are now pushing new technology development efforts for air transportation. A key challenge in hybrid electric aircraft is safe high voltage distribution and transmission of megawatts of power (>20 MW). For the past two years, a multidisciplinary materials research team at NASA Glenn Research Center has investigated the feasibility of distributing high voltage power on future hybrid electric aircraft. This presentation describes the team's approach to addressing this challenge, significant technical findings, and next steps in GRC's materials research effort for MW power distribution on aircraft.

Design and Modelling of a Microfluidic Electro-Lysis Device with Controlling Plates

NASA Technical Reports Server (NTRS)

Jenkins, A.; Chen, C. P.; Spearing, S.; Monaco, L. A.; Steele, A.; Flores, G.

2006-01-01

Many Lab-on-Chip applications require sample pre-treatment systems. Using electric fields to perform cell-lysis in bio-MEMS systems has provided a powerful tool which can be integrated into Lab-on-a-Chip platforms. The major design considerations for electro-lysis devices include optimal geometry and placement of micro-electrodes, cell concentration, flow rates, optimal electric field (e.g. pulsed DC vs. AC), etc. To avoid electrolysis of the flowing solution at the exposed electrode surfaces, magnitudes and the applied voltages and duration of the DC pulse, or the AC frequency of the AC, have to be optimized for a given configuration. Using simulation tools for calculation of electric fields has proved very useful, for exploring alternative configurations and operating conditions for achieving electro cell-lysis. To alleviate the problem associated with low electric fields within the microfluidics channel and the high voltage demand on the contact electrode strips, two "control plates" are added to the microfluidics configuration. The principle of placing the two controlling plate-electrodes is based on the electric fields generated by a combined insulator/dielectric (gladwater) media. Surface charges are established at the insulator/dielectric interface. This paper discusses the effects of this interface charge on the modification of the electric field of the flowing liquid/cell solution.

Simulation of Space Charge Dynamic in Polyethylene Under DC Continuous Electrical Stress

NASA Astrophysics Data System (ADS)

Boukhari, Hamed; Rogti, Fatiha

2016-10-01

The space charge dynamic plays a very important role in the aging and breakdown of polymeric insulation materials under high voltage. This is due to the intensification of the local electric field and the attendant chemical-mechanical effects in the vicinity around the trapped charge. In this paper, we have investigated the space charge dynamic in low-density polyethylene under high direct-current voltage, which is evaluated by experimental conditions. The evaluation is on the basis of simulation using a bipolar charge transport model consisting of charge injection, transports, trapping, detrapping, and recombination phenomena. The theoretical formulation of the physical problem is based on the Poisson, the continuity, and the transport equations. Numerical results provide temporal and local distributions of the electric field, the space charge density for the different kinds of charges (net charge density, mobile and trapped of electron density, mobile hole density), conduction and displacement current densities, and the external current. The result shows the appearance of the negative packet-like space charge with a large amount of the bulk under the dc electric field of 100 kV/mm, and the induced distortion of the electric field is largely near to the anode, about 39% higher than the initial electric field applied.

Electrical Oscillations in Two-Dimensional Microtubular Structures

PubMed Central

Cantero, María del Rocío; Perez, Paula L.; Smoler, Mariano; Villa Etchegoyen, Cecilia; Cantiello, Horacio F.

2016-01-01

Microtubules (MTs) are unique components of the cytoskeleton formed by hollow cylindrical structures of αβ tubulin dimeric units. The structural wall of the MT is interspersed by nanopores formed by the lateral arrangement of its subunits. MTs are also highly charged polar polyelectrolytes, capable of amplifying electrical signals. The actual nature of these electrodynamic capabilities remains largely unknown. Herein we applied the patch clamp technique to two-dimensional MT sheets, to characterize their electrical properties. Voltage-clamped MT sheets generated cation-selective oscillatory electrical currents whose magnitude depended on both the holding potential, and ionic strength and composition. The oscillations progressed through various modes including single and double periodic regimes and more complex behaviours, being prominent a fundamental frequency at 29 Hz. In physiological K+ (140 mM), oscillations represented in average a 640% change in conductance that was also affected by the prevalent anion. Current injection induced voltage oscillations, thus showing excitability akin with action potentials. The electrical oscillations were entirely blocked by taxol, with pseudo Michaelis-Menten kinetics and a KD of ~1.29 μM. The findings suggest a functional role of the nanopores in the MT wall on the genesis of electrical oscillations that offer new insights into the nonlinear behaviour of the cytoskeleton. PMID:27256791

Design and Modelling of a Microfluidic Electro-Lysis Device with Controlling Plates

NASA Astrophysics Data System (ADS)

Jenkins, A.; Chen, C. P.; Spearing, S.; Monaco, L. A.; Steele, A.; Flores, G.

2006-04-01

Many Lab-on-Chip applications require sample pre-treatment systems. Using electric fields to perform cell lysis in bio-MEMS systems has provided a powerful tool which can be integrated into Lab-on-a- Chip platforms. The major design considerations for electro-lysis devices include optimal geometry and placement of micro-electrodes, cell concentration, flow rates, optimal electric field (e.g. pulsed DC vs. AC), etc. To avoid electrolysis of the flowing solution at the exposed electrode surfaces, magnitudes and the applied voltages and duration of the DC pulse, or the AC frequency of the AC, have to be optimized for a given configuration. Using simulation tools for calculation of electric fields has proved very useful, for exploring alternative configurations and operating conditions for achieving electro cell-lysis. To alleviate the problem associated with low electric fields within the microfluidics channel and the high voltage demand on the contact electrode strips, two ''control plates'' are added to the microfluidics configuration. The principle of placing the two controlling plate-electrodes is based on the electric fields generated by a combined insulator/dielectric (glass/water) media. Surface charges are established at the insulator/dielectric interface. This paper discusses the effects of this interface charge on the modification of the electric field of the flowing liquid/cell solution.

29 CFR 1926.97 - Electrical protective equipment.

Code of Federal Regulations, 2014 CFR

2014-07-01

... glove. (2) Electrical requirements. (i) Equipment shall be capable of withstanding the ac proof-test voltage specified in Table E-1 or the dc proof-test voltage specified in Table E-2. (A) The proof test shall reliably indicate that the equipment can withstand the voltage involved. (B) The test voltage...

A novel microfluidic valve controlledby induced charge electro-osmotic flow

NASA Astrophysics Data System (ADS)

Wang, Chengfa; Song, Yongxin; Pan, Xinxiang; Li, Dongqing

2016-07-01

In this paper, a novel microfluidic valve by utilizing induced charge electro-osmotic flow (ICEOF) is proposed and analyzed. The key part of the microfluidic valve is a Y-shaped microchannel. A small metal plate is placed at each corner of the junction of the Y-shaped microchannel. When a DC electrical field is applied through the channels, electro-osmotic flows occur in the channels, and two vortices will be formed near each of the metal plates due to the ICEOF. The two vortices behave like virtual ‘blocking columns’ to restrain and direct the flow in the Y-channel. In this paper, effects of the length of the metal plates, the applied voltages, the width of the microchannel, the zeta potential of the non-metal microchannel wall, and the orientation of the branch channels on the flow switching between two outlet channels are numerically investigated. The results show that the flow switching between the two outlet channels can be flexibly achieved by adjusting the applied DC voltages. The critical switching voltage (CSV), under which one outlet channel is closed, decreases with the increase in the metal plate length and the orientation angle of the outlet channels. The CSV, however, increases with the increase in the inlet voltage, the width of the microchannel, and the absolute value of the zeta potential of the non-metal microchannel wall. Compared with other types of micro-valves, the proposed micro-valve is simple in structure without any moving parts. Only a DC power source is needed for its actuation, thus it can operate automatically by controlling the applied voltages.

Combining molecular dynamics and an electrodiffusion model to calculate ion channel conductance

NASA Astrophysics Data System (ADS)

Wilson, Michael A.; Nguyen, Thuy Hien; Pohorille, Andrew

2014-12-01

Establishing the relation between the structures and functions of protein ion channels, which are protein assemblies that facilitate transmembrane ion transport through water-filled pores, is at the forefront of biological and medical sciences. A reliable way to determine whether our understanding of this relation is satisfactory is to reproduce the measured ionic conductance over a broad range of applied voltages. This can be done in molecular dynamics simulations by way of applying an external electric field to the system and counting the number of ions that traverse the channel per unit time. Since this approach is computationally very expensive we develop a markedly more efficient alternative in which molecular dynamics is combined with an electrodiffusion equation. This alternative approach applies if steady-state ion transport through channels can be described with sufficient accuracy by the one-dimensional diffusion equation in the potential given by the free energy profile and applied voltage. The theory refers only to line densities of ions in the channel and, therefore, avoids ambiguities related to determining the surface area of the channel near its endpoints or other procedures connecting the line and bulk ion densities. We apply the theory to a simple, model system based on the trichotoxin channel. We test the assumptions of the electrodiffusion equation, and determine the precision and consistency of the calculated conductance. We demonstrate that it is possible to calculate current/voltage dependence and accurately reconstruct the underlying (equilibrium) free energy profile, all from molecular dynamics simulations at a single voltage. The approach developed here applies to other channels that satisfy the conditions of the electrodiffusion equation.

Voltage-dependent formation of gramicidin channels in lipid bilayers.

PubMed Central

Sandblom, J; Galvanovskis, J; Jilderos, B

2001-01-01

The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628

Investigation on emission characteristics of metal-ceramic cathode applied to industrial X-ray diode.

PubMed

Xun, Ma; Jianqiang, Yuan; Hongwei, Liu; Hongtao, Li; Lingyun, Wang; Ping, Jiang

2016-06-01

The industrial x-ray diode with high impedance configuration is usually adopted to generate repetitive x-ray, but its performance would be worsened due to lower electric field on the cathode of diode when a voltage of several hundreds of kV is applied. To improve its performance, a novel metal-ceramic cathode is proposed in this paper. Key factors (width, relative permittivity of ceramic, and so on) affecting electric field distribution on triple points are analyzed by electrostatic field calculation program, so as to optimize the design of this novel cathode. Experiments are done to study the characteristics including emission current of cathode, diode voltage duration, diode mean dynamic impedance, and diode impedance drop velocity within diode power duration. The results show that metal-ceramic cathode could improve diode performance by enhancing emission current and stabling impedance; the impedance drop velocity of diode with spoke-shaped metal-ceramic cathode was reduced to -5 Ω ns(-1) within diode power duration, comparing to -15 Ω ns(-1) with metal foil cathode.

Non-invasive probe diagnostic method for electron temperature and ion current density in atmospheric pressure plasma jet source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Young-Cheol; Kim, Yu-Sin; Lee, Hyo-Chang

2015-08-15

The electrical probe diagnostics are very hard to be applied to atmospheric plasmas due to severe perturbation by the electrical probes. To overcome this, the probe for measuring electron temperature and ion current density is indirectly contacted with an atmospheric jet source. The plasma parameters are obtained by using floating harmonic analysis. The probe is mounted on the quartz tube that surrounds plasma. When a sinusoidal voltage is applied to a probe contacting on a quartz tube, the electrons near the sheath at dielectric tube are collected and the probe current has harmonic components due to probe sheath nonlinearity. Frommore » the relation of the harmonic currents and amplitude of the sheath voltage, the electron temperature near the wall can be obtained with collisional sheath model. The electron temperatures and ion current densities measured at the discharge region are in the ranges of 2.7–3.4 eV and 1.7–5.2 mA/cm{sup 2} at various flow rates and input powers.« less

A molecular dynamics simulation study on trapping ions in a nanoscale Paul trap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Xiongce; Krstic, Predrag S

2008-01-01

We found by molecular dynamics simulations that a low energy ion can be trapped effectively in a nanoscale Paul trap in both vacuum and in aqueous environment when appropriate AC/DC electric fields are applied to the system. Using the negatively charged chlorine ion as an example, we show that the trapped ion oscillates around the center of the nanotrap with the amplitude dependent on the parameters of the system and applied voltage. Successful trapping of the ion within nanoseconds requires electric bias of GHz frequency, in the range of hundreds of mV. The oscillations are damped in the aqueous environment,more » but polarization of the water molecules requires application of the higher voltage biases to reach the improved stability of the trapping. Application of a supplemental DC driving field along the trap axis can effectively drive the ion off the trap center and out of the trap, opening a possibility of studying DNA and other biological molecules using embedded probes while achieving a full control of their translocation and localization in the trap.« less

Wavelet transform processing applied to partial discharge evaluation

NASA Astrophysics Data System (ADS)

Macedo, E. C. T.; Araújo, D. B.; da Costa, E. G.; Freire, R. C. S.; Lopes, W. T. A.; Torres, I. S. M.; de Souza Neto, J. M. R.; Bhatti, S. A.; Glover, I. A.

2012-05-01

Partial Discharge (PD) is characterized by high frequency current pulses that occur in high voltage (HV) electrical equipments originated from gas ionization process when damaged insulation is submitted to high values of electric field [1]. PD monitoring is a useful method of assessing the aging degree of the insulation, manufacturing defects or chemical/mechanical damage. Many sources of noise (e.g. radio transmissions, commutator noise from rotating machines, power electronics switching circuits, corona discharge, etc.) can directly affect the PD estimation. Among the many mathematical techniques that can be applied to de-noise PD signals, the wavelet transform is one of the most powerful. It can simultaneously supply information about the pulse occurrence, time and pulse spectrum, and also de-noise in-field measured PD signals. In this paper is described the application of wavelet transform in the suppression of the main types of noise that can affect the observation and analysis of PD signals in high voltage apparatus. In addition, is presented a study that indicates the appropriated mother-wavelet for this application based on the cross-correlation factor.

Comparison of characteristics and downstream uniformity of linear-field and cross-field atmospheric pressure plasma jet array in He

NASA Astrophysics Data System (ADS)

Zhang, Bo; Fang, Zhi; Liu, Feng; Zhou, Renwu; Zhou, Ruoyu

2018-06-01

Using an atmospheric pressure plasma jet array is an effective way for expanding the treatment area of a single jet, and generating arrays with well downstream uniformity is of great interest for its applications. In this paper, a plasma jet array in helium is generated in a linear-field jet array with a ring-ring electrode structure excited by alternating current. The characteristics and downstream uniformity of the array and their dependence on the applied voltage and gas flow rate are investigated through optical, electrical, and Schlieren diagnostics. The results are compared with those of our reported work of a cross-field jet array with a needle-ring electrode structure. The results show that the linear-field jet array can generate relatively large-scale plasma with better uniformity and longer plumes than the cross-field case. The divergences observed in gas channels and the plasma plume trajectories are much less than those of the cross-field one. The deflection angle of lateral plumes is less than 6°, which is independent of the gas flow rate and applied voltage. The maximum downstream plumes of 23 mm can be obtained at 7 kV peak applied voltage and 4 l/min gas flow rate. The better uniformity of linear-field jet arrays is due to the effective suppression of hydrodynamic and electrical interactions among the jets in the arrays with a more uniform electric field distribution. The hydrodynamic interaction induced by the gas heating in the linear-field jet array is less than that of the cross-field one. The more uniform electric field distribution in the linear-field jet arrays can reduce the divergence of the propagation trajectories of the plasma plumes. It will generate less residual charge between the adjacent discharges and thus can reduce the accumulation effect of Coulomb force between the plasma plumes. The reported results can help design controllable and scalable plasma jet arrays with well uniformity for material surface and biomedical treatments.

Healing of broken multiwalled carbon nanotubes using very low energy electrons in SEM: a route toward complete recovery.

PubMed

Kulshrestha, Neha; Misra, Abhishek; Hazra, Kiran Shankar; Roy, Soumyendu; Bajpai, Reeti; Mohapatra, Dipti Ranjan; Misra, D S

2011-03-22

We report the healing of electrically broken multiwalled carbon nanotubes (MWNTs) using very low energy electrons (3-10 keV) in scanning electron microscopy (SEM). Current-induced breakdown caused by Joule heating has been achieved by applying suitably high voltages. The broken tubes were examined and exposed to electrons of 3-10 keV in situ in SEM with careful maneuvering of the electron beam at the broken site, which results in the mechanical joining of the tube. Electrical recovery of the same tube has been confirmed by performing the current-voltage measurements after joining. This easy approach is directly applicable for the repairing of carbon nanotubes incorporated in ready devices, such as in on-chip horizontal interconnects or on-tip probing applications, such as in scanning tunneling microscopy.

Piezo-phototronic sensor

DOEpatents

Wang, Zhong L.; Hu, Youfan; Zhang, Yan

2013-10-15

A device includes a substrate having a first surface. A piezoelectric nanowire is disposed on the first surface of the substrate. The piezoelectric nanowire has a first end and an opposite second end. The piezoelectric nanowire is subjected to an amount of strain. A first Schottky contact is in electrical communication with the first end of the piezoelectric nanowire. A second Schottky contact is in electrical communication with the second end of the piezoelectric nanowire. A bias voltage source is configured to impart a bias voltage between the first Schottky contact and the second Schottky contact. A mechanism is configured to measure current flowing through the piezoelectric nanowire. The amount of strain is selected so that a predetermined current will flow through the piezoelectric nanowire when light of a selected intensity is applied to a first location on the piezoelectric nanowire.

Primary Electric Propulsion Technology Study. [for thruster wear-out mechanisms

NASA Technical Reports Server (NTRS)

Poeschel, R. L.; Beattie, J. R.

1979-01-01

An investigation of the 30-cm engineering-model-thruster technology with emphasis placed on the development of models for understanding and predicting the operational characteristics and wear-out mechanisms of the thruster as a function of operating or design parameters is presented. The task studies include: (1) the wear mechanisms and wear rates that determine the useful lifetime of the thruster discharge chamber; (2) cathode lifetime as determined by the depletion of barium from the barium-aluminate-impregnated-porous-tungsten insert that serves as a barium reservoir; (3) accelerator-grid-system technology; (4) a verification of the high-voltage propellant-flow-electrical-isolator design developed under NASA contract NAS3-20395 for operation at 10-kV applied voltage and 10-A equivalent propellant flow with mercury and argon propellants. A model was formulated for predicting performance.

Imaging of the interaction of low frequency electric fields with biological tissues by optical coherence tomography

NASA Astrophysics Data System (ADS)

Peña, Adrian F.; Devine, Jack; Doronin, Alexander; Meglinski, Igor

2014-03-01

We report the use of conventional Optical Coherence Tomography (OCT) for visualization of propagation of low frequency electric field in soft biological tissues ex vivo. To increase the overall quality of the experimental images an adaptive Wiener filtering technique has been employed. Fourier domain correlation has been subsequently applied to enhance spatial resolution of images of biological tissues influenced by low frequency electric field. Image processing has been performed on Graphics Processing Units (GPUs) utilizing Compute Unified Device Architecture (CUDA) framework in the frequencydomain. The results show that variation in voltage and frequency of the applied electric field relates exponentially to the magnitude of its influence on biological tissue. The magnitude of influence is about twice more for fresh tissue samples in comparison to non-fresh ones. The obtained results suggest that OCT can be used for observation and quantitative evaluation of the electro-kinetic changes in biological tissues under different physiological conditions, functional electrical stimulation, and potentially can be used non-invasively for food quality control.

Irreversible electroporation ablation area enhanced by synergistic high- and low-voltage pulses.

PubMed

Yao, Chenguo; Lv, Yanpeng; Dong, Shoulong; Zhao, Yajun; Liu, Hongmei

2017-01-01

Irreversible electroporation (IRE) produced by a pulsed electric field can ablate tissue. In this study, we achieved an enhancement in ablation area by using a combination of short high-voltage pulses (HVPs) to create a large electroporated area and long low-voltage pulses (LVPs) to ablate the electroporated area. The experiments were conducted in potato tuber slices. Slices were ablated with an array of four pairs of parallel steel electrodes using one of the following four electric pulse protocols: HVP, LVP, synergistic HVP+LVP (SHLVP) or LVP+HVP. Our results showed that the SHLVPs more effectively necrotized tissue than either the HVPs or LVPs, even when the SHLVP dose was the same as or lower than the HVP or LVP doses. The HVP and LVP order mattered and only HVPs+LVPs (SHLVPs) treatments increased the size of the ablation zone because the HVPs created a large electroporated area that was more susceptible to the subsequent LVPs. Real-time temperature change monitoring confirmed that the tissue was non-thermally ablated by the electric pulses. Theoretical calculations of the synergistic effects of the SHLVPs on tissue ablation were performed. Our proposed SHLVP protocol provides options for tissue ablation and may be applied to optimize the current clinical IRE protocols.

Irreversible electroporation ablation area enhanced by synergistic high- and low-voltage pulses

PubMed Central

2017-01-01

Irreversible electroporation (IRE) produced by a pulsed electric field can ablate tissue. In this study, we achieved an enhancement in ablation area by using a combination of short high-voltage pulses (HVPs) to create a large electroporated area and long low-voltage pulses (LVPs) to ablate the electroporated area. The experiments were conducted in potato tuber slices. Slices were ablated with an array of four pairs of parallel steel electrodes using one of the following four electric pulse protocols: HVP, LVP, synergistic HVP+LVP (SHLVP) or LVP+HVP. Our results showed that the SHLVPs more effectively necrotized tissue than either the HVPs or LVPs, even when the SHLVP dose was the same as or lower than the HVP or LVP doses. The HVP and LVP order mattered and only HVPs+LVPs (SHLVPs) treatments increased the size of the ablation zone because the HVPs created a large electroporated area that was more susceptible to the subsequent LVPs. Real-time temperature change monitoring confirmed that the tissue was non-thermally ablated by the electric pulses. Theoretical calculations of the synergistic effects of the SHLVPs on tissue ablation were performed. Our proposed SHLVP protocol provides options for tissue ablation and may be applied to optimize the current clinical IRE protocols. PMID:28253331

Avoiding neuromuscular stimulation in liver irreversible electroporation using radiofrequency electric fields

NASA Astrophysics Data System (ADS)

Castellví, Quim; Mercadal, Borja; Moll, Xavier; Fondevila, Dolors; Andaluz, Anna; Ivorra, Antoni

2018-02-01

Electroporation-based treatments typically consist of the application of high-voltage dc pulses. As an undesired side effect, these dc pulses cause electrical stimulation of excitable tissues such as motor nerves. The present in vivo study explores the use of bursts of sinusoidal voltage in a frequency range from 50 kHz to 2 MHz, to induce irreversible electroporation (IRE) whilst avoiding neuromuscular stimulation. A series of 100 dc pulses or sinusoidal bursts, both with an individual duration of 100 µs, were delivered to rabbit liver through thin needles in a monopolar electrode configuration, and thoracic movements were recorded with an accelerometer. Tissue samples were harvested three hours after treatment and later post-processed to determine the dimensions of the IRE lesions. Thermal damage due to Joule heating was ruled out via computer simulations. Sinusoidal bursts with a frequency equal to or above 100 kHz did not cause thoracic movements and induced lesions equivalent to those obtained with conventional dc pulses when the applied voltage amplitude was sufficiently high. IRE efficacy dropped with increasing frequency. For 100 kHz bursts, it was estimated that the electric field threshold for IRE is about 1.4 kV cm-1 whereas that of dc pulses is about 0.5 kV cm-1.

Hybrid Organic/ZnO p-n Junctions with n-Type ZnO Grown by Atomic Layer Deposition

NASA Astrophysics Data System (ADS)

Łuka, G.; Krajewski, T.; Szczerbakow, A.; Łusakowska, E.; Kopalko, K.; Guziewicz, E.; Wachnicki, Ł.; Szczepanik, A.; Godlewski, M.; Fidelus, J. D.

2008-11-01

We report on fabrication of hybrid inorganic-on-organic thin film structures with polycrystalline zinc oxide films grown by atomic layer deposition technique. ZnO films were deposited on two kinds of thin organic films, i.e. pentacene and poly(dimethylosiloxane) elastomer with a carbon nanotube content (PDMS:CNT). Surface morphology as well as electrical measurements of the films and devices were analyzed. The current density versus voltage (I-V) characteristics of ITO/pentacene/ZnO/Au structure show a low-voltage switching phenomenon typical of organic memory elements. The I-V studies of ITO/PDMS:CNT/ZnO/Au structure indicate some charging effects in the system under applied voltages.

Case report of a high voltage electrical injury and review of the indications for early fasciotomy in limb salvage of an electrically injured limb

PubMed Central

Huei, T.J.; Mohd Yussof, S.J.; Lip, H.T.C.; Salina, I.

2017-01-01

Summary Electrical injuries make up a relatively small portion of burn injuries. Safety measures in place on domestic electricity supply have reduced the occurrence of high voltage electrical injuries. We present the case of a young man who sustained a high voltage electrical injury on all four limbs. Early fasciotomy was performed on both his hands and forearms. Despite early compartment release, the left upper limb deteriorated and required amputation. In this article we discuss the indications, outcomes and complications of early fasciotomy. PMID:29021730

Comparative simulation analysis on the ignition threshold of atmospheric He and Ar dielectric barrier discharge

NASA Astrophysics Data System (ADS)

Yao, Congwei; Chang, Zhengshi; Chen, Sile; Ma, Hengchi; Mu, Haibao; Zhang, Guan-Jun

2017-09-01

Dielectric barrier discharge (DBD) is widely applied in many fields, and the discharge characteristics of insert gas have been the research focus for years. In this paper, fluid models of atmospheric Ar and He DBDs driven by 22 kHz sinusoidal voltage are built to analyze their ignition processes. The contributions of different electron sources in ignition process are analyzed, including the direct ionization of ground state atom, stepwise ionization of metastable particles, and secondary electron emission from dielectric wall, and they play different roles in different discharge stages. The Townsend direct ionization coefficient of He is higher than Ar with the same electrical field intensity, which is the direct reason for the different ignition thresholds between He and Ar. Further, the electron energy loss per free electron produced in Ar and He DBDs is discussed. It is found that the total electron energy loss rate of Ar is higher than He when the same electrical field is applied. The excitation reaction of Ar consumes the major electron energy but cannot produce free electrons effectively, which is the essential reason for the higher ignition threshold of Ar. The computation results of He and Ar extinction voltages can be explained in the view of electron energy loss, as well as the experimental results of different extinction voltages between Ar/NH3 and He DBDs.

Removal of virus and toxin using heatable multi-walled carbon nanotube web filters

NASA Astrophysics Data System (ADS)

Jang, Hoon-Sik; Jeon, Sang Koo; Ryu, Kwon-Sang; Nahm, Seung Hoon

2016-02-01

Many studies have used a carbon nanotube (CNT) filter for pathogen removal and/or inactivation by means of electrochemical or electrochlorination. The large surface area, fine pore size and high electrical and thermal conductivity of CNTs make them suitable and distinct to use for the filtering and removal of pathogens. Here, we grew spin-capable multi-walled CNTs (MWCNTs) and manufactured a web filter using the spun MWCNTs. Botulinum toxin type E light chain (BoT/E-LC) and vaccinia virus (VV) were filtered using the MWCNT web filters and were evaporated and removed by applying direct current (DC) voltage to both sides of the MWCNT webs, excluding electrochemical or electrochlorination. The filtering and removal of BoT/E-LC and VV were performed after seven layers of the MWCNT sheets were coated onto a silicon oxide porous plate. The electrical resistance of the webs in the seven layer sheet was 293 Ω. The temperature of MWCNTs webs was linearly increased to ˜300 °C at 210 V of DC voltage. This temperature was enough to remove BoT/E-LC and VV. From the SEM and XPS results, we confirmed that BoT/E-LC and VV on the MWCNT webs were almost removed by applying a DC voltage and that some element (N, Na, Cl, etc.) as residues on the MWCNT webs remained.

Electromicroinjection of particles into living cells

DOEpatents

Ray, F. Andrew; Cram, L. Scott; Galey, William R.

1988-01-01

Method and apparatus for introducing particles into living cells. Fluorescently-stained human chromosomes are introduced into cultured, mitotic Chinese hamster cells using electromicroinjection. The recipient cells frequently survived the physiological perturbation imposed by a successful chromosome injection. Successfully injected recipient cells maintained viability as evidenced by their ability to be expanded. The technique relies on the surface charge of fluorescently stained chromosomes and their ability to be attracted and repelled to and from the tip of a micropipette. The apparatus includes a micropipette having a tip suitable for piercing the membrane of a target cell and an electrode inserted into the lumen thereof. The target cells and suspended particles are located in an electrically conducted solution, and the lumen of the micropipette is filled with an electrically conducting solution which contacts the electrode located therein. A second electrode is also located in the conducting solution containing the target cells and particles. Voltages applied to the electrode within the micropipette attract the particles to the region of the tip thereof. The particles adhere to the surface of the micropipette with sufficient force that insertion of the micropipette tip and attached particle through the membrane of a target cell will not dislodge the particle. By applying a voltage having the opposite polarity of the attraction voltage, the particles are expelled from the micropipette to which is then withdrawn from the cell body.

Shuttlecock-Shaped Molecular Rectifier: Asymmetric Electron Transport Coupled with Controlled Molecular Motion.

PubMed

Ryu, Taekhee; Lansac, Yves; Jang, Yun Hee

2017-07-12

A fullerene derivative with five hydroxyphenyl groups attached around a pentagon, (4-HOC 6 H 4 ) 5 HC 60 (1), has shown an asymmetric current-voltage (I-V) curve in a conducting atomic force microscopy experiment on gold. Such molecular rectification has been ascribed to the asymmetric distribution of frontier molecular orbitals over its shuttlecock-shaped structure. Our nonequilibrium Green's function (NEGF) calculations based on density functional theory (DFT) indeed exhibit an asymmetric I-V curve for 1 standing up between two Au(111) electrodes, but the resulting rectification ratio (RR ∼ 3) is insufficient to explain the wide range of RR observed in experiments performed under a high bias voltage. Therefore, we formulate a hypothesis that high RR (>10) may come from molecular orientation switching induced by a strong electric field applied between two electrodes. Indeed, molecular dynamics simulations of a self-assembled monolayer of 1 on Au(111) show that the orientation of 1 can be switched between standing-up and lying-on-the-side configurations in a manner to align its molecular dipole moment with the direction of the applied electric field. The DFT-NEGF calculations taking into account such field-induced reorientation between up and side configurations indeed yield RR of ∼13, which agrees well with the experimental value obtained under a high bias voltage.

Electrical Characterization Laboratory | Energy Systems Integration

Science.gov Websites

the ability of electrical equipment to withstand high-voltage surges and high-current faults. A capability. High-Voltage Characterization The high-voltage characterization hub offers a Class 1, Div 2 lab

30 CFR 75.511 - Low-, medium-, or high-voltage distribution circuits and equipment; repair.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Low-, medium-, or high-voltage distribution... Electrical Equipment-General § 75.511 Low-, medium-, or high-voltage distribution circuits and equipment; repair. [Statutory Provision] No electrical work shall be performed on low-, medium-, or high-voltage...

30 CFR 75.511 - Low-, medium-, or high-voltage distribution circuits and equipment; repair.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Low-, medium-, or high-voltage distribution... Electrical Equipment-General § 75.511 Low-, medium-, or high-voltage distribution circuits and equipment; repair. [Statutory Provision] No electrical work shall be performed on low-, medium-, or high-voltage...

30 CFR 75.511 - Low-, medium-, or high-voltage distribution circuits and equipment; repair.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Low-, medium-, or high-voltage distribution... Electrical Equipment-General § 75.511 Low-, medium-, or high-voltage distribution circuits and equipment; repair. [Statutory Provision] No electrical work shall be performed on low-, medium-, or high-voltage...

30 CFR 75.511 - Low-, medium-, or high-voltage distribution circuits and equipment; repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Low-, medium-, or high-voltage distribution... Electrical Equipment-General § 75.511 Low-, medium-, or high-voltage distribution circuits and equipment; repair. [Statutory Provision] No electrical work shall be performed on low-, medium-, or high-voltage...

30 CFR 75.511 - Low-, medium-, or high-voltage distribution circuits and equipment; repair.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Low-, medium-, or high-voltage distribution... Electrical Equipment-General § 75.511 Low-, medium-, or high-voltage distribution circuits and equipment; repair. [Statutory Provision] No electrical work shall be performed on low-, medium-, or high-voltage...

Improved detection of electrical activity with a voltage probe based on a voltage-sensing phosphatase.

PubMed

Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi

2013-09-15

  One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.

Development of super-clean diesel engine and combustor using nonthermal plasma hybrid aftertreatment

NASA Astrophysics Data System (ADS)

Okubo, Masaaki

2015-10-01

One of important and successful environmental applications of atmospheric-pressure corona discharge or plasma is electrostatic precipitator (ESP), which have been widely used for coal- or oil-fired boilers in electric power plants and particulate matter control emitted from industries such as glass melting furnace system, etc. In the ESPs, steady high voltage is usually applied to a pair of electrodes (at least, one of these has sharp edge). Unsteady pulsed high voltage is often applied for the collection of high-resistivity particulate matter (PM) to avoid reverse corona phenomena which reduce the collection efficiency of the ESPs. It was found that unsteady high voltage can treat hazardous gaseous components (NOx, SOx, hydrocarbon, and CO, etc.) in the exhaust gas, and researches were shifted from PM removal to hazardous gases aftertreatment with unsteady corona discharge induced plasmas. In the paper, recent results on diesel engine and industrial boiler emission controls are mainly reviewed among these our research topics.

Membrane potential dynamics of axons in cultured hippocampal neurons probed by second-harmonic-generation imaging

NASA Astrophysics Data System (ADS)

Nuriya, Mutsuo; Yasui, Masato

2010-03-01

The electrical properties of axons critically influence the nature of communication between neurons. However, due to their small size, direct measurement of membrane potential dynamics in intact and complex mammalian axons has been a challenge. Furthermore, quantitative optical measurements of axonal membrane potential dynamics have not been available. To characterize the basic principles of somatic voltage signal propagation in intact axonal arbors, second-harmonic-generation (SHG) imaging is applied to cultured mouse hippocampal neurons. When FM4-64 is applied extracellularly to dissociated neurons, whole axonal arbors are visualized by SHG imaging. Upon action potential generation by somatic current injection, nonattenuating action potentials are recorded in intact axonal arbors. Interestingly, however, both current- and voltage-clamp recordings suggest that nonregenerative subthreshold somatic voltage changes at the soma are poorly conveyed to these axonal sites. These results reveal the nature of membrane potential dynamics of cultured hippocampal neurons, and further show the possibility of SHG imaging in physiological investigations of axons.

Lateral separation of colloids or cells by dielectrophoresis augmented by AC electroosmosis.

PubMed

Zhou, Hao; White, Lee R; Tilton, Robert D

2005-05-01

Colloidal particles and biological cells are patterned and separated laterally adjacent to a micropatterned electrode array by applying AC electric fields that are principally oriented normally to the electrode array. This is demonstrated for yeast cells, red blood cells, and colloidal polystyrene particles of different sizes and zeta-potentials. The separation mechanism is observed experimentally to depend on the applied field frequency and voltage. At high frequencies, particles position themselves in a manner that is consistent with dielectrophoresis, while at low frequencies, the positioning is explained in terms of a strong coupling between gravity, the vertical component of the dielectrophoretic force, and the Stokes drag on particles induced by AC electroosmotic flow. Compared to high frequency dielectrophoretic separations, the low frequency separations are faster and require lower applied voltages. Furthermore, the AC electroosmosis coupling with dielectrophoresis may enable cell separations that are not feasible based on dielectrophoresis alone.

Simulations of induced-charge electro-osmosis in microfluidic devices

NASA Astrophysics Data System (ADS)

Ben, Yuxing

2005-03-01

Theories of nonlinear electrokinetic phenomena generally assume a uniform, neutral bulk electroylte in contact with a polarizable thin double layer near a metal or dielectric surface, which acts as a "capacitor skin". Induced-charge electro-osmosis (ICEO) is the general effect of nonlinear electro-osmotic slip, when an applied electric field acts on its own induced (diffuse) double-layer charge. In most theoretical and experimental work, ICEO has been studied in very simple geometries, such as colloidal spheres and planar, periodic micro-electrode arrays. Here we use finite-element simulations to predict how more complicated geometries of polarizable surfaces and/or electrodes yield flow profiles with subtle dependence on the amplitude and frequency of the applied voltage. We also consider how the simple model equations break down, due to surface conduction, bulk diffusion, and concentration polarization, for large applied voltages (as in most experiments).

Tough Nanocomposite Ionogel-based Actuator Exhibits Robust Performance

NASA Astrophysics Data System (ADS)

Liu, Xinhua; He, Bin; Wang, Zhipeng; Tang, Haifeng; Su, Teng; Wang, Qigang

2014-10-01

Ionogel electrolytes can be fabricated for electrochemical actuators with many desirable advantages, including direct low-voltage control in air, high electrochemical and thermal stability, and complete silence during actuation. However, the demands for active actuators with above features and load-driving ability remain a challenge; much work is necessary to enhance the mechanical strength of electrolyte materials. Herein, we describe a cross-linked supramolecular approach to prepare tough nanocomposite gel electrolytes from HEMA, BMIMBF4, and TiO2 via self-initiated UV polymerization. The tough and stable ionogels are emerging to fabricate electric double-layer capacitor-like soft actuators, which can be driven by electrically induced ion migration. The ionogel-based actuator shows a displacement response of 5.6 mm to the driving voltage of 3.5 V. After adding the additional mass weight of the same as the actuator, it still shows a large displacement response of 3.9 mm. Furthermore, the actuator can not only work in harsh temperature environments (100°C and -10°C) but also realize the goal of grabbing an object by adjusting the applied voltage.

Tough nanocomposite ionogel-based actuator exhibits robust performance.

PubMed

Liu, Xinhua; He, Bin; Wang, Zhipeng; Tang, Haifeng; Su, Teng; Wang, Qigang

2014-10-20

Ionogel electrolytes can be fabricated for electrochemical actuators with many desirable advantages, including direct low-voltage control in air, high electrochemical and thermal stability, and complete silence during actuation. However, the demands for active actuators with above features and load-driving ability remain a challenge; much work is necessary to enhance the mechanical strength of electrolyte materials. Herein, we describe a cross-linked supramolecular approach to prepare tough nanocomposite gel electrolytes from HEMA, BMIMBF4, and TiO2 via self-initiated UV polymerization. The tough and stable ionogels are emerging to fabricate electric double-layer capacitor-like soft actuators, which can be driven by electrically induced ion migration. The ionogel-based actuator shows a displacement response of 5.6 mm to the driving voltage of 3.5 V. After adding the additional mass weight of the same as the actuator, it still shows a large displacement response of 3.9 mm. Furthermore, the actuator can not only work in harsh temperature environments (100°C and -10°C) but also realize the goal of grabbing an object by adjusting the applied voltage.

Tough Nanocomposite Ionogel-based Actuator Exhibits Robust Performance

PubMed Central

Liu, Xinhua; He, Bin; Wang, Zhipeng; Tang, Haifeng; Su, Teng; Wang, Qigang

2014-01-01

Ionogel electrolytes can be fabricated for electrochemical actuators with many desirable advantages, including direct low-voltage control in air, high electrochemical and thermal stability, and complete silence during actuation. However, the demands for active actuators with above features and load-driving ability remain a challenge; much work is necessary to enhance the mechanical strength of electrolyte materials. Herein, we describe a cross-linked supramolecular approach to prepare tough nanocomposite gel electrolytes from HEMA, BMIMBF4, and TiO2 via self-initiated UV polymerization. The tough and stable ionogels are emerging to fabricate electric double-layer capacitor-like soft actuators, which can be driven by electrically induced ion migration. The ionogel-based actuator shows a displacement response of 5.6 mm to the driving voltage of 3.5 V. After adding the additional mass weight of the same as the actuator, it still shows a large displacement response of 3.9 mm. Furthermore, the actuator can not only work in harsh temperature environments (100°C and −10°C) but also realize the goal of grabbing an object by adjusting the applied voltage. PMID:25327414

Margin and sensitivity methods for security analysis of electric power systems

NASA Astrophysics Data System (ADS)

Greene, Scott L.

Reliable operation of large scale electric power networks requires that system voltages and currents stay within design limits. Operation beyond those limits can lead to equipment failures and blackouts. Security margins measure the amount by which system loads or power transfers can change before a security violation, such as an overloaded transmission line, is encountered. This thesis shows how to efficiently compute security margins defined by limiting events and instabilities, and the sensitivity of those margins with respect to assumptions, system parameters, operating policy, and transactions. Security margins to voltage collapse blackouts, oscillatory instability, generator limits, voltage constraints and line overloads are considered. The usefulness of computing the sensitivities of these margins with respect to interarea transfers, loading parameters, generator dispatch, transmission line parameters, and VAR support is established for networks as large as 1500 buses. The sensitivity formulas presented apply to a range of power system models. Conventional sensitivity formulas such as line distribution factors, outage distribution factors, participation factors and penalty factors are shown to be special cases of the general sensitivity formulas derived in this thesis. The sensitivity formulas readily accommodate sparse matrix techniques. Margin sensitivity methods are shown to work effectively for avoiding voltage collapse blackouts caused by either saddle node bifurcation of equilibria or immediate instability due to generator reactive power limits. Extremely fast contingency analysis for voltage collapse can be implemented with margin sensitivity based rankings. Interarea transfer can be limited by voltage limits, line limits, or voltage stability. The sensitivity formulas presented in this thesis apply to security margins defined by any limit criteria. A method to compute transfer margins by directly locating intermediate events reduces the total number of loadflow iterations required by each margin computation and provides sensitivity information at minimal additional cost. Estimates of the effect of simultaneous transfers on the transfer margins agree well with the exact computations for a network model derived from a portion of the U.S grid. The accuracy of the estimates over a useful range of conditions and the ease of obtaining the estimates suggest that the sensitivity computations will be of practical value.

Pure spin current and phonon thermoelectric transport in a triangulene-based molecular junction.

PubMed

Wang, Qiang; Li, Jianwei; Nie, Yihang; Xu, Fuming; Yu, Yunjin; Wang, Bin

2018-06-13

The experimental synthesis and characterization of enigmatic triangulene were reported for the first time recently. Based on this enigmatic molecule, we proposed a triangulene-based molecular junction and presented first principles calculations to investigate the electron and phonon thermoelectric transport properties. Numerical results show that the spin polarized electric transport properties of the triangulene-based molecular junction can be adjusted effectively by bias voltage and gate voltage. Through varying the gate voltage applied on the triangulene molecule, the system can exhibit a perfect spin filter effect. When a temperature gradient is applied between the two leads, spin up current and spin down current flow along opposite directions in the system simultaneously. Thus pure spin current can be obtained on a large scale by changing the temperature, temperature gradient, and gate voltage. When the phonon vibration effect is considered in thermal transport, the figure of merit is suppressed distinctively especially when the temperature is within the 10 K < T < 100 K range. More importantly, a large spin figure of merit can be achieved accompanied by a small charge figure of merit by adjusting the temperature, gate voltage and chemical potential in a wide range, which indicates a favorable application prospect of the triangulene-based molecular junction as a spin calorigenic device.

Ion diagnostics of a discharge in crossed electric and magnetic fields for electric propulsion

NASA Astrophysics Data System (ADS)

Mazouffre, S.; Kulaev, V.; Luna, J. Pérez

2009-08-01

The velocity distribution function (VDF) of metastable Xe+ ions was measured along the channel centerline of the high-power PPS®X000 Hall effect thruster by means of laser induced fluorescence (LIF) spectroscopy at 834.72 nm for various discharge voltages (300-700 V) and propellant mass flow rates (6-15 mg s-1). The development of the on-axis profile of the velocity dispersion reveals the interrelation between ionization and acceleration layers. The ion velocity profiles are in accordance with outcomes of a hybrid numerical model in which the electron mobility is assessed from particle-in-cell simulations. The axial distribution of the effective electric field is inferred from the mean ion velocity profile, despite the parasitic effect due to ions created in the acceleration region. Most of the acceleration process takes place outside the thruster channel. The electric field augments and it moves upstream when the applied voltage is ramped up. The impact of the xenon mass flow rates is found to depend upon the voltage. A novel approach based on the moments of the experimental VDFs in combination with the Boltzmann's equation is introduced in order to determine the real electric field distribution. The method also provides the ionization frequency profile. The LIF diagnostics reveals the existence at the end of the acceleration region of fast ions of which the kinetic energy is above the supplied energy. The fraction of these supra-sped up ions grows when the voltage increases. The ion VDFs were also recorded in the plasma plume far field by way of a retarding potential analyzer (RPA). The shape of the RPA traces as well as their evolution with operating conditions are in agreement with trends observed by means of LIF spectroscopy. Finally, physical mechanisms at the origin of supra-sped up ions are discussed in light of numerical simulation outcomes and a set of new experimental results.

Remote electrical arc suppression by laser filamentation.

PubMed

Schubert, Elise; Mongin, Denis; Kasparian, Jérôme; Wolf, Jean-Pierre

2015-11-02

We investigate the interaction of narrow plasma channels formed in the filamentation of ultrashort laser pulses, with a DC high voltage. The laser filaments prevent electrical arcs by triggering corona that neutralize the high-voltage electrodes. This phenomenon, that relies on the electric field modulation and free electron release around the filament, opens new prospects to lightning and over-voltage mitigation.

Application of Microsecond Voltage Pulses for Water Disinfection by Diaphragm Electric Discharge

NASA Astrophysics Data System (ADS)

Kakaurov, S. V.; Suvorov, I. F.; Yudin, A. S.; Solovyova, T. L.; Kuznetsova, N. S.

2015-11-01

The paper presents the dependence of copper and silver ions formation on the duration of voltage pulses of diaphragm electric discharge and on the pH of treated liquid medium. Knowing it allows one to create an automatic control system to control bactericidal agent's parameters obtained in diaphragm electric discharge reactor. The current-voltage characteristic of the reactor with a horizontal to the diaphragm membrane water flow powered from the author's custom pulse voltage source is also presented. The results of studies of the power consumption of diaphragm electric discharge depending on temperature of the treated liquid medium are given.

Impedance spectroscopy applied to the fast wounding dynamics of an electrical wound-healing assay in mammalian cells

NASA Astrophysics Data System (ADS)

Bellotti, Mariela I.; Giana, Fabián E.; Bonetto, Fabián J.

2015-08-01

Electrical wound-healing assays are often used as a means to study in vitro cell migration and proliferation. In such analysis, a cell monolayer that sits on a small electrode is electrically wounded and its spectral impedance is then continuously measured in order to monitor the healing process. The relatively slow dynamics of the cell healing have been extensively studied, while those of the much faster wounding phase have not yet been investigated. An analysis of the electrical properties of a particular cell type during this phase could give extra information about the changes in the cell membrane due to the application of the wounding current, and could also be useful to optimize the wounding regime for different cell types. The main issue when trying to register information about these dynamics is that the traditional measurement scheme employed in typical wound-healing assays doesn’t allow the simultaneous application of the wounding signal and measurement of the system’s impedance. In this paper, we overcome this limitation by implementing a measurement strategy consisting of cycles of fast alternating low- and high-voltage signals applied on electrodes covered with mammalian cells. This approach is capable of registering the fast impedance changes during the transient regime corresponding to the cell wounding process. Furthermore, these quasi-simultaneous high- and low-voltage measurements can be compared in order to obtain an empirical correlation between both quantities.

Electro-dewatering of wastewater sludge: An investigation of the relationship between filtrate flow rate and electric current.

PubMed

Olivier, Jérémy; Conrardy, Jean-Baptiste; Mahmoud, Akrama; Vaxelaire, Jean

2015-10-01

Compared to conventional dewatering techniques, electrical assisted mechanical dewatering, also called electro-dewatering (EDW) is an alternative and an effective technology for the dewatering of sewage sludge with low energy consumption. The objectives of this study were to evaluate the dewatering performance and to determine the influence of the process parameters (e.g. applied electric current, applied voltage, and the initial amount of dry solids) on the kinetics of EDW-process for activated urban sludge. Also significant efforts have been devoted herein to provide comprehensive information about the EDW mechanisms and to understand the relationship between these operating conditions with regards to develop a qualitative and quantitative understanding model of the electro-dewatering process and then produce a robust design methodology. The results showed a very strong correlation between the applied electric current and the filtrate flow rate and consequently the electro-dewatering kinetics. A higher applied electric current leads to faster EDW kinetics and a higher final dry solids content. In contrast, the results of this work showed a significant enhancement of the dewatering kinetics by decreasing the mass of the dry solids introduced into the cell (commonly known as the sludge loading). Copyright © 2015 Elsevier Ltd. All rights reserved.

Consumption of the electric power inside silent discharge reactors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yehia, Ashraf, E-mail: yehia30161@yahoo.com

An experimental study was made in this paper to investigate the relation between the places of the dielectric barriers, which cover the surfaces of the electrodes in the coaxial cylindrical reactors, and the rate of change of the electric power that is consumed in forming silent discharges. Therefore, silent discharges have been formed inside three coaxial cylindrical reactors. The dielectric barriers in these reactors were pasted on both the internal surface of the outer electrode in the first reactor and the external surface of the inner electrode in the second reactor as well as the surfaces of the two electrodesmore » in the third reactor. The reactor under study has been fed by atmospheric air that flowed inside it with a constant rate at normal temperature and pressure, in parallel with the application of a sinusoidal ac voltage between the electrodes of the reactor. The electric power consumed in forming the silent discharges inside the three reactors was measured as a function of the ac peak voltage. The validity of the experimental results was investigated by applying Manley's equation on the same discharge conditions. The results have shown that the rate of consumption of the electric power relative to the ac peak voltage per unit width of the discharge gap improves by a ratio of either 26.8% or 80% or 128% depending on the places of the dielectric barriers that cover the surfaces of the electrodes inside the three reactors.« less