Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Challenges for single molecule electronic devices with nanographene and organic molecules. Do single molecules offer potential as elements of electronic devices in the next generation?

NASA Astrophysics Data System (ADS)

Enoki, Toshiaki; Kiguchi, Manabu

2018-03-01

Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

Superresolution Imaging using Single-Molecule Localization

PubMed Central

Patterson, George; Davidson, Michael; Manley, Suliana; Lippincott-Schwartz, Jennifer

2013-01-01

Superresolution imaging is a rapidly emerging new field of microscopy that dramatically improves the spatial resolution of light microscopy by over an order of magnitude (∼10–20-nm resolution), allowing biological processes to be described at the molecular scale. Here, we discuss a form of superresolution microscopy based on the controlled activation and sampling of sparse subsets of photoconvertible fluorescent molecules. In this single-molecule based imaging approach, a wide variety of probes have proved valuable, ranging from genetically encodable photoactivatable fluorescent proteins to photoswitchable cyanine dyes. These have been used in diverse applications of superresolution imaging: from three-dimensional, multicolor molecule localization to tracking of nanometric structures and molecules in living cells. Single-molecule-based superresolution imaging thus offers exciting possibilities for obtaining molecular-scale information on biological events occurring at variable timescales. PMID:20055680

SNSMIL, a real-time single molecule identification and localization algorithm for super-resolution fluorescence microscopy

PubMed Central

Tang, Yunqing; Dai, Luru; Zhang, Xiaoming; Li, Junbai; Hendriks, Johnny; Fan, Xiaoming; Gruteser, Nadine; Meisenberg, Annika; Baumann, Arnd; Katranidis, Alexandros; Gensch, Thomas

2015-01-01

Single molecule localization based super-resolution fluorescence microscopy offers significantly higher spatial resolution than predicted by Abbe’s resolution limit for far field optical microscopy. Such super-resolution images are reconstructed from wide-field or total internal reflection single molecule fluorescence recordings. Discrimination between emission of single fluorescent molecules and background noise fluctuations remains a great challenge in current data analysis. Here we present a real-time, and robust single molecule identification and localization algorithm, SNSMIL (Shot Noise based Single Molecule Identification and Localization). This algorithm is based on the intrinsic nature of noise, i.e., its Poisson or shot noise characteristics and a new identification criterion, QSNSMIL, is defined. SNSMIL improves the identification accuracy of single fluorescent molecules in experimental or simulated datasets with high and inhomogeneous background. The implementation of SNSMIL relies on a graphics processing unit (GPU), making real-time analysis feasible as shown for real experimental and simulated datasets. PMID:26098742

Delocalization of frontier orbitals induced red emission for heptazine based thermally activated delayed fluorescence molecule: First-principles study

NASA Astrophysics Data System (ADS)

Kang, Yongxiang; Zhao, Liyun; Leng, Jiancai

2018-04-01

Design of red organic emitting molecules with characteristic of thermally activated delayed fluorescence (TADF) remains a great challenge. Here, electronic and optical properties of a series of multi-branched TADF molecules have been investigated based on the newly-proposed optimal Hartree-Fock percentage method. Results show that, though enlarging the delocalization of HOMO and LUMO, the emission wavelength is redshift. The designed red TADF molecule possesses smaller reorganization energy than these for reported molecules. This indicates the non-radiative energy consumption of excited state is small and effective luminescence can be expected. Thus, a promising red thermally activated delayed fluorescence molecule is proposed.

End-to-end distance and contour length distribution functions of DNA helices

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-06-01

I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

A reagent-assisted method in SERS detection of methyl salicylate

NASA Astrophysics Data System (ADS)

Li, Yali; Li, Qianwen; Wang, Yanan; Oh, Joohee; Jin, Sila; Park, Yeonju; Zhou, Tieli; Zhao, Bing; Ruan, Weidong; Jung, Young Mee

2018-04-01

With the explosive application of methyl salicylate (MS) molecules in food and cosmetics, the further detection of MS molecules becomes particularly important. Here we investigated the detection of MS molecules based on surface-enhanced Raman scattering (SERS) in a novel molecule/assistant/metal system constructed with MS, 4,4‧-(hexafluoroisopropylidene) bis (benzoic acid) and Ag nanoparticles (AgNPs). The minimum detection concentration is 10-4 M. To explore the function of assisted reagent, we also referred another system without assistant molecules. The result demonstrates that SERS signals were not acquired, which proves that the assistant molecules are critical for the capture of MS molecules. Two possible mechanisms of MS/assistant/AgNPs system were speculated through two patterns of hydrogen bonds. The linker molecules acted as the role of the bridge between metallic substrates and target molecules through the molecular recognition. This strategy is very beneficial to the expanding of MS detection techniques and other hydrogen bond based coupling detections with SERS.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Greater Real-Life Diagnostic Efficacy of Allergen Molecule-Based Diagnosis for Prescription of Immunotherapy in an Area with Multiple Pollen Exposure

PubMed Central

Saltabayeva, Ulbosin; Garib, Victoria; Morenko, Marina; Rosenson, Rafail; Ispayeva, Zhanat; Gatauova, Madina; Zulus, Loreta; Karaulov, Alexander; Gastager, Felix; Valenta, Rudolf

2017-01-01

Background Allergen molecule-based diagnosis has been suggested to facilitate the identification of disease-causing allergen sources and the prescription of allergen-specific immunotherapy (AIT). The aim of the current study was to compare allergen molecule-based IgE serology with allergen extract-based skin testing for the identification of the disease-causing allergen sources. The study was conducted in an area where patients are exposed to pollen from multiple sources (trees, grasses, and weeds) at the same time to compare the diagnostic efficiency of the 2 forms of diagnosis. Methods Patients from Astana, Kazakhstan, who suffered from pollen-induced allergy (n = 95) were subjected to skin prick testing (SPT) with a local panel of tree pollen, grass pollen, and weed pollen allergen extracts and IgE antibodies specific for marker allergen molecules (nArt v 1, nArt v 3, rAmb a 1, rPhl p 1, rPhl p 5, rBet v 1) were measured by ImmunoCAP. Direct and indirect costs for diagnosis based on SPT and marker allergen-based IgE serology as well as direct costs for immunotherapy depending on SPT and serological test results were calculated. Results The costs for SPT-based diagnosis per patient were lower than the costs for allergen molecule-based IgE serology. However, allergen molecule-based serology was more precise in detecting the disease-causing allergen sources. A lower number of immunotherapy treatments (n = 119) was needed according to molecular diagnosis as compared to extract-based diagnosis (n = 275), which considerably reduced the total costs for diagnosis and for a 3-year treatment from EUR 1,112.30 to 521.77 per patient. Conclusions The results from this real-life study show that SPT is less expensive than allergen molecule-based diagnostic testing, but molecular diagnosis allowed more precise prescription of immunotherapy which substantially reduced treatment costs and combined costs for diagnosis and treatment. PMID:28654920

Network medicine in disease analysis and therapeutics.

PubMed

Chen, B; Butte, A J

2013-12-01

Two parallel trends are occurring in drug discovery. The first is that we are moving away from a symptom-based disease classification system to a system based on molecules and molecular states. The second is that we are shifting from targeting a single molecule toward targeting multiple molecules, pathways, or networks. Network medicine is an approach to understanding disease and discovering therapeutics looking at many molecules and how they interrelate, and it may play a critical role in the adoption of both trends.

Electronic properties of a molecular system with Platinum

NASA Astrophysics Data System (ADS)

Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David

2017-10-01

The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.

Characterizing protein domain associations by Small-molecule ligand binding

PubMed Central

Li, Qingliang; Cheng, Tiejun; Wang, Yanli; Bryant, Stephen H.

2012-01-01

Background Protein domains are evolutionarily conserved building blocks for protein structure and function, which are conventionally identified based on protein sequence or structure similarity. Small molecule binding domains are of great importance for the recognition of small molecules in biological systems and drug development. Many small molecules, including drugs, have been increasingly identified to bind to multiple targets, leading to promiscuous interactions with protein domains. Thus, a large scale characterization of the protein domains and their associations with respect to small-molecule binding is of particular interest to system biology research, drug target identification, as well as drug repurposing. Methods We compiled a collection of 13,822 physical interactions of small molecules and protein domains derived from the Protein Data Bank (PDB) structures. Based on the chemical similarity of these small molecules, we characterized pairwise associations of the protein domains and further investigated their global associations from a network point of view. Results We found that protein domains, despite lack of similarity in sequence and structure, were comprehensively associated through binding the same or similar small-molecule ligands. Moreover, we identified modules in the domain network that consisted of closely related protein domains by sharing similar biochemical mechanisms, being involved in relevant biological pathways, or being regulated by the same cognate cofactors. Conclusions A novel protein domain relationship was identified in the context of small-molecule binding, which is complementary to those identified by traditional sequence-based or structure-based approaches. The protein domain network constructed in the present study provides a novel perspective for chemogenomic study and network pharmacology, as well as target identification for drug repurposing. PMID:23745168

Organic Xenobiotics

NASA Astrophysics Data System (ADS)

Coleman, William F.

2005-02-01

Fully manipulable (Chime) versions of these molecules appear below. These and other molecules are available at Only@ JCE Online . Figure 1. Atrazine molecule. Interactive Chime-based structure (top); static structure graphic (bottom).

Enhancing SERS by Means of Supramolecular Charge Transfer

NASA Technical Reports Server (NTRS)

Wong, Eric; Flood, Amar; Morales, Alfredo

2009-01-01

In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.

Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

PubMed

Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

2017-01-01

In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Yung-Ting; Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan 10617, Taiwan; Liu, Shun-Wei

Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less lightmore » than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts.« less

Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

PubMed Central

Jin, Ruifa; Wang, Kai

2015-01-01

A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

Effects of Functional Groups in Redox-Active Organic Molecules: A High-Throughput Screening Approach

DOE PAGES

Pelzer, Kenley M.; Cheng, Lei; Curtiss, Larry A.

2016-12-08

Nonaqueous redox flow batteries have attracted recent attention with their potential for high electrochemical storage capacity, with organic electrolytes serving as solvents with a wide electrochemical stability window. Organic molecules can also serve as electroactive species, where molecules with low reduction potentials or high oxidation potentials can provide substantial chemical energy. To identify promising electrolytes in a vast chemical space, high-throughput screening (HTS) of candidate molecules plays an important role, where HTS is used to calculate properties of thousands of molecules and identify a few organic molecules worthy of further attention in battery research. Here, in this work, we presentmore » reduction and oxidation potentials obtained from HTS of 4178 molecules. The molecules are composed of base groups of five- or six-membered rings with one or two functional groups attached, with the set of possible functional groups including both electron-withdrawing and electron-donating groups. In addition to observing the trends in potentials that result from differences in organic base groups and functional groups, we analyze the effects of molecular characteristics such as multiple bonds, Hammett parameters, and functional group position. In conclusion, this work provides useful guidance in determining how the identities of the base groups and functional groups are correlated with desirable reduction and oxidation potentials.« less

Effects of Functional Groups in Redox-Active Organic Molecules: A High-Throughput Screening Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pelzer, Kenley M.; Cheng, Lei; Curtiss, Larry A.

Nonaqueous redox flow batteries have attracted recent attention with their potential for high electrochemical storage capacity, with organic electrolytes serving as solvents with a wide electrochemical stability window. Organic molecules can also serve as electroactive species, where molecules with low reduction potentials or high oxidation potentials can provide substantial chemical energy. To identify promising electrolytes in a vast chemical space, high-throughput screening (HTS) of candidate molecules plays an important role, where HTS is used to calculate properties of thousands of molecules and identify a few organic molecules worthy of further attention in battery research. Here, in this work, we presentmore » reduction and oxidation potentials obtained from HTS of 4178 molecules. The molecules are composed of base groups of five- or six-membered rings with one or two functional groups attached, with the set of possible functional groups including both electron-withdrawing and electron-donating groups. In addition to observing the trends in potentials that result from differences in organic base groups and functional groups, we analyze the effects of molecular characteristics such as multiple bonds, Hammett parameters, and functional group position. In conclusion, this work provides useful guidance in determining how the identities of the base groups and functional groups are correlated with desirable reduction and oxidation potentials.« less

Minimizing pulling geometry errors in atomic force microscope single molecule force spectroscopy.

PubMed

Rivera, Monica; Lee, Whasil; Ke, Changhong; Marszalek, Piotr E; Cole, Daniel G; Clark, Robert L

2008-10-01

In atomic force microscopy-based single molecule force spectroscopy (AFM-SMFS), it is assumed that the pulling angle is negligible and that the force applied to the molecule is equivalent to the force measured by the instrument. Recent studies, however, have indicated that the pulling geometry errors can drastically alter the measured force-extension relationship of molecules. Here we describe a software-based alignment method that repositions the cantilever such that it is located directly above the molecule's substrate attachment site. By aligning the applied force with the measurement axis, the molecule is no longer undergoing combined loading, and the full force can be measured by the cantilever. Simulations and experimental results verify the ability of the alignment program to minimize pulling geometry errors in AFM-SMFS studies.

3D flexible alignment using 2D maximum common substructure: dependence of prediction accuracy on target-reference chemical similarity.

PubMed

Kawabata, Takeshi; Nakamura, Haruki

2014-07-28

A protein-bound conformation of a target molecule can be predicted by aligning the target molecule on the reference molecule obtained from the 3D structure of the compound-protein complex. This strategy is called "similarity-based docking". For this purpose, we develop the flexible alignment program fkcombu, which aligns the target molecule based on atomic correspondences with the reference molecule. The correspondences are obtained by the maximum common substructure (MCS) of 2D chemical structures, using our program kcombu. The prediction performance was evaluated using many target-reference pairs of superimposed ligand 3D structures on the same protein in the PDB, with different ranges of chemical similarity. The details of atomic correspondence largely affected the prediction success. We found that topologically constrained disconnected MCS (TD-MCS) with the simple element-based atomic classification provides the best prediction. The crashing potential energy with the receptor protein improved the performance. We also found that the RMSD between the predicted and correct target conformations significantly correlates with the chemical similarities between target-reference molecules. Generally speaking, if the reference and target compounds have more than 70% chemical similarity, then the average RMSD of 3D conformations is <2.0 Å. We compared the performance with a rigid-body molecular alignment program based on volume-overlap scores (ShaEP). Our MCS-based flexible alignment program performed better than the rigid-body alignment program, especially when the target and reference molecules were sufficiently similar.

A series of simple oligomer-like small molecules based on oligothiophenes for solution-processed solar cells with high efficiency.

PubMed

Kan, Bin; Li, Miaomiao; Zhang, Qian; Liu, Feng; Wan, Xiangjian; Wang, Yunchuang; Ni, Wang; Long, Guankui; Yang, Xuan; Feng, Huanran; Zuo, Yi; Zhang, Mingtao; Huang, Fei; Cao, Yong; Russell, Thomas P; Chen, Yongsheng

2015-03-25

A series of acceptor-donor-acceptor simple oligomer-like small molecules based on oligothiophenes, namely, DRCN4T-DRCN9T, were designed and synthesized. Their optical, electrical, and thermal properties and photovoltaic performances were systematically investigated. Except for DRCN4T, excellent performances were obtained for DRCN5T-DRCN9T. The devices based on DRCN5T, DRCN7T, and DRCN9T with axisymmetric chemical structures exhibit much higher short-circuit current densities than those based on DRCN6T and DRCN8T with centrosymmetric chemical structures, which is attributed to their well-developed fibrillar network with a feature size less than 20 nm. The devices based on DRCN5T/PC71BM showed a notable certified power conversion efficiency (PCE) of 10.10% under AM 1.5G irradiation (100 mW cm(-2)) using a simple solution spin-coating fabrication process. This is the highest PCE for single-junction small-molecule-based organic photovoltaics (OPVs) reported to date. DRCN5T is a rather simpler molecule compared with all of the other high-performance molecules in OPVs to date, and this might highlight its advantage in the future possible commercialization of OPVs. These results demonstrate that a fine and balanced modification/design of chemical structure can make significant performance differences and that the performance of solution-processed small-molecule-based solar cells can be comparable to or even surpass that of their polymer counterparts.

Reversible multi-electron redox chemistry of π-conjugated N-containing heteroaromatic molecule-based organic cathodes

NASA Astrophysics Data System (ADS)

Peng, Chengxin; Ning, Guo-Hong; Su, Jie; Zhong, Guiming; Tang, Wei; Tian, Bingbing; Su, Chenliang; Yu, Dingyi; Zu, Lianhai; Yang, Jinhu; Ng, Man-Fai; Hu, Yong-Sheng; Yang, Yong; Armand, Michel; Loh, Kian Ping

2017-07-01

Even though organic molecules with well-designed functional groups can be programmed to have high electron density per unit mass, their poor electrical conductivity and low cycle stability limit their applications in batteries. Here we report a facile synthesis of π-conjugated quinoxaline-based heteroaromatic molecules (3Q) by condensation of cyclic carbonyl molecules with o-phenylenediamine. 3Q features a number of electron-deficient pyrazine sites, where multiple redox reactions take place. When hybridized with graphene and coupled with an ether-based electrolyte, an organic cathode based on 3Q molecules displays a discharge capacity of 395 mAh g-1 at 400 mA g-1 (1C) in the voltage range of 1.2-3.9 V and a nearly 70% capacity retention after 10,000 cycles at 8 A g-1. It also exhibits a capacity of 222 mAh g-1 at 20C, which corresponds to 60% of the initial specific capacity. Our results offer evidence that heteroaromatic molecules with multiple redox sites are promising in developing high-energy-density, long-cycle-life organic rechargeable batteries.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Profiling protein function with small molecule microarrays

PubMed Central

Winssinger, Nicolas; Ficarro, Scott; Schultz, Peter G.; Harris, Jennifer L.

2002-01-01

The regulation of protein function through posttranslational modification, local environment, and protein–protein interaction is critical to cellular function. The ability to analyze on a genome-wide scale protein functional activity rather than changes in protein abundance or structure would provide important new insights into complex biological processes. Herein, we report the application of a spatially addressable small molecule microarray to an activity-based profile of proteases in crude cell lysates. The potential of this small molecule-based profiling technology is demonstrated by the detection of caspase activation upon induction of apoptosis, characterization of the activated caspase, and inhibition of the caspase-executed apoptotic phenotype using the small molecule inhibitor identified in the microarray-based profile. PMID:12167675

Size-independent neural networks based first-principles method for accurate prediction of heat of formation of fuels

NASA Astrophysics Data System (ADS)

Yang, GuanYa; Wu, Jiang; Chen, ShuGuang; Zhou, WeiJun; Sun, Jian; Chen, GuanHua

2018-06-01

Neural network-based first-principles method for predicting heat of formation (HOF) was previously demonstrated to be able to achieve chemical accuracy in a broad spectrum of target molecules [L. H. Hu et al., J. Chem. Phys. 119, 11501 (2003)]. However, its accuracy deteriorates with the increase in molecular size. A closer inspection reveals a systematic correlation between the prediction error and the molecular size, which appears correctable by further statistical analysis, calling for a more sophisticated machine learning algorithm. Despite the apparent difference between simple and complex molecules, all the essential physical information is already present in a carefully selected set of small molecule representatives. A model that can capture the fundamental physics would be able to predict large and complex molecules from information extracted only from a small molecules database. To this end, a size-independent, multi-step multi-variable linear regression-neural network-B3LYP method is developed in this work, which successfully improves the overall prediction accuracy by training with smaller molecules only. And in particular, the calculation errors for larger molecules are drastically reduced to the same magnitudes as those of the smaller molecules. Specifically, the method is based on a 164-molecule database that consists of molecules made of hydrogen and carbon elements. 4 molecular descriptors were selected to encode molecule's characteristics, among which raw HOF calculated from B3LYP and the molecular size are also included. Upon the size-independent machine learning correction, the mean absolute deviation (MAD) of the B3LYP/6-311+G(3df,2p)-calculated HOF is reduced from 16.58 to 1.43 kcal/mol and from 17.33 to 1.69 kcal/mol for the training and testing sets (small molecules), respectively. Furthermore, the MAD of the testing set (large molecules) is reduced from 28.75 to 1.67 kcal/mol.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Binding Direction-Based Two-Dimensional Flattened Contact Area Computing Algorithm for Protein-Protein Interactions.

PubMed

Kang, Beom Sik; Pugalendhi, GaneshKumar; Kim, Ku-Jin

2017-10-13

Interactions between protein molecules are essential for the assembly, function, and regulation of proteins. The contact region between two protein molecules in a protein complex is usually complementary in shape for both molecules and the area of the contact region can be used to estimate the binding strength between two molecules. Although the area is a value calculated from the three-dimensional surface, it cannot represent the three-dimensional shape of the surface. Therefore, we propose an original concept of two-dimensional contact area which provides further information such as the ruggedness of the contact region. We present a novel algorithm for calculating the binding direction between two molecules in a protein complex, and then suggest a method to compute the two-dimensional flattened area of the contact region between two molecules based on the binding direction.

Single-molecule quantum dot as a Kondo simulator

NASA Astrophysics Data System (ADS)

Hiraoka, R.; Minamitani, E.; Arafune, R.; Tsukahara, N.; Watanabe, S.; Kawai, M.; Takagi, N.

2017-06-01

Structural flexibility of molecule-based systems is key to realizing the novel functionalities. Tuning the structure in the atomic scale enables us to manipulate the quantum state in the molecule-based system. Here we present the reversible Hamiltonian manipulation in a single-molecule quantum dot consisting of an iron phthalocyanine molecule attached to an Au electrode and a scanning tunnelling microscope tip. We precisely controlled the position of Fe2+ ion in the molecular cage by using the tip, and tuned the Kondo coupling between the molecular spins and the Au electrode. Then, we realized the crossover between the strong-coupling Kondo regime and the weak-coupling regime governed by spin-orbit interaction in the molecule. The results open an avenue to simulate low-energy quantum many-body physics and quantum phase transition through the molecular flexibility.

Greater Real-Life Diagnostic Efficacy of Allergen Molecule-Based Diagnosis for Prescription of Immunotherapy in an Area with Multiple Pollen Exposure.

PubMed

Saltabayeva, Ulbosin; Garib, Victoria; Morenko, Marina; Rosenson, Rafail; Ispayeva, Zhanat; Gatauova, Madina; Zulus, Loreta; Karaulov, Alexander; Gastager, Felix; Valenta, Rudolf

2017-01-01

Allergen molecule-based diagnosis has been suggested to facilitate the identification of disease-causing allergen sources and the prescription of allergen-specific immunotherapy (AIT). The aim of the current study was to compare allergen molecule-based IgE serology with allergen extract-based skin testing for the identification of the disease-causing allergen sources. The study was conducted in an area where patients are exposed to pollen from multiple sources (trees, grasses, and weeds) at the same time to compare the diagnostic efficiency of the 2 forms of diagnosis. Patients from Astana, Kazakhstan, who suffered from pollen-induced allergy (n = 95) were subjected to skin prick testing (SPT) with a local panel of tree pollen, grass pollen, and weed pollen allergen extracts and IgE antibodies specific for marker allergen molecules (nArt v 1, nArt v 3, rAmb a 1, rPhl p 1, rPhl p 5, rBet v 1) were measured by ImmunoCAP. Direct and indirect costs for diagnosis based on SPT and marker allergen-based IgE serology as well as direct costs for immunotherapy depending on SPT and serological test results were calculated. The costs for SPT-based diagnosis per patient were lower than the costs for allergen molecule-based IgE serology. However, allergen molecule-based serology was more precise in detecting the disease-causing allergen sources. A lower number of immunotherapy treatments (n = 119) was needed according to molecular diagnosis as compared to extract-based diagnosis (n = 275), which considerably reduced the total costs for diagnosis and for a 3-year treatment from EUR 1,112.30 to 521.77 per patient. The results from this real-life study show that SPT is less expensive than allergen molecule-based diagnostic testing, but molecular diagnosis allowed more precise prescription of immunotherapy which substantially reduced treatment costs and combined costs for diagnosis and treatment. © 2017 The Author(s) Published by S. Karger AG, Basel.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

PubMed

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Triphenylamine-Based Push–Pull Molecule for Photovoltaic Applications: From Synthesis to Ultrafast Device Photophysics

PubMed Central

2017-01-01

Small push–pull molecules attract much attention as prospective donor materials for organic solar cells (OSCs). By chemical engineering, it is possible to combine a number of attractive properties such as broad absorption, efficient charge separation, and vacuum and solution processabilities in a single molecule. Here we report the synthesis and early time photophysics of such a molecule, TPA-2T-DCV-Me, based on the triphenylamine (TPA) donor core and dicyanovinyl (DCV) acceptor end group connected by a thiophene bridge. Using time-resolved photoinduced absorption and photoluminescence, we demonstrate that in blends with [70]PCBM the molecule works both as an electron donor and hole acceptor, thereby allowing for two independent channels of charge generation. The charge-generation process is followed by the recombination of interfacial charge transfer states that takes place on the subnanosecond time scale as revealed by time-resolved photoluminescence and nongeminate recombination as follows from the OSC performance. Our findings demonstrate the potential of TPA-DCV-based molecules as donor materials for both solution-processed and vacuum-deposited OSCs. PMID:28413568

Alcohol molecules adsorption on graphane nanosheets - A first-principles investigation

NASA Astrophysics Data System (ADS)

Nagarajan, V.; Chandiramouli, R.

2018-05-01

The geometric structure, electronic and adsorption properties of methanol, ethanol and 1-propanol molecules on hydrogenated graphene (graphane) were investigated using first-principles calculations. The stability of graphane base material is confirmed using formation energy and phonon band structures. The adsorption of alcohol molecules on bare graphane and hydrogen vacant graphane nanosheet is found to be prominent and the selectivity of alcohol molecules can be achieved using bare or hydrogen vacant graphane nanosheet. Moreover, the interaction of alcohol molecules on bare and hydrogen vacant graphane nanosheets is studied using the adsorption energy, energy band gap variation, Bader charge transfer and average energy band gap variation. The adsorption energy ranges from -0.149 to -0.383 eV upon alcohol adsorption. The energy gap varies from 4.71 to 2.62 eV for bare graphane and from 4.02 to 3.60 eV for hydrogen vacant graphane nanosheets upon adsorption of alcohol molecules. The adsorption properties of alcohol molecules provide useful information for the possible application of graphane nanosheet as a base material for the detection of alcohol molecules.

Chirality-induced spin polarization places symmetry constraints on biomolecular interactions.

PubMed

Kumar, Anup; Capua, Eyal; Kesharwani, Manoj K; Martin, Jan M L; Sitbon, Einat; Waldeck, David H; Naaman, Ron

2017-03-07

Noncovalent interactions between molecules are key for many biological processes. Necessarily, when molecules interact, the electronic charge in each of them is redistributed. Here, we show experimentally that, in chiral molecules, charge redistribution is accompanied by spin polarization. We describe how this spin polarization adds an enantioselective term to the forces, so that homochiral interaction energies differ from heterochiral ones. The spin polarization was measured by using a modified Hall effect device. An electric field that is applied along the molecules causes charge redistribution, and for chiral molecules, a Hall voltage is measured that indicates the spin polarization. Based on this observation, we conjecture that the spin polarization enforces symmetry constraints on the biorecognition process between two chiral molecules, and we describe how these constraints can lead to selectivity in the interaction between enantiomers based on their handedness. Model quantum chemistry calculations that rigorously enforce these constraints show that the interaction energy for methyl groups on homochiral molecules differs significantly from that found for heterochiral molecules at van der Waals contact and shorter (i.e., ∼0.5 kcal/mol at 0.26 nm).

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.

PubMed

Kirillova, Svetlana; Carugo, Oliviero

2011-10-19

Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

PubMed Central

2011-01-01

Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

LigandRNA: computational predictor of RNA–ligand interactions

PubMed Central

Philips, Anna; Milanowska, Kaja; Łach, Grzegorz; Bujnicki, Janusz M.

2013-01-01

RNA molecules have recently become attractive as potential drug targets due to the increased awareness of their importance in key biological processes. The increase of the number of experimentally determined RNA 3D structures enabled structure-based searches for small molecules that can specifically bind to defined sites in RNA molecules, thereby blocking or otherwise modulating their function. However, as of yet, computational methods for structure-based docking of small molecule ligands to RNA molecules are not as well established as analogous methods for protein-ligand docking. This motivated us to create LigandRNA, a scoring function for the prediction of RNA–small molecule interactions. Our method employs a grid-based algorithm and a knowledge-based potential derived from ligand-binding sites in the experimentally solved RNA–ligand complexes. As an input, LigandRNA takes an RNA receptor file and a file with ligand poses. As an output, it returns a ranking of the poses according to their score. The predictive power of LigandRNA favorably compares to five other publicly available methods. We found that the combination of LigandRNA and Dock6 into a “meta-predictor” leads to further improvement in the identification of near-native ligand poses. The LigandRNA program is available free of charge as a web server at http://ligandrna.genesilico.pl. PMID:24145824

Fragment-based virtual screening approach and molecular dynamics simulation studies for identification of BACE1 inhibitor leads.

PubMed

Manoharan, Prabu; Ghoshal, Nanda

2018-05-01

Traditional structure-based virtual screening method to identify drug-like small molecules for BACE1 is so far unsuccessful. Location of BACE1, poor Blood Brain Barrier permeability and P-glycoprotein (Pgp) susceptibility of the inhibitors make it even more difficult. Fragment-based drug design method is suitable for efficient optimization of initial hit molecules for target like BACE1. We have developed a fragment-based virtual screening approach to identify/optimize the fragment molecules as a starting point. This method combines the shape, electrostatic, and pharmacophoric features of known fragment molecules, bound to protein conjugate crystal structure, and aims to identify both chemically and energetically feasible small fragment ligands that bind to BACE1 active site. The two top-ranked fragment hits were subjected for a 53 ns MD simulation. Principle component analysis and free energy landscape analysis reveal that the new ligands show the characteristic features of established BACE1 inhibitors. The potent method employed in this study may serve for the development of potential lead molecules for BACE1-directed Alzheimer's disease therapeutics.

Ga metal nanoparticle-GaAs quantum molecule complexes for Terahertz generation.

PubMed

Bietti, Sergio; Basso Basset, Francesco; Scarpellini, David; Fedorov, Alexey; Ballabio, Andrea; Esposito, Luca; Elborg, Martin; Kuroda, Takashi; Nemcsics, Akos; Toth, Lajos; Manzoni, Cristian; Vozzi, Caterina; Sanguinetti, Stefano

2018-06-18

A hybrid metal-semiconductor nanosystem for the generation of THz radiation, based on the fabrication of GaAs quantum molecules-Ga metal nanoparticles complexes through a self assembly approach, is proposed. The role of the growth parameters, the substrate temperature, the Ga and As flux during the quantum dot molecule fabrication and the metal nanoparticle alignment is discussed. The tuning of the relative positioning of quantum dot molecules and metal nanoparticles is obtained through the careful control of Ga droplet nucleation sites via Ga surface diffusion. The electronic structure of a typical quantum dot molecule was evaluated on the base of the morphological characterizations performed by Atomic Force Microscopy and cross sectional Scanning Electron Microscopy, and the predicted results confirmed by micro-photoluminescence experiments, showing that the Ga metal nanoparticle-GaAs quantum molecule complexes are suitable for terahertz generation from intraband transition. . © 2018 IOP Publishing Ltd.

An optical conveyor for molecules.

PubMed

Weinert, Franz M; Braun, Dieter

2009-12-01

Trapping single ions under vacuum allows for precise spectroscopy in atomic physics. The confinement of biological molecules in bulk water is hindered by the lack of comparably strong forces. Molecules have been immobilized to surfaces, however often with detrimental effects on their function. Here, we optically trap molecules by creating the microscale analogue of a conveyor belt: a bidirectional flow is combined with a perpendicular thermophoretic molecule drift. Arranged in a toroidal geometry, the conveyor accumulates a hundredfold excess of 5-base DNA within seconds. The concentrations of the trapped DNA scale exponentially with length, reaching trapping potential depths of 14 kT for 50 bases. The mechanism does not require microfluidics, electrodes, or surface modifications. As a result, the trap can be dynamically relocated. The optical conveyor can be used to enhance diffusion-limited surface reactions, redirect cellular signaling, observe individual biomolecules over a prolonged time, or approach single-molecule chemistry in bulk water.

High mobility high efficiency organic films based on pure organic materials

DOEpatents

Salzman, Rhonda F [Ann Arbor, MI; Forrest, Stephen R [Ann Arbor, MI

2009-01-27

A method of purifying small molecule organic material, performed as a series of operations beginning with a first sample of the organic small molecule material. The first step is to purify the organic small molecule material by thermal gradient sublimation. The second step is to test the purity of at least one sample from the purified organic small molecule material by spectroscopy. The third step is to repeat the first through third steps on the purified small molecule material if the spectroscopic testing reveals any peaks exceeding a threshold percentage of a magnitude of a characteristic peak of a target organic small molecule. The steps are performed at least twice. The threshold percentage is at most 10%. Preferably the threshold percentage is 5% and more preferably 2%. The threshold percentage may be selected based on the spectra of past samples that achieved target performance characteristics in finished devices.

In search of novel ligands using a structure-based approach: a case study on the adenosine A2A receptor.

PubMed

Lenselink, Eelke B; Beuming, Thijs; van Veen, Corine; Massink, Arnault; Sherman, Woody; van Vlijmen, Herman W T; IJzerman, Adriaan P

2016-10-01

In this work, we present a case study to explore the challenges associated with finding novel molecules for a receptor that has been studied in depth and has a wealth of chemical information available. Specifically, we apply a previously described protocol that incorporates explicit water molecules in the ligand binding site to prospectively screen over 2.5 million drug-like and lead-like compounds from the commercially available eMolecules database in search of novel binders to the adenosine A 2A receptor (A 2A AR). A total of seventy-one compounds were selected for purchase and biochemical assaying based on high ligand efficiency and high novelty (Tanimoto coefficient ≤0.25 to any A 2A AR tested compound). These molecules were then tested for their affinity to the adenosine A 2A receptor in a radioligand binding assay. We identified two hits that fulfilled the criterion of ~50 % radioligand displacement at a concentration of 10 μM. Next we selected an additional eight novel molecules that were predicted to make a bidentate interaction with Asn253 6.55 , a key interacting residue in the binding pocket of the A 2A AR. None of these eight molecules were found to be active. Based on these results we discuss the advantages of structure-based methods and the challenges associated with finding chemically novel molecules for well-explored targets.

Delivery of RNA interference therapeutics using polycation-based nanoparticles.

PubMed

Howard, Kenneth Alan

2009-07-25

RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

Aggregation and folding phase transitions of RNA molecules

NASA Astrophysics Data System (ADS)

Bundschuh, Ralf

2007-03-01

RNA is a biomolecule that is involved in nearly all aspects of cellular functions. In order to perform many of these functions, RNA molecules have to fold into specific secondary structures. This folding is driven by the tendency of the bases to form Watson-Crick base pairs. Beyond the biological importance of RNA, the relatively simple rules for structure formation of RNA make it a very interesting system from the statistical physics point of view. We will present examples of phase transitions in RNA secondary structure formation that are amenable to analytical descriptions. A special focus will be on aggregation between several RNA molecules which is important for some regulatory circuits based on RNA structure, triplet repeat diseases like Huntington's, and as a model for prion diseases. We show that depending on the relative strength of the intramolecular and the intermolecular base pairing, RNA molecules undergo a transition into an aggregated phase and quantitatively characterize this transition.

Definition of the persistence length in the coarse-grained models of DNA elasticity.

PubMed

Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

2012-11-01

By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

Molecular vibrations in metal-single-molecule-metal junctions

NASA Astrophysics Data System (ADS)

Yokota, Kazumichi; Taniguchi, Masateru; Kawai, Tomoji

2010-03-01

Molecular vibrations in a metal-single-molecule-metal junction were studied based on density functional theory using a single benzenedithiolate molecule connected between gold clusters. We found that the difference in vibrational energy between an isolated benzenedithiol and the single-molecule junction is less than 3% in the energy range above 540 cm -1, where sulfur atoms contribute little to molecular vibrations. The finding implies that we can predict the peak energy in the inelastic electron tunneling spectrum of the single-molecule junction in the high energy range by vibrational analyses of isolated molecules.

An optical deoxyribonucleic acid-based half-subtractor.

PubMed

Yang, Chia-Ning; Chen, Yi-Li; Lin, Hung-Yin; Hsu, Chun-Yu

2013-10-09

This study introduces an optical DNA-based logic circuit that mimics a half-subtractor. The system contains an Au-surface immobilized molecular-beacon molecule that serves as a dual-gate molecule and outputs two series of fluorescence signals following Boolean INH and XOR patterns after interacting with one or two single-stranded DNA molecules as input. To the best of our knowledge, the system reported herein is rather concise compared to other molecular logic gate systems.

Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads

PubMed Central

Jaffrezic-Renault, Nicole; Martelet, Claude; Chevolot, Yann; Cloarec, Jean-Pierre

2007-01-01

This review paper reports the applications of magnetic microbeads in biosensors and bio-bar code assays. Affinity biosensors are presented through different types of transducing systems: electrochemical, piezo electric or magnetic ones, applied to immunodetection and genodetection. Enzymatic biosensors are based on biofunctionalization through magnetic microbeads of a transducer, more often amperometric, potentiometric or conductimetric. The bio-bar code assays relie on a sandwich structure based on specific biological interaction of a magnetic microbead and a nanoparticle with a defined biological molecule. The magnetic particle allows the separation of the reacted target molecules from unreacted ones. The nanoparticles aim at the amplification and the detection of the target molecule. The bio-bar code assays allow the detection at very low concentration of biological molecules, similar to PCR sensitivity.

Single-protein nanomechanical mass spectrometry in real time

PubMed Central

Hanay, M.S.; Kelber, S.; Naik, A.K.; Chi, D.; Hentz, S.; Bullard, E.C.; Colinet, E.; Duraffourg, L.; Roukes, M.L.

2012-01-01

Nanoelectromechanical systems (NEMS) resonators can detect mass with exceptional sensitivity. Previously, mass spectra from several hundred adsorption events were assembled in NEMS-based mass spectrometry using statistical analysis. Here, we report the first realization of single-molecule NEMS-based mass spectrometry in real time. As each molecule in the sample adsorbs upon the NEMS resonator, its mass and the position-of-adsorption are determined by continuously tracking two driven vibrational modes of the device. We demonstrate the potential of multimode NEMS-based mass spectrometry by analyzing IgM antibody complexes in real-time. NEMS-MS is a unique and promising new form of mass spectrometry: it can resolve neutral species, provides resolving power that increases markedly for very large masses, and allows acquisition of spectra, molecule-by-molecule, in real-time. PMID:22922541

A Fragment-Based Method of Creating Small-Molecule Libraries to Target the Aggregation of Intrinsically Disordered Proteins.

PubMed

Joshi, Priyanka; Chia, Sean; Habchi, Johnny; Knowles, Tuomas P J; Dobson, Christopher M; Vendruscolo, Michele

2016-03-14

The aggregation process of intrinsically disordered proteins (IDPs) has been associated with a wide range of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases. Currently, however, no drug in clinical use targets IDP aggregation. To facilitate drug discovery programs in this important and challenging area, we describe a fragment-based approach of generating small-molecule libraries that target specific IDPs. The method is based on the use of molecular fragments extracted from compounds reported in the literature to inhibit of the aggregation of IDPs. These fragments are used to screen existing large generic libraries of small molecules to form smaller libraries specific for given IDPs. We illustrate this approach by describing three distinct small-molecule libraries to target, Aβ, tau, and α-synuclein, which are three IDPs implicated in Alzheimer's and Parkinson's diseases. The strategy described here offers novel opportunities for the identification of effective molecular scaffolds for drug discovery for neurodegenerative disorders and to provide insights into the mechanism of small-molecule binding to IDPs.

Effect of Ring Strain on the Charge Transport of a Robust Norbornadiene–Quadricyclane-Based Molecular Photoswitch

PubMed Central

2017-01-01

Integrating functional molecules into single-molecule devices is a key step toward the realization of future computing machines based on the smallest possible components. In this context, photoswitching molecules that can make a transition between high and low conductivity in response to light are attractive candidates. Here we present the synthesis and conductance properties of a new type of robust molecular photothermal switch based on the norbornadiene (NB)–quadricyclane (QC) system. The transport through the molecule in the ON state is dominated by a pathway through the π-conjugated system, which is no longer available when the system is switched to the OFF state. Interestingly, in the OFF state we find that the same pathway contributes only 12% to the transport properties. We attribute this observation to the strained tetrahedral geometry of the QC. These results challenge the prevailing assumption that current will simply flow through the shortest through-bond path in a molecule. PMID:28408968

Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

PubMed

Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

2016-06-01

RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells.

Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

NASA Astrophysics Data System (ADS)

Deymier, P. A.; Runge, K.

2018-03-01

A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

Hierarchical virtual screening approaches in small molecule drug discovery.

PubMed

Kumar, Ashutosh; Zhang, Kam Y J

2015-01-01

Virtual screening has played a significant role in the discovery of small molecule inhibitors of therapeutic targets in last two decades. Various ligand and structure-based virtual screening approaches are employed to identify small molecule ligands for proteins of interest. These approaches are often combined in either hierarchical or parallel manner to take advantage of the strength and avoid the limitations associated with individual methods. Hierarchical combination of ligand and structure-based virtual screening approaches has received noteworthy success in numerous drug discovery campaigns. In hierarchical virtual screening, several filters using ligand and structure-based approaches are sequentially applied to reduce a large screening library to a number small enough for experimental testing. In this review, we focus on different hierarchical virtual screening strategies and their application in the discovery of small molecule modulators of important drug targets. Several virtual screening studies are discussed to demonstrate the successful application of hierarchical virtual screening in small molecule drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

SEM (Symmetry Equivalent Molecules): a web-based GUI to generate and visualize the macromolecules

PubMed Central

Hussain, A. S. Z.; Kumar, Ch. Kiran; Rajesh, C. K.; Sheik, S. S.; Sekar, K.

2003-01-01

SEM, Symmetry Equivalent Molecules, is a web-based graphical user interface to generate and visualize the symmetry equivalent molecules (proteins and nucleic acids). In addition, the program allows the users to save the three-dimensional atomic coordinates of the symmetry equivalent molecules in the local machine. The widely recognized graphics program RasMol has been deployed to visualize the reference (input atomic coordinates) and the symmetry equivalent molecules. This program is written using CGI/Perl scripts and has been interfaced with all the three-dimensional structures (solved using X-ray crystallography) available in the Protein Data Bank. The program, SEM, can be accessed over the World Wide Web interface at http://dicsoft2.physics.iisc.ernet.in/sem/ or http://144.16.71.11/sem/. PMID:12824326

Drug and bioactive molecule screening based on a bioelectrical impedance cell culture platform

PubMed Central

Ramasamy, Sakthivel; Bennet, Devasier; Kim, Sanghyo

2014-01-01

This review will present a brief discussion on the recent advancements of bioelectrical impedance cell-based biosensors, especially the electric cell-substrate impedance sensing (ECIS) system for screening of various bioactive molecules. The different technical integrations of various chip types, working principles, measurement systems, and applications for drug targeting of molecules in cells are highlighted in this paper. Screening of bioactive molecules based on electric cell-substrate impedance sensing is a trial-and-error process toward the development of therapeutically active agents for drug discovery and therapeutics. In general, bioactive molecule screening can be used to identify active molecular targets for various diseases and toxicity at the cellular level with nanoscale resolution. In the innovation and screening of new drugs or bioactive molecules, the activeness, the efficacy of the compound, and safety in biological systems are the main concerns on which determination of drug candidates is based. Further, drug discovery and screening of compounds are often performed in cell-based test systems in order to reduce costs and save time. Moreover, this system can provide more relevant results in in vivo studies, as well as high-throughput drug screening for various diseases during the early stages of drug discovery. Recently, MEMS technologies and integration with image detection techniques have been employed successfully. These new technologies and their possible ongoing transformations are addressed. Select reports are outlined, and not all the work that has been performed in the field of drug screening and development is covered. PMID:25525360

Understanding the Halogenation Effects in Diketopyrrolopyrrole-Based Small Molecule Photovoltaics.

PubMed

Sun, Shi-Xin; Huo, Yong; Li, Miao-Miao; Hu, Xiaowen; Zhang, Hai-Jun; Zhang, You-Wen; Zhang, You-Dan; Chen, Xiao-Long; Shi, Zi-Fa; Gong, Xiong; Chen, Yongsheng; Zhang, Hao-Li

2015-09-16

Two molecules containing a central diketopyrrolopyrrole and two oligothiophene units have been designed and synthesized. Comparisons between the molecules containing terminal F (FDPP) and Cl (CDPP) atoms allowed us to evaluate the effects of halogenation on the photovoltaic properties of the small molecule organic solar cells (OSCs). The OSCs devices employing FDPP:PC71BM films showed power conversion efficiencies up to 4.32%, suggesting that fluorination is an efficient method for constructing small molecules for OSCs.

Pseudo-conformer models for linear molecules: Joint treatment of spectroscopic, electron diffraction and ab initio data for the C3O2 molecule

NASA Astrophysics Data System (ADS)

Tarasov, Yury I.; Kochikov, Igor V.

2018-06-01

Dynamic analysis of the molecules with large-amplitude motions (LAM) based on the pseudo-conformer approach has been successfully applied to various molecules. Floppy linear molecules present a special class of molecular structures that possess a pair of conjugate LAM coordinates but allow one-dimensional treatment. In this paper, previously developed treatment for the semirigid molecules is applied to the carbon suboxide molecule. This molecule characterized by the extremely large CCC bending has been thoroughly investigated by spectroscopic and ab initio methods. However, the earlier electron diffraction investigations were performed within a static approach, obtaining thermally averaged parameters. In this paper we apply a procedure aimed at obtaining the short list of self-consistent reference geometry parameters of a molecule, while all thermally averaged parameters are calculated based on reference geometry, relaxation dependencies and quadratic and cubic force constants. We show that such a model satisfactorily describes available electron diffraction evidence with various QC bending potential energy functions when r.m.s. CCC angle is in the interval 151 ± 2°. This leads to a self-consistent molecular model satisfying spectroscopic and GED data. The parameters for linear reference geometry have been defined as re(CO) = 1.161(2) Å and re(CC) = 1.273(2) Å.

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

Estimation of boiling points using density functional theory with polarized continuum model solvent corrections.

PubMed

Chan, Poh Yin; Tong, Chi Ming; Durrant, Marcus C

2011-09-01

An empirical method for estimation of the boiling points of organic molecules based on density functional theory (DFT) calculations with polarized continuum model (PCM) solvent corrections has been developed. The boiling points are calculated as the sum of three contributions. The first term is calculated directly from the structural formula of the molecule, and is related to its effective surface area. The second is a measure of the electronic interactions between molecules, based on the DFT-PCM solvation energy, and the third is employed only for planar aromatic molecules. The method is applicable to a very diverse range of organic molecules, with normal boiling points in the range of -50 to 500 °C, and includes ten different elements (C, H, Br, Cl, F, N, O, P, S and Si). Plots of observed versus calculated boiling points gave R²=0.980 for a training set of 317 molecules, and R²=0.979 for a test set of 74 molecules. The role of intramolecular hydrogen bonding in lowering the boiling points of certain molecules is quantitatively discussed. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

A Single-Level Tunnel Model to Account for Electrical Transport through Single Molecule- and Self-Assembled Monolayer-based Junctions

PubMed Central

Garrigues, Alvar R.; Yuan, Li; Wang, Lejia; Mucciolo, Eduardo R.; Thompon, Damien; del Barco, Enrique; Nijhuis, Christian A.

2016-01-01

We present a theoretical analysis aimed at understanding electrical conduction in molecular tunnel junctions. We focus on discussing the validity of coherent versus incoherent theoretical formulations for single-level tunneling to explain experimental results obtained under a wide range of experimental conditions, including measurements in individual molecules connecting the leads of electromigrated single-electron transistors and junctions of self-assembled monolayers (SAM) of molecules sandwiched between two macroscopic contacts. We show that the restriction of transport through a single level in solid state junctions (no solvent) makes coherent and incoherent tunneling formalisms indistinguishable when only one level participates in transport. Similar to Marcus relaxation processes in wet electrochemistry, the thermal broadening of the Fermi distribution describing the electronic occupation energies in the electrodes accounts for the exponential dependence of the tunneling current on temperature. We demonstrate that a single-level tunnel model satisfactorily explains experimental results obtained in three different molecular junctions (both single-molecule and SAM-based) formed by ferrocene-based molecules. Among other things, we use the model to map the electrostatic potential profile in EGaIn-based SAM junctions in which the ferrocene unit is placed at different positions within the molecule, and we find that electrical screening gives rise to a strongly non-linear profile across the junction. PMID:27216489

Effect of pH value of probe molecule on the graphene oxide-based surface enhanced Raman scattering

NASA Astrophysics Data System (ADS)

Cui, Shao-li; Du, Xiao-qing; Zeng, Chao; Li, Lu; Bao, Jun

2017-06-01

The dependence of graphene oxide (GO)-based surface enhanced Raman scattering (SERS) on the pH value of probe molecule was investigated. Water-soluble copper phthalocyanine (TSCuPc) was used as probe molecule and its pH value was adjusted with HCl and NaOH solution. The Raman spectra of TSCuPc with pH equaling 3, 8, and 11 on GO base were tested, respectively. The results show that both Raman enhanced intensity and full width at half maximum (FWHM) of characteristic peaks vary with the pH value of TSCuPc. It is shown that there is no obvious spectral widening of TSCuPc characteristic peaks when TSCuPc is neutral or acidic, and the chemical enhancement intensity of neutral TSCuPc on GO is biggest. In contrast, when TSCuPc is alkaline, the characteristic Raman peaks between 1350 and 1600 cm-1 of TSCuPc on GO are much wider and the intensities of characteristic peaks decrease considerably. The reasons for the pH dependence of GO-based Raman spectra were explored by comparing the wettability of molecule droplet on GO and the absorbance of different pH-adjusted TSCuPc films. It is found that the effect of molecule's pH value on SERS can be contributed to the differences of concentration and distributions on GO surface for varied pH-treated molecule.

Quantitative analysis of single-molecule superresolution images

PubMed Central

Coltharp, Carla; Yang, Xinxing; Xiao, Jie

2014-01-01

This review highlights the quantitative capabilities of single-molecule localization-based superresolution imaging methods. In addition to revealing fine structural details, the molecule coordinate lists generated by these methods provide the critical ability to quantify the number, clustering, and colocalization of molecules with 10 – 50 nm resolution. Here we describe typical workflows and precautions for quantitative analysis of single-molecule superresolution images. These guidelines include potential pitfalls and essential control experiments, allowing critical assessment and interpretation of superresolution images. PMID:25179006

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, Daniel J.; Wallace, J. Shield

1998-01-01

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle.

Controlled release of molecular components of dendrimer/bioactive complexes

DOEpatents

Segalman, D.J.; Wallace, J.S.

1998-08-18

A method for releasing molecules (guest molecules) from the matrix formed by the structure of another molecule (host molecule) in a controllable manner has been invented. This method has many applications in science and industry. In addition, applications based on such molecular systems may revolutionize significant areas of medicine, in particular the treatment of cancer and of viral infection. Similar effects can also be obtained by controlled fragmentation of a source molecule, where the molecular fragments form the active principle. 13 figs.

Crossing borders to bind proteins--a new concept in protein recognition based on the conjugation of small organic molecules or short peptides to polypeptides from a designed set.

PubMed

Baltzer, Lars

2011-06-01

A new concept for protein recognition and binding is highlighted. The conjugation of small organic molecules or short peptides to polypeptides from a designed set provides binder molecules that bind proteins with high affinities, and with selectivities that are equal to those of antibodies. The small organic molecules or peptides need to bind the protein targets but only with modest affinities and selectivities, because conjugation to the polypeptides results in molecules with dramatically improved binder performance. The polypeptides are selected from a set of only sixteen sequences designed to bind, in principle, any protein. The small number of polypeptides used to prepare high-affinity binders contrasts sharply with the huge libraries used in binder technologies based on selection or immunization. Also, unlike antibodies and engineered proteins, the polypeptides have unordered three-dimensional structures and adapt to the proteins to which they bind. Binder molecules for the C-reactive protein, human carbonic anhydrase II, acetylcholine esterase, thymidine kinase 1, phosphorylated proteins, the D-dimer, and a number of antibodies are used as examples to demonstrate that affinities are achieved that are higher than those of the small molecules or peptides by as much as four orders of magnitude. Evaluation by pull-down experiments and ELISA-based tests in human serum show selectivities to be equal to those of antibodies. Small organic molecules and peptides are readily available from pools of endogenous ligands, enzyme substrates, inhibitors or products, from screened small molecule libraries, from phage display, and from mRNA display. The technology is an alternative to established binder concepts for applications in drug development, diagnostics, medical imaging, and protein separation.

Sensitivity Comparison of Vapor Trace Detection of Explosives Based on Chemo-Mechanical Sensing with Optical Detection and Capacitive Sensing with Electronic Detection

PubMed Central

Strle, Drago; Štefane, Bogdan; Zupanič, Erik; Trifkovič, Mario; Maček, Marijan; Jakša, Gregor; Kvasič, Ivan; Muševič, Igor

2014-01-01

The article offers a comparison of the sensitivities for vapour trace detection of Trinitrotoluene (TNT) explosives of two different sensor systems: a chemo-mechanical sensor based on chemically modified Atomic Force Microscope (AFM) cantilevers based on Micro Electro Mechanical System (MEMS) technology with optical detection (CMO), and a miniature system based on capacitive detection of chemically functionalized planar capacitors with interdigitated electrodes with a comb-like structure with electronic detection (CE). In both cases (either CMO or CE), the sensor surfaces are chemically functionalized with a layer of APhS (trimethoxyphenylsilane) molecules, which give the strongest sensor response for TNT. The construction and calibration of a vapour generator is also presented. The measurements of the sensor response to TNT are performed under equal conditions for both systems, and the results show that CE system with ultrasensitive electronics is far superior to optical detection using MEMS. Using CMO system, we can detect 300 molecules of TNT in 10+12 molecules of N2 carrier gas, whereas the CE system can detect three molecules of TNT in 10+12 molecules of carrier N2. PMID:24977388

Similarity- and Substructure-Based Development of β2-Adrenergic Receptor Ligands Based on Unusual Scaffolds

PubMed Central

2017-01-01

The β2-adrenergic receptor (β2AR) is a G protein-coupled receptor (GPCR) and a well-explored target. Here, we report the discovery of 13 ligands, ten of which are novel, of this particular GPCR. They have been identified by similarity- and substructure-based searches using multiple ligands, which were described in an earlier study, as starting points. Of note, two of the molecules used as queries here distinguish themselves from other β2AR antagonists by their unique scaffold. The molecules described in this work allow us to explore the ligand space around the previously reported molecules in greater detail, leading to insights into their structure–activity relationship. We also report experimental binding and selectivity data and putative binding modes for the novel molecules. PMID:28523097

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Predicting human olfactory perception from chemical features of odor molecules.

PubMed

Keller, Andreas; Gerkin, Richard C; Guan, Yuanfang; Dhurandhar, Amit; Turu, Gabor; Szalai, Bence; Mainland, Joel D; Ihara, Yusuke; Yu, Chung Wen; Wolfinger, Russ; Vens, Celine; Schietgat, Leander; De Grave, Kurt; Norel, Raquel; Stolovitzky, Gustavo; Cecchi, Guillermo A; Vosshall, Leslie B; Meyer, Pablo

2017-02-24

It is still not possible to predict whether a given molecule will have a perceived odor or what olfactory percept it will produce. We therefore organized the crowd-sourced DREAM Olfaction Prediction Challenge. Using a large olfactory psychophysical data set, teams developed machine-learning algorithms to predict sensory attributes of molecules based on their chemoinformatic features. The resulting models accurately predicted odor intensity and pleasantness and also successfully predicted 8 among 19 rated semantic descriptors ("garlic," "fish," "sweet," "fruit," "burnt," "spices," "flower," and "sour"). Regularized linear models performed nearly as well as random forest-based ones, with a predictive accuracy that closely approaches a key theoretical limit. These models help to predict the perceptual qualities of virtually any molecule with high accuracy and also reverse-engineer the smell of a molecule. Copyright © 2017, American Association for the Advancement of Science.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Genetics Home Reference: CLN7 disease

MedlinePlus

... unknown. The MFSD8 protein is embedded in the membrane of cell compartments called lysosomes , which digest and recycle different types of molecules. Based on the structure of the protein, MFSD8 probably transports molecules across the lysosomal membrane, but the specific molecules it moves have not ...

9 CFR 121.1 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-01-01

.... Recombinant nucleic acids. (1) Molecules that are constructed by joining nucleic acid molecules and that can... of the United States. Synthetic nucleic acids. (1) Molecules that are chemically or by other means synthesized or amplified, including those that are chemically or otherwise modified but can base pair with...

9 CFR 121.1 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

.... Recombinant nucleic acids. (1) Molecules that are constructed by joining nucleic acid molecules and that can... of the United States. Synthetic nucleic acids. (1) Molecules that are chemically or by other means synthesized or amplified, including those that are chemically or otherwise modified but can base pair with...

Detection of gas molecules on single Mn adatom adsorbed graphyne: a DFT-D study

NASA Astrophysics Data System (ADS)

Lu, Zhansheng; Lv, Peng; Ma, Dongwei; Yang, Xinwei; Li, Shuo; Yang, Zongxian

2018-02-01

As one of the prominent applications in intelligent systems, gas sensing technology has attracted great interest in both industry and academia. In the current study, the pristine graphyne (GY) without and with a single Mn atom is investigated to detect the gas molecules (CO, CH4, CO2, NH3, NO and O2). The pristine GY is promising to detect O2 molecules because of its chemical adsorption on GY with large electron transfer. The great stability of the Mn/GY is found, and the Mn atom prefers to anchor at the alkyne ring as a single atom. Upon single Mn atom anchoring, the sensitivity and selectivity of GY based gas sensors is significantly improved for various molecules, except CH4. The recovery time of the Mn/GY after detecting the gas molecules may help to appraise the detection efficiency for the Mn/GY. The current study will help to understand the mechanism of detecting the gas molecules, and extend the potentially fascinating applications of GY-based materials.

Programming of a Mn-coordinated 4-4‧-biphenyl dicarboxylic acid nanosystem on Au(1 1 1) and investigation of the non-covalent binding of C60 molecules

NASA Astrophysics Data System (ADS)

Zhang, Yan-Feng; Zhu, Na; Komeda, T.

The fabrication of Mn-based coordination networks on a Au(1 1 1) substrate with 4-4 '-biphenyl dicarboxylic acid (BDA) as the linker molecule was investigated by scanning tunneling microscopy. Intriguing structures of ladder and rectangular-shaped networks were obtained by controlling the ratios of deposited amount of BDA molecules and Mn atoms. These structures are well explained by models in which BDA molecules occupy the perimeter of the rectangles and a pair of two Mn atoms are placed at the lattice points. For the rectangular structure, further two phases of a rectangular and a square networks were identified in which the paired Mn atoms were directing an identical direction and 90° rotated in an alternate manner, respectively. In addition, it was revealed that the open space surrounded by rectangle BDA molecules could capture a dimer of C60 molecules which were deposited on the Mn-based BDA networks.

Superconducting molybdenum-rhenium electrodes for single-molecule transport studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaudenzi, R.; Island, J. O.; Bruijckere, J. de

2015-06-01

We demonstrate that electronic transport through single molecules or molecular ensembles, commonly based on gold (Au) electrodes, can be extended to superconducting electrodes by combining gold with molybdenum-rhenium (MoRe). This combination induces proximity-effect superconductivity in the gold to temperatures of at least 4.6 K and magnetic fields of 6 T, improving on previously reported aluminum based superconducting nanojunctions. As a proof of concept, we show three-terminal superconductive transport measurements through an individual Fe{sub 4} single-molecule magnet.

Selection of an optimal cysteine-containing peptide-based chelator for labeling of affibody molecules with (188)Re.

PubMed

Altai, Mohamed; Honarvar, Hadis; Wållberg, Helena; Strand, Joanna; Varasteh, Zohreh; Rosestedt, Maria; Orlova, Anna; Dunås, Finn; Sandström, Mattias; Löfblom, John; Tolmachev, Vladimir; Ståhl, Stefan

2014-11-24

Affibody molecules constitute a class of small (7 kDa) scaffold proteins that can be engineered to have excellent tumor targeting properties. High reabsorption in kidneys complicates development of affibody molecules for radionuclide therapy. In this study, we evaluated the influence of the composition of cysteine-containing C-terminal peptide-based chelators on the biodistribution and renal retention of (188)Re-labeled anti-HER2 affibody molecules. Biodistribution of affibody molecules containing GGXC or GXGC peptide chelators (where X is G, S, E or K) was compared with biodistribution of a parental affibody molecule ZHER2:2395 having a KVDC peptide chelator. All constructs retained low picomolar affinity to HER2-expressing cells after labeling. The biodistribution of all (188)Re-labeled affibody molecules was in general comparable, with the main observed difference found in the uptake and retention of radioactivity in excretory organs. The (188)Re-ZHER2:V2 affibody molecule with a GGGC chelator provided the lowest uptake in all organs and tissues. The renal retention of (188)Re-ZHER2:V2 (3.1 ± 0.5 %ID/g at 4 h after injection) was 55-fold lower than retention of the parental (188)Re-ZHER2:2395 (172 ± 32 %ID/g). We show that engineering of cysteine-containing peptide-based chelators can be used for significant improvement of biodistribution of (188)Re-labeled scaffold proteins, particularly reduction of their uptake in excretory organs. Copyright © 2014 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

Diffusion and mobility of atomic particles in a liquid

NASA Astrophysics Data System (ADS)

Smirnov, B. M.; Son, E. E.; Tereshonok, D. V.

2017-11-01

The diffusion coefficient of a test atom or molecule in a liquid is determined for the mechanism where the displacement of the test molecule results from the vibrations and motion of liquid molecules surrounding the test molecule and of the test particle itself. This leads to a random change in the coordinate of the test molecule, which eventually results in the diffusion motion of the test particle in space. Two models parameters of interaction of a particle and a liquid are used to find the activation energy of the diffusion process under consideration: the gas-kinetic cross section for scattering of test molecules in the parent gas and the Wigner-Seitz radius for test molecules. In the context of this approach, we have calculated the diffusion coefficient of atoms and molecules in water, where based on experimental data, we have constructed the dependence of the activation energy for the diffusion of test molecules in water on the interaction parameter and the temperature dependence for diffusion coefficient of atoms or molecules in water within the models considered. The statistically averaged difference of the activation energies for the diffusion coefficients of different test molecules in water that we have calculated based on each of the presented models does not exceed 10% of the diffusion coefficient itself. We have considered the diffusion of clusters in water and present the dependence of the diffusion coefficient on the cluster size. The accuracy of the presented formulas for the diffusion coefficient of atomic particles in water is estimated to be 50%.

Computational Prediction of the Immunomodulatory Potential of RNA Sequences.

PubMed

Nagpal, Gandharva; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Raghava, Gajendra Pal Singh

2017-01-01

Advances in the knowledge of various roles played by non-coding RNAs have stimulated the application of RNA molecules as therapeutics. Among these molecules, miRNA, siRNA, and CRISPR-Cas9 associated gRNA have been identified as the most potent RNA molecule classes with diverse therapeutic applications. One of the major limitations of RNA-based therapeutics is immunotoxicity of RNA molecules as it may induce the innate immune system. In contrast, RNA molecules that are potent immunostimulators are strong candidates for use in vaccine adjuvants. Thus, it is important to understand the immunotoxic or immunostimulatory potential of these RNA molecules. The experimental techniques for determining immunostimulatory potential of siRNAs are time- and resource-consuming. To overcome this limitation, recently our group has developed a web-based server "imRNA" for predicting the immunomodulatory potential of RNA sequences. This server integrates a number of modules that allow users to perform various tasks including (1) generation of RNA analogs with reduced immunotoxicity, (2) identification of highly immunostimulatory regions in RNA sequence, and (3) virtual screening. This server may also assist users in the identification of minimum mutations required in a given RNA sequence to minimize its immunomodulatory potential that is required for designing RNA-based therapeutics. Besides, the server can be used for designing RNA-based vaccine adjuvants as it may assist users in the identification of mutations required for increasing immunomodulatory potential of a given RNA sequence. In summary, this chapter describes major applications of the "imRNA" server in designing RNA-based therapeutics and vaccine adjuvants (http://www.imtech.res.in/raghava/imrna/).

Classification and identification of molecules through factor analysis method based on terahertz spectroscopy

NASA Astrophysics Data System (ADS)

Huang, Jianglou; Liu, Jinsong; Wang, Kejia; Yang, Zhengang; Liu, Xiaming

2018-06-01

By means of factor analysis approach, a method of molecule classification is built based on the measured terahertz absorption spectra of the molecules. A data matrix can be obtained by sampling the absorption spectra at different frequency points. The data matrix is then decomposed into the product of two matrices: a weight matrix and a characteristic matrix. By using the K-means clustering to deal with the weight matrix, these molecules can be classified. A group of samples (spirobenzopyran, indole, styrene derivatives and inorganic salts) has been prepared, and measured via a terahertz time-domain spectrometer. These samples are classified with 75% accuracy compared to that directly classified via their molecular formulas.

Facilitation of the PED analysis of large molecules by using global coordinates.

PubMed

Jamróz, Michał H; Ostrowski, Sławomir; Dobrowolski, Jan Cz

2015-10-05

Global coordinates have been found to be useful in the potential energy distribution (PED) analyses of the following large molecules: [13]-acene and [33]-helicene. The global coordinate is defined based on much distanced fragments of the analysed molecule, whereas so far, the coordinates used in the analysis were based on stretchings, bendings, or torsions of the adjacent atoms. It has been shown that the PED analyses performed using the global coordinate and the classical ones can lead to exactly the same PED contributions. The global coordinates may significantly improve the facility of the analysis of the vibrational spectra of large molecules. Copyright © 2015 Elsevier B.V. All rights reserved.

Fast and efficient molecule detection in localization-based super-resolution microscopy by parallel adaptive histogram equalization.

PubMed

Li, Yiming; Ishitsuka, Yuji; Hedde, Per Niklas; Nienhaus, G Ulrich

2013-06-25

In localization-based super-resolution microscopy, individual fluorescent markers are stochastically photoactivated and subsequently localized within a series of camera frames, yielding a final image with a resolution far beyond the diffraction limit. Yet, before localization can be performed, the subregions within the frames where the individual molecules are present have to be identified-oftentimes in the presence of high background. In this work, we address the importance of reliable molecule identification for the quality of the final reconstructed super-resolution image. We present a fast and robust algorithm (a-livePALM) that vastly improves the molecule detection efficiency while minimizing false assignments that can lead to image artifacts.

DNA-Based Single-Molecule Electronics: From Concept to Function.

PubMed

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

DNA-Based Single-Molecule Electronics: From Concept to Function

PubMed Central

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

PubMed

Zhang, Hui; Guo, Peixuan

2014-05-15

Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

Biophysics: Breaking the Nanometer Barrier

DOE Office of Scientific and Technical Information (OSTI.GOV)

Block, Steven

2006-03-20

A new field of scientific exploration – single molecule biophysics – is currently reshaping and redefining our understanding of the mechanochemistry of life. The development of laser-based optical traps, or ‘optical tweezers,’ has allowed for physiological assessments of such precision that bio-molecules can now be measured and studied one at a time. In this colloquium, Professor Block will present findings based on his group’s construction of optical trapping instrumentation that has broken the nanometer barrier, allowing researchers to study single-molecule displacements on the Angstrom level. Focusing on RNA polymerase, the motor enzyme responsible for transcribing the genetic code contained inmore » DNA, Block’s group has been able to measure, in real time, the motion of a single molecule of RNA polymerase as it moves from base to base along the DNA template. A remarkable opportunity to gain insight into one of the most fundamental biological processes of life, this colloquium can not be missed!« less

Nonpeptide-Based Small-Molecule Probe for Fluorogenic and Chromogenic Detection of Chymotrypsin.

PubMed

Wu, Lei; Yang, Shu-Hou; Xiong, Hao; Yang, Jia-Qian; Guo, Jun; Yang, Wen-Chao; Yang, Guang-Fu

2017-03-21

We report herein a nonpeptide-based small-molecule probe for fluorogenic and chromogenic detection of chymotrypsin, as well as the primary application for this probe. This probe was rationally designed by mimicking the peptide substrate and optimized by adjusting the recognition group. The refined probe 2 exhibits good specificity toward chymotrypsin, producing about 25-fold higher enhancement in both the fluorescence intensity and absorbance upon the catalysis by chymotrypsin. Compared with the most widely used peptide substrate (AMC-FPAA-Suc) of chymotrypsin, probe 2 shows about 5-fold higher binding affinity and comparable catalytical efficiency against chymotrypsin. Furthermore, it was successfully applied for the inhibitor characterization. To the best of our knowledge, probe 2 is the first nonpeptide-based small-molecule probe for chymotrypsin, with the advantages of simple structure and high sensitivity compared to the widely used peptide-based substrates. This small-molecule probe is expected to be a useful molecular tool for drug discovery and chymotrypsin-related disease diagnosis.

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

Magnetic wire trap arrays for biomarker-based molecular detection

NASA Astrophysics Data System (ADS)

Vieira, Gregory; Mahajan, Kalpesh; Ruan, Gang; Winter, Jessica; Sooryakumar, R.

2012-02-01

Submicrometer-scale magnetic devices built on chip-based platforms have recently been shown to present opportunities for new particle trapping and manipulation technologies. Meanwhile, advances in nanoparticle fabrication allow for the building of custom-made particles with precise control of their size, composition, and other properties such as magnetism, fluorescence, and surface biomarker characteristics. In particular, carefully tailored surface biomarkers facilitate precise binding to targeted molecules, self-actuated construction of hybrid structures, and fluorescence-based detection schemes. Based on these progresses, we present an on-chip detection mechanism for molecules with known surface markers. Hybrid nanostructures consisting of micelle nanoparticles, fluorescent quantum dots, and superparamagnetic iron oxide nanoparticles are used to detect proteins or DNA molecules. The target is detected by the magnetic and fluorescent functionalities of the composite nanostructure, whereas in the absence of the target these signals are not present. Underlying this approach is the simultaneous manipulation via ferromagnetic zigzag nanowire arrays and imaging via quantum dot excitation. This chip-based detection technique could provide a powerful, low cost tool for ultrasensitive molecule detection with ramifications in healthcare diagnostics and small-scale chemical synthesis.

Smoldyn: particle-based simulation with rule-based modeling, improved molecular interaction and a library interface.

PubMed

Andrews, Steven S

2017-03-01

Smoldyn is a spatial and stochastic biochemical simulator. It treats each molecule of interest as an individual particle in continuous space, simulating molecular diffusion, molecule-membrane interactions and chemical reactions, all with good accuracy. This article presents several new features. Smoldyn now supports two types of rule-based modeling. These are a wildcard method, which is very convenient, and the BioNetGen package with extensions for spatial simulation, which is better for complicated models. Smoldyn also includes new algorithms for simulating the diffusion of surface-bound molecules and molecules with excluded volume. Both are exact in the limit of short time steps and reasonably good with longer steps. In addition, Smoldyn supports single-molecule tracking simulations. Finally, the Smoldyn source code can be accessed through a C/C ++ language library interface. Smoldyn software, documentation, code, and examples are at http://www.smoldyn.org . steven.s.andrews@gmail.com. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Molecule kernels: a descriptor- and alignment-free quantitative structure-activity relationship approach.

PubMed

Mohr, Johannes A; Jain, Brijnesh J; Obermayer, Klaus

2008-09-01

Quantitative structure activity relationship (QSAR) analysis is traditionally based on extracting a set of molecular descriptors and using them to build a predictive model. In this work, we propose a QSAR approach based directly on the similarity between the 3D structures of a set of molecules measured by a so-called molecule kernel, which is independent of the spatial prealignment of the compounds. Predictors can be build using the molecule kernel in conjunction with the potential support vector machine (P-SVM), a recently proposed machine learning method for dyadic data. The resulting models make direct use of the structural similarities between the compounds in the test set and a subset of the training set and do not require an explicit descriptor construction. We evaluated the predictive performance of the proposed method on one classification and four regression QSAR datasets and compared its results to the results reported in the literature for several state-of-the-art descriptor-based and 3D QSAR approaches. In this comparison, the proposed molecule kernel method performed better than the other QSAR methods.

Design strategy for photoinduced electron transfer-based small-molecule fluorescent probes of biomacromolecules.

PubMed

Zhang, Wei; Ma, Zhao; Du, Lupei; Li, Minyong

2014-06-07

As the cardinal support of innumerable biological processes, biomacromolecules such as proteins, nucleic acids and polysaccharides are of importance to living systems. The key to understanding biological processes is to realize the role of these biomacromolecules in thte localization, distribution, conformation and interaction with other molecules. With the current development and adaptation of fluorescent technologies in biomedical and pharmaceutical fields, the fluorescence imaging (FLI) approach of using small-molecule fluorescent probes is becoming an up-to-the-minute method for the detection and monitoring of these imperative biomolecules in life sciences. However, conventional small-molecule fluorescent probes may provide undesirable results because of their intrinsic deficiencies such as low signal-to-noise ratio (SNR) and false-positive errors. Recently, small-molecule fluorescent probes with a photoinduced electron transfer (PET) "on/off" switch for biomacromolecules have been thoroughly considered. When recognized by the biomacromolecules, these probes turn on/off the PET switch and change the fluorescence intensity to present a high SNR result. It should be emphasized that these PET-based fluorescent probes could be advantageous for understanding the pathogenesis of various diseases caused by abnormal expression of biomacromolecules. The discussion of this successful strategy involved in this review will be a valuable guide for the further development of new PET-based small-molecule fluorescent probes for biomacromolecules.

Study of lithium cation in water clusters: based on atom-bond electronegativity equalization method fused into molecular mechanics.

PubMed

Li, Xin; Yang, Zhong-Zhi

2005-05-12

We present a potential model for Li(+)-water clusters based on a combination of the atom-bond electronegativity equalization and molecular mechanics (ABEEM/MM) that is to take ABEEM charges of the cation and all atoms, bonds, and lone pairs of water molecules into the intermolecular electrostatic interaction term in molecular mechanics. The model allows point charges on cationic site and seven sites of an ABEEM-7P water molecule to fluctuate responding to the cluster geometry. The water molecules in the first sphere of Li(+) are strongly structured and there is obvious charge transfer between the cation and the water molecules; therefore, the charge constraint on the ionic cluster includes the charged constraint on the Li(+) and the first-shell water molecules and the charge neutrality constraint on each water molecule in the external hydration shells. The newly constructed potential model based on ABEEM/MM is first applied to ionic clusters and reproduces gas-phase state properties of Li(+)(H(2)O)(n) (n = 1-6 and 8) including optimized geometries, ABEEM charges, binding energies, frequencies, and so on, which are in fair agreement with those measured by available experiments and calculated by ab initio methods. Prospects and benefits introduced by this potential model are pointed out.

Morphogen Electrochemically Triggered Self-Construction of Polymeric Films Based on Mussel-Inspired Chemistry.

PubMed

Maerten, Clément; Garnier, Tony; Lupattelli, Paolo; Chau, Nguyet Trang Thanh; Schaaf, Pierre; Jierry, Loïc; Boulmedais, Fouzia

2015-12-15

Inspired by the strong chemical adhesion mechanism of mussels, we designed a catechol-based electrochemically triggered self-assembly of films based on ethylene glycol molecules bearing catechol groups on both sides and denoted as bis-catechol molecules. These molecules play the role of morphogens and, in contrast to previously investigated systems, they are also one of the constituents, after reaction, of the film. Unable to interact together, commercially available poly(allylamine hydrochloride) (PAH) chains and bis-catechol molecules are mixed in an aqueous solution and brought in contact with an electrode. By application of defined potential cycles, bis-catechol molecules undergo oxidation leading to molecules bearing "reactive" quinone groups which diffuse toward the solution. In this active state, the quinones react with amino groups of PAH through Michael addition and Schiff's base condensation reaction. The application of cyclic voltammetry (CV) between 0 and 500 mV (vs Ag/AgCl, scan rate of 50 mV/s) of a PAH/bis-catechol solution results in a fast self-construction of a film that reaches a thickness of 40 nm after 60 min. The films present a spiky structure which is attributed to the use of bis-functionalized molecules as one component of the films. XPS measurements show the presence of both PAH and bis-catechol cross-linked together in a covalent way. We show that the amine/catechol ratio is an important parameter which governs the film buildup. For a given amine/catechol ratio, it does exist an optimum CV scan rate leading to a maximum of the film thickness as a function of the scan rate.

Optical-nanofiber-based interface for single molecules

NASA Astrophysics Data System (ADS)

Skoff, Sarah M.; Papencordt, David; Schauffert, Hardy; Bayer, Bernhard C.; Rauschenbeutel, Arno

2018-04-01

Optical interfaces for quantum emitters are a prerequisite for implementing quantum networks. Here, we couple single molecules to the guided modes of an optical nanofiber. The molecules are embedded within a crystal that provides photostability and, due to the inhomogeneous broadening, a means to spectrally address single molecules. Single molecules are excited and detected solely via the nanofiber interface without the requirement of additional optical access. In this way, we realize a fully fiber-integrated system that is scalable and may become a versatile constituent for quantum hybrid systems.

Molecular electronics with single molecules in solid-state devices.

PubMed

Moth-Poulsen, Kasper; Bjørnholm, Thomas

2009-09-01

The ultimate aim of molecular electronics is to understand and master single-molecule devices. Based on the latest results on electron transport in single molecules in solid-state devices, we focus here on new insights into the influence of metal electrodes on the energy spectrum of the molecule, and on how the electron transport properties of the molecule depend on the strength of the electronic coupling between it and the electrodes. A variety of phenomena are observed depending on whether this coupling is weak, intermediate or strong.

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

Advanced selective non-invasive ketone body detection sensors based on new ionophores

NASA Astrophysics Data System (ADS)

Sathyapalan, A.; Sarswat, P. K.; Zhu, Y.; Free, M. L.

2014-12-01

New molecules and methods were examined that can be used to detect trace level ketone bodies. Diseases such as type 1 diabetes, childhood hypo-glycaemia-growth hormone deficiency, toxic inhalation, and body metabolism changes are linked with ketone bodies concentration. Here we introduce, selective ketone body detection sensors based on small, environmentally friendly organic molecules with Lewis acid additives. Density functional theory (DFT) simulation of the sensor molecules (Bromo-acetonaphthone tungstate (BANT) and acetonaphthophenyl ether propiono hydroxyl tungstate (APPHT)), indicated a fully relaxed geometry without symmetry attributes and specific coordination which enhances ketone bodies sensitivity. A portable sensing unit was made in which detection media containing ketone bodies at low concentration and new molecules show color change in visible light as well as unique irradiance during UV illumination. RGB analysis, electrochemical tests, SEM characterization, FTIR, absorbance and emission spectroscopy were also performed in order to validate the ketone sensitivity of these new molecules.

Ordered Structure Formed by Biologically Related Molecules

NASA Astrophysics Data System (ADS)

Hatta, Ichiro; Nishino, Junichiro; Sumi, Akinori; Hibino, Masahiro

1995-07-01

The two-dimensional arrangement of biologically related molecules was studied by means of scanning probe microscopy. For monolayers of fatty acid molecules with a saturated hydrocarbon chain adsorbed on a graphite substrate, in the scanning tunneling microscope image, the position associated with the carbon atoms was clearly distinguished. In addition, based on the image for fatty acid molecules with an unsaturated hydrocarbon chain, at the position of a double bond, local electrical conductance was found to increase. Based on the images, it was pointed out that not the position of each carbon but the interaction between a graphite substrate and an alkyl chain plays an important role in imaging. On the other hand, for the surface of Langmuir-Blodgett films composed of phosphatidic acids with cations, the scanning force microscope image shows, for the first time, evidence of the methyl ends in the arrangement of phospholipid molecules.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

PubMed

Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

2018-06-13

The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

Supramolecular Amino Acid Based Hydrogels: Probing the Contribution of Additive Molecules using NMR Spectroscopy

PubMed Central

Ramalhete, Susana M.; Nartowski, Karol P.; Sarathchandra, Nichola; Foster, Jamie S.; Round, Andrew N.; Angulo, Jesús

2017-01-01

Abstract Supramolecular hydrogels are composed of self‐assembled solid networks that restrict the flow of water. l‐Phenylalanine is the smallest molecule reported to date to form gel networks in water, and it is of particular interest due to its crystalline gel state. Single and multi‐component hydrogels of l‐phenylalanine are used herein as model materials to develop an NMR‐based analytical approach to gain insight into the mechanisms of supramolecular gelation. Structure and composition of the gel fibres were probed using PXRD, solid‐state NMR experiments and microscopic techniques. Solution‐state NMR studies probed the properties of free gelator molecules in an equilibrium with bound molecules. The dynamics of exchange at the gel/solution interfaces was investigated further using high‐resolution magic angle spinning (HR‐MAS) and saturation transfer difference (STD) NMR experiments. This approach allowed the identification of which additive molecules contributed in modifying the material properties. PMID:28401991

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

A rotation-translation invariant molecular descriptor of partial charges and its use in ligand-based virtual screening

PubMed Central

2014-01-01

Background Measures of similarity for chemical molecules have been developed since the dawn of chemoinformatics. Molecular similarity has been measured by a variety of methods including molecular descriptor based similarity, common molecular fragments, graph matching and 3D methods such as shape matching. Similarity measures are widespread in practice and have proven to be useful in drug discovery. Because of our interest in electrostatics and high throughput ligand-based virtual screening, we sought to exploit the information contained in atomic coordinates and partial charges of a molecule. Results A new molecular descriptor based on partial charges is proposed. It uses the autocorrelation function and linear binning to encode all atoms of a molecule into two rotation-translation invariant vectors. Combined with a scoring function, the descriptor allows to rank-order a database of compounds versus a query molecule. The proposed implementation is called ACPC (AutoCorrelation of Partial Charges) and released in open source. Extensive retrospective ligand-based virtual screening experiments were performed and other methods were compared with in order to validate the method and associated protocol. Conclusions While it is a simple method, it performed remarkably well in experiments. At an average speed of 1649 molecules per second, it reached an average median area under the curve of 0.81 on 40 different targets; hence validating the proposed protocol and implementation. PMID:24887178

Extracting physics of life at the molecular level: A review of single-molecule data analyses.

PubMed

Colomb, Warren; Sarkar, Susanta K

2015-06-01

Studying individual biomolecules at the single-molecule level has proved very insightful recently. Single-molecule experiments allow us to probe both the equilibrium and nonequilibrium properties as well as make quantitative connections with ensemble experiments and equilibrium thermodynamics. However, it is important to be careful about the analysis of single-molecule data because of the noise present and the lack of theoretical framework for processes far away from equilibrium. Biomolecular motion, whether it is free in solution, on a substrate, or under force, involves thermal fluctuations in varying degrees, which makes the motion noisy. In addition, the noise from the experimental setup makes it even more complex. The details of biologically relevant interactions, conformational dynamics, and activities are hidden in the noisy single-molecule data. As such, extracting biological insights from noisy data is still an active area of research. In this review, we will focus on analyzing both fluorescence-based and force-based single-molecule experiments and gaining biological insights at the single-molecule level. Inherently nonequilibrium nature of biological processes will be highlighted. Simulated trajectories of biomolecular diffusion will be used to compare and validate various analysis techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

ChemBank: a small-molecule screening and cheminformatics resource database.

PubMed

Seiler, Kathleen Petri; George, Gregory A; Happ, Mary Pat; Bodycombe, Nicole E; Carrinski, Hyman A; Norton, Stephanie; Brudz, Steve; Sullivan, John P; Muhlich, Jeremy; Serrano, Martin; Ferraiolo, Paul; Tolliday, Nicola J; Schreiber, Stuart L; Clemons, Paul A

2008-01-01

ChemBank (http://chembank.broad.harvard.edu/) is a public, web-based informatics environment developed through a collaboration between the Chemical Biology Program and Platform at the Broad Institute of Harvard and MIT. This knowledge environment includes freely available data derived from small molecules and small-molecule screens and resources for studying these data. ChemBank is unique among small-molecule databases in its dedication to the storage of raw screening data, its rigorous definition of screening experiments in terms of statistical hypothesis testing, and its metadata-based organization of screening experiments into projects involving collections of related assays. ChemBank stores an increasingly varied set of measurements derived from cells and other biological assay systems treated with small molecules. Analysis tools are available and are continuously being developed that allow the relationships between small molecules, cell measurements, and cell states to be studied. Currently, ChemBank stores information on hundreds of thousands of small molecules and hundreds of biomedically relevant assays that have been performed at the Broad Institute by collaborators from the worldwide research community. The goal of ChemBank is to provide life scientists unfettered access to biomedically relevant data and tools heretofore available primarily in the private sector.

Confinement of water molecule inside (2, 2) graphyne nanotube

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deb, Jyotirmoy; Bhattacharya, Barnali; Sarkar, Utpal, E-mail: utpalchemiitkgp@yahoo.com

2016-05-23

Using density functional theory (DFT) calculations with generalized gradient approximation, the interaction between H{sub 2}O molecule and (2, 2) graphyne nanotube (GNT) has been investigated. The stable configuration due to the insertion of H{sub 2}O molecule inside (2, 2) GNT is determined on the basis of binding energy. The band gap of the GNT decreases due to the confinement of H{sub 2}O molecule. The charge analysis reveals that electrons are shifted from the H{sub 2}O molecule to the GNT. The electronic property of the GNT is highly influenced by the presence of H{sub 2}O molecule; thus, we may design amore » GNT based sensor for the detection of water molecule.« less

The concept of template-based de novo design from drug-derived molecular fragments and its application to TAR RNA.

PubMed

Schüller, Andreas; Suhartono, Marcel; Fechner, Uli; Tanrikulu, Yusuf; Breitung, Sven; Scheffer, Ute; Göbel, Michael W; Schneider, Gisbert

2008-02-01

Principles of fragment-based molecular design are presented and discussed in the context of de novo drug design. The underlying idea is to dissect known drug molecules in fragments by straightforward pseudo-retro-synthesis. The resulting building blocks are then used for automated assembly of new molecules. A particular question has been whether this approach is actually able to perform scaffold-hopping. A prospective case study illustrates the usefulness of fragment-based de novo design for finding new scaffolds. We were able to identify a novel ligand disrupting the interaction between the Tat peptide and TAR RNA, which is part of the human immunodeficiency virus (HIV-1) mRNA. Using a single template structure (acetylpromazine) as reference molecule and a topological pharmacophore descriptor (CATS), new chemotypes were automatically generated by our de novo design software Flux. Flux features an evolutionary algorithm for fragment-based compound assembly and optimization. Pharmacophore superimposition and docking into the target RNA suggest perfect matching between the template molecule and the designed compound. Chemical synthesis was straightforward, and bioactivity of the designed molecule was confirmed in a FRET assay. This study demonstrates the practicability of de novo design to generating RNA ligands containing novel molecular scaffolds.

Correlation between coordinated water content and proton conductivity in Ca-BTC-based metal-organic frameworks.

PubMed

Mallick, Arijit; Kundu, Tanay; Banerjee, Rahul

2012-09-11

Proton conductivity of five Ca-based MOFs which depends on the amount of water molecules coordinated to the Ca-centres has been reported. These MOFs show high temperature proton conductivity due to the strong hydrogen bonding between the lattice and coordinated water molecules.

Robust nonparametric quantification of clustering density of molecules in single-molecule localization microscopy

PubMed Central

Jiang, Shenghang; Park, Seongjin; Challapalli, Sai Divya; Fei, Jingyi; Wang, Yong

2017-01-01

We report a robust nonparametric descriptor, J′(r), for quantifying the density of clustering molecules in single-molecule localization microscopy. J′(r), based on nearest neighbor distribution functions, does not require any parameter as an input for analyzing point patterns. We show that J′(r) displays a valley shape in the presence of clusters of molecules, and the characteristics of the valley reliably report the clustering features in the data. Most importantly, the position of the J′(r) valley (rJm′) depends exclusively on the density of clustering molecules (ρc). Therefore, it is ideal for direct estimation of the clustering density of molecules in single-molecule localization microscopy. As an example, this descriptor was applied to estimate the clustering density of ptsG mRNA in E. coli bacteria. PMID:28636661

Separation and counting of single molecules through nanofluidics, programmable electrophoresis, and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2006-04-25

An apparatus for carrying out the separation, detection, and/or counting of single molecules at nanometer scale. Molecular separation is achieved by driving single molecules through a microfluidic or nanofluidic medium using programmable and coordinated electric fields. In various embodiments, the fluidic medium is a strip of hydrophilic material on nonconductive hydrophobic surface, a trough produced by parallel strips of hydrophobic nonconductive material on a hydrophilic base, or a covered passageway produced by parallel strips of hydrophobic nonconductive material on a hydrophilic base together with a nonconductive cover on the parallel strips of hydrophobic nonconductive material. The molecules are detected and counted using nanoelectrode-gated electron tunneling methods, dielectric monitoring, and other methods.

Detection of Single Molecules Illuminated by a Light-Emitting Diode

PubMed Central

Gerhardt, Ilja; Mai, Lijian; Lamas-Linares, Antía; Kurtsiefer, Christian

2011-01-01

Optical detection and spectroscopy of single molecules has become an indispensable tool in biological imaging and sensing. Its success is based on fluorescence of organic dye molecules under carefully engineered laser illumination. In this paper we demonstrate optical detection of single molecules on a wide-field microscope with an illumination based on a commercially available, green light-emitting diode. The results are directly compared with laser illumination in the same experimental configuration. The setup and the limiting factors, such as light transfer to the sample, spectral filtering and the resulting signal-to-noise ratio are discussed. A theoretical and an experimental approach to estimate these parameters are presented. The results can be adapted to other single emitter and illumination schemes. PMID:22346610

High Level ab initio Predictions of the Energetics of mCO2•(H2O)n (n = 1-3, m = 1-12) Clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thanthiriwatte, Sahan; Duke, Jessica R.; Jackson, Virgil E.

Electronic structure calculations at the correlated molecular orbital theory and density functional theory levels have been used to generate a reliable set of clustering energies for up to three water molecules in carbon dioxide clusters up to n = 12. The structures and energetics are dominated by Lewis acid-base interactions with hydrogen bonding interactions playing a lesser energetic role. The actual binding energies are somewhat larger than might be expected. The correlated molecular orbital MP2 method and density functional theory with the ωB97X exchange-correlation functional provide good results for the energetics of the clusters but the B3LYP and ωB97X-D functionalsmore » do not. Seven CO2 molecules form the first solvent shell about a single H2O with four CO2 molecules interacting with the H2O via Lewis acid-base interactions, two CO2 interacting with the H2O by hydrogen bonds, and the seventh CO2 completing the shell. The Lewis acid-base and weak hydrogen bond interactions between the water molecules and the CO2 molecules are strong enough to disrupt the trimer ring configuration for as few as seven CO2 molecules. Calculated 13C NMR chemical shifts for mCO2•(H2O)n show little change with respect to the number of H2O or CO2 molecules in the cluster. The O-H stretching frequencies do exhibit shifts that can provide information about the interactions between water and CO2 molecules.« less

Molecules-in-molecules fragment-based method for the calculation of chiroptical spectra of large molecules: Vibrational circular dichroism and Raman optical activity spectra of alanine polypeptides.

PubMed

Jose, K V Jovan; Raghavachari, Krishnan

2016-12-01

The molecules-in-molecules (MIM) fragment-based method has recently been adapted to evaluate the chiroptical (vibrational circular dichroism [VCD] and Raman optical activity [ROA]) spectra of large molecules such as peptides. In the MIM-VCD and MIM-ROA methods, the relevant higher energy derivatives of the parent molecule are assembled from the corresponding derivatives of smaller fragment subsystems. In addition, the missing long-range interfragment interactions are accounted at a computationally less expensive level of theory (MIM2). In this work we employed the MIM-VCD and MIM-ROA fragment-based methods to explore the evolution of the chiroptical spectroscopic characteristics of 3 10 -helix, α-helix, β-hairpin, γ-turn, and β-extended conformers of gas phase polyalanine (chain length n = 6-14). The different conformers of polyalanine show distinctive features in the MIM chiroptical spectra and the associated spectral intensities increase with evolution of system size. For a better understanding the site-specific effects on the vibrational spectra, isotopic substitutions were also performed employing the MIM method. An increasing redshift with the number of isotopically labeled 13 C=O functional groups in the peptide molecule was seen. For larger polypeptides, we implemented the two-step-MIM model to circumvent the high computational expense associated with the evaluation of chiroptical spectra at a high level of theory using large basis sets. The chiroptical spectra of α-(alanine) 20 polypeptide obtained using the two-step-MIM model, including continuum solvation effects, show good agreement with the full calculations and experiment. This benchmark study suggests that the MIM-fragment approach can assist in predicting and interpreting chiroptical spectra of large polypeptides. © 2016 Wiley Periodicals, Inc.

Polymer and small molecule based hybrid light source

DOEpatents

Choong, Vi-En; Choulis, Stelios; Krummacher, Benjamin Claus; Mathai, Mathew; So, Franky

2010-03-16

An organic electroluminescent device, includes: a substrate; a hole-injecting electrode (anode) coated over the substrate; a hole injection layer coated over the anode; a hole transporting layer coated over the hole injection layer; a polymer based light emitting layer, coated over the hole transporting layer; a small molecule based light emitting layer, thermally evaporated over the polymer based light emitting layer; and an electron-injecting electrode (cathode) deposited over the electroluminescent polymer layer.

Going Vertical To Improve the Accuracy of Atomic Force Microscopy Based Single-Molecule Force Spectroscopy.

PubMed

Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T

2018-01-23

Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.

Development and application of hybrid structure based method for efficient screening of ligands binding to G-protein coupled receptors

NASA Astrophysics Data System (ADS)

Kortagere, Sandhya; Welsh, William J.

2006-12-01

G-protein coupled receptors (GPCRs) comprise a large superfamily of proteins that are targets for nearly 50% of drugs in clinical use today. In the past, the use of structure-based drug design strategies to develop better drug candidates has been severely hampered due to the absence of the receptor's three-dimensional structure. However, with recent advances in molecular modeling techniques and better computing power, atomic level details of these receptors can be derived from computationally derived molecular models. Using information from these models coupled with experimental evidence, it has become feasible to build receptor pharmacophores. In this study, we demonstrate the use of the Hybrid Structure Based (HSB) method that can be used effectively to screen and identify prospective ligands that bind to GPCRs. Essentially; this multi-step method combines ligand-based methods for building enriched libraries of small molecules and structure-based methods for screening molecules against the GPCR target. The HSB method was validated to identify retinal and its analogues from a random dataset of ˜300,000 molecules. The results from this study showed that the 9 top-ranking molecules are indeed analogues of retinal. The method was also tested to identify analogues of dopamine binding to the dopamine D2 receptor. Six of the ten top-ranking molecules are known analogues of dopamine including a prodrug, while the other thirty-four molecules are currently being tested for their activity against all dopamine receptors. The results from both these test cases have proved that the HSB method provides a realistic solution to bridge the gap between the ever-increasing demand for new drugs to treat psychiatric disorders and the lack of efficient screening methods for GPCRs.

Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

PubMed

Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

2017-05-08

The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A reversible single-molecule switch based on activated antiaromaticity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Xiaodong; Zang, Yaping; Zhu, Liangliang

Single-molecule electronic devices provide researchers with an unprecedented ability to relate novel physical phenomena to molecular chemical structures. Typically, conjugated aromatic molecular backbones are relied upon to create electronic devices, where the aromaticity of the building blocks is used to enhance conductivity. We capitalize on the classical physical organic chemistry concept of Hückel antiaromaticity by demonstrating a single-molecule switch that exhibits low conductance in the neutral state and, upon electrochemical oxidation, reversibly switches to an antiaromatic high-conducting structure. We form single-molecule devices using the scanning tunneling microscope–based break-junction technique and observe an on/off ratio of ~70 for a thiophenylidene derivativemore » that switches to an antiaromatic state with 6-4-6-p electrons. Through supporting nuclear magnetic resonance measurements, we show that the doubly oxidized core has antiaromatic character and we use density functional theory calculations to rationalize the origin of the high-conductance state for the oxidized single-molecule junction. Together, our work demonstrates how the concept of antiaromaticity can be exploited to create single-molecule devices that are highly conducting.« less

A reversible single-molecule switch based on activated antiaromaticity

DOE PAGES

Yin, Xiaodong; Zang, Yaping; Zhu, Liangliang; ...

2017-10-27

Single-molecule electronic devices provide researchers with an unprecedented ability to relate novel physical phenomena to molecular chemical structures. Typically, conjugated aromatic molecular backbones are relied upon to create electronic devices, where the aromaticity of the building blocks is used to enhance conductivity. We capitalize on the classical physical organic chemistry concept of Hückel antiaromaticity by demonstrating a single-molecule switch that exhibits low conductance in the neutral state and, upon electrochemical oxidation, reversibly switches to an antiaromatic high-conducting structure. We form single-molecule devices using the scanning tunneling microscope–based break-junction technique and observe an on/off ratio of ~70 for a thiophenylidene derivativemore » that switches to an antiaromatic state with 6-4-6-p electrons. Through supporting nuclear magnetic resonance measurements, we show that the doubly oxidized core has antiaromatic character and we use density functional theory calculations to rationalize the origin of the high-conductance state for the oxidized single-molecule junction. Together, our work demonstrates how the concept of antiaromaticity can be exploited to create single-molecule devices that are highly conducting.« less

Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines.

PubMed

Zhang, Xinyuan; Zheng, Nan; Rosania, Gus R

2008-09-01

Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions.

Structure and electronic absorption spectra of nematogenic alkoxycinnamic acids - a comparative study based on semiempirical and DFT methods.

PubMed

Praveen, Pogula Lakshmi; Ojha, Durga Prasad

2012-04-01

Structure of nematogenic p-n-Alkoxy cinnamic acids (nOCAC) with various alkyl chain carbon atoms (n = 2, 4, 6, 8) has been optimized using density functional B3LYP with 6-31+G (d) basis set using crystallographic geometry as input. Using the optimized geometry, electronic structure of the molecules has been evaluated using the semiempirical methods and DFT calculations. Molecular charge distribution and phase stability of these systems have been analyzed based on Mulliken and Löwdin population analysis. The electronic absorption spectra of nOCAC molecules have been simulated by employing DFT method, semiempirical CNDO/S and INDO/S parameterizations. Two types of calculations have been performed for model systems containing single and double molecules of nOCAC. UV-Visible spectra have been calculated for all single molecules. The UV stability of the molecules has been discussed in light of the electronic transition oscillator strength (f). The dimer complexes of higher homologues (n = 6, 8) have also been reported to enable the comparison between single and double molecules.

Thioarsenides: A case for long-range Lewis acid-base-directed van der Waals interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibbs, Gerald V.; Wallace, Adam F.; Downs, R. T.

2011-04-01

Electron density distributions, bond paths, Laplacian and local energy density properties have been calculated for a number of As4Sn (n = 3,4,5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis base regions) with aligned regions of locally depleted electron density (Lewis acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for severalmore » other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long range Lewis acid-base directed van der Waals interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.« less

Molecule signatures in photoluminescence spectra of transition metal dichalcogenides

NASA Astrophysics Data System (ADS)

Feierabend, Maja; Berghäuser, Gunnar; Selig, Malte; Brem, Samuel; Shegai, Timur; Eigler, Siegfried; Malic, Ermin

2018-01-01

Monolayer transition metal dichalcogenides (TMDs) show an optimal surface-to-volume ratio and are thus promising candidates for novel molecule sensor devices. It was recently predicted that a certain class of molecules exhibiting a large dipole moment can be detected through the activation of optically inaccessible (dark) excitonic states in absorption spectra of tungsten-based TMDs. In this paper, we investigate the molecule signatures in photoluminescence spectra in dependence of a number of different experimentally accessible quantities, such as excitation density, temperature, as well as molecular characteristics including the dipole moment and its orientation, molecule-TMD distance, molecular coverage, and distribution. We show that under certain optimal conditions even room-temperature detection of molecules can be achieved.

Organizing and addressing magnetic molecules.

PubMed

Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

2009-04-20

Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

Adsorption of CO and O2 molecules on Li metal adsorbed graphene: Search for graphene based gas sensors

NASA Astrophysics Data System (ADS)

Kaur, Gagandeep; Gupta, Shuchi; Sachdeva, Ritika; Dharamvir, Keya

2018-05-01

Adsorption of small gas molecules (such as CO and O2) on pristine graphene (PG) and Li-adsorbed graphene (PG-Li) have been investigated using first principles methods within density functional theory (DFT). We also notice that PG-Li has a higher chemical reactivity towards the gas molecules as compared to PG and these molecules have higher adsorption energy on this surface. Moreover, the strong interactions between PG-Li and the adsorbed molecules (as compared to PG and gas molecules) induce dramatic changes to the electronic properties of PG adsorbed with Li and make PG-Li a promising candidate as sensing material for CO and O2 gases.

Coupling carbon nanomaterials with photochromic molecules for the generation of optically responsive materials

PubMed Central

Zhang, Xiaoyan; Hou, Lili; Samorì, Paolo

2016-01-01

Multifunctional carbon-based nanomaterials offer routes towards the realization of smart and high-performing (opto)electronic (nano)devices, sensors and logic gates. Meanwhile photochromic molecules exhibit reversible transformation between two forms, induced by the absorption of electromagnetic radiation. By combining carbon-based nanomaterials with photochromic molecules, one can achieve reversible changes in geometrical structure, electronic properties and nanoscale mechanics triggering by light. This thus enables a reversible modulation of numerous physical and chemical properties of the carbon-based nanomaterials towards the fabrication of cognitive devices. This review examines the state of the art with respect to these responsive materials, and seeks to identify future directions for investigation. PMID:27067387

Controlled chain polymerisation and chemical soldering for single-molecule electronics.

PubMed

Okawa, Yuji; Akai-Kasaya, Megumi; Kuwahara, Yuji; Mandal, Swapan K; Aono, Masakazu

2012-05-21

Single functional molecules offer great potential for the development of novel nanoelectronic devices with capabilities beyond today's silicon-based devices. To realise single-molecule electronics, the development of a viable method for connecting functional molecules to each other using single conductive polymer chains is required. The method of initiating chain polymerisation using the tip of a scanning tunnelling microscope (STM) is very useful for fabricating single conductive polymer chains at designated positions and thereby wiring single molecules. In this feature article, developments in the controlled chain polymerisation of diacetylene compounds and the properties of polydiacetylene chains are summarised. Recent studies of "chemical soldering", a technique enabling the covalent connection of single polydiacetylene chains to single functional molecules, are also introduced. This represents a key step in advancing the development of single-molecule electronics.

Molecular engineering and measurements to test hypothesized mechanisms in single molecule conductance switching.

PubMed

Moore, Amanda M; Dameron, Arrelaine A; Mantooth, Brent A; Smith, Rachel K; Fuchs, Daniel J; Ciszek, Jacob W; Maya, Francisco; Yao, Yuxing; Tour, James M; Weiss, Paul S

2006-02-15

Six customized phenylene-ethynylene-based oligomers have been studied for their electronic properties using scanning tunneling microscopy to test hypothesized mechanisms of stochastic conductance switching. Previously suggested mechanisms include functional group reduction, functional group rotation, backbone ring rotation, neighboring molecule interactions, bond fluctuations, and hybridization changes. Here, we test these hypotheses experimentally by varying the molecular designs of the switches; the ability of the molecules to switch via each hypothetical mechanism is selectively engineered into or out of each molecule. We conclude that hybridization changes at the molecule-surface interface are responsible for the switching we observe.

Small Molecule based Musculoskeletal Regenerative Engineering

PubMed Central

Lo, Kevin W.-H.; Jiang, Tao; Gagnon, Keith A.; Nelson, Clarke; Laurencin, Cato T.

2014-01-01

Clinicians and scientists working in the field of regenerative engineering are actively investigating a wide range of methods to promote musculoskeletal tissue regeneration. Small molecule-mediated tissue regeneration is emerging as a promising strategy for regenerating various musculoskeletal tissues and a large number of small molecule compounds have been recently discovered as potential bioactive molecules for musculoskeletal tissue repair and regeneration. In this review, we summarize the recent literature encompassing the past four years in the area of small bioactive molecule for promoting repair and regeneration of various musculoskeletal tissues including bone, muscle, cartilage, tendon, and nerve. PMID:24405851

Electron Transport through Porphyrin Molecular Junctions

NASA Astrophysics Data System (ADS)

Zhou, Qi

The goal of this work is to study the properties that would affect the electron transport through a porphyrin molecular junction. This work contributes to the field of electron transport in molecular junctions in the following 3 aspects. First of all, by carrying out experiments comparing the conductance of the iron (III) porphyrin (protected) and the free base porphyrin (protected), it is confirmed that the molecular energy level broadening and shifting occurs for porphyrin molecules when coupled with the metal electrodes, and this level broadening and shifting plays an important role in the electron transport through molecular junctions. Secondly, by carrying out an in-situ deprotection of the acetyl-protected free base porphyrin molecules, it is found out that the presence of acetyl groups reduces the conductance. Thirdly, by incorporating the Matrix-assisted laser desorption/ionization (MALDI) spectrum and the in-situ deprotection prior to formation of molecular junctions, it allows a more precise understanding of the molecules involved in the formation of molecular junctions, and therefore allows an accurate analysis of the conductance histogram. The molecules are prepared by self-assembly and the junctions are formed using a Scanning Tunneling Microscopy (STM) molecular break junction technique. The porphyrin molecules are characterized by MALDI in solution before self-assembly to a gold/mica substrate. The self-assembled monolayers (SAMs) of porphyrins on gold are characterized by Ultraviolet-visible (UV-Vis) reflection spectroscopy to confirm that the molecules are attached to the substrate. The SAMs are then characterized by Angle-Resolved X-ray photoelectron spectroscopy (ARXPS) to determine the thickness and the average molecular orientation of the molecular layer. The electron transport is measured by conductance-displacement (G-S) experiments under a given bias (-0.4V). The conductance value of a single molecule is identified by a statistical analysis over a large set of measurements. In this thesis, I focus on two factors that would affect the electron transport through the porphyrin molecules, namely, the metal ion center, and the deprotection of the end groups. The effect of metal ion center is studied by comparing the conductance of an iron (III) porphyrin (protected) to that of a free base porphyrin (protected). The in-situ deprotection of the molecules before forming the junctions is completed to study the effect of the molecular-electrode interaction. The first factor studied, that is, the metal ion center in the porphyrin molecule, show that the conductance for iron (III) porphyrin (protected) is 3.74 x10-5 G0, and the conductance for the free base porphyrin (protected) is 4.73x10-5 G0 , where G0 = e2 / pih = (25.8kO)-1 is the quantized unit of electrical conductance. Through our collaborative efforts, first principles calculations carried out by our collaborators for the molecular levels of an isolated molecule (without electrodes) show that the energy levels of an iron (III) porphyrin molecule are slightly shifted compared to that of the free base porphyrin. For the free base porphyrin, the highest occupied molecular orbital (HOMO) level (-4.952 eV) lies between the chemical potentials of the substrate (-4.7 eV) and the STM tip (-5.1 eV). This level serves as a channel for electron transport. For the iron (III) porphyrin, the HOMO is at -5.306 eV, which is not in between the chemical potentials of the substrate. Therefore, a significantly smaller conductance is expected for the iron (III) porphyrin compared to the conductance of a free base porphyrin, because of the lack of the electron transport channel. However, the conductance measured from G-S experiments is comparable, i.e. 3.74 x10-5 G0 for iron (III) porphyrin and 4.73x10-5 G0 for free base porphyrin. This suggests that the molecular energy level broadening and shifting occurs for porphyrin molecules when coupled with the metal electrodes, and this level broadening and shifting may significantly affect the electron transport through molecular junctions. The second factor studied, that is, the deprotection of the porphyrin end groups (acetylthio, -SCOCH3), was completed in-situ for the free base porphyrin through the reaction of the acetylthio with sulfuric acid at 35° Celsius for 3 hours. MALDI spectroscopy confirms that two additional deprotected porphyrin species are formed by deprotection, with protonated (MH+) molecular masses of 721 and 679, corresponding to a partially deprotected porphyrin (i.e. only one of the two end groups deprotected), and a fully deprotected porphyrin molecule. Along with the un-reacted acetyl protected porphyrin, a total of 3 porphyrin species are in the solution. This solution is used for self-assembly on a gold/mica surface. The thickness of the in-situ deprotected SAM is determined to be ˜1.7 nm, confirming a relatively upright molecular orientation (54.0°-63.5° between the substrate surface and the molecule), compared to a thickness of ˜1.5 nm for the protected SAM that has a more flat-lying molecular orientation (˜45.6° between the substrate surface and the molecule). From G-S measurements on SAMs prepared by in-situ deprotection, junctions with lower conductance steps at mid 10-5 G0 and junctions with higher conductance steps around 10-4 G 0 are observed. Supported by computational modeling from our collaborating research group, we associate the lower conductance steps to junctions based on the protected form of thiols at the tip-molecule interface, and the higher conductance steps to the deprotected form of the thiol contacts. We suggest that the reduced conductance in the protected porphyrin originates from the presence of the acetyl end groups (-COCH3), rather than from the elongation of the sulfur-gold (S-Au) bonds at the tip-molecule interface. By studying these two factors, I expect this work to provide insights into electron transport through molecules or metal-molecule-metal junctions, and in applications related to integrating molecules as functional units in electronic devices. Future work related to this thesis may include the molecular conductance based on reduction-oxidation (redox) properties of iron ligated porphyrins for the application of molecular switches and molecular memory elements.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

A Cell Based Assay To Identify Neuroprotective Molecules for the Treatment of Amyotrophic Lateral Sclerosis

DTIC Science & Technology

This project on ALS stems from our findings that rodent astrocytes expressing mutated SOD1 kill specifically spinal primary and embryonic mouse stem...identifying the toxic factor, the topic of this project is to search for neuroprotective small molecules by using ourcell-based model of ALS for high

Advanced Analytical Methodologies Based on Raman Spectroscopy to Detect Prebiotic and Biotic Molecules: Applicability in the Study of the Martian Nakhlite NWA 6148 Meteorite

NASA Astrophysics Data System (ADS)

Madariaga, J. M.; Torre-Fdez, I.; Ruiz-Galende, P.; Aramendia, J.; Gomez-Nubla, L.; Fdez-Ortiz de Vallejuelo, S.; Maguregui, M.; Castro, K.; Arana, G.

2018-04-01

Advanced methodologies based on Raman spectroscopy are proposed to detect prebiotic and biotic molecules in returned samples from Mars: (a) optical microscopy with confocal micro-Raman, (b) the SCA instrument, (c) Raman Imaging. Examples for NWA 6148.

Persistence length of collagen molecules based on nonlocal viscoelastic model.

PubMed

Ghavanloo, Esmaeal

2017-12-01

Persistence length is one of the most interesting properties of a molecular chain, which is used to describe the stiffness of a molecule. The experimentally measured values of the persistence length of the collagen molecule are widely scattered from 14 to 180 nm. Therefore, an alternative approach is highly desirable to predict the persistence length of a molecule and also to explain the experimental results. In this paper, a nonlocal viscoelastic model is developed to obtain the persistence length of the collagen molecules in solvent. A new explicit formula is proposed for the persistence length of the molecule with the consideration of the small-scale effect, viscoelastic properties of the molecule, loading frequency, and viscosity of the solvent. The presented model indicates that there exists a range of molecule lengths in which the persistence length strongly depends on the frequency and spatial mode of applied loads, small-scale effect, and viscoelastic properties of the collagen.

Site Identification by Ligand Competitive Saturation (SILCS) simulations for fragment-based drug design.

PubMed

Faller, Christina E; Raman, E Prabhu; MacKerell, Alexander D; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules ("fragments") that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind nonoverlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy.The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is "soaked" in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called "FragMaps" can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine "Grid Free Energies (GFEs)," which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The Zn12O12 cluster-assembled nanowires as a highly sensitive and selective gas sensor for NO and NO2.

PubMed

Yong, Yongliang; Su, Xiangying; Zhou, Qingxiao; Kuang, Yanmin; Li, Xiaohong

2017-12-13

Motivated by the recent realization of cluster-assembled nanomaterials as gas sensors, first-principles calculations are carried out to explore the stability and electronic properties of Zn 12 O 12 cluster-assembled nanowires and the adsorption behaviors of environmental gases on the Zn 12 O 12 -based nanowires, including CO, NO, NO 2 , SO 2 , NH 3 , CH 4 , CO 2 , O 2 and H 2 . Our results indicate that the ultrathin Zn 12 O 12 cluster-assembled nanowires are particularly thermodynamic stable at room temperature. The CO, NO, NO 2 , SO 2 , and NH 3 molecules are all chemisorbed on the Zn 12 O 12 -based nanowires with reasonable adsorption energies, but CH 4 , CO 2 , O 2 and H 2 molecules are only physically adsorbed on the nanowire. The electronic properties of the Zn 12 O 12 -based nanowire present dramatic changes after the adsorption of the NO and NO 2 molecules, especially their electric conductivity and magnetic properties, however, the other molecules adsorption hardly change the electric conductivity of the nanowire. Meanwhile, the recovery time of the nanowire sensor at T = 300 K is estimated at 1.5 μs and 16.7 μs for NO and NO 2 molecules, respectively. Furthermore, the sensitivities of NO and NO 2 are much larger than that of the other molecules. Our results thus conclude that the Zn 12 O 12 -based nanowire is a potential candidate for gas sensors with highly sensitivity for NO and NO 2 .

Development of pharmacophore models for small molecules targeting RNA: Application to the RNA repeat expansion in myotonic dystrophy type 1.

PubMed

Angelbello, Alicia J; González, Àlex L; Rzuczek, Suzanne G; Disney, Matthew D

2016-12-01

RNA is an important drug target, but current approaches to identify bioactive small molecules have been engineered primarily for protein targets. Moreover, the identification of small molecules that bind a specific RNA target with sufficient potency remains a challenge. Computer-aided drug design (CADD) and, in particular, ligand-based drug design provide a myriad of tools to identify rapidly new chemical entities for modulating a target based on previous knowledge of active compounds without relying on a ligand complex. Herein we describe pharmacophore virtual screening based on previously reported active molecules that target the toxic RNA that causes myotonic dystrophy type 1 (DM1). DM1-associated defects are caused by sequestration of muscleblind-like 1 protein (MBNL1), an alternative splicing regulator, by expanded CUG repeats (r(CUG) exp ). Several small molecules have been found to disrupt the MBNL1-r(CUG) exp complex, ameliorating DM1 defects. Our pharmacophore model identified a number of potential lead compounds from which we selected 11 compounds to evaluate. Of the 11 compounds, several improved DM1 defects both in vitro and in cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Overview of Single-Molecule Speckle (SiMS) Microscopy and Its Electroporation-Based Version with Efficient Labeling and Improved Spatiotemporal Resolution.

PubMed

Yamashiro, Sawako; Watanabe, Naoki

2017-07-06

Live-cell single-molecule imaging was introduced more than a decade ago, and has provided critical information on remodeling of the actin cytoskeleton, the motion of plasma membrane proteins, and dynamics of molecular motor proteins. Actin remodeling has been the best target for this approach because actin and its associated proteins stop diffusing when assembled, allowing visualization of single-molecules of fluorescently-labeled proteins in a state specific manner. The approach based on this simple principle is called Single-Molecule Speckle (SiMS) microscopy. For instance, spatiotemporal regulation of actin polymerization and lifetime distribution of actin filaments can be monitored directly by tracking actin SiMS. In combination with fluorescently labeled probes of various actin regulators, SiMS microscopy has contributed to clarifying the processes underlying recycling, motion and remodeling of the live-cell actin network. Recently, we introduced an electroporation-based method called eSiMS microscopy, with high efficiency, easiness and improved spatiotemporal precision. In this review, we describe the application of live-cell single-molecule imaging to cellular actin dynamics and discuss the advantages of eSiMS microscopy over previous SiMS microscopy.

The first radical-based spintronic memristors: Towards resistive RAMs made of organic magnets

NASA Astrophysics Data System (ADS)

Goss, Karin; Krist, Florian; Seyfferle, Simon; Hoefel, Udo; Paretzki, Alexa; Dressel, Martin; Bogani, Lapo; Institut Fuer Anorganische Chemie, University of Stuttgart Collaboration; 1. Physikalisches Institut, University of Stuttgart Team

2014-03-01

Using molecules as building blocks for electronic devices offers ample possibilities for new device functionalities due to a chemical tunability much higher than that of standard inorganic materials, and at the same time offers a decrease in the size of the electronic component down to the single-molecule level. Purely organic molecules containing no metallic centers such as organic radicals can serve as an electronic component with magnetic properties due to the unpaired electron in the radical state. Here we present memristive logic units based on organic radicals of the nitronyl-nitroxide kind. Integrating these purely molecular units as a spin coated layer into crossbar arrays, electrically induced unipolar resistive switching is observed with a change in resistance of up to 100%. We introduce a model based on filamentary reorganization of molecules of different oxidation state revealing the importance of the molecular nature for the switching properties. The major role of the oxidation state of these paramagnetic molecules introduces a magnetic field dependence to the device functionality, which goes along with magnetoresistive charactistics observed for the material. These are the first steps towards a spintronic implementation of organic radicals in electronic devices.

SMMRNA: a database of small molecule modulators of RNA

PubMed Central

Mehta, Ankita; Sonam, Surabhi; Gouri, Isha; Loharch, Saurabh; Sharma, Deepak K.; Parkesh, Raman

2014-01-01

We have developed SMMRNA, an interactive database, available at http://www.smmrna.org, with special focus on small molecule ligands targeting RNA. Currently, SMMRNA consists of ∼770 unique ligands along with structural images of RNA molecules. Each ligand in the SMMRNA contains information such as Kd, Ki, IC50, ΔTm, molecular weight (MW), hydrogen donor and acceptor count, XlogP, number of rotatable bonds, number of aromatic rings and 2D and 3D structures. These parameters can be explored using text search, advanced search, substructure and similarity-based analysis tools that are embedded in SMMRNA. A structure editor is provided for 3D visualization of ligands. Advance analysis can be performed using substructure and OpenBabel-based chemical similarity fingerprints. Upload facility for both RNA and ligands is also provided. The physicochemical properties of the ligands were further examined using OpenBabel descriptors, hierarchical clustering, binning partition and multidimensional scaling. We have also generated a 3D conformation database of ligands to support the structure and ligand-based screening. SMMRNA provides comprehensive resource for further design, development and refinement of small molecule modulators for selective targeting of RNA molecules. PMID:24163098

Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

PubMed

Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

2017-07-24

Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

PubMed Central

Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

2016-01-01

Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and development of more pharmacologically effective osteoarthritis drugs, and to investigate possible therapeutic options. PMID:27977731

Molecules on si: electronics with chemistry.

PubMed

Vilan, Ayelet; Yaffe, Omer; Biller, Ariel; Salomon, Adi; Kahn, Antoine; Cahen, David

2010-01-12

Basic scientific interest in using a semiconducting electrode in molecule-based electronics arises from the rich electrostatic landscape presented by semiconductor interfaces. Technological interest rests on the promise that combining existing semiconductor (primarily Si) electronics with (mostly organic) molecules will result in a whole that is larger than the sum of its parts. Such a hybrid approach appears presently particularly relevant for sensors and photovoltaics. Semiconductors, especially Si, present an important experimental test-bed for assessing electronic transport behavior of molecules, because they allow varying the critical interface energetics without, to a first approximation, altering the interfacial chemistry. To investigate semiconductor-molecule electronics we need reproducible, high-yield preparations of samples that allow reliable and reproducible data collection. Only in that way can we explore how the molecule/electrode interfaces affect or even dictate charge transport, which may then provide a basis for models with predictive power.To consider these issues and questions we will, in this Progress Report, review junctions based on direct bonding of molecules to oxide-free Si.describe the possible charge transport mechanisms across such interfaces and evaluate in how far they can be quantified.investigate to what extent imperfections in the monolayer are important for transport across the monolayer.revisit the concept of energy levels in such hybrid systems.

Liquid Catholyte Molecules for Nonaqueous Redox Flow Batteries

DOE PAGES

Huang, Jinhua; Cheng, Lei; Assary, Rajeev S.; ...

2014-11-25

In this study, a series of dimethoxybenzene-based catholyte molecules, which are electrochemically reversible at high potential (4.0 V vs Li/Li +) and in the form of liquid, is developed. The liquid nature offers the molecules the possibility of being a solo or co-solvent for nonaqueous redox flow batteries. This could dramatically improve the energy density.

Controlling the Morphology of BDTT-DPP-Based Small Molecules via End-Group Functionalization for Highly Efficient Single and Tandem Organic Photovoltaic Cells.

PubMed

Kim, Ji-Hoon; Park, Jong Baek; Yang, Hoichang; Jung, In Hwan; Yoon, Sung Cheol; Kim, Dongwook; Hwang, Do-Hoon

2015-11-04

A series of narrow-band gap, π-conjugated small molecules based on diketopyrrolopyrrole (DPP) electron acceptor units coupled with alkylthienyl-substituted-benzodithiophene (BDTT) electron donors were designed and synthesized for use as donor materials in solution-processed organic photovoltaic cells. In particular, by end-group functionalization of the small molecules with fluorine derivatives, the nanoscale morphologies of the photoactive layers of the photovoltaic cells were successfully controlled. The influences of different fluorine-based end-groups on the optoelectronic and morphological properties, carrier mobilities, and the photovoltaic performances of these materials were investigated. A high power conversion efficiency (PCE) of 6.00% under simulated solar light (AM 1.5G) illumination has been achieved for organic photovoltaic cells based on a small-molecule bulk heterojunction system consisting of a trifluoromethylbenzene (CF3) end-group-containing oligomer (BDTT-(DPP)2-CF3) as the donor and [6,6]-phenyl-C71-butyric acid methyl ester (PC71BM) as the acceptor. As a result, the introduction of CF3 end-groups has been found to enhance both the short circuit current density (JSC) and fill factor (FF). A tandem photovoltaic device comprising an inverted BDTT-(DPP)2-CF3:PC71BM cell and a poly(3-hexylthiophene) (P3HT):indene-C60-bisadduct (IC60BA)-based cell as the top and bottom cell components, respectively, showed a maximum PCE of 8.30%. These results provide valuable guidelines for the rational design of conjugated small molecules for applications in high-performance organic photovoltaic cells. Furthermore, to the best of our knowledge, this is the first report on the design of fluorine-functionalized BDTT-DPP-based small molecules, which have been shown to be a viable candidate for use in inverted tandem cells.

Toxicology of organic-inorganic hybrid molecules: bio-organometallics and its toxicology.

PubMed

Fujie, Tomoya; Hara, Takato; Kaji, Toshiyuki

2016-01-01

Bio-organometallics is a research strategy of biology that uses organic-inorganic hybrid molecules. The molecules are expected to exhibit useful bioactivities based on the unique structure formed by interaction between the organic structure and intramolecular metal(s). However, studies on both biology and toxicology of organic-inorganic hybrid molecules have been incompletely performed. There can be two types of toxicological studies of bio-organometallics; one is evaluation of organic-inorganic hybrid molecules and the other is analysis of biological systems from the viewpoint of toxicology using organic-inorganic hybrid molecules. Our recent studies indicate that cytotoxicity of hybrid molecules containing a metal that is nontoxic in inorganic forms can be more toxic than that of hybrid molecules containing a metal that is toxic in inorganic forms when the structure of the ligand is the same. Additionally, it was revealed that organic-inorganic hybrid molecules are useful for analysis of biological systems important for understanding the toxicity of chemical compounds including heavy metals.

Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

NASA Astrophysics Data System (ADS)

Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

2018-02-01

Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Size, weight and position: ion mobility spectrometry and imaging MS combined.

PubMed

Kiss, András; Heeren, Ron M A

2011-03-01

Size, weight and position are three of the most important parameters that describe a molecule in a biological system. Ion mobility spectrometry is capable of separating molecules on the basis of their size or shape, whereas imaging mass spectrometry is an effective tool to measure the molecular weight and spatial distribution of molecules. Recent developments in both fields enabled the combination of the two technologies. As a result, ion-mobility-based imaging mass spectrometry is gaining more and more popularity as a (bio-)analytical tool enabling the determination of the size, weight and position of several molecules simultaneously on biological surfaces. This paper reviews the evolution of ion-mobility-based imaging mass spectrometry and provides examples of its application in analytical studies of biological surfaces.

Vibronic coupling simulations for linear and nonlinear optical processes: Simulation results

NASA Astrophysics Data System (ADS)

Silverstein, Daniel W.; Jensen, Lasse

2012-02-01

A vibronic coupling model based on time-dependent wavepacket approach is applied to simulate linear optical processes, such as one-photon absorbance and resonance Raman scattering, and nonlinear optical processes, such as two-photon absorbance and resonance hyper-Raman scattering, on a series of small molecules. Simulations employing both the long-range corrected approach in density functional theory and coupled cluster are compared and also examined based on available experimental data. Although many of the small molecules are prone to anharmonicity in their potential energy surfaces, the harmonic approach performs adequately. A detailed discussion of the non-Condon effects is illustrated by the molecules presented in this work. Linear and nonlinear Raman scattering simulations allow for the quantification of interference between the Franck-Condon and Herzberg-Teller terms for different molecules.

Self-Assembly of Optical Molecules with Supramolecular Concepts

PubMed Central

Okamoto, Ken; Chithra, Parayalil; Richards, Gary J.; Hill, Jonathan P.; Ariga, Katsuhiko

2009-01-01

Fabrication of nano-sized objects is one of the most important issues in nanoscience and nanotechnology. Soft nanomaterials with flexible properties have been given much attention and can be obtained through bottom-up processing from functional molecules, where self-assembly based on supramolecular chemistry and designed assembly have become crucial processes and techniques. Among the various functional molecules, dyes have become important materials in certain areas of nanotechnology and their self-assembling behaviors have been actively researched. In this short review, we briefly introduce recent progress in self-assembly of optical molecules and dyes, based mainly on supramolecular concepts. The introduced examples are classified into four categories: self-assembly of (i) low-molecular-weight dyes and (ii) polymeric dyes and dye self-assembly (iii) in nanoscale architectures and (iv) at surfaces. PMID:19564931

Circular-polarization-sensitive metamaterial based on triple-quantum-dot molecules.

PubMed

Kotetes, Panagiotis; Jin, Pei-Qing; Marthaler, Michael; Schön, Gerd

2014-12-05

We propose a new type of chiral metamaterial based on an ensemble of artificial molecules formed by three identical quantum dots in a triangular arrangement. A static magnetic field oriented perpendicular to the plane breaks mirror symmetry, rendering the molecules sensitive to the circular polarization of light. By varying the orientation and magnitude of the magnetic field one can control the polarization and frequency of the emission spectrum. We identify a threshold frequency Ω, above which we find strong birefringence. In addition, Kerr rotation and circular-polarized lasing action can be implemented. We investigate the single-molecule lasing properties for different energy-level arrangements and demonstrate the possibility of circular-polarization conversion. Finally, we analyze the effect of weak stray electric fields or deviations from the equilateral triangular geometry.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Electron transmission through a class of anthracene aldehyde molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petreska, Irina, E-mail: irina.petreska@pmf.ukim.mk; Ohanesjan, Vladimir, E-mail: ohanesjan.vladimir@gmail.com; Pejov, Ljupco, E-mail: ljupcop@pmf.ukim.mk

2016-03-25

Transmission of electrons via metal-molecule-metal junctions, involving rotor-stator anthracene aldehyde molecules is investigated. Two model barriers having input parameters evaluated from accurate ab initio calculations are proposed and the transmission coefficients are obtained by using the quasiclassical approximation. Transmission coefficients further enter in the integral for the net current, utilizing Simmons’ method. Conformational dependence of the tunneling processes is evident and the presence of the side groups enhances the functionality of the future single-molecule based electronic devices.

Azobenzenes as light-controlled molecular electronic switches in nanoscale metal-molecule-metal junctions.

PubMed

Mativetsky, Jeffrey M; Pace, Giuseppina; Elbing, Mark; Rampi, Maria A; Mayor, Marcel; Samorì, Paolo

2008-07-23

Conductance switching associated with the photoisomerization of azobenzene-based (Azo) molecules was observed in nanoscopic metal-molecule-metal junctions. The junctions were formed by using a conducting atomic force microscope (C-AFM) approach, where a metallic AFM tip was used to electrically contact a gold-supported Azo self-assembled monolayer. The measured 30-fold increase in conductance is consistent with the expected decrease in tunneling barrier length resulting from the conformational change of the Azo molecule.

Graphene-based nanoprobes for molecular diagnostics.

PubMed

Chen, Shixing; Li, Fuwu; Fan, Chunhai; Song, Shiping

2015-10-07

In recent years, graphene has received widespread attention owing to its extraordinary electrical, chemical, optical, mechanical and structural properties. Lately, considerable interest has been focused on exploring the potential applications of graphene in life sciences, particularly in disease-related molecular diagnostics. In particular, the coupling of functional molecules with graphene as a nanoprobe offers an excellent platform to realize the detection of biomarkers, such as nucleic acids, proteins and other bioactive molecules, with high performance. This article reviews emerging graphene-based nanoprobes in electrical, optical and other assay methods and their application in various strategies of molecular diagnostics. In particular, this review focuses on the construction of graphene-based nanoprobes and their special advantages for the detection of various bioactive molecules. Properties of graphene-based materials and their functionalization are also comprehensively discussed in view of the development of nanoprobes. Finally, future challenges and perspectives of graphene-based nanoprobes are discussed.

Tunable molecular plasmons in polycyclic aromatic hydrocarbons.

PubMed

Manjavacas, Alejandro; Marchesin, Federico; Thongrattanasiri, Sukosin; Koval, Peter; Nordlander, Peter; Sánchez-Portal, Daniel; García de Abajo, F Javier

2013-04-23

We show that chemically synthesized polycyclic aromatic hydrocarbons (PAHs) exhibit molecular plasmon resonances that are remarkably sensitive to the net charge state of the molecule and the atomic structure of the edges. These molecules can be regarded as nanometer-sized forms of graphene, from which they inherit their high electrical tunability. Specifically, the addition or removal of a single electron switches on/off these molecular plasmons. Our first-principles time-dependent density-functional theory (TDDFT) calculations are in good agreement with a simpler tight-binding approach that can be easily extended to much larger systems. These fundamental insights enable the development of novel plasmonic devices based upon chemically available molecules, which, unlike colloidal or lithographic nanostructures, are free from structural imperfections. We further show a strong interaction between plasmons in neighboring molecules, quantified in significant energy shifts and field enhancement, and enabling molecular-based plasmonic designs. Our findings suggest new paradigms for electro-optical modulation and switching, single-electron detection, and sensing using individual molecules.

Identifying the preferred RNA motifs and chemotypes that interact by probing millions of combinations.

PubMed

Tran, Tuan; Disney, Matthew D

2012-01-01

RNA is an important therapeutic target but information about RNA-ligand interactions is limited. Here, we report a screening method that probes over 3,000,000 combinations of RNA motif-small molecule interactions to identify the privileged RNA structures and chemical spaces that interact. Specifically, a small molecule library biased for binding RNA was probed for binding to over 70,000 unique RNA motifs in a high throughput solution-based screen. The RNA motifs that specifically bind each small molecule were identified by microarray-based selection. In this library-versus-library or multidimensional combinatorial screening approach, hairpin loops (among a variety of RNA motifs) were the preferred RNA motif space that binds small molecules. Furthermore, it was shown that indole, 2-phenyl indole, 2-phenyl benzimidazole and pyridinium chemotypes allow for specific recognition of RNA motifs. As targeting RNA with small molecules is an extremely challenging area, these studies provide new information on RNA-ligand interactions that has many potential uses.

Identifying the Preferred RNA Motifs and Chemotypes that Interact by Probing Millions of Combinations

PubMed Central

Tran, Tuan; Disney, Matthew D.

2012-01-01

RNA is an important therapeutic target but information about RNA-ligand interactions is limited. Here we report a screening method that probes over 3,000,000 combinations of RNA motif-small molecule interactions to identify the privileged RNA structures and chemical spaces that interact. Specifically, a small molecule library biased for binding RNA was probed for binding to over 70,000 unique RNA motifs in a high throughput solution-based screen. The RNA motifs that specifically bind each small molecule were identified by microarray-based selection. In this library-versus-library or multidimensional combinatorial screening approach, hairpin loops (amongst a variety of RNA motifs) were the preferred RNA motif space that binds small molecules. Furthermore, it was shown that indole, 2-phenyl indole, 2-phenyl benzimidazole, and pyridinium chemotypes allow for specific recognition of RNA motifs. Since targeting RNA with small molecules is an extremely challenging area, these studies provide new information on RNA-ligand interactions that has many potential uses. PMID:23047683

Single-Molecule Electrical Random Resequencing of DNA and RNA

NASA Astrophysics Data System (ADS)

Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

2012-07-01

Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

9,10-Azaboraphenanthrene-containing small molecules and conjugated polymers: synthesis and their application in chemodosimeters for the ratiometric detection of fluoride ions.

PubMed

Zhang, Weidong; Li, Guoping; Xu, Letian; Zhuo, Yue; Wan, Wenming; Yan, Ni; He, Gang

2018-05-21

The introduction of main group elements into conjugated scaffolds is emerging as a key route to novel optoelectronic materials. Herein, an efficient and versatile way to synthesize polymerizable 9,10-azaboraphenanthrene ( BNP )-containing monomers by aromaticity-driven ring expansion reactions between highly antiaromatic borafluorene and azides is reported, and the corresponding conjugated small molecules and polymers are developed as well. The BNP -containing small molecules and conjugated polymers showed good air/moisture stability and notable fluorescence properties. Addition of fluoride ions to the BNP -based small molecules and polymers induced a rapid change in the emission color from blue to green/yellow, respectively, accompanied by strong intensity changes. The conjugated polymers showed better ratiometric sensing performance than small molecules due to the exciton migration along the conjugated chains. Further experiments showed that the sensing process is fully reversible. The films prepared by solution-deposition of BNP -based compounds in the presence of polycaprolactone also showed good ratiometric sensing for fluoride ions.

Giant light-harvesting nanoantenna for single-molecule detection in ambient light

PubMed Central

Trofymchuk, Kateryna; Reisch, Andreas; Didier, Pascal; Fras, François; Gilliot, Pierre; Mely, Yves; Klymchenko, Andrey S.

2017-01-01

Here, we explore the enhancement of single molecule emission by polymeric nano-antenna that can harvest energy from thousands of donor dyes to a single acceptor. In this nano-antenna, the cationic dyes are brought together in very close proximity using bulky counterions, thus enabling ultrafast diffusion of excitation energy (≤30 fs) with minimal losses. Our 60-nm nanoparticles containing >10,000 rhodamine-based donor dyes can efficiently transfer energy to 1-2 acceptors resulting in an antenna effect of ~1,000. Therefore, single Cy5-based acceptors become 25-fold brighter than quantum dots QD655. This unprecedented amplification of the acceptor dye emission enables observation of single molecules at illumination powers (1-10 mW cm-2) that are >10,000-fold lower than typically required in single-molecule measurements. Finally, using a basic setup, which includes a 20X air objective and a sCMOS camera, we could detect single Cy5 molecules by simply shining divergent light on the sample at powers equivalent to sunlight. PMID:28983324

Electrostatic melting in a single-molecule field-effect transistor with applications in genomic identification

PubMed Central

Vernick, Sefi; Trocchia, Scott M.; Warren, Steven B.; Young, Erik F.; Bouilly, Delphine; Gonzalez, Ruben L.; Nuckolls, Colin; Shepard, Kenneth L.

2017-01-01

The study of biomolecular interactions at the single-molecule level holds great potential for both basic science and biotechnology applications. Single-molecule studies often rely on fluorescence-based reporting, with signal levels limited by photon emission from single optical reporters. The point-functionalized carbon nanotube transistor, known as the single-molecule field-effect transistor, is a bioelectronics alternative based on intrinsic molecular charge that offers significantly higher signal levels for detection. Such devices are effective for characterizing DNA hybridization kinetics and thermodynamics and enabling emerging applications in genomic identification. In this work, we show that hybridization kinetics can be directly controlled by electrostatic bias applied between the device and the surrounding electrolyte. We perform the first single-molecule experiments demonstrating the use of electrostatics to control molecular binding. Using bias as a proxy for temperature, we demonstrate the feasibility of detecting various concentrations of 20-nt target sequences from the Ebolavirus nucleoprotein gene in a constant-temperature environment. PMID:28516911

Microfluidic integrated acoustic waving for manipulation of cells and molecules.

PubMed

Barani, Alireza; Paktinat, Hossein; Janmaleki, Mohsen; Mohammadi, Aminollah; Mosaddegh, Peiman; Fadaei-Tehrani, Alireza; Sanati-Nezhad, Amir

2016-11-15

Acoustophoresis with its simple and low-cost fabrication, rapid and localized fluid actuation, compatibility with microfluidic components, and biocompatibility for cellular studies, has been extensively integrated into microfluidics to provide on-chip microdevices for a variety of applications in biology, bioengineering and chemistry. Among different applications, noninvasive manipulation of cells and biomolecules are significantly important, which are addressed by acoustic-based microfluidics. Here in this paper, we briefly explain the principles and different configurations of acoustic wave and acoustic streaming for the manipulation of cells and molecules and overview its applications for single cell isolation, cell focusing and sorting, cell washing and patterning, cell-cell fusion and communication, and tissue engineering. We further discuss the application of acoustic-based microfluidic systems for the mixing and transport of liquids, manipulation of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules, followed by explanation on the present challenges of acoustic-based microfluidics for the handling of cells and molecules, and highlighting the future directions. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

NASA Astrophysics Data System (ADS)

Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

2011-03-01

The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

Highly sensitive detection of target molecules using a new fluorescence-based bead assay

NASA Astrophysics Data System (ADS)

Scheffler, Silvia; Strauß, Denis; Sauer, Markus

2007-07-01

Development of immunoassays with improved sensitivity, specificity and reliability are of major interest in modern bioanalytical research. We describe the development of a new immunomagnetic fluorescence detection (IM-FD) assay based on specific antigen/antibody interactions and on accumulation of the fluorescence signal on superparamagnetic PE beads in combination with the use of extrinsic fluorescent labels. IM-FD can be easily modified by varying the order of coatings and assay conditions. Depending on the target molecule, antibodies (ABs), entire proteins, or small protein epitopes can be used as capture molecules. The presence of target molecules is detected by fluorescence microscopy using fluorescently labeled secondary or detection antibodies. Here, we demonstrate the potential of the new assay detecting the two tumor markers IGF-I and p53 antibodies in the clinically relevant concentration range. Our data show that the fluorescence-based bead assay exhibits a large dynamic range and a high sensitivity down to the subpicomolar level.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Soluble adhesion molecules in human cancers: sources and fates.

PubMed

van Kilsdonk, Jeroen W J; van Kempen, Léon C L T; van Muijen, Goos N P; Ruiter, Dirk J; Swart, Guido W M

2010-06-01

Adhesion molecules endow tumor cells with the necessary cell-cell contacts and cell-matrix interactions. As such, adhesion molecules are involved in cell signalling, proliferation and tumor growth. Rearrangements in the adhesion repertoire allow tumor cells to migrate, invade and form metastases. Besides these membrane-bound adhesion molecules several soluble adhesion molecules are detected in the supernatant of tumor cell lines and patient body fluids. Truncated soluble adhesion molecules can be generated by several conventional mechanisms, including alternative splicing of mRNA transcripts, chromosomal translocation, and extracellular proteolytic ectodomain shedding. Secretion of vesicles (ectosomes and exosomes) is an alternative mechanism mediating the release of full-length adhesion molecules. Soluble adhesion molecules function as modulators of cell adhesion, induce proteolytic activity and facilitate cell signalling. Additionally, adhesion molecules present on secreted vesicles might be involved in the vesicle-target cell interaction. Based on currently available data, released soluble adhesion molecules contribute to cancer progression and therefore should not be regarded as unrelated and non-functional side products of tumor progression. 2010 Elsevier GmbH. All rights reserved.

A naphthodithiophene-diketopyrrolopyrrole donor molecule for efficient solution-processed solar cells.

PubMed

Loser, Stephen; Bruns, Carson J; Miyauchi, Hiroyuki; Ortiz, Rocío Ponce; Facchetti, Antonio; Stupp, Samuel I; Marks, Tobin J

2011-06-01

We report the synthesis, characterization, and first implementation of a naphtho[2,3-b:6,7-b']dithiophene (NDT)-based donor molecule in highly efficient organic photovoltaics (OPVs). When NDT(TDPP)(2) (TDPP = thiophene-capped diketopyrrolopyrrole) is combined with the electron acceptor PC(61)BM, a power conversion efficiency (PCE) of 4.06 ± 0.06% is achieved-a record for a PC(61)BM-based small-molecule OPV. The substantial PCE is attributed to the broad, high oscillator strength visible absorption, the ordered molecular packing, and an exceptional hole mobility of NDT(TDPP)(2). © 2011 American Chemical Society

Probe-based measurement of lateral single-electron transfer between individual molecules

PubMed Central

Steurer, Wolfram; Fatayer, Shadi; Gross, Leo; Meyer, Gerhard

2015-01-01

The field of molecular electronics aims at using single molecules as functional building blocks for electronics components, such as switches, rectifiers or transistors. A key challenge is to perform measurements with atomistic control over the alignment of the molecule and its contacting electrodes. Here we use atomic force microscopy to examine charge transfer between weakly coupled pentacene molecules on insulating films with single-electron sensitivity and control over the atomistic details. We show that, in addition to the imaging capability, the probe tip can be used to control the charge state of individual molecules and to detect charge transfers to/from the tip, as well as between individual molecules. Our approach represents a novel route for molecular charge transfer studies with a host of opportunities, especially in combination with single atom/molecule manipulation and nanopatterning techniques. PMID:26387533

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Liangjun; Zheng, Yujun, E-mail: yzheng@sdu.edu.cn

In the present study, the dynamical behaviors of tripartite entanglement of vibrations in triatomic molecules are studied based on the Lie algebraic models of molecules. The dynamical behaviors of tripartite entanglement of the local mode molecule H{sub 2}O and normal mode molecule NO{sub 2} are comparatively studied for different initial states by employing the general concurrence. Our results show that the dynamics of tripartite entanglement are relied on the dynamics of intramolecular energy distribution. The local mode molecule is more suitable to construct the tripartite entangled states. Also, the greater degree of tripartite entanglement can be obtained if the stretchingmore » vibration is first excited. These results shed new light on the understanding of quantum multipartite entanglement of vibrations in the polyatomic molecules.« less

Single-Molecule Electronics: Chemical and Analytical Perspectives.

PubMed

Nichols, Richard J; Higgins, Simon J

2015-01-01

It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

Antibody-enabled small-molecule drug discovery.

PubMed

Lawson, Alastair D G

2012-06-29

Although antibody-based therapeutics have become firmly established as medicines for serious diseases, the value of antibodies as tools in the early stages of small-molecule drug discovery is only beginning to be realized. In particular, antibodies may provide information to reduce risk in small-molecule drug discovery by enabling the validation of targets and by providing insights into the design of small-molecule screening assays. Moreover, antibodies can act as guides in the quest for small molecules that have the ability to modulate protein-protein interactions, which have traditionally only been considered to be tractable targets for biological drugs. The development of small molecules that have similar therapeutic effects to current biologics has the potential to benefit a broader range of patients at earlier stages of disease.

Current rectification in a single molecule diode: the role of electrode coupling.

PubMed

Sherif, Siya; Rubio-Bollinger, Gabino; Pinilla-Cienfuegos, Elena; Coronado, Eugenio; Cuevas, Juan Carlos; Agraït, Nicolás

2015-07-24

We demonstrate large rectification ratios (> 100) in single-molecule junctions based on a metal-oxide cluster (polyoxometalate), using a scanning tunneling microscope (STM) both at ambient conditions and at low temperature. These rectification ratios are the largest ever observed in a single-molecule junction, and in addition these junctions sustain current densities larger than 10(5) A cm(-2). By following the variation of the I-V characteristics with tip-molecule separation we demonstrate unambiguously that rectification is due to asymmetric coupling to the electrodes of a molecule with an asymmetric level structure. This mechanism can be implemented in other type of molecular junctions using both organic and inorganic molecules and provides a simple strategy for the rational design of molecular diodes.

Current rectification in a single molecule diode: the role of electrode coupling

NASA Astrophysics Data System (ADS)

Sherif, Siya; Rubio-Bollinger, Gabino; Pinilla-Cienfuegos, Elena; Coronado, Eugenio; Cuevas, Juan Carlos; Agraït, Nicolás

2015-07-01

We demonstrate large rectification ratios (\\gt 100) in single-molecule junctions based on a metal-oxide cluster (polyoxometalate), using a scanning tunneling microscope (STM) both at ambient conditions and at low temperature. These rectification ratios are the largest ever observed in a single-molecule junction, and in addition these junctions sustain current densities larger than 105 A cm-2. By following the variation of the I-V characteristics with tip-molecule separation we demonstrate unambiguously that rectification is due to asymmetric coupling to the electrodes of a molecule with an asymmetric level structure. This mechanism can be implemented in other type of molecular junctions using both organic and inorganic molecules and provides a simple strategy for the rational design of molecular diodes.

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

Distinguishing Lead and Molecule States in Graphene-Based Single-Electron Transistors

PubMed Central

2017-01-01

Graphene provides a two-dimensional platform for contacting individual molecules, which enables transport spectroscopy of molecular orbital, spin, and vibrational states. Here we report single-electron tunneling through a molecule that has been anchored to two graphene leads. Quantum interference within the graphene leads gives rise to an energy-dependent transmission and fluctuations in the sequential tunnel-rates. The lead states are electrostatically tuned by a global back-gate, resulting in a distinct pattern of varying intensity in the measured conductance maps. This pattern could potentially obscure transport features that are intrinsic to the molecule under investigation. Using ensemble averaged magneto-conductance measurements, lead and molecule states are disentangled, enabling spectroscopic investigation of the single molecule. PMID:28423272

Influence of thermocleavable functionality on organic field-effect transistor performance of small molecules

NASA Astrophysics Data System (ADS)

Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay

2017-06-01

Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.

Development of Spiro[cyclopenta[1,2-b:5,4-b']dithiophene-4,9'-fluorene]-Based A-π-D-π-A Small Molecules with Different Acceptor Units for Efficient Organic Solar Cells.

PubMed

Wang, Wengong; Shen, Ping; Dong, Xinning; Weng, Chao; Wang, Guo; Bin, Haijun; Zhang, Jing; Zhang, Zhi-Guo; Li, Yongfang

2017-02-08

Three acceptor-π-donor-π-acceptor (A-π-D-π-A) small molecules (STFYT, STFRDN, and STFRCN) with spiro[cyclopenta[1,2-b:5,4-b']dithiophene-4,9'-fluorene] (STF) as the central donor unit, terthiophene as the π-conjugated bridge, indenedione, 3-ethylrhodanine, or 2-(1,1-dicyanomethylene)rhodanine as the acceptor unit are designed, synthesized, and characterized as electron donor materials in solution-processing organic solar cells (OSCs). The effects of the spiro STF-based central core and different acceptors on the molecular configuration, absorption properties, electronic energy levels, carrier transport properties, the morphology of active layers, and photovoltaic properties are investigated in detail. The three molecules exhibit desirable physicochemical features: wide absorption bands (300-850 nm) and high molar absorption coefficients (4.82 × 10 4 to 7.56 × 10 4 M -1 cm -1 ) and relatively low HOMO levels (-5.15 to -5.38 eV). Density functional theory calculations reveal that the spiro STF central core benefits to reduce the steric hindrance effect between the central donor block and terthiophene bridge and suppress excessive intermolecular aggregations. The optimized OSCs based on these molecules deliver power conversion efficiencies (PCEs) of 6.68%, 3.30%, and 4.33% for STFYT, STFRDN, and STFRCN, respectively. The higher PCE of STFYT-based OSCs should be ascribed to its better absorption ability, higher and balanced hole and electron mobilities, and superior active layer morphology as compared to the other two compounds. So far, this is the first example of developing the A-π-D-π-A type small molecules with a spiro central donor core for high-performance OSC applications. Meanwhile, these results demonstrate that using spiro central block to construct A-π-D-π-A molecule is an alternative and effective strategy for achieving high-performance small molecule donor materials.

Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions

DOEpatents

Sansinena, Jose-Maria [Los Alamos, NM; Redondo, Antonio [Los Alamos, NM; Olazabal, Virginia [Los Alamos, NM; Hoffbauer, Mark A [Los Alamos, NM; Akhadov, Elshan A [Los Alamos, NM

2009-12-29

A barrier structure for use in an electrochemical stochastic membrane sensor for single molecule detection. The sensor is based upon inorganic nanopores having electrically tunable dimensions. The inorganic nanopores are formed from inorganic materials and an electrically conductive polymer. Methods of making the barrier structure and sensing single molecules using the barrier structure are also described.

Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sansinena, Jose-Maria; Redondo, Antonio; Olazabal, Virginia

2017-09-12

A barrier structure for use in an electrochemical stochastic membrane sensor for single molecule detection. The sensor is based upon inorganic nanopores having electrically tunable dimensions. The inorganic nanopores are formed from inorganic materials and an electrically conductive polymer. Methods of making the barrier structure and sensing single molecules using the barrier structure are also described.

Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sansinena, Jose-Maria; Redondo, Antonio; Olazabal, Virginia

2017-07-18

A barrier structure for use in an electrochemical stochastic membrane sensor for single molecule detection. The sensor is based upon inorganic nanopores having electrically tunable dimensions. The inorganic nanopores are formed from inorganic materials and an electrically conductive polymer. Methods of making the barrier structure and sensing single molecules using the barrier structure are also described.

Improved transparency--nonlinearity trade-off with boroxine-based octupolar molecules.

PubMed

Alcaraz, Gilles; Euzenat, Lisenn; Mongin, Olivier; Katan, Claudine; Ledoux, Isabelle; Zyss, Joseph; Blanchard-Desce, Mireille; Vaultier, Michel

2003-11-21

A series of octupolar molecules derived from the boroxine framework were designed and their optical nonlinearities were investigated by performing harmonic light scattering experiments in solution; the molecules were found to combine excellent transparency in the near UV-visible region (lambdamax < or = 280 nm) and significant first-order hyperpolarisabilities (up to beta(0) = 56 x 10(-30) esu).

Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sansinena, Jose-Maria; Redondo, Antonio; Olazabal, Virginia

A barrier structure for use in an electrochemical stochastic membrane sensor for single molecule detection. The sensor is based upon inorganic nanopores having electrically tunable dimensions. The inorganic nanopores are formed from inorganic materials and an electrically conductive polymer. Methods of making the barrier structure and sensing single molecules using the barrier structure are also described.

The Virtual Museum of Minerals and Molecules: Molecular Visualization in a Virtual Hands-On Museum

ERIC Educational Resources Information Center

Barak, Phillip; Nater, Edward A.

2005-01-01

The Virtual Museum of Minerals and Molecules (VMMM) is a web-based resource presenting interactive, 3-D, research-grade molecular models of more than 150 minerals and molecules of interest to chemical, earth, plant, and environmental sciences. User interactivity with the 3-D display allows models to be rotated, zoomed, and specific regions of…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadjadi, Seyedabdolreza; Zhang, Yong; Kwok, Sun, E-mail: sunkwok@hku.hk

The 3.3 μ m unidentified infrared emission feature is commonly attributed to the C–H stretching band of aromatic molecules. Astronomical observations have shown that this feature is composed of two separate bands at 3.28 and 3.30 μ m, and the origin of these two bands is unclear. In this paper, we perform vibrational analyses based on quantum mechanical calculations of 153 organic molecules, including both pure aromatic molecules and molecules with mixed aromatic/olefinic/aliphatic hydridizations. We find that many of the C–H stretching vibrational modes in polycyclic aromatic hydrocarbon (PAH) molecules are coupled. Even considering the uncoupled modes only, the correlationmore » between the band intensity ratios and the structure of the PAH molecule is not observed, and the 3.28 and 3.30 μ m features cannot be directly interpreted in the PAH model. Based on these results, the possible aromatic, olefinic, and aliphatic origins of the 3.3 μ m feature are discussed. We suggest that the 3.28 μ m feature is assigned to aromatic C–H stretch whereas the 3.30 μ m feature is olefinic. From the ratio of these two features, the relative olefinic to aromatic content of the carrier can be determined.« less

MHC2NNZ: A novel peptide binding prediction approach for HLA DQ molecules

NASA Astrophysics Data System (ADS)

Xie, Jiang; Zeng, Xu; Lu, Dongfang; Liu, Zhixiang; Wang, Jiao

2017-07-01

The major histocompatibility complex class II (MHC-II) molecule plays a crucial role in immunology. Computational prediction of MHC-II binding peptides can help researchers understand the mechanism of immune systems and design vaccines. Most of the prediction algorithms for MHC-II to date have made large efforts in human leukocyte antigen (HLA, the name of MHC in Human) molecules encoded in the DR locus. However, HLA DQ molecules are equally important and have only been made less progress because it is more difficult to handle them experimentally. In this study, we propose an artificial neural network-based approach called MHC2NNZ to predict peptides binding to HLA DQ molecules. Unlike previous artificial neural network-based methods, MHC2NNZ not only considers sequence similarity features but also captures the chemical and physical properties, and a novel method incorporating these properties is proposed to represent peptide flanking regions (PFR). Furthermore, MHC2NNZ improves the prediction accuracy by combining with amino acid preference at more specific positions of the peptides binding core. By evaluating on 3549 peptides binding to six most frequent HLA DQ molecules, MHC2NNZ is demonstrated to outperform other state-of-the-art MHC-II prediction methods.

Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

NASA Astrophysics Data System (ADS)

Granger, Devin Benjamin

Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and donor molecules for bulk heterojunction organic photovoltaics based on anthrathiophene and benzo[1,2-b:4,5-b']dithiophene central units like literature molecules containing fluorene and dithieno[2,3-b:2',3'-d]silole cores. The synthetic strategies of developing reduced symmetry benzo[1,2-b:4,5-b']dithiophene to study the effect of substitution around the central unit is also described. The optical and electronic properties of the donors and acceptors are described along with the performance and characteristics of devices employing these molecules. The final two data chapters focus on new nitrogen containing polycyclic hydrocarbons containing indolizine and (2.2.2) cyclazine units. The optical, electronic and other physical properties of these molecules are explored, in addition to the synthetic strategies for incorporating the indolizine and cyclazine units. By use of alkylsilylethynyl groups, crystal engineering was investigated for the benzo[2,3-b:5,6-b']diindolizine chromophore described in chapter 4 to target the 2-D "brick-work" packing motif for application in field effect transistor devices. Optical and electronic properties of the cyclazine end-capped acene molecules described in chapter 5 were investigated and described in relation to the base acene molecules. In both cases, density functional theory calculations were conducted to better understand unexpected optical properties of these molecules, which are like the linear acene series despite the non-linear attachment.

Recent Advances on Luminescent Enhancement-Based Porous Silicon Biosensors.

PubMed

Jenie, S N Aisyiyah; Plush, Sally E; Voelcker, Nicolas H

2016-10-01

Luminescence-based detection paradigms have key advantages over other optical platforms such as absorbance, reflectance or interferometric based detection. However, autofluorescence, low quantum yield and lack of photostability of the fluorophore or emitting molecule are still performance-limiting factors. Recent research has shown the need for enhanced luminescence-based detection to overcome these drawbacks while at the same time improving the sensitivity, selectivity and reducing the detection limits of optical sensors and biosensors. Nanostructures have been reported to significantly improve the spectral properties of the emitting molecules. These structures offer unique electrical, optic and magnetic properties which may be used to tailor the surrounding electrical field of the emitter. Here, the main principles behind luminescence and luminescence enhancement-based detections are reviewed, with an emphasis on europium complexes as the emitting molecule. An overview of the optical porous silicon microcavity (pSiMC) as a biosensing platform and recent proof-of-concept examples on enhanced luminescence-based detection using pSiMCs are provided and discussed.

Site Identification by Ligand Competitive Saturation (SILCS) Simulations for Fragment-Based Drug Design

PubMed Central

Faller, Christina E.; Raman, E. Prabhu; MacKerell, Alexander D.; Guvench, Olgun

2015-01-01

Fragment-based drug design (FBDD) involves screening low molecular weight molecules (“fragments”) that correspond to functional groups found in larger drug-like molecules to determine their binding to target proteins or nucleic acids. Based on the principle of thermodynamic additivity, two fragments that bind non-overlapping nearby sites on the target can be combined to yield a new molecule whose binding free energy is the sum of those of the fragments. Experimental FBDD approaches, like NMR and X-ray crystallography, have proven very useful but can be expensive in terms of time, materials, and labor. Accordingly, a variety of computational FBDD approaches have been developed that provide different levels of detail and accuracy. The Site Identification by Ligand Competitive Saturation (SILCS) method of computational FBDD uses all-atom explicit-solvent molecular dynamics (MD) simulations to identify fragment binding. The target is “soaked” in an aqueous solution with multiple fragments having different identities. The resulting computational competition assay reveals what small molecule types are most likely to bind which regions of the target. From SILCS simulations, 3D probability maps of fragment binding called “FragMaps” can be produced. Based on the probabilities relative to bulk, SILCS FragMaps can be used to determine “Grid Free Energies (GFEs),” which provide per-atom contributions to fragment binding affinities. For essentially no additional computational overhead relative to the production of the FragMaps, GFEs can be used to compute Ligand Grid Free Energies (LGFEs) for arbitrarily complex molecules, and these LGFEs can be used to rank-order the molecules in accordance with binding affinities. PMID:25709034

Ultracold molecule assembly with photonic crystals

NASA Astrophysics Data System (ADS)

Pérez-Ríos, Jesús; Kim, May E.; Hung, Chen-Lung

2017-12-01

Photoassociation (PA) is a powerful technique to synthesize molecules directly and continuously from cold and ultracold atoms into deeply bound molecular states. In freespace, however, PA efficiency is constrained by the number of spontaneous decay channels linking the initial excited molecular state to a sea of final (meta)stable rovibronic levels. Here, we propose a novel scheme based on molecules strongly coupled to a guided photonic mode in a photonic crystal waveguide that turns PA into a powerful tool for near deterministic formation of ultracold molecules in their ground rovibrational level. Our example shows a potential ground state molecule production efficiency > 90 % , and a saturation rate > {10}6 molecules per second. By combining state-of-the-art cold atomic and molecular physics with nanophotonic engineering, our scheme presents a novel experimental package for trapping, cooling, and optically manipulating ultracold molecules, thus opening up new possibilities in the direction of ultracold chemistry and quantum information.

The Molecule Pages database

PubMed Central

Saunders, Brian; Lyon, Stephen; Day, Matthew; Riley, Brenda; Chenette, Emily; Subramaniam, Shankar

2008-01-01

The UCSD-Nature Signaling Gateway Molecule Pages (http://www.signaling-gateway.org/molecule) provides essential information on more than 3800 mammalian proteins involved in cellular signaling. The Molecule Pages contain expert-authored and peer-reviewed information based on the published literature, complemented by regularly updated information derived from public data source references and sequence analysis. The expert-authored data includes both a full-text review about the molecule, with citations, and highly structured data for bioinformatics interrogation, including information on protein interactions and states, transitions between states and protein function. The expert-authored pages are anonymously peer reviewed by the Nature Publishing Group. The Molecule Pages data is present in an object-relational database format and is freely accessible to the authors, the reviewers and the public from a web browser that serves as a presentation layer. The Molecule Pages are supported by several applications that along with the database and the interfaces form a multi-tier architecture. The Molecule Pages and the Signaling Gateway are routinely accessed by a very large research community. PMID:17965093

The Molecule Pages database.

PubMed

Saunders, Brian; Lyon, Stephen; Day, Matthew; Riley, Brenda; Chenette, Emily; Subramaniam, Shankar; Vadivelu, Ilango

2008-01-01

The UCSD-Nature Signaling Gateway Molecule Pages (http://www.signaling-gateway.org/molecule) provides essential information on more than 3800 mammalian proteins involved in cellular signaling. The Molecule Pages contain expert-authored and peer-reviewed information based on the published literature, complemented by regularly updated information derived from public data source references and sequence analysis. The expert-authored data includes both a full-text review about the molecule, with citations, and highly structured data for bioinformatics interrogation, including information on protein interactions and states, transitions between states and protein function. The expert-authored pages are anonymously peer reviewed by the Nature Publishing Group. The Molecule Pages data is present in an object-relational database format and is freely accessible to the authors, the reviewers and the public from a web browser that serves as a presentation layer. The Molecule Pages are supported by several applications that along with the database and the interfaces form a multi-tier architecture. The Molecule Pages and the Signaling Gateway are routinely accessed by a very large research community.

Bleaching/blinking assisted localization microscopy for superresolution imaging using standard fluorescent molecules.

PubMed

Burnette, Dylan T; Sengupta, Prabuddha; Dai, Yuhai; Lippincott-Schwartz, Jennifer; Kachar, Bechara

2011-12-27

Superresolution imaging techniques based on the precise localization of single molecules, such as photoactivated localization microscopy (PALM) and stochastic optical reconstruction microscopy (STORM), achieve high resolution by fitting images of single fluorescent molecules with a theoretical Gaussian to localize them with a precision on the order of tens of nanometers. PALM/STORM rely on photoactivated proteins or photoswitching dyes, respectively, which makes them technically challenging. We present a simple and practical way of producing point localization-based superresolution images that does not require photoactivatable or photoswitching probes. Called bleaching/blinking assisted localization microscopy (BaLM), the technique relies on the intrinsic bleaching and blinking behaviors characteristic of all commonly used fluorescent probes. To detect single fluorophores, we simply acquire a stream of fluorescence images. Fluorophore bleach or blink-off events are detected by subtracting from each image of the series the subsequent image. Similarly, blink-on events are detected by subtracting from each frame the previous one. After image subtractions, fluorescence emission signals from single fluorophores are identified and the localizations are determined by fitting the fluorescence intensity distribution with a theoretical Gaussian. We also show that BaLM works with a spectrum of fluorescent molecules in the same sample. Thus, BaLM extends single molecule-based superresolution localization to samples labeled with multiple conventional fluorescent probes.

Conformation-based signal transfer and processing at the single-molecule level

NASA Astrophysics Data System (ADS)

Li, Chao; Wang, Zhongping; Lu, Yan; Liu, Xiaoqing; Wang, Li

2017-11-01

Building electronic components made of individual molecules is a promising strategy for the miniaturization and integration of electronic devices. However, the practical realization of molecular devices and circuits for signal transmission and processing at room temperature has proven challenging. Here, we present room-temperature intermolecular signal transfer and processing using SnCl2Pc molecules on a Cu(100) surface. The in-plane orientations of the molecules are effectively coupled via intermolecular interaction and serve as the information carrier. In the coupled molecular arrays, the signal can be transferred from one molecule to another in the in-plane direction along predesigned routes and processed to realize logical operations. These phenomena enable the use of molecules displaying intrinsic bistable states as complex molecular devices and circuits with novel functions.

Laser-triggered release of encapsulated molecules from polylactic-co-glycolic acid microcapsules

NASA Astrophysics Data System (ADS)

Ariyasu, Kazumasa; Ishii, Atsuhiro; Umemoto, Taiga; Terakawa, Mitsuhiro

2016-08-01

The controlled release of encapsulated molecules from a microcapsule is a promising method of targeted drug delivery. Laser-triggered methods for the release of encapsulated molecules have the advantage of spatial and temporal controllability. In this study, we demonstrated the release of encapsulated molecules from biodegradable polymer-based microcapsules using near-infrared femtosecond laser pulses. The polylactic-co-glycolic acid microcapsules encapsulating fluorescein isothiocyanate-dextran molecules were fabricated using a dual-coaxial nozzle system. Irradiation of femtosecond laser pulses enhanced the release of the molecules from the microcapsules, which was accompanied by a decrease in the residual ratio of the microcapsules. The laser-induced modification of the surface of the shell of the microcapsules indicated the potential for sustained release as well as burst release.

Morphological study on small molecule acceptor-based organic solar cells with efficiencies beyond 7% (Presentation Recording)

NASA Astrophysics Data System (ADS)

Ma, Wei; Yan, He

2015-10-01

Despite the essential role of fullerenes in achieving best-performance organic solar cells (OSCs), fullerene acceptors have several drawbacks including poor light absorption, high-cost production and purification. For this reason, small molecule acceptor (SMA)-based OSCs have attracted much attention due to the easy tunability of electronic and optical properties of SMA materials. In this study, polymers with temperature dependent aggregation behaviors are combined with various small molecule acceptor materials, which lead to impressive power conversion efficiencies of up to 7.3%. The morphological and aggregation properties of the polymer:small molecule blends are studied in details. It is found that the temperature-dependent aggregation behavior of polymers allows for the processing of the polymer solutions at moderately elevated temperature, and more importantly, controlled aggregation and strong crystallization of the polymer during the film cooling and drying process. This results in a well-controlled and near-ideal polymer:small molecule morphology that is controlled by polymer aggregation during warm casting and thus insensitive to the choice of small molecules. As a result, several cases of highly efficient (PCE between 6-7.3%) SMA OSCs are achieved. The second part of this presentation will describe the morphology of a new small molecule acceptor with a unique 3D structure. The relationship between molecular structure and morphology is revealed.

Overcoming the “Oxidant Problem”: Strategies to Use O2 as the Oxidant in Organometallic C–H Oxidation Reactions Catalyzed by Pd (and Cu)

PubMed Central

Campbell, Alison N.; Stahl, Shannon S.

2012-01-01

Oxidation reactions are key transformations in organic chemistry because they can increase chemical complexity and incorporate heteroatom substituents into carbon-based molecules. This principle is manifested in the conversion of petrochemical feedstocks into commodity chemicals and in the synthesis of fine chemicals, pharmaceuticals, and other complex organic molecules. The utility and function of such molecules correlate directly with the presence and specific placement of oxygen and nitrogen heteroatoms and other functional groups within the molecules. PMID:22263575

Selection and Biosensor Application of Aptamers for Small Molecules

PubMed Central

Pfeiffer, Franziska; Mayer, Günter

2016-01-01

Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

Nanopores and nucleic acids: prospects for ultrarapid sequencing

NASA Technical Reports Server (NTRS)

Deamer, D. W.; Akeson, M.

2000-01-01

DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

Research Update: Molecular electronics: The single-molecule switch and transistor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sotthewes, Kai; Heimbuch, René, E-mail: r.heimbuch@utwente.nl; Kumar, Avijit

2014-01-01

In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected to macroscopic leads and how the transport properties of the molecule can be measured. Based on this knowledge we have realized two single-molecule devices: a molecular switch and a molecular transistor. The switch can be opened and closed at will by carefully adjusting the separation between the electrical contacts and the voltage dropmore » across the contacts. This single-molecular switch operates in a broad temperature range from cryogenic temperatures all the way up to room temperature. Via mechanical gating, i.e., compressing or stretching of the octanethiol molecule, by varying the contact's interspace, we are able to systematically adjust the conductance of the electrode-octanethiol-electrode junction. This two-terminal single-molecule transistor is very robust, but the amplification factor is rather limited.« less

Ultrasensitive detection and characterization of molecules with infrared plasmonic metamaterials

PubMed Central

Cheng, Fei; Yang, Xiaodong; Gao, Jie

2015-01-01

Infrared vibrational spectroscopy is an effective technique which enables the direct probe of molecular fingerprints, and such detection can be further enhanced by the emerging engineered plasmonic metamaterials. Here we experimentally demonstrate ultrasensitive detection and characterization of polymer molecules based on an asymmetric infrared plasmonic metamaterial, and quantitatively analyze the molecule detection sensitivity and molecule-structure interactions. A sharp, non-radiative Fano resonance supported by the plasmonic metamaterial exhibits strongly enhanced near-field, and the resonance frequency is tailored to match the vibrational fingerprint of the target molecule. By utilizing the near-field nature of the plasmonic excitation, significantly enhanced absorption signal of molecules in the infrared spectroscopy are obtained, enabling ultrasensitive detection of only minute quantities of organic molecules. The enhancement of molecular absorption up to 105 fold is obtained, and sensitive detection of molecules at zeptomole levels (corresponding to a few tens of molecules within a unit cell) is achieved with high signal-to-noise ratio in our experiment. The demonstrated infrared plasmonic metamaterial sensing platform offers great potential for improving the specificity and sensitivity of label-free, biochemical detection. PMID:26388404

Inflammatory bowel disease and patterns of volatile organic compounds in the exhaled breath of children: A case-control study using Ion Molecule Reaction-Mass Spectrometry.

PubMed

Monasta, Lorenzo; Pierobon, Chiara; Princivalle, Andrea; Martelossi, Stefano; Marcuzzi, Annalisa; Pasini, Francesco; Perbellini, Luigi

2017-01-01

Inflammatory bowel diseases (IBD) profoundly affect quality of life and have been gradually increasing in incidence, prevalence and severity in many areas of the world, and in children in particular. Patients with suspected IBD require careful history and clinical examination, while definitive diagnosis relies on endoscopic and histological findings. The aim of the present study was to investigate whether the alveolar air of pediatric patients with IBD presents a specific volatile organic compounds' (VOCs) pattern when compared to controls. Patients 10-17 years of age, were divided into four groups: Crohn's disease (CD), ulcerative colitis (UC), controls with gastrointestinal symptomatology, and surgical controls with no evidence of gastrointestinal problems. Alveolar breath was analyzed by ion molecule reaction mass spectrometry. Four models were built starting from 81 molecules plus the age of subjects as independent variables, adopting a penalizing LASSO logistic regression approach: 1) IBDs vs. controls, finally based on 18 VOCs plus age (sensitivity = 95%, specificity = 69%, AUC = 0.925); 2) CD vs. UC, finally based on 13 VOCs plus age (sensitivity = 94%, specificity = 76%, AUC = 0.934); 3) IBDs vs. gastroenterological controls, finally based on 15 VOCs plus age (sensitivity = 94%, specificity = 65%, AUC = 0.918); 4) IBDs vs. controls, built starting from the 21 directly or indirectly calibrated molecules only, and finally based on 12 VOCs plus age (sensitivity = 94%, specificity = 71%, AUC = 0.888). The molecules identified by the models were carefully studied in relation to the concerned outcomes. This study, with the creation of models based on VOCs profiles, precise instrumentation and advanced statistical methods, can contribute to the development of new non-invasive, fast and relatively inexpensive diagnostic tools, with high sensitivity and specificity. It also represents a crucial step towards gaining further insights on the etiology of IBD through the analysis of specific molecules which are the expression of the particular metabolism that characterizes these patients.

Complex small-molecule architectures regulate phenotypic plasticity in a nematode.

PubMed

Bose, Neelanjan; Ogawa, Akira; von Reuss, Stephan H; Yim, Joshua J; Ragsdale, Erik J; Sommer, Ralf J; Schroeder, Frank C

2012-12-07

Chemistry the worm's way: The nematode Pristionchus pacificus constructs elaborate small molecules from modified building blocks of primary metabolism, including an unusual xylopyranose-based nucleoside (see scheme). These compounds act as signaling molecules to control adult phenotypic plasticity and dauer development and provide examples of modular generation of structural diversity in metazoans. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Field Effect Transistor in Nanoscale

DTIC Science & Technology

2017-04-26

analogues) and BxCyNz (Napathalene analogues with x+y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations...analogues with x +y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations. Interestingly, various types of non-linear...Small molecules (such as benzene), double quantum dots (like GaAs-based QDs) which are coupled weakly to metallic electrodes have shown their

Inhibiting prolyl isomerase activity by hybrid organic-inorganic molecules containing rhodium(II) fragments.

PubMed

Coughlin, Jane M; Kundu, Rituparna; Cooper, Julian C; Ball, Zachary T

2014-11-15

A small molecule containing a rhodium(II) tetracarboxylate fragment is shown to be a potent inhibitor of the prolyl isomerase FKBP12. The use of small molecules conjugates of rhodium(II) is presented as a general strategy for developing new protein inhibitors based on distinct structural and sequence features of the enzyme active site. Copyright © 2014 Elsevier Ltd. All rights reserved.

Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

DTIC Science & Technology

2015-10-01

several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects

A systematic approach to prioritize drug targets using machine learning, a molecular descriptor-based classification model, and high-throughput screening of plant derived molecules: a case study in oral cancer.

PubMed

Randhawa, Vinay; Kumar Singh, Anil; Acharya, Vishal

2015-12-01

Systems-biology inspired identification of drug targets and machine learning-based screening of small molecules which modulate their activity have the potential to revolutionize modern drug discovery by complementing conventional methods. To utilize the effectiveness of such pipelines, we first analyzed the dysregulated gene pairs between control and tumor samples and then implemented an ensemble-based feature selection approach to prioritize targets in oral squamous cell carcinoma (OSCC) for therapeutic exploration. Based on the structural information of known inhibitors of CXCR4-one of the best targets identified in this study-a feature selection was implemented for the identification of optimal structural features (molecular descriptor) based on which a classification model was generated. Furthermore, the CXCR4-centered descriptor-based classification model was finally utilized to screen a repository of plant derived small-molecules to obtain potential inhibitors. The application of our methodology may assist effective selection of the best targets which may have previously been overlooked, that in turn will lead to the development of new oral cancer medications. The small molecules identified in this study can be ideal candidates for trials as potential novel anti-oral cancer agents. Importantly, distinct steps of this whole study may provide reference for the analysis of other complex human diseases.

nextPARS: parallel probing of RNA structures in Illumina

PubMed Central

Saus, Ester; Willis, Jesse R.; Pryszcz, Leszek P.; Hafez, Ahmed; Llorens, Carlos; Himmelbauer, Heinz

2018-01-01

RNA molecules play important roles in virtually every cellular process. These functions are often mediated through the adoption of specific structures that enable RNAs to interact with other molecules. Thus, determining the secondary structures of RNAs is central to understanding their function and evolution. In recent years several sequencing-based approaches have been developed that allow probing structural features of thousands of RNA molecules present in a sample. Here, we describe nextPARS, a novel Illumina-based implementation of in vitro parallel probing of RNA structures. Our approach achieves comparable accuracy to previous implementations, while enabling higher throughput and sample multiplexing. PMID:29358234

Dual band metamaterial perfect absorber based on artificial dielectric "molecules".

PubMed

Liu, Xiaoming; Lan, Chuwen; Li, Bo; Zhao, Qian; Zhou, Ji

2016-07-13

Dual band metamaterial perfect absorbers with two absorption bands are highly desirable because of their potential application areas such as detectors, transceiver system, and spectroscopic imagers. However, most of these dual band metamaterial absorbers proposed were based on resonances of metal patterns. Here, we numerically and experimentally demonstrate a dual band metamaterial perfect absorber composed of artificial dielectric "molecules" with high symmetry. The artificial dielectric "molecule" consists of four "atoms" of two different sizes corresponding to two absorption bands with near unity absorptivity. Numerical and experimental absorptivity verify that the dual-band metamaterial absorber is polarization insensitive and can operate in wide-angle incidence.

Lead bromide-based layered perovskite Langmuir-Blodgett films having π-conjugated molecules as organic layer prepared by using squeezed out technique

NASA Astrophysics Data System (ADS)

Era, Masanao; Shironita, Yu; Soda, Koichi

2018-03-01

Using the squeezed out technique, we successfully prepared PbBr-based layered perovskite Langmuir-Blodgett (LB) films, which have π-conjugated materials as an organic layer (i.e., a phenylenevinylene oligomer, a dithienylethene derivative, and a π-conjugated polyfluorene derivative). The mixed monolayers of π-conjugated materials and octadecylammonium bromide were spread on an aqueous subphase containing saturated PbBr2. During pressing, octadecylammonium molecules were squeezed from the mixed monolayer, and the squeezed ammonium molecules formed the PbBr-based layered perovskite structure at the air-aqueous subphase interface. The monolayers with the PbBr-based layered perovskite structure could be deposited on fused quartz substrates by the LB technique. In addition to the preparation procedure, the structural and optical properties of the layered perovskite LB films and their formation mechanism are reported in this paper.

PhAST: pharmacophore alignment search tool.

PubMed

Hähnke, Volker; Hofmann, Bettina; Grgat, Tomislav; Proschak, Ewgenij; Steinhilber, Dieter; Schneider, Gisbert

2009-04-15

We present a ligand-based virtual screening technique (PhAST) for rapid hit and lead structure searching in large compound databases. Molecules are represented as strings encoding the distribution of pharmacophoric features on the molecular graph. In contrast to other text-based methods using SMILES strings, we introduce a new form of text representation that describes the pharmacophore of molecules. This string representation opens the opportunity for revealing functional similarity between molecules by sequence alignment techniques in analogy to homology searching in protein or nucleic acid sequence databases. We favorably compared PhAST with other current ligand-based virtual screening methods in a retrospective analysis using the BEDROC metric. In a prospective application, PhAST identified two novel inhibitors of 5-lipoxygenase product formation with minimal experimental effort. This outcome demonstrates the applicability of PhAST to drug discovery projects and provides an innovative concept of sequence-based compound screening with substantial scaffold hopping potential. 2008 Wiley Periodicals, Inc.

Interaction between vegetable oil based plasticizer molecules and polyvinyl chloride, and their plasticization effect

NASA Astrophysics Data System (ADS)

Haryono, Agus; Triwulandari, Evi; Jiang, Pingping

2017-01-01

Plasticizer molecules are low molecular weight compounds that are widely used in polymer industries especially in polyvinyl chloride (PVC) resin. As an additive in PVC resin, the important role of plasticizer molecules is to improve the flexibility and processability of PVC by lowering the glass transition temperature (Tg). However, the commercial plasticizer like di(2-ethylhexyl)phthalate (DEHP) is known to cause liver cancer, at least in laboratory rats. DEHP can leach out from PVC into blood, certain drug solutions and fatty foods, which has been detected in the bloodstream of patients undergoing transfusion. Vegetable oil based plasticizers have some attractive properties such as non-toxic, bio-degradable, good heat and light stability, renewable resources, and environmentally friendly. Here we discussed the main results and development of vegetable oil based plasticizer, and especially palm oil based plasticizer. The interaction between plasticizer and polymer was discussed from the properties of the plasticized polymeric material.

Using quantum dynamics simulations to follow the competition between charge migration and charge transfer in polyatomic molecules

NASA Astrophysics Data System (ADS)

Spinlove, K. E.; Vacher, M.; Bearpark, M.; Robb, M. A.; Worth, G. A.

2017-01-01

Recent work, particularly by Cederbaum and co-workers, has identified the phenomenon of charge migration, whereby charge flow occurs over a static molecular framework after the creation of an electronic wavepacket. In a real molecule, this charge migration competes with charge transfer, whereby the nuclear motion also results in the re-distribution of charge. To study this competition, quantum dynamics simulations need to be performed. To break the exponential scaling of standard grid-based algorithms, approximate methods need to be developed that are efficient yet able to follow the coupled electronic-nuclear motion of these systems. Using a simple model Hamiltonian based on the ionisation of the allene molecule, the performance of different methods based on Gaussian Wavepackets is demonstrated.

Biological hydrogels as selective diffusion barriers.

PubMed

Lieleg, Oliver; Ribbeck, Katharina

2011-09-01

The controlled exchange of molecules between organelles, cells, or organisms and their environment is crucial for life. Biological gels such as mucus, the extracellular matrix (ECM), and the biopolymer barrier within the nuclear pore are well suited to achieve such a selective exchange, allowing passage of particular molecules while rejecting many others. Although hydrogel-based filters are integral parts of biology, clear concepts of how their barrier function is controlled at a microscopic level are still missing. We summarize here our current understanding of how selective filtering is established by different biopolymer-based hydrogels. We ask if the modulation of microscopic particle transport in biological hydrogels is based on a generic filtering principle which employs biochemical/biophysical interactions with the filtered molecules rather than size-exclusion effects. Copyright © 2011 Elsevier Ltd. All rights reserved.

FlavorDB: a database of flavor molecules

PubMed Central

Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; NK, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi

2018-01-01

Abstract Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. PMID:29059383

Combining single-molecule manipulation and single-molecule detection.

PubMed

Cordova, Juan Carlos; Das, Dibyendu Kumar; Manning, Harris W; Lang, Matthew J

2014-10-01

Single molecule force manipulation combined with fluorescence techniques offers much promise in revealing mechanistic details of biomolecular machinery. Here, we review force-fluorescence microscopy, which combines the best features of manipulation and detection techniques. Three of the mainstay manipulation methods (optical traps, magnetic traps and atomic force microscopy) are discussed with respect to milestones in combination developments, in addition to highlight recent contributions to the field. An overview of additional strategies is discussed, including fluorescence based force sensors for force measurement in vivo. Armed with recent exciting demonstrations of this technology, the field of combined single-molecule manipulation and single-molecule detection is poised to provide unprecedented views of molecular machinery. Copyright © 2014 Elsevier Ltd. All rights reserved.

Theory of Transport of Long Polymer Molecules through Carbon Nanotube Channels

NASA Technical Reports Server (NTRS)

Wei, Chenyu; Srivastava, Deepak

2003-01-01

A theory of transport of long chain polymer molecules through carbon nanotube (CNT) channels is developed using Fokker-Planck equation and direct molecular dynamics (MD) simulations. The mean transport or translocation time tau is found to depend on the chemical potential energy, entropy and diffusion coefficient. A power law dependence tau approx. N(sup 2)is found where N is number of monomers in a molecule. For 10(exp 5)-unit long polyethylene molecules, tau is estimated to be approx. 1micro-s. The diffusion coefficient of long polymer molecules inside CNTs, like that of short ones, are found to be few orders of magnitude larger than in ordinary silicate based zeolite systems.

Rapid identification of Keap1-Nrf2 small-molecule inhibitors through structure-based virtual screening and hit-based substructure search.

PubMed

Zhuang, Chunlin; Narayanapillai, Sreekanth; Zhang, Wannian; Sham, Yuk Yin; Xing, Chengguo

2014-02-13

In this study, rapid structure-based virtual screening and hit-based substructure search were utilized to identify small molecules that disrupt the interaction of Keap1-Nrf2. Special emphasis was placed toward maximizing the exploration of chemical diversity of the initial hits while economically establishing informative structure-activity relationship (SAR) of novel scaffolds. Our most potent noncovalent inhibitor exhibits three times improved cellular activation in Nrf2 activation than the most active noncovalent Keap1 inhibitor known to date.

What is the minimum number of water molecules required to dissolve a potassium chloride molecule?

PubMed

Sen, Anik; Ganguly, Bishwajit

2010-12-01

This work answers an unsolved question that consists of determining the least number of water molecules necessary to separate a potassium chloride molecule. The answer based on accurate quantum chemical calculations suggests that tetramers are the smallest clusters necessary to dissociate KCl molecules. The study was made with Møller-Plesset second-order perturbation theory modified with the cluster theory having single, double, and perturbative triple excitations. With this extensive study, the dissociation of KCl molecule in different water clusters was evaluated. The calculated results show that four water molecules stabilize a solvent separated K(+)/Cl(-) ion-pair in prismatic structure and with six water molecules further dissociation was observed. Attenuated total reflection infrared spectroscopy of KCl dissolved in water establishes that clusters are made of closely bound ions with a mean of five water molecules per ion-pair [K(+)(H(2)O)(5)Cl(-)]. (Max and Chapados, Appl Spectrosc 1999, 53, 1601; Max and Chapados, J Chem Phys 2001, 115, 2664.) The calculated results tend to support that five water molecules leads toward the formation of contact ion-pair. The structures, energies, and infrared spectra of KCl molecules in different water clusters are also discussed. © 2010 Wiley Periodicals, Inc.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

A molecular-field-based similarity study of non-nucleoside HIV-1 reverse transcriptase inhibitors

NASA Astrophysics Data System (ADS)

Mestres, Jordi; Rohrer, Douglas C.; Maggiora, Gerald M.

1999-01-01

This article describes a molecular-field-based similarity method for aligning molecules by matching their steric and electrostatic fields and an application of the method to the alignment of three structurally diverse non-nucleoside HIV-1 reverse transcriptase inhibitors. A brief description of the method, as implemented in the program MIMIC, is presented, including a discussion of pairwise and multi-molecule similarity-based matching. The application provides an example that illustrates how relative binding orientations of molecules can be determined in the absence of detailed structural information on their target protein. In the particular system studied here, availability of the X-ray crystal structures of the respective ligand-protein complexes provides a means for constructing an 'experimental model' of the relative binding orientations of the three inhibitors. The experimental model is derived by using MIMIC to align the steric fields of the three protein P66 subunit main chains, producing an overlay with a 1.41 Å average rms distance between the corresponding Cα's in the three chains. The inter-chain residue similarities for the backbone structures show that the main-chain conformations are conserved in the region of the inhibitor-binding site, with the major deviations located primarily in the 'finger' and RNase H regions. The resulting inhibitor structure overlay provides an experimental-based model that can be used to evaluate the quality of the direct a priori inhibitor alignment obtained using MIMIC. It is found that the 'best' pairwise alignments do not always correspond to the experimental model alignments. Therefore, simply combining the best pairwise alignments will not necessarily produce the optimal multi-molecule alignment. However, the best simultaneous three-molecule alignment was found to reproduce the experimental inhibitor alignment model. A pairwise consistency index has been derived which gauges the quality of combining the pairwise alignments and aids in efficiently forming the optimal multi-molecule alignment analysis. Two post-alignment procedures are described that provide information on feature-based and field-based pharmacophoric patterns. The former corresponds to traditional pharmacophore models and is derived from the contribution of individual atoms to the total similarity. The latter is based on molecular regions rather than atoms and is constructed by computing the percent contribution to the similarity of individual points in a regular lattice surrounding the molecules, which when contoured and colored visually depict regions of highly conserved similarity. A discussion of how the information provided by each of the procedures is useful in drug design is also presented.

Micro-hole array fluorescent sensor based on AC-Dielectrophoresis (DEP) for simultaneous analysis of nano-molecules

NASA Astrophysics Data System (ADS)

Kim, Hye Jin; Kang, Dong-Hoon; Lee, Eunji; Hwang, Kyo Seon; Shin, Hyun-Joon; Kim, Jinsik

2018-02-01

We propose a simple fluorescent bio-chip based on two types of alternative current-dielectrophoretic (AC-DEP) force, attractive (positive DEP) and repulsive (negative DEP) force, for simultaneous nano-molecules analysis. Various radius of micro-holes on the bio-chip are designed to apply the different AC-DEP forces, and the nano-molecules are concentrated inside the micro-hole arrays according to the intensity of the DEP force. The bio-chip was fabricated by Micro Electro Mechanical system (MEMS) technique, and was composed of two layers; a SiO2 layer and Ta/Pt layer were accomplished for an insulation layer and a top electrode with micro-hole arrays to apply electric fields for DEP force, respectively. Each SiO2 and Ta/Pt layers were deposited by thermal oxidation and sputtering, and micro-hole arrays were fabricated with Inductively Coupled Plasma (ICP) etching process. For generation of each positive and negative DEP at micro-holes, we applied two types of sine-wave AC voltage with different frequency range alternately. The intensity of the DEP force was controlled by the radius of the micro-hole and size of nano-molecule, and calculated with COMSOL multi-physics. Three types of nano-molecules labelled with different fluorescent dye were used and the intensity of nano-molecules was examined by the fluorescent optical analysis after applying the DEP force. By analyzing the fluorescent intensities of the nano-molecules, we verify the various nano-molecules in analyte are located successfully inside corresponding micro-holes with different radius according to their size.

Single Molecule Sensing by Nanopores and Nanopore Devices

PubMed Central

Gu, Li-Qun; Shim, Ji Wook

2010-01-01

Molecular-scale pore structures, called nanopores, can be assembled by protein ion channels through genetic engineering or be artificially fabricated on solid substrates using fashion nanotechnology. When target molecules interact with the functionalized lumen of a nanopore, they characteristically block the ion pathway. The resulting conductance changes allow for identification of single molecules and quantification of target species in the mixture. In this review, we first overview nanopore-based sensory techniques that have been created for the detection of myriad biomedical targets, from metal ions, drug compounds, and cellular second messengers to proteins and DNA. Then we introduce our recent discoveries in nanopore single molecule detection: (1) using the protein nanopore to study folding/unfolding of the G-quadruplex aptamer; (2) creating a portable and durable biochip that is integrated with a single-protein pore sensor (this chip is compared with recently developed protein pore sensors based on stabilized bilayers on glass nanopore membranes and droplet interface bilayer); and (3) creating a glass nanopore-terminated probe for single-molecule DNA detection, chiral enantiomer discrimination, and identification of the bioterrorist agent ricin with an aptamer-encoded nanopore. PMID:20174694

Imaging the distribution of individual platinum-based anticancer drug molecules attached to single-wall carbon nanotubes

PubMed Central

Bhirde, Ashwin A; Sousa, Alioscka A; Patel, Vyomesh; Azari, Afrouz A; Gutkind, J Silvio; Leapman, Richard D; Rusling, James F

2009-01-01

Aims To image the distribution of drug molecules attached to single-wall carbon nanotubes (SWNTs). Materials & methods Herein we report the use of scanning transmission electron microscopy (STEM) for atomic scale visualization and quantitation of single platinum-based drug molecules attached to SWNTs designed for targeted drug delivery. Fourier transform infrared spectroscopy and energy-dispersive x-ray spectroscopy were used for characterization of the SWNT drug conjugates. Results Z-contrast STEM imaging enabled visualization of the first-line anticancer drug cisplatin on the nanotubes at single molecule level. The identity and presence of cisplatin on the nanotubes was confirmed using energy-dispersive x-ray spectroscopy and Fourier transform infrared spectroscopy. STEM tomography was also used to provide additional insights concerning the nanotube conjugates. Finally, our observations provide a rationale for exploring the use of SWNT bioconjugates to selectively target and kill squamous cancer cells. Conclusion Z-contrast STEM imaging provides a means for direct visualization of heavy metal containing molecules (i.e., cisplatin) attached to surfaces of carbon SWNTs along with distribution and quantitation. PMID:19839812

Computational screening of organic materials towards improved photovoltaic properties

NASA Astrophysics Data System (ADS)

Dai, Shuo; Olivares-Amaya, Roberto; Amador-Bedolla, Carlos; Aspuru-Guzik, Alan; Borunda, Mario

2015-03-01

The world today faces an energy crisis that is an obstruction to the development of the human civilization. One of the most promising solutions is solar energy harvested by economical solar cells. Being the third generation of solar cell materials, organic photovoltaic (OPV) materials is now under active development from both theoretical and experimental points of view. In this study, we constructed a parameter to select the desired molecules based on their optical spectra performance. We applied it to investigate a large collection of potential OPV materials, which were from the CEPDB database set up by the Harvard Clean Energy Project. Time dependent density functional theory (TD-DFT) modeling was used to calculate the absorption spectra of the molecules. Then based on the parameter, we screened out the top performing molecules for their potential OPV usage and suggested experimental efforts toward their synthesis. In addition, from those molecules, we summarized the functional groups that provided molecules certain spectrum capability. It is hoped that useful information could be mined out to provide hints to molecular design of OPV materials.

Organic Photovoltaic Devices Based on Oriented n-Type Molecular Films Deposited on Oriented Polythiophene Films.

PubMed

Mizokuro, Toshiko; Tanigaki, Nobutaka; Miyadera, Tetsuhiko; Shibata, Yousei; Koganezawa, Tomoyuki

2018-04-01

The molecular orientation of π-conjugated molecules has been reported to significantly affect the performance of organic photovoltaic devices (OPVs) based on molecular films. Hence, the control of molecular orientation is a key issue toward the improvement of OPV performance. In this research, oriented thin films of an n-type molecule, 3,4,9,10-Perylenetetracarboxylic Bisbenzimida-zole (PTCBI), were formed by deposition on in-plane oriented polythiophene (PT) films. Orientation of the PTCBI films was evaluated by polarized UV-vis spectroscopy and 2D-Grazing incidence X-ray diffraction. Results indicated that PTCBI molecules on PT film exhibit nearly edge-on and in-plane orientation (with molecular long axis along the substrate), whereas PTCBI molecules without PT film exhibit neither. OPVs composed of PTCBI molecular film with and without PT were fabricated and evaluated for correlation of orientation with performance. The OPVs composed of PTCBI film with PT showed higher power conversion efficiency (PCE) than that of film without PT. The experiment indicated that in-plane orientation of PTCBI molecules absorbs incident light more efficiently, leading to increase in PCE.

Drug transport across the blood–brain barrier

PubMed Central

Pardridge, William M

2012-01-01

The blood–brain barrier (BBB) prevents the brain uptake of most pharmaceuticals. This property arises from the epithelial-like tight junctions within the brain capillary endothelium. The BBB is anatomically and functionally distinct from the blood–cerebrospinal fluid barrier at the choroid plexus. Certain small molecule drugs may cross the BBB via lipid-mediated free diffusion, providing the drug has a molecular weight <400 Da and forms <8 hydrogen bonds. These chemical properties are lacking in the majority of small molecule drugs, and all large molecule drugs. Nevertheless, drugs can be reengineered for BBB transport, based on the knowledge of the endogenous transport systems within the BBB. Small molecule drugs can be synthesized that access carrier-mediated transport (CMT) systems within the BBB. Large molecule drugs can be reengineered with molecular Trojan horse delivery systems to access receptor-mediated transport (RMT) systems within the BBB. Peptide and antisense radiopharmaceuticals are made brain-penetrating with the combined use of RMT-based delivery systems and avidin–biotin technology. Knowledge on the endogenous CMT and RMT systems expressed at the BBB enable new solutions to the problem of BBB drug transport. PMID:22929442

Ligand solvation in molecular docking.

PubMed

Shoichet, B K; Leach, A R; Kuntz, I D

1999-01-01

Solvation plays an important role in ligand-protein association and has a strong impact on comparisons of binding energies for dissimilar molecules. When databases of such molecules are screened for complementarity to receptors of known structure, as often occurs in structure-based inhibitor discovery, failure to consider ligand solvation often leads to putative ligands that are too highly charged or too large. To correct for the different charge states and sizes of the ligands, we calculated electrostatic and non-polar solvation free energies for molecules in a widely used molecular database, the Available Chemicals Directory (ACD). A modified Born equation treatment was used to calculate the electrostatic component of ligand solvation. The non-polar component of ligand solvation was calculated based on the surface area of the ligand and parameters derived from the hydration energies of apolar ligands. These solvation energies were subtracted from the ligand-receptor interaction energies. We tested the usefulness of these corrections by screening the ACD for molecules that complemented three proteins of known structure, using a molecular docking program. Correcting for ligand solvation improved the rankings of known ligands and discriminated against molecules with inappropriate charge states and sizes.

Infrared spectroscopy of molecular submonolayers on surfaces by infrared scanning tunneling microscopy: tetramantane on Au111.

PubMed

Pechenezhskiy, Ivan V; Hong, Xiaoping; Nguyen, Giang D; Dahl, Jeremy E P; Carlson, Robert M K; Wang, Feng; Crommie, Michael F

2013-09-20

We have developed a new scanning-tunneling-microscopy-based spectroscopy technique to characterize infrared (IR) absorption of submonolayers of molecules on conducting crystals. The technique employs a scanning tunneling microscope as a precise detector to measure the expansion of a molecule-decorated crystal that is irradiated by IR light from a tunable laser source. Using this technique, we obtain the IR absorption spectra of [121]tetramantane and [123]tetramantane on Au(111). Significant differences between the IR spectra for these two isomers show the power of this new technique to differentiate chemical structures even when single-molecule-resolved scanning tunneling microscopy (STM) images look quite similar. Furthermore, the new technique was found to yield significantly better spectral resolution than STM-based inelastic electron tunneling spectroscopy, and to allow determination of optical absorption cross sections. Compared to IR spectroscopy of bulk tetramantane powders, infrared scanning tunneling microscopy (IRSTM) spectra reveal narrower and blueshifted vibrational peaks for an ordered tetramantane adlayer. Differences between bulk and surface tetramantane vibrational spectra are explained via molecule-molecule interactions.

Manipulating and Visualizing Molecular Interactions in Customized Nanoscale Spaces

NASA Astrophysics Data System (ADS)

Stabile, Francis; Henkin, Gil; Berard, Daniel; Shayegan, Marjan; Leith, Jason; Leslie, Sabrina

We present a dynamically adjustable nanofluidic platform for formatting the conformations of and visualizing the interaction kinetics between biomolecules in solution, offering new time resolution and control of the reaction processes. This platform extends convex lens-induced confinement (CLiC), a technique for imaging molecules under confinement, by introducing a system for in situ modification of the chemical environment; this system uses a deep microchannel to diffusively exchange reagents within the nanoscale imaging region, whose height is fixed by a nanopost array. To illustrate, we visualize and manipulate salt-induced, surfactant-induced, and enzyme-induced reactions between small-molecule reagents and DNA molecules, where the conformations of the DNA molecules are formatted by the imposed nanoscale confinement. By using nanofabricated, nonabsorbing, low-background glass walls to confine biomolecules, our nanofluidic platform facilitates quantitative exploration of physiologically and biotechnologically relevant processes at the nanoscale. This device provides new kinetic information about dynamic chemical processes at the single-molecule level, using advancements in the CLiC design including a microchannel-based diffuser and postarray-based dialysis slit.

Density Functional Theory (DFT) Study of Molecularly Imprinted Polymer (MIP) Methacrylic Acid (MAA) with D-Glucose

NASA Astrophysics Data System (ADS)

Wungu, T. D. K.; Marsha, S. E.; Widayani; Suprijadi

2017-07-01

In order to find an alternative biosensor material which enables to detect the glucose level, therefore in this study, the interaction between Methacrylic Acid (MAA) based Molecularly Imprinted Polymer (MIP) with D-Glucose is investigated using the Density Functional Theory (DFT). The aim of this study is to determine whether a molecule of the MAA can be functioned as a bio-sensing of glucose. In this calculation, the Gaussian 09 with B3LYP and 631+G(d) basis sets is used to calculate all electronic properties. It is found that the interaction between a molecule of MAA and a molecule of D-Glucose was observed through the shortened distance between the two molecules. The binding energy of MAA/D-glucose and the Mulliken population analysis are investigated for checking possible interaction. From analysis, the MAA based MIP can be used as a bio-sensing material.

Wavelength dependence and multiple-induced states in photoresponses of copper phthalocyanine-doped gold nanoparticle single-electron device

NASA Astrophysics Data System (ADS)

Yamamoto, Makoto; Ueda, Rieko; Terui, Toshifumi; Imazu, Keisuke; Tamada, Kaoru; Sakano, Takeshi; Matsuda, Kenji; Ishii, Hisao; Noguchi, Yutaka

2014-01-01

We have proposed a gold nanoparticle (GNP)-based single-electron transistor (SET) doped with a dye molecule, where the molecule works as a photoresponsive floating gate. Here, we examined the source-drain current (I_{\\text{SD}}) at a constant drain voltage under light irradiation with various wavelengths ranging from 400 to 700 nm. Current change was enhanced at the wavelengths of 600 and 700 nm, corresponding to the optical absorption band of the doped molecule (copper phthalocyanine: CuPc). Moreover, several peaks appear in the histograms of I_{\\text{SD}} during light irradiation, indicating that multiple discrete states were induced in the device. The results suggest that the current change was initiated by the light absorption of CuPc and multiple CuPc molecules near the GNP working as a floating gate. Molecular doping can activate advanced device functions in GNP-based SETs.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Spectroscopy of Isolated Prebiotic Nucleobases

NASA Technical Reports Server (NTRS)

Svadlenak, Nathan; Callahan, Michael P.; Ligare, Marshall; Gulian, Lisa; Gengeliczki, Zsolt; Nachtigallova, Dana; Hobza, Pavel; deVries, Mattanjah

2011-01-01

We use multiphoton ionization and double resonance spectroscopy to study the excited state dynamics of biologically relevant molecules as well as prebiotic nucleobases, isolated in the gas phase. Molecules that are biologically relevant to life today tend to exhibit short excited state lifetimes compared to similar but non-biologically relevant analogs. The mechanism is internal conversion, which may help protect the biologically active molecules from UV damage. This process is governed by conical intersections that depend very strongly on molecular structure. Therefore we have studied purines and pyrimidines with systematic variations of structure, including substitutions, tautomeric forms, and cluster structures that represent different base pair binding motifs. These structural variations also include possible alternate base pairs that may shed light on prebiotic chemistry. With this in mind we have begun to probe the ultrafast dynamics of molecules that exhibit very short excited states and search for evidence of internal conversions.

Development of Single-Stranded DNA Aptamers for Specific Bisphenol A Detection

PubMed Central

Jo, Minjoung; Ahn, Ji-Young; Lee, Joohyung; Lee, Seram; Hong, Sun Woo; Yoo, Jae-Wook; Kang, Jeehye; Dua, Pooja

2011-01-01

The development of reagents with high affinity and specificity to small molecules is crucial for the high-throughput detection of chemical compounds, such as toxicants or pollutants. Aptamers are short and single-stranded (ss) oligonucleotides able to recognize target molecules with high affinity. Here, we report the selection of ssDNA aptamers that bind to Bisphenol A (BPA), an environmental hormone. Using SELEX process, we isolated high affinity aptamers to BPA from a 1015 random library of 60 mer ssDNAs. The selected aptamers bound specifically to BPA, but not to structurally similar molecules, such as Bisphenol B with one methyl group difference, or 4,4′-Bisphenol with 2 methyl groups difference. Using these aptamers, we developed an aptamer-based sol–gel biochip and detected BPA dissolved in water. This novel BPA aptamer-based detection can be further applied to the universal and high-specificity detection of small molecules. PMID:21413891

A novel porous framework as variable chemo-sensor: from response of specific carcinogenic alkyl-aromatic to selective detection of explosive nitro-aromatics.

PubMed

Chen, Qihui

2018-06-07

Selective probing one molecule from one class similar molecules is highly challenging due to their similar chemical and physical properties. Here, a novel metal-organic framework FJI-H15 with flexible porous cages has been designed and synthesized, which can specifically recognize ethyl-benzene with ultrahigh enhancement efficiency from series of alkyl-aromatics, in which an unusual size-dependent interaction has been found and proved. While it also can selectively detect phenolic-nitroaromatics among series of nitro-aromatics based on energy transferring and electrostatic interaction. Such unusual specificity and variable mechanisms responding to different type molecules has not been reported, which will provide a new strategy for developing more effective chemo-sensor based on MOFs for probing small structural differences in molecules. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Room temperature stable single molecule rectifiers with graphite electrodes

NASA Astrophysics Data System (ADS)

Rungger, Ivan; Kaliginedi, V.; Droghetti, A.; Ozawa, H.; Kuzume, A.; Haga, M.; Broekmann, P.; Rudnev, A. V.

In this combined theoretical and experimental study we present new molecular electronics device characteristics of unprecedented stability at room temperature by using electrodes based on highly oriented pyrolytic graphite with covalently attached molecules. To this aim, we explore the effect of the anchoring group chemistry on the charge transport properties of graphite/molecule contacts by means of the scanning tunneling microscopy break-junction technique and ab initio simulations. The theoretical approach to evaluate the conductance is based on density functional theory calculations combined with the non-equilibrium Greens function technique, as implemented in the Smeagol electron transport code. We also demonstrate a strong bias dependence and rectification of the single molecule conductance induced by the anchoring chemistry in combination with the very low density of states of graphite around the Fermi energy. We show that the direction of tunneling current rectification can be tuned by anchoring group chemistry.

FRET and BRET-based biosensors in live cell compound screens.

PubMed

Robinson, Katie Herbst; Yang, Jessica R; Zhang, Jin

2014-01-01

Live cell compound screening with genetically encoded fluorescence or bioluminescence-based biosensors offers a potentially powerful approach to identify novel regulators of a signaling event of interest. In particular, compound screening in living cells has the added benefit that the entire signaling network remains intact, and thus the screen is not just against a single molecule of interest but against any molecule within the signaling network that may modulate the distinct signaling event reported by the biosensor in use. Furthermore, only molecules that are cell permeable or act at cell surface receptors will be identified as "hits," thus reducing further optimization of the compound in terms of cell penetration. Here we discuss a detailed protocol for using genetically encoded biosensors in living cells in a 96-well format for the execution of high throughput compound screens and the identification of small molecules which modulate a signaling event of interest.

PDB@: an offline toolkit for exploration and analysis of PDB files.

PubMed

Mani, Udayakumar; Ravisankar, Sadhana; Ramakrishnan, Sai Mukund

2013-12-01

Protein Data Bank (PDB) is a freely accessible archive of the 3-D structural data of biological molecules. Structure based studies offers a unique vantage point in inferring the properties of a protein molecule from structural data. This is too big a task to be done manually. Moreover, there is no single tool, software or server that comprehensively analyses all structure-based properties. The objective of the present work is to develop an offline computational toolkit, PDB@ containing in-built algorithms that help categorizing the structural properties of a protein molecule. The user has the facility to view and edit the PDB file to his need. Some features of the present work are unique in itself and others are an improvement over existing tools. Also, the representation of protein properties in both graphical and textual formats helps in predicting all the necessary details of a protein molecule on a single platform.

Recent Advances in Cyclodextrin-Based Light-Responsive Supramolecular Systems.

PubMed

Zhang, Xiaojin; Ma, Xin; Wang, Kang; Lin, Shijun; Zhu, Shitai; Dai, Yu; Xia, Fan

2018-06-01

Cyclodextrins (CDs), one of the host molecules in supramolecular chemistry, can host guest molecules to form inclusion complexes via non-covalent and reversible host-guest interactions. CD-based light-responsive supramolecular systems are typically constructed using CDs and guest molecules with light-responsive moieties, including azobenzene, arylazopyrazole, o-nitrobenzyl ester, pyrenylmethyl ester, coumarin, and anthracene. To date, numerous efforts have been reported on the topic of CD-based light-responsive supramolecular systems, but these have not yet been highlighted in a separated review. This review summarizes the efforts reported over the past ten years. The main text of this review is divided into five sections (vesicles, micelles, gels, capturers, and nanovalves) according to the formation of self-assemblies. This feature article aims to afford a comprehensive understanding of the light-responsive moieties used in the construction of CD-based light-responsive supramolecular systems and to provide a helpful guide for the further design of CD-based light-responsive supramolecular systems. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SISGR: Room Temperature Single-Molecule Detection and Imaging by Stimulated Emission Microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Xiaoliang Sunney

Single-molecule spectroscopy has made considerable impact on many disciplines including chemistry, physics, and biology. To date, most single-molecule spectroscopy work is accomplished by detecting fluorescence. On the other hand, many naturally occurring chromophores, such as retinal, hemoglobin and cytochromes, do not have detectable fluorescence. There is an emerging need for single-molecule spectroscopy techniques that do not require fluorescence. In the last proposal period, we have successfully demonstrated stimulated emission microscopy, single molecule absorption, and stimulated Raman microscopy based on a high-frequency modulation transfer technique. These first-of-a- kind new spectroscopy/microscopy methods tremendously improved our ability to observe molecules that fluorescence weakly,more » even to the limit of single molecule detection for absorption measurement. All of these methods employ two laser beams: one (pump beam) excites a single molecule to a real or virtual excited state, and the other (probe beam) monitors the absorption/emission property of the single. We extract the intensity change of the probe beam with high sensitivity by implementing a high-frequency phase-sensitive detection scheme, which offers orders of magnitude improvement in detection sensitivity over direct absorption/emission measurement. However, single molecule detection based on fluorescence or absorption is fundamentally limited due to their broad spectral response. It is important to explore other avenues in single molecule detection and imaging which provides higher molecular specificity for studying a wide variety of heterogeneous chemical and biological systems. This proposal aimed to achieve single-molecule detection sensitivity with near resonance stimulated Raman scattering (SRS) microscopy. SRS microscopy was developed in our lab as a powerful technique for imaging heterogeneous samples based on their intrinsic vibrational contrasts, which provides much higher molecular specificity than absorption and fluorescence. Current sensitivity limit of SRS microscopy has not yet reached single molecule detection. We proposed to capitalize on our state-of-the-art SRS microscopy and develop near-resonance enhanced SRS for single molecule detection of carotenoids and heme proteins. The specific aims we pursued are: (1) building the next SRS generation microscope that utilizes near resonance enhancement to allow detection and imaging of single molecules with undetectable fluorescence, such as -carotene. (2) using near-resonance SRS as a contrast mechanism to study dye-sensitize semiconductor interface, elucidating the heterogeneous electron ejection kinetics with high spatial and temporal resolution. (3) studying the binding and unbinding of oxygen in single hemoglobin molecules in order to gain molecular level understanding of the long-standing issue of cooperativity. The new methods developed in the fund period of this grant have advanced the detection sensitivity in many aspects. Near-resonance SRS improved the signal by using shorter wavelengths for SRS microscopy. Frequency modulation and multi-color SRS target the reduction of background to improve the chemical specificity of SRS while maintaining the high imaging speed. Time-domain coherent Raman scattering microscopy targets to reduce the noise floor of coherent Raman microscopy. These methods have already demonstrated first-of-a-kind new applications in biology and medical research. However, we are still one order of magnitude away from single molecule limit. It is important to continue to improve the laser specification and develop new imaging methods to finally achieve label-free single molecule microscopy.« less

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Nanogap Electrodes towards Solid State Single-Molecule Transistors.

PubMed

Cui, Ajuan; Dong, Huanli; Hu, Wenping

2015-12-01

With the establishment of complementary metal-oxide-semiconductor (CMOS)-based integrated circuit technology, it has become more difficult to follow Moore's law to further downscale the size of electronic components. Devices based on various nanostructures were constructed to continue the trend in the minimization of electronics, and molecular devices are among the most promising candidates. Compared with other candidates, molecular devices show unique superiorities, and intensive studies on molecular devices have been carried out both experimentally and theoretically at the present time. Compared to two-terminal molecular devices, three-terminal devices, namely single-molecule transistors, show unique advantages both in fundamental research and application and are considered to be an essential part of integrated circuits based on molecular devices. However, it is very difficult to construct them using the traditional microfabrication techniques directly, thus new fabrication strategies are developed. This review aims to provide an exclusive way of manufacturing solid state gated nanogap electrodes, the foundation of constructing transistors of single or a few molecules. Such single-molecule transistors have the potential to be used to build integrated circuits. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tetrakis(1-imidazolyl) borate (BIM4) based zwitterionic and related molecules used as electron injection layers

DOEpatents

Li, Huaping; Xu, Yunhua; Bazan, Guillermo C

2013-02-05

Tetrakis(1-imidazolyl)borate (BIm4) based zwitterionic and/or related molecules for the fabrication of PLEDs is provided. Device performances with these materials approaches that of devices with Ba/Al cathodes for which the cathode contact is ohmic. Methods of producing such materials, and electron injection layers and devices containing these materials are also provided.

Exploration of sensing of nitrogen dioxide and ozone molecules using novel TiO2/Stanene heterostructures employing DFT calculations

NASA Astrophysics Data System (ADS)

Abbasi, Amirali; Sardroodi, Jaber Jahanbin

2018-06-01

Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.

Combinatorics of feedback in cellular uptake and metabolism of small molecules.

PubMed

Krishna, Sandeep; Semsey, Szabolcs; Sneppen, Kim

2007-12-26

We analyze the connection between structure and function for regulatory motifs associated with cellular uptake and usage of small molecules. Based on the boolean logic of the feedback we suggest four classes: the socialist, consumer, fashion, and collector motifs. We find that the socialist motif is good for homeostasis of a useful but potentially poisonous molecule, whereas the consumer motif is optimal for nutrition molecules. Accordingly, examples of these motifs are found in, respectively, the iron homeostasis system in various organisms and in the uptake of sugar molecules in bacteria. The remaining two motifs have no obvious analogs in small molecule regulation, but we illustrate their behavior using analogies to fashion and obesity. These extreme motifs could inspire construction of synthetic systems that exhibit bistable, history-dependent states, and homeostasis of flux (rather than concentration).

Quenching methods for background reduction in luminescence-based probe-target binding assays

DOEpatents

Cai, Hong [Los Alamos, NM; Goodwin, Peter M [Los Alamos, NM; Keller, Richard A [Los Alamos, NM; Nolan, Rhiannon L [Santa Fe, NM

2007-04-10

Background luminescence is reduced from a solution containing unbound luminescent probes, each having a first molecule that attaches to a target molecule and having an attached luminescent moiety, and luminescent probe/target adducts. Quenching capture reagent molecules are formed that are capable of forming an adduct with the unbound luminescent probes and having an attached quencher material effective to quench luminescence of the luminescent moiety. The quencher material of the capture reagent molecules is added to a solution of the luminescent probe/target adducts and binds in a proximity to the luminescent moiety of the unbound luminescent probes to quench luminescence from the luminescent moiety when the luminescent moiety is exposed to exciting illumination. The quencher capture reagent does not bind to probe molecules that are bound to target molecules and the probe/target adduct emission is not quenched.

A web site for calculating the degree of chirality.

PubMed

Zayit, Amir; Pinsky, Mark; Elgavi, Hadassah; Dryzun, Chaim; Avnir, David

2011-01-01

The web site, http://www.csm.huji.ac.il/, uses the Continuous Chirality Measure to evaluate quantitatively the degree of chirality of a molecule, a structure, a fragment. The value of this measure ranges from zero, the molecule is achiral, to higher values (the upper limit is 100); the higher the chirality value, the more chiral the molecule is. The measure is based on the distance between the chiral molecule and the nearest structure that is achiral. Questions such as the following can be addressed: by how much is one molecule more chiral than the other? how does chirality change along conformational motions? is there a correlation between chirality and enantioselectivity in a series of molecules? Both elementary and advanced features are offered. Related calculation options are the symmetry measures and shape measures. Copyright © 2009 Wiley-Liss, Inc.

Challenges and Opportunities for Small-Molecule Fluorescent Probes in Redox Biology Applications.

PubMed

Jiang, Xiqian; Wang, Lingfei; Carroll, Shaina L; Chen, Jianwei; Wang, Meng C; Wang, Jin

2018-02-16

The concentrations of reactive oxygen/nitrogen species (ROS/RNS) are critical to various biochemical processes. Small-molecule fluorescent probes have been widely used to detect and/or quantify ROS/RNS in many redox biology studies and serve as an important complementary to protein-based sensors with unique applications. Recent Advances: New sensing reactions have emerged in probe development, allowing more selective and quantitative detection of ROS/RNS, especially in live cells. Improvements have been made in sensing reactions, fluorophores, and bioavailability of probe molecules. In this review, we will not only summarize redox-related small-molecule fluorescent probes but also lay out the challenges of designing probes to help redox biologists independently evaluate the quality of reported small-molecule fluorescent probes, especially in the chemistry literature. We specifically highlight the advantages of reversibility in sensing reactions and its applications in ratiometric probe design for quantitative measurements in living cells. In addition, we compare the advantages and disadvantages of small-molecule probes and protein-based probes. The low physiological relevant concentrations of most ROS/RNS call for new sensing reactions with better selectivity, kinetics, and reversibility; fluorophores with high quantum yield, wide wavelength coverage, and Stokes shifts; and structural design with good aqueous solubility, membrane permeability, low protein interference, and organelle specificity. Antioxid. Redox Signal. 00, 000-000.

The beauty of chemistry in the words of writers and in the hands of scientists.

PubMed

Venturi, Margherita; Marchi, Enrico; Balzani, Vincenzo

2012-01-01

Chemistry is a central science because all the processes that sustain life are based on chemical reactions, and all things that we use in everyday life are natural or artificial chemical compounds. Chemistry is also a fantastic world populated by an unbelievable number of nanometric objects called molecules, the smallest entities that have distinct shapes, sizes, and properties. Molecules are the words of matter. Indeed, most of the other sciences have been permeated by the concepts of chemistry and the language of molecules. Like words, molecules contain specific pieces of information that are revealed when they interact with one another or when they are stimulated by photons or electrons. In the hands of chemists, molecules, particularly when they are suitably combined or assembled to create supramolecular systems, can play a variety of functions, even more complex and more clever than those invented by nature. The wonderful world of chemistry has inspired scientists not only to prepare new molecules or investigate new chemical processes, but also to create masterpieces. Some nice stories based on chemical concepts (1) show that there cannot be borders on the Earth, (2) underline that there is a tight connection among all forms of matter, and (3) emphasize the irreplaceable role of sunlight.

Simulation-based cheminformatic analysis of organelle-targeted molecules: lysosomotropic monobasic amines

PubMed Central

Zhang, Xinyuan; Zheng, Nan

2008-01-01

Cell-based molecular transport simulations are being developed to facilitate exploratory cheminformatic analysis of virtual libraries of small drug-like molecules. For this purpose, mathematical models of single cells are built from equations capturing the transport of small molecules across membranes. In turn, physicochemical properties of small molecules can be used as input to simulate intracellular drug distribution, through time. Here, with mathematical equations and biological parameters adjusted so as to mimic a leukocyte in the blood, simulations were performed to analyze steady state, relative accumulation of small molecules in lysosomes, mitochondria, and cytosol of this target cell, in the presence of a homogenous extracellular drug concentration. Similarly, with equations and parameters set to mimic an intestinal epithelial cell, simulations were also performed to analyze steady state, relative distribution and transcellular permeability in this non-target cell, in the presence of an apical-to-basolateral concentration gradient. With a test set of ninety-nine monobasic amines gathered from the scientific literature, simulation results helped analyze relationships between the chemical diversity of these molecules and their intracellular distributions. Electronic supplementary material The online version of this article (doi:10.1007/s10822-008-9194-7) contains supplementary material, which is available to authorized users. PMID:18338229

Adsorption-induced symmetry reduction of metal-phthalocyanines studied by vibrational spectroscopy

NASA Astrophysics Data System (ADS)

Sforzini, J.; Bocquet, F. C.; Tautz, F. S.

2017-10-01

We investigate the vibrational properties of Pt- and Pd-phthalocyanine (PtPc and PdPc) molecules on Ag(111) with high-resolution electron energy loss spectroscopy (HREELS). In the monolayer regime, both molecules exhibit long-range order. The vibrational spectra prove a flat adsorption geometry. The redshift of specific vibrational modes suggests a moderate interaction of the molecules with the substrate. The presence of asymmetric vibrational peaks indicates an interfacial dynamical charge transfer (IDCT). The molecular orbital that is involved in IDCT is the former Eg lowest unoccupied molecular orbital (LUMO) of the molecules that becomes partially occupied upon adsorption. A group-theoretical analysis of the IDCT modes, based on calculated vibrational frequencies and line shape fits, provides proof for the reduction of the symmetry of the molecule-substrate complex from fourfold D4 h to C2 v(σv) , Cs(σv) , or C2 and the ensuing lifting of the degeneracy of the former LUMO of the molecule. The vibration-based analysis of orbital degeneracies, as carried out here for PtPc/Ag(111) and PdPc/Ag(111), is particularly useful whenever the presence of multiple molecular in-plane orientations at the interface makes the analysis of orbital degeneracies with angle-resolved photoemission spectroscopy difficult.

Docking ligands into flexible and solvated macromolecules. 7. Impact of protein flexibility and water molecules on docking-based virtual screening accuracy.

PubMed

Therrien, Eric; Weill, Nathanael; Tomberg, Anna; Corbeil, Christopher R; Lee, Devin; Moitessier, Nicolas

2014-11-24

The use of predictive computational methods in the drug discovery process is in a state of continual growth. Over the last two decades, an increasingly large number of docking tools have been developed to identify hits or optimize lead molecules through in-silico screening of chemical libraries to proteins. In recent years, the focus has been on implementing protein flexibility and water molecules. Our efforts led to the development of Fitted first reported in 2007 and further developed since then. In this study, we wished to evaluate the impact of protein flexibility and occurrence of water molecules on the accuracy of the Fitted docking program to discriminate active compounds from inactive compounds in virtual screening (VS) campaigns. For this purpose, a total of 171 proteins cocrystallized with small molecules representing 40 unique enzymes and receptors as well as sets of known ligands and decoys were selected from the Protein Data Bank (PDB) and the Directory of Useful Decoys (DUD), respectively. This study revealed that implementing displaceable crystallographic or computationally placed particle water molecules and protein flexibility can improve the enrichment in active compounds. In addition, an informed decision based on library diversity or research objectives (hit discovery vs lead optimization) on which implementation to use may lead to significant improvements.

Identification of the Phenol Functionality in Deprotonated Monomeric and Dimeric Lignin Degradation Products via Tandem Mass Spectrometry Based on Ion-Molecule Reactions with Diethylmethoxyborane

NASA Astrophysics Data System (ADS)

Zhu, Hanyu; Max, Joann P.; Marcum, Christopher L.; Luo, Hao; Abu-Omar, Mahdi M.; Kenttämaa, Hilkka I.

2016-11-01

Conversion of lignin into smaller molecules provides a promising alternate and sustainable source for the valuable chemicals currently derived from crude oil. Better understanding of the chemical composition of the resulting product mixtures is essential for the optimization of such conversion processes. However, these mixtures are complex and contain isomeric molecules with a wide variety of functionalities, which makes their characterization challenging. Tandem mass spectrometry based on ion-molecule reactions has proven to be a powerful tool in functional group identification and isomer differentiation for previously unknown compounds. This study demonstrates that the identification of the phenol functionality, the most commonly observed functionality in lignin degradation products, can be achieved via ion-molecule reactions between diethylmethoxyborane (DEMB) and the deprotonated analyte in the absence of strongly electron-withdrawing substituents in the ortho- and para-positions. Either a stable DEMB adduct or an adduct that has lost a methanol molecule (DEMB adduct-MeOH) is formed for these ions. Deprotonated phenols with an adjacent phenol or hydroxymethyl functionality or a conjugated carboxylic acid functionality can be identified based on the formation of DEMB adduct-MeOH. Deprotonated compounds not containing the phenol functionality and phenols containing an electron-withdrawing ortho- or para-substituent were found to be unreactive toward diethylmethoxyborane. Hence, certain deprotonated isomeric compounds with phenol and carboxylic acid, aldehyde, carboxylic acid ester, or nitro functionalities can be differentiated via these reactions. The above mass spectrometry method was successfully coupled with high-performance liquid chromatography for the analysis of a complex biomass degradation mixture.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

DFT analysis on the molecular structure, vibrational and electronic spectra of 2-(cyclohexylamino)ethanesulfonic acid

NASA Astrophysics Data System (ADS)

Renuga Devi, T. S.; Sharmi kumar, J.; Ramkumaar, G. R.

2015-02-01

The FTIR and FT-Raman spectra of 2-(cyclohexylamino)ethanesulfonic acid were recorded in the regions 4000-400 cm-1 and 4000-50 cm-1 respectively. The structural and spectroscopic data of the molecule in the ground state were calculated using Hartee-Fock and Density functional method (B3LYP) with the correlation consistent-polarized valence double zeta (cc-pVDZ) basis set and 6-311++G(d,p) basis set. The most stable conformer was optimized and the structural and vibrational parameters were determined based on this. The complete assignments were performed based on the Potential Energy Distribution (PED) of the vibrational modes, calculated using Vibrational Energy Distribution Analysis (VEDA) 4 program. With the observed FTIR and FT-Raman data, a complete vibrational assignment and analysis of the fundamental modes of the compound were carried out. Thermodynamic properties and Atomic charges were calculated using both Hartee-Fock and density functional method using the cc-pVDZ basis set and compared. The calculated HOMO-LUMO energy gap revealed that charge transfer occurs within the molecule. 1H and 13C NMR chemical shifts of the molecule were calculated using Gauge Including Atomic Orbital (GIAO) method and were compared with experimental results. Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using Natural Bond Orbital (NBO) analysis. The first order hyperpolarizability (β) and Molecular Electrostatic Potential (MEP) of the molecule was computed using DFT calculations. The electron density based local reactivity descriptor such as Fukui functions were calculated to explain the chemical reactivity site in the molecule.

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

PubMed

Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

2018-04-18

Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

Structure-based analysis reveals hydration changes induced by arginine hydrochloride.

PubMed

Nakakido, Makoto; Tanaka, Yoshikazu; Mitsuhori, Mariko; Kudou, Motonori; Ejima, Daisuke; Arakawa, Tsutomu; Tsumoto, Kouhei

2008-10-01

Arginine hydrochloride has been used to suppress protein aggregation during refolding and in various other applications. We investigated the structure of hen egg-white lysozyme (HEL) and solvent molecules in arginine hydrochloride solution by X-ray crystallography. Neither the backbone nor side-chain structure of HEL was altered by the presence of arginine hydrochloride. In addition, no stably bound arginine molecules were observed. The number of hydration water molecules, however, changed with the arginine hydrochloride concentration. We suggest that arginine hydrochloride suppresses protein aggregation by altering the hydration structure and the transient binding of arginine molecules that could not be observed.

Development of a microcapillary column for detecting targeted messenger RNA molecules.

PubMed

Ohnishi, Michihiro

2006-03-24

A capillary column in a rapid-flow system has been developed for detecting targeted messenger RNA (mRNA) molecules. The column has a structure made of two beds-one bed of porous microbeads and one bed of microbeads with a polythymidine base sequence. The targeted eukaryotic mRNA molecules are detected by two-step hybridization (sandwich hybridization) composed of polyadenosine selection of mRNA molecules and formation of a probe-target (targeted mRNA) hybrid. The sandwich hybridization, which is accomplished within 1 h, was tested using synthetic polydeoxynucleotides. Ten picomoles of the targeted polydeoxynucleotide were detected.

Axial Colocalization of Single Molecules with Nanometer Accuracy Using Metal-Induced Energy Transfer.

PubMed

Isbaner, Sebastian; Karedla, Narain; Kaminska, Izabela; Ruhlandt, Daja; Raab, Mario; Bohlen, Johann; Chizhik, Alexey; Gregor, Ingo; Tinnefeld, Philip; Enderlein, Jörg; Tsukanov, Roman

2018-04-11

Single-molecule localization based super-resolution microscopy has revolutionized optical microscopy and routinely allows for resolving structural details down to a few nanometers. However, there exists a rather large discrepancy between lateral and axial localization accuracy, the latter typically three to five times worse than the former. Here, we use single-molecule metal-induced energy transfer (smMIET) to localize single molecules along the optical axis, and to measure their axial distance with an accuracy of 5 nm. smMIET relies only on fluorescence lifetime measurements and does not require additional complex optical setups.

From porphyrins to pyrphyrins: adsorption study and metalation of a molecular catalyst on Au(111)

NASA Astrophysics Data System (ADS)

Mette, Gerson; Sutter, Denys; Gurdal, Yeliz; Schnidrig, Stephan; Probst, Benjamin; Iannuzzi, Marcella; Hutter, Jürg; Alberto, Roger; Osterwalder, Jürg

2016-04-01

The molecular ligand pyrphyrin, a tetradentate bipyridine based macrocycle, represents an interesting but widely unexplored class of molecules. It resembles the well-known porphyrin, but consists of pyridyl subunits instead of pyrroles. Metal complexes based on pyrphyrin ligands have recently shown promise as water reduction catalysts in homogeneous photochemical water splitting reactions. In this study, the adsorption and metalation of pyrphyrin on a single crystalline Au(111) surface is investigated in an ultrahigh vacuum by means of scanning tunneling microscopy, low-energy electron diffraction, X-ray photoelectron spectroscopy and density functional theory. Pyrphyrin coverages of approximately one monolayer and less are obtained by sublimation of the molecules on the substrate kept at room temperature. The molecules self-assemble in two distinct phases of long-range molecular ordering depending on the surface coverage. The deposition of cobalt metal and subsequent annealing lead to the formation of Co-ligated pyrphyrin molecules accompanied by a pronounced change of the molecular self-assembly. Electronic structure calculations taking the herringbone reconstruction of Au(111) into account show that the molecules are physisorbed, but preferred adsorption sites are identified where Co and the N atoms of the two terminal cyano groups are optimally coordinated to the surface Au atoms. An intermediate state of the metalation reaction is observed and the reaction steps for the Co metalation of pyrphyrin molecules on Au(111) are established in a joint experimental and computational effort.The molecular ligand pyrphyrin, a tetradentate bipyridine based macrocycle, represents an interesting but widely unexplored class of molecules. It resembles the well-known porphyrin, but consists of pyridyl subunits instead of pyrroles. Metal complexes based on pyrphyrin ligands have recently shown promise as water reduction catalysts in homogeneous photochemical water splitting reactions. In this study, the adsorption and metalation of pyrphyrin on a single crystalline Au(111) surface is investigated in an ultrahigh vacuum by means of scanning tunneling microscopy, low-energy electron diffraction, X-ray photoelectron spectroscopy and density functional theory. Pyrphyrin coverages of approximately one monolayer and less are obtained by sublimation of the molecules on the substrate kept at room temperature. The molecules self-assemble in two distinct phases of long-range molecular ordering depending on the surface coverage. The deposition of cobalt metal and subsequent annealing lead to the formation of Co-ligated pyrphyrin molecules accompanied by a pronounced change of the molecular self-assembly. Electronic structure calculations taking the herringbone reconstruction of Au(111) into account show that the molecules are physisorbed, but preferred adsorption sites are identified where Co and the N atoms of the two terminal cyano groups are optimally coordinated to the surface Au atoms. An intermediate state of the metalation reaction is observed and the reaction steps for the Co metalation of pyrphyrin molecules on Au(111) are established in a joint experimental and computational effort. Electronic supplementary information (ESI) available: More details and results of the XPS experiments and the DFT calculation including also the coordinates of the calculated configurations. See DOI: 10.1039/C5NR08953K

Adsorption of small inorganic molecules on a defective MoS2 monolayer.

PubMed

González, César; Biel, Blanca; Dappe, Yannick J

2017-04-05

We present a theoretical study of molecular adsorption on defects on a MoS 2 monolayer. Based on Density Functional Theory, our calculations confirm that small inorganic molecules, such as CO 2 , CO, H 2 O, NO, NO 2 , H 2 and N 2 , remain bonded to the pristine monolayer through weak van der Waals interactions, suggesting that the molecules may easily diffuse over the clean monolayer. On the other hand, the introduction of defects can lead to three different situations, depending on the defect and the molecule considered: physisorption, chemical (strong) bonding to the metallic defects, namely the Mo substitutional atoms on the S vacancies, and dissociation, that can take place spontaneously at 0 K in some specific cases or by the effect of thermal agitation in molecules such as CO 2 or NO 2 on the S vacancy. Our energetic and electronic analyses provide an explanation to such bonding possibilities, showing that in the low interacting situations, the molecules tend to adopt a planar configuration parallel to the monolayer, while a molecular rotation is favored in order to facilitate the bond formation on the reactive sites. Finally, the ab initio based Scanning Tunneling Microscopy (STM) simulations show the fingerprint of each molecule adsorbed on the most reactive site. This work opens the way to the possibility of tuning the catalytic properties of MoS 2 by controlling the creation of specific defects in the MoS 2 monolayer.

Spatial Distributions of Guest Molecule and Hydration Level in Dendrimer-Based Guest–Host Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chih-Ying; Chen, Hsin-Lung; Do, Changwoo

2016-08-09

Using the electrostatic complex of G4 poly(amidoamine) (PAMAM) dendrimer with an amphiphilic surfactant as a model system, contrast variation small angle neutron scattering (SANS) is implemented to resolve the key structural characteristics of dendrimer-based guest–host system. Quantifications of the radial distributions of the scattering length density and the hydration level within the complex molecule reveal that the surfactant is embedded in the peripheral region of dendrimer and the steric crowding in this region increases the backfolding of the dendritic segments, thereby reducing the hydration level throughout the complex molecule. Here, the insights into the spatial location of the guest moleculesmore » as well as the perturbations of dendrimer conformation and hydration level deduced here are crucial for the delicate design of dendrimer-based guest–host system for biomedical applications.« less

Anisotropic behavior of organic molecules on prepatterned surfaces

NASA Astrophysics Data System (ADS)

Hopp, Stefan Frieder; Heuer, Andreas

2012-04-01

The nucleation of organic molecules on surfaces, prepatterned with stripes, is investigated with emphasis on anisotropy effects. Representing the molecules as ellipsoids, the related particle-particle interaction is modeled by means of a generalized Gay-Berne potential for similar biaxial particles. The orientation behavior of these ellipsoidal molecules induced by the stripe pattern is studied for the first monolayer by performing kinetic Monte Carlo simulations. It is shown how the properties of the particle alignment depend on energy scales, temperature, and flux. Based on the fact the particles strictly arrange in rows, it is furthermore instructive to analyze the orientation behavior within the different rows. Finally, the transfer of orientation from a preset row of molecules with fixed orientation to other nucleating particles is examined.

Adsorption of methanol molecule on graphene: Experimental results and first-principles calculations

NASA Astrophysics Data System (ADS)

Zhao, X. W.; Tian, Y. L.; Yue, W. W.; Chen, M. N.; Hu, G. C.; Ren, J. F.; Yuan, X. B.

2018-04-01

Adsorption properties of methanol molecule on graphene surface are studied both theoretically and experimentally. The adsorption geometrical structures, adsorption energies, band structures, density of states and the effective masses are obtained by means of first-principles calculations. It is found that the electronic characteristics and conductivity of graphene are sensitive to the methanol molecule adsorption. After adsorption of methanol molecule, bandgap appears. With the increasing of the adsorption distance, the bandgap, adsorption energy and effective mass of the adsorption system decreased, hence the resistivity of the system decreases gradually, these results are consistent with the experimental results. All these calculations and experiments indicate that the graphene-based sensors have a wide range of applications in detecting particular molecules.

A-π-D-π-A Electron-Donating Small Molecules for Solution-Processed Organic Solar Cells: A Review.

PubMed

Wang, Zhen; Zhu, Lingyun; Shuai, Zhigang; Wei, Zhixiang

2017-11-01

Organic solar cells based on semiconducting polymers and small molecules have attracted considerable attention in the last two decades. Moreover, the power conversion efficiencies for solution-processed solar cells containing A-π-D-π-A-type small molecules and fullerenes have reached 11%. However, the method for designing high-performance, photovoltaic small molecules still remains unclear. In this review, recent studies on A-π-D-π-A electron-donating small molecules for organic solar cells are introduced. Moreover, the relationships between molecular properties and device performances are summarized, from which inspiration for the future design of high performance organic solar cells may be obtained. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Meeting report: SMART timing--principles of single molecule techniques course at the University of Michigan 2014.

PubMed

Bartke, Rebecca M; Cameron, Elizabeth L; Cristie-David, Ajitha S; Custer, Thomas C; Denies, Maxwell S; Daher, May; Dhakal, Soma; Ghosh, Soumi; Heinicke, Laurie A; Hoff, J Damon; Hou, Qian; Kahlscheuer, Matthew L; Karslake, Joshua; Krieger, Adam G; Li, Jieming; Li, Xiang; Lund, Paul E; Vo, Nguyen N; Park, Jun; Pitchiaya, Sethuramasundaram; Rai, Victoria; Smith, David J; Suddala, Krishna C; Wang, Jiarui; Widom, Julia R; Walter, Nils G

2015-05-01

Four days after the announcement of the 2014 Nobel Prize in Chemistry for "the development of super-resolved fluorescence microscopy" based on single molecule detection, the Single Molecule Analysis in Real-Time (SMART) Center at the University of Michigan hosted a "Principles of Single Molecule Techniques 2014" course. Through a combination of plenary lectures and an Open House at the SMART Center, the course took a snapshot of a technology with an especially broad and rapidly expanding range of applications in the biomedical and materials sciences. Highlighting the continued rapid emergence of technical and scientific advances, the course underscored just how brightly the future of the single molecule field shines. © 2014 Wiley Periodicals, Inc.

Correlation dynamics and enhanced signals for the identification of serial biomolecules and DNA bases.

PubMed

Ahmed, Towfiq; Haraldsen, Jason T; Rehr, John J; Di Ventra, Massimiliano; Schuller, Ivan; Balatsky, Alexander V

2014-03-28

Nanopore-based sequencing has demonstrated a significant potential for the development of fast, accurate, and cost-efficient fingerprinting techniques for next generation molecular detection and sequencing. We propose a specific multilayered graphene-based nanopore device architecture for the recognition of single biomolecules. Molecular detection and analysis can be accomplished through the detection of transverse currents as the molecule or DNA base translocates through the nanopore. To increase the overall signal-to-noise ratio and the accuracy, we implement a new 'multi-point cross-correlation' technique for identification of DNA bases or other molecules on the single molecular level. We demonstrate that the cross-correlations between each nanopore will greatly enhance the transverse current signal for each molecule. We implement first-principles transport calculations for DNA bases surveyed across a multilayered graphene nanopore system to illustrate the advantages of the proposed geometry. A time-series analysis of the cross-correlation functions illustrates the potential of this method for enhancing the signal-to-noise ratio. This work constitutes a significant step forward in facilitating fingerprinting of single biomolecules using solid state technology.

Electrospray deposition of organic molecules on bulk insulator surfaces.

PubMed

Hinaut, Antoine; Pawlak, Rémy; Meyer, Ernst; Glatzel, Thilo

2015-01-01

Large organic molecules are of important interest for organic-based devices such as hybrid photovoltaics or molecular electronics. Knowing their adsorption geometries and electronic structures allows to design and predict macroscopic device properties. Fundamental investigations in ultra-high vacuum (UHV) are thus mandatory to analyze and engineer processes in this prospects. With increasing size, complexity or chemical reactivity, depositing molecules by thermal evaporation becomes challenging. A recent way to deposit molecules in clean conditions is Electrospray Ionization (ESI). ESI keeps the possibility to work with large molecules, to introduce them in vacuum, and to deposit them on a large variety of surfaces. Here, ESI has been successfully applied to deposit triply fused porphyrin molecules on an insulating KBr(001) surface in UHV environment. Different deposition coverages have been obtained and characterization of the surface by in-situ atomic force microscopy working in the non-contact mode shows details of the molecular structures adsorbed on the surface. We show that UHV-ESI, can be performed on insulating surfaces in the sub-monolayer regime and to single molecules which opens the possibility to study a variety of complex molecules.

Using the QCM Biosensor-Based T7 Phage Display Combined with Bioinformatics Analysis for Target Identification of Bioactive Small Molecule.

PubMed

Takakusagi, Yoichi; Takakusagi, Kaori; Sugawara, Fumio; Sakaguchi, Kengo

2018-01-01

Identification of target proteins that directly bind to bioactive small molecule is of great interest in terms of clarifying the mode of action of the small molecule as well as elucidating the biological phenomena at the molecular level. Of the experimental technologies available, T7 phage display allows comprehensive screening of small molecule-recognizing amino acid sequence from the peptide libraries displayed on the T7 phage capsid. Here, we describe the T7 phage display strategy that is combined with quartz-crystal microbalance (QCM) biosensor for affinity selection platform and bioinformatics analysis for small molecule-recognizing short peptides. This method dramatically enhances efficacy and throughput of the screening for small molecule-recognizing amino acid sequences without repeated rounds of selection. Subsequent execution of bioinformatics programs allows combinatorial and comprehensive target protein discovery of small molecules with its binding site, regardless of protein sample insolubility, instability, or inaccessibility of the fixed small molecules to internally located binding site on larger target proteins when conventional proteomics approaches are used.

Medical expert system for assessment of coronary heart disease destabilization based on the analysis of the level of soluble vascular adhesion molecules

NASA Astrophysics Data System (ADS)

Serkova, Valentina K.; Pavlov, Sergey V.; Romanava, Valentina A.; Monastyrskiy, Yuriy I.; Ziepko, Sergey M.; Kuzminova, Nanaliya V.; Wójcik, Waldemar; DzierŻak, RóŻa; Kalizhanova, Aliya; Kashaganova, Gulzhan

2017-08-01

Theoretical and practical substantiation of the possibility of the using the level of soluble vascular adhesion molecules (sVCAM) is performed. Expert system for the assessment of coronary heart disease (CHD) destabilization on the base of the analysis of soluble vascular adhesion molecules level is developed. Correlation between the increase of VCAM level and C-reactive protein (CRP) in patients with different variants of CHD progression is established. Association of chronic nonspecific vascular inflammation activation and CHD destabilization is shown. The expedience of parallel determination of sVCAM and CRP levels for diagnostics of CHD destabilization and forecast elaboration is noted.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

New 3-D coordination polymers based on semi-rigid V-shape tetracarboxylates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jing-Jing; Xu, Wei; Wang, Yan-Ning

Under the hydrothermal conditions, the reactions of transition-metal salts, tetracarboxylic acids and N,N′-donor ligands yielded three new coordination polymers as [Cu{sub 4}(fph){sub 2}(bpe){sub 3}(H{sub 2}O){sub 2}]·2H{sub 2}O (fph=4,4′-(hexafluoroisopropylidene)diphthalate, bpe=1,2-bis(pyridyl)ethylene) 1, [Co{sub 2}(fph)(bpa){sub 2}(H{sub 2}O){sub 2}]·3H{sub 2}O (bpa=1,2-bis(pyridyl)ethylane) 2, and [Ni(H{sub 2}O)(H{sub 2}oph)(bpa)] (oph=4,4′-oxydiphthalate) 3. X-ray single-crystal diffraction analysis revealed that the title three compounds all possess the three-dimensional (3-D) network structures. For compound 1, the fph molecules first link the Cu{sup 2+} ions into a two-dimensional (2-D) wave-like layer with a (4,4) topology. The bpe molecules act as the second linkers, extending the 2-D layers into a 3-D network. Formore » compound 2, the fph molecules still serve as the first connectors, linking the Co{sup 2+} ions into a one-dimensional (1-D) tube-like chain. Then the bpa molecules propagate the chains into a 3-D (4,4,4)-connected network. In the formation of the 3-D network of compound 3, the oph molecule does not play a role. The bpa molecules as well as the water molecules act as a mixed bridge. Only a kind of 4-connected metal node is observed in compound 3. The magnetic properties of compounds 1–3 were investigated and all exhibit the predominant antiferromegnetic magnetic behaviors. - Graphical abstract: Structures of three semi-rigid V-shape tetracarboxylate-based coordination polymers were reported, and their magnetic properties were investigated. - Highlights: • Structures of three tetracarboxylate-based coordination polymers were reported. • Role of organic bases in metal–tetracarboxylate compounds was discussed. • Characters of V-shape and semi-rigidity for tetracarboxylate play a key role in crystal growth. • Their magnetic properties were investigated.« less

Protein mechanics: from single molecules to functional biomaterials.

PubMed

Li, Hongbin; Cao, Yi

2010-10-19

Elastomeric proteins act as the essential functional units in a wide variety of biomechanical machinery and serve as the basic building blocks for biological materials that exhibit superb mechanical properties. These proteins provide the desired elasticity, mechanical strength, resilience, and toughness within these materials. Understanding the mechanical properties of elastomeric protein-based biomaterials is a multiscale problem spanning from the atomistic/molecular level to the macroscopic level. Uncovering the design principles of individual elastomeric building blocks is critical both for the scientific understanding of multiscale mechanics of biomaterials and for the rational engineering of novel biomaterials with desirable mechanical properties. The development of single-molecule force spectroscopy techniques has provided methods for characterizing mechanical properties of elastomeric proteins one molecule at a time. Single-molecule atomic force microscopy (AFM) is uniquely suited to this purpose. Molecular dynamic simulations, protein engineering techniques, and single-molecule AFM study have collectively revealed tremendous insights into the molecular design of single elastomeric proteins, which can guide the design and engineering of elastomeric proteins with tailored mechanical properties. Researchers are focusing experimental efforts toward engineering artificial elastomeric proteins with mechanical properties that mimic or even surpass those of natural elastomeric proteins. In this Account, we summarize our recent experimental efforts to engineer novel artificial elastomeric proteins and develop general and rational methodologies to tune the nanomechanical properties of elastomeric proteins at the single-molecule level. We focus on general design principles used for enhancing the mechanical stability of proteins. These principles include the development of metal-chelation-based general methodology, strategies to control the unfolding hierarchy of multidomain elastomeric proteins, and the design of novel elastomeric proteins that exhibit stimuli-responsive mechanical properties. Moving forward, we are now exploring the use of these artificial elastomeric proteins as building blocks of protein-based biomaterials. Ultimately, we would like to rationally tailor mechanical properties of elastomeric protein-based materials by programming the molecular sequence, and thus nanomechanical properties, of elastomeric proteins at the single-molecule level. This step would help bridge the gap between single protein mechanics and material biomechanics, revealing how the mechanical properties of individual elastomeric proteins are translated into the properties of macroscopic materials.

Adsorption of gas molecules on Cu impurities embedded monolayer MoS2: A first- principles study

NASA Astrophysics Data System (ADS)

Zhao, B.; Li, C. Y.; Liu, L. L.; Zhou, B.; Zhang, Q. K.; Chen, Z. Q.; Tang, Z.

2016-09-01

Adsorption of small gas molecules (O2, NO, NO2 and NH3) on transition-metal Cu atom embedded monolayer MoS2 was investigated by first-principles calculations based on the density-functional theory (DFT). The embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS2 with a high diffusion barrier. The stable adsorption geometry, charge transfer and electronic structures of these gas molecules on monolayer MoS2 embedded with transition-metal Cu atom are discussed in detail. It is found that the monolayer MoS2 with embedded Cu atom can effectively capture these gas molecules with high adsorption energy. The NH3 molecule acts as electron donor after adsorption, which is different from the other gas molecules (O2, NO, and NO2). The results suggest that MoS2-Cu system may be promising for future applications in gas molecules sensing and catalysis, which is similar to those of the transition-metal embedded graphene.

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

PubMed Central

Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

2014-01-01

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields. PMID:25283876

Observation of anisotropic interactions between metastable atoms and target molecules by two-dimensional collisional ionization electron spectroscopy

NASA Astrophysics Data System (ADS)

Kishimoto, Naoki; Ohno, Koichi

Excited metastable atoms colliding with target molecules can sensitively probe outer properties of molecules by chemi-ionization (Penning ionization) from molecular orbitals in the outer region, since metastable atoms cannot penetrate into the repulsive interaction wall around the molecules. By means of two-dimensional measurements using kinetic energy analysis of electrons combined with a velocity-resolved metastable beam, one can obtain information on the anisotropic interaction between the colliding particles without any control of orientation or alignment of target molecules. We have developed a classical trajectory method to calculate the collision energy dependence of partial ionization cross-sections (CEDPICS) on the anisotropic interaction potential energy surface, which has enabled us to study stereodynamics between metastable atoms and target molecules as well as the spatial distribution of molecular orbitals and electron ejection functions which have a relation with entrance and exit channels of the reaction. Based on the individual CEDPICS, the electronic structure of molecules can also be elucidated.

Conductivity Modifications of Graphene by Electron Donative Organic Molecules

NASA Astrophysics Data System (ADS)

Masujima, Hiroaki; Mori, Takehiko; Hayamizu, Yuhei

2017-07-01

Graphene has been studied for the application of transparent electrodes in flexible electrical devices with semiconductor organics. Control of the charge carrier density in graphene is crucial to reduce the contact resistance between graphene and the active layer of organic semiconductor. Chemical doping of graphene is an approach to change the carrier density, where the adsorbed organic molecules donate or accept electrons form graphene. While various acceptor organic molecules have been demonstrated so far, investigation about donor molecules is still poor. In this work, we have investigated doping effect in graphene field-effect transistors functionalized by organic donor molecules such as dibenzotetrathiafulvalene (DBTTF), hexamethyltetrathiafulvalene (HMTTF), 1,5-diaminonaphthalene (DAN), and N, N, N', N'-tetramethyl- p-phenylenediamine (TMPD). Based on conductivity measurements of graphene transistors, the former three molecules do not have any significant effect to graphene transistors. However, TMPD shows effective n-type doping. The doping effect has a correlation with the level of highest occupied molecular orbital (HOMO) of each molecule, where TMPD has the highest HOMO level.

Large low-field magnetoresistance in Fe3O4/molecule nanoparticles at room temperature

NASA Astrophysics Data System (ADS)

Yue, F. J.; Wang, S.; Lin, L.; Zhang, F. M.; Li, C. H.; Zuo, J. L.; Du, Y. W.; Wu, D.

2011-01-01

Acetic acid molecule-coated Fe3O4 nanoparticles, 450-650 nm in size, have been synthesized using a chemical solvothermal reduction method. Fourier transform infrared spectroscopy measurements confirm one monolayer acetic acid molecules chemically bond to the Fe3O4 nanoparticles. The low-field magnetoresistance (LFMR) of more than -10% at room temperature and -23% at 140 K is achieved with saturation field of less than 2 kOe. In comparison, the resistivity of cold-pressed bare Fe3O4 nanoparticles is six orders of magnitudes smaller than that of Fe3O4/molecule nanoparticles, and the LFMR ratio is one order of magnitude smaller. Our results indicate that the large LFMR in Fe3O4/molecule nanoparticles is associated with spin-polarized electrons tunnelling through molecules instead of direct nanoparticle contacts. These results suggest that magnetic oxide-molecule hybrid materials are an alternative type of materials to develop spin-based devices by a simple low-cost approach.

Large magnetoresistance in Fe3O4/molecule nanoparticles

NASA Astrophysics Data System (ADS)

Wang, S.; Yue, F. J.; Lin, L.; Shi, Y. J.; Wu, D.

2010-08-01

In this work, we successfully fabricate Fe3O4 nanoparticles self-assembled with molecules to explore a new approach of studying the molecular spintronics. Fourier transform infrared spectroscopy measurements indicate that one monolayer molecules chemically bonds to the Fe3O4 nanoparticles and the physically absorbed molecules do not exist in the samples. The magnetoresistance (MR) of molecule fully coated ~10 nm size nanoparticles is up to 7.3% at room temperature and 17.5% at 115 K under a field of 5.8 kOe. And the MR ratio is more than two times larger than that of pure Fe3O4 nanoparticles. This enhanced MR is likely arising from weak spin scattering while carriers transport through the molecules. Moreover, a very large low field magnetoresistance is also observed with ~500nm ferromagnetic Fe3O4 nanoparticles coated with acetic acid molecules. Those features open a door for the development of future spin-based molecular electronics.

A general method for controlling and resolving rotational orientation of molecules in molecule-surface collisions

PubMed Central

Godsi, Oded; Corem, Gefen; Alkoby, Yosef; Cantin, Joshua T.; Krems, Roman V.; Somers, Mark F.; Meyer, Jörg; Kroes, Geert-Jan; Maniv, Tsofar; Alexandrowicz, Gil

2017-01-01

The outcome of molecule–surface collisions can be modified by pre-aligning the molecule; however, experiments accomplishing this are rare because of the difficulty of preparing molecules in aligned quantum states. Here we present a general solution to this problem based on magnetic manipulation of the rotational magnetic moment of the incident molecule. We apply the technique to the scattering of H2 from flat and stepped copper surfaces. We demonstrate control of the molecule's initial quantum state, allowing a direct comparison of differences in the stereodynamic scattering from the two surfaces. Our results show that a stepped surface exhibits a much larger dependence of the corrugation of the interaction on the alignment of the molecule than the low-index surface. We also demonstrate an extension of the technique that transforms the set-up into an interferometer, which is sensitive to molecular quantum states both before and after the scattering event. PMID:28480890

FlavorDB: a database of flavor molecules.

PubMed

Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh

2018-01-04

Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Theoretical study of hydrogen storage in a truncated triangular pyramid molecule consisting of pyridine and benzene rings bridged by vinylene groups

NASA Astrophysics Data System (ADS)

Ishikawa, Shigeru; Nemoto, Tetsushi; Yamabe, Tokio

2018-06-01

Hydrogen storage in a truncated triangular pyramid molecule C33H21N3, which consists of three pyridine rings and one benzene ring bridged by six vinylene groups, is studied by quantum chemical methods. The molecule is derived by substituting three benzene rings in a truncated tetrahedron hydrocarbon C36H24 with pyridine rings. The optimized molecular structure under C 3v symmetry shows no imaginary vibrational modes at the B3LYP/cc-pVTZ level of theory. The hydrogen storage process is investigated based on the MP2/cc-pVTZ method. Like the structure before substitution, the C33H21N3 molecule has a cavity that stores a hydrogen molecule with a binding energy of - 140 meV. The Langmuir isotherm shows that this cavity can store hydrogen at higher temperatures and lower pressures than usual physisorption materials. The C33H21N3 molecule has a kinetic advantage over the C36H24 molecule because the former molecule has a lower barrier (+ 560 meV) for the hydrogen molecule entering the cavity compared with the latter molecule (+ 730 meV) owing to the lack of hydrogen atoms narrowing the opening.

Nanoscopic electrode molecular probes

DOEpatents

Krstic, Predrag S [Knoxville, TN; Meunier, Vincent [Knoxville, TN

2012-05-22

The present invention relates to a method and apparatus for enhancing the electron transport property measurements of a molecule when the molecule is placed between chemically functionalized carbon-based nanoscopic electrodes to which a suitable voltage bias is applied. The invention includes selecting a dopant atom for the nanoscopic electrodes, the dopant atoms being chemically similar to atoms present in the molecule, and functionalizing the outer surface and terminations of the electrodes with the dopant atoms.

Gas separation device based on electrical swing adsorption

DOEpatents

Judkins, Roddie R.; Burchell, Timothy D.

1999-10-26

A method and apparatus for separating one constituent, especially carbon dioxide, from a fluid mixture, such as natural gas. The fluid mixture flows through an adsorbent member having an affinity for molecules of the one constituent, the molecules being adsorbed on the adsorbent member. A voltage is applied to the adsorbent member, the voltage imparting a current flow which causes the molecules of the one constituent to be desorbed from the adsorbent member.

Transformational Medical Technologies Initiative (TMTI)

DTIC Science & Technology

2007-01-01

Parker Development of monoclonal antibodies (Mab) protein based therapeutics against viral hemorrhagic fevers (VHF) CUBRC Prosetta, Inc Development of...2,028,389 $178,416 $186,000 $558,804 CUBRC Prosetta, Inc 2 (1 base, 1yr opt) $8,300,922 $4,017,013 $1,070,977 $3,212,932 Small Molecule/Drugs...Green II Genomic Identification USAMRIID - Hart Green Yellow CUBRC Prosetta, Inc Yellow Yellow Small Molecule/Drugs Functional Genetics, Inc Green

The Design of a Molecular Assembly Line Based on Biological Molecules

DTIC Science & Technology

2003-06-01

and will demonstrate how one can construct a purely synthetic analogue of a polyketide synthase . 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF...scaffold in programmed assembly and molecular electronics. It is based on the principles of the biological molecules polyketide synthase and kinesin, and in...stereoselective centers) with any reasonable yield, not including the R&D and process development time. Figure 1.6 shows how a polyketide synthase

Exploring Polypharmacology Using a ROCS-Based Target Fishing Approach

DTIC Science & Technology

2012-01-01

target representatives. Target profiles were then generated for a given query molecule by computing maximal shape/ chemistry overlap between the query...molecule and the drug sets assigned to each protein target. The overlap was computed using the program ROCS (Rapid Overlay of Chemical Structures ). We...approaches in off-target prediction has been reviewed.9,10 Many structure -based target fishing (SBTF) approaches, such as INVDOCK11 and Target Fishing Dock

Calculating Henry’s Constants of Charged Molecules Using SPARC

EPA Science Inventory

SPARC Performs Automated Reasoning in Chemistry is a computer program designed to model physical and chemical properties of molecules solely based on thier chemical structure. SPARC uses a toolbox of mechanistic perturbation models to model intermolecular interactions. SPARC has ...

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Theoretical study of ozone adsorption on the surface of Fe, Co and Ni doped boron nitride nanosheets

NASA Astrophysics Data System (ADS)

Farmanzadeh, Davood; Askari Ardehjani, Nastaran

2018-06-01

In this work, the adsorption of ozone molecule on Fe, Co and Ni doped boron nitride nanosheets (BNNSs) were investigated using density functional theory. The most stable adsorption configurations, charge transfer and adsorption energy of ozone molecule on pure and doped BNNSs are calculated. It is shown that ozone molecule has no remarkable interaction with pure boron nitride nanosheet, it tends to be chemisorbed on Fe, Co and Ni doped BNNSs with adsorption energy in the range of -249.4 to -686.1 kJ/mol. In all configurations, the adsorption of ozone molecule generates a semiconductor by reducing Eg in the pure and Fe, Co and Ni doped boron nitride nanosheet. It shows that the conductance of BNNSs change over the adsorption of ozone molecule. The obtained results in this study can be used in developing BN-based sheets for ozone molecule removal.

Visualization of molecular structures using HoloLens-based augmented reality

PubMed Central

Hoffman, MA; Provance, JB

2017-01-01

Biological molecules and biologically active small molecules are complex three dimensional structures. Current flat screen monitors are limited in their ability to convey the full three dimensional characteristics of these molecules. Augmented reality devices, including the Microsoft HoloLens, offer an immersive platform to change how we interact with molecular visualizations. We describe a process to incorporate the three dimensional structures of small molecules and complex proteins into the Microsoft HoloLens using aspirin and the human leukocyte antigen (HLA) as examples. Small molecular structures can be introduced into the HoloStudio application, which provides native support for rotating, resizing and performing other interactions with these molecules. Larger molecules can be imported through the Unity gaming development platform and then Microsoft Visual Developer. The processes described here can be modified to import a wide variety of molecular structures into augmented reality systems and improve our comprehension of complex structural features. PMID:28815109

Carbon Nanotube Biosensors for Space Molecule Detection and Clinical Molecular Diagnostics

NASA Technical Reports Server (NTRS)

Han, Jie

2001-01-01

Both space molecule detection and clinical molecule diagnostics need to develop ultra sensitive biosensors for detection of less than attomole molecules such as amino acids for DNA. However all the electrode sensor systems including those fabricated from the existing carbon nanotubes, have a background level of nA (nanoAmp). This has limited DNA or other molecule detection to nA level or molecules whose concentration is, much higher than attomole level. A program has been created by NASA and NCI (National Cancer Institute) to exploit the possibility of carbon nanotube based biosensors to solve this problem for both's interest. In this talk, I will present our effort on the evaluation and novel design of carbon nanotubes as electrode biosensors with strategies to minimize background currents while maximizing signal intensity.The fabrication of nanotube electrode arrays, immobilization of molecular probes on nanotube electrodes and in vitro biosensor testing will also be discussed.

Single Molecule Enzymology via Nanoelectronic Circuits

NASA Astrophysics Data System (ADS)

Collins, Philip

Traditional single-molecule techniques rely on fluorescence or force transduction to monitor conformational changes and biochemical activity. Recent demonstrations of single-molecule monitoring with electronic transistors are poised to add to the single-molecule research toolkit. The transistor-based technique is sensitive to the motion of single charged side chain residues and can transduce those motions with microsecond resolution, opening the doors to single-molecule enzymology with unprecedented resolution. Furthermore, the solid-state platform provides opportunities for parallelization in arrays and long-duration monitoring of one molecule's activity or processivity, all without the limitations caused by photo-oxidation or mutagenic fluorophore incorporation. This presentation will review some of these advantages and their particular application to DNA polymerase I processing single-stranded DNA templates. This research was supported financially by the NIH NCI (R01 CA133592-01), the NIH NIGMS (1R01GM106957-01) and the NSF (DMR-1104629 and ECCS-1231910).

Molecular separation method and apparatus

DOEpatents

Villa-Aleman, Eliel

1996-01-01

A method and apparatus for separating a gaseous mixture of chemically identical but physically different molecules based on their polarities. The gaseous mixture of molecules is introduced in discrete quantities into the proximal end of a porous glass molecular. The molecular sieve is exposed to microwaves to excite the molecules to a higher energy state from a lower energy state, those having a higher dipole moment being excited more than those with a lower energy state. The temperature of the sieve kept cold by a flow of liquid nitrogen through a cooling jacket so that the heat generated by the molecules colliding with the material is transferred away from the material. The molecules thus alternate between a higher energy state and a lower one, with the portion of molecules having the higher dipole moment favored over the others. The former portion can then be extracted separately from the distal end of the molecular sieve.

Molecular separation method and apparatus

DOEpatents

Villa-Aleman, E.

1996-04-09

A method and apparatus are disclosed for separating a gaseous mixture of chemically identical but physically different molecules based on their polarities. The gaseous mixture of molecules is introduced in discrete quantities into the proximal end of a porous glass molecular sieve. The molecular sieve is exposed to microwaves to excite the molecules to a higher energy state from a lower energy state, those having a higher dipole moment being excited more than those with a lower energy state. The temperature of the sieve kept cold by a flow of liquid nitrogen through a cooling jacket so that the heat generated by the molecules colliding with the material is transferred away from the material. The molecules thus alternate between a higher energy state and a lower one, with the portion of molecules having the higher dipole moment favored over the others. The former portion can then be extracted separately from the distal end of the molecular sieve. 2 figs.

Fluorination-enabled optimal morphology leads to over 11% efficiency for inverted small-molecule organic solar cells

PubMed Central

Deng, Dan; Zhang, Yajie; Zhang, Jianqi; Wang, Zaiyu; Zhu, Lingyun; Fang, Jin; Xia, Benzheng; Wang, Zhen; Lu, Kun; Ma, Wei; Wei, Zhixiang

2016-01-01

Solution-processable small molecules for organic solar cells have attracted intense attention for their advantages of definite molecular structures compared with their polymer counterparts. However, the device efficiencies based on small molecules are still lower than those of polymers, especially for inverted devices, the highest efficiency of which is <9%. Here we report three novel solution-processable small molecules, which contain π-bridges with gradient-decreased electron density and end acceptors substituted with various fluorine atoms (0F, 1F and 2F, respectively). Fluorination leads to an optimal active layer morphology, including an enhanced domain purity, the formation of hierarchical domain size and a directional vertical phase gradation. The optimal morphology balances charge separation and transfer, and facilitates charge collection. As a consequence, fluorinated molecules exhibit excellent inverted device performance, and an average power conversion efficiency of 11.08% is achieved for a two-fluorine atom substituted molecule. PMID:27991486

DG-AMMOS: a new tool to generate 3d conformation of small molecules using distance geometry and automated molecular mechanics optimization for in silico screening.

PubMed

Lagorce, David; Pencheva, Tania; Villoutreix, Bruno O; Miteva, Maria A

2009-11-13

Discovery of new bioactive molecules that could enter drug discovery programs or that could serve as chemical probes is a very complex and costly endeavor. Structure-based and ligand-based in silico screening approaches are nowadays extensively used to complement experimental screening approaches in order to increase the effectiveness of the process and facilitating the screening of thousands or millions of small molecules against a biomolecular target. Both in silico screening methods require as input a suitable chemical compound collection and most often the 3D structure of the small molecules has to be generated since compounds are usually delivered in 1D SMILES, CANSMILES or in 2D SDF formats. Here, we describe the new open source program DG-AMMOS which allows the generation of the 3D conformation of small molecules using Distance Geometry and their energy minimization via Automated Molecular Mechanics Optimization. The program is validated on the Astex dataset, the ChemBridge Diversity database and on a number of small molecules with known crystal structures extracted from the Cambridge Structural Database. A comparison with the free program Balloon and the well-known commercial program Omega generating the 3D of small molecules is carried out. The results show that the new free program DG-AMMOS is a very efficient 3D structure generator engine. DG-AMMOS provides fast, automated and reliable access to the generation of 3D conformation of small molecules and facilitates the preparation of a compound collection prior to high-throughput virtual screening computations. The validation of DG-AMMOS on several different datasets proves that generated structures are generally of equal quality or sometimes better than structures obtained by other tested methods.

Cheminformatics-aided discovery of small-molecule Protein-Protein Interaction (PPI) dual inhibitors of Tumor Necrosis Factor (TNF) and Receptor Activator of NF-κB Ligand (RANKL).

PubMed

Melagraki, Georgia; Ntougkos, Evangelos; Rinotas, Vagelis; Papaneophytou, Christos; Leonis, Georgios; Mavromoustakos, Thomas; Kontopidis, George; Douni, Eleni; Afantitis, Antreas; Kollias, George

2017-04-01

We present an in silico drug discovery pipeline developed and applied for the identification and virtual screening of small-molecule Protein-Protein Interaction (PPI) compounds that act as dual inhibitors of TNF and RANKL through the trimerization interface. The cheminformatics part of the pipeline was developed by combining structure-based with ligand-based modeling using the largest available set of known TNF inhibitors in the literature (2481 small molecules). To facilitate virtual screening, the consensus predictive model was made freely available at: http://enalos.insilicotox.com/TNFPubChem/. We thus generated a priority list of nine small molecules as candidates for direct TNF function inhibition. In vitro evaluation of these compounds led to the selection of two small molecules that act as potent direct inhibitors of TNF function, with IC50 values comparable to those of a previously-described direct inhibitor (SPD304), but with significantly reduced toxicity. These molecules were also identified as RANKL inhibitors and validated in vitro with respect to this second functionality. Direct binding of the two compounds was confirmed both for TNF and RANKL, as well as their ability to inhibit the biologically-active trimer forms. Molecular dynamics calculations were also carried out for the two small molecules in each protein to offer additional insight into the interactions that govern TNF and RANKL complex formation. To our knowledge, these compounds, namely T8 and T23, constitute the second and third published examples of dual small-molecule direct function inhibitors of TNF and RANKL, and could serve as lead compounds for the development of novel treatments for inflammatory and autoimmune diseases.

Perylene-Diimide Based Donor-Acceptor-Donor Type Small-Molecule Acceptors for Solution-Processable Organic Solar Cells

NASA Astrophysics Data System (ADS)

Ganesamoorthy, Ramasamy; Vijayaraghavan, Rajagopalan; Sakthivel, Pachagounder

2017-12-01

Development of nonfullerene acceptors plays an important role in the commercial availability of plastic solar cells. We report herein synthesis of bay-substituted donor-acceptor-donor (D-A-D)-type perylene diimide (PDI)-based small molecules (SM-1 to SM-4) by Suzuki coupling method and their use as acceptors in bulk heterojunction organic solar cells (BHJ-OSCs) with poly(3-hexylthiophene) (P3HT) polymer donor. We varied the number of electron-rich thiophene units and the solubilizing side chains and also evaluated the optical and electrochemical properties of the small molecules. The synthesized small molecules were confirmed by Fourier-transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and high-resolution mass spectroscopy (HR-MS). The small molecules showed extensive and strong absorption in the ultraviolet-visible (UV-Vis) region up to 750 nm, with bandgap (E_{{g}}^{{opt}} ) reduced below <2 eV. The energy levels of small molecules SM-1 to SM-4 were suitable for use as electron-accepting materials. The small molecules showed good thermal stability up to 300°C. BHJ-OSCs with SM-1 and P3HT polymer donor showed maximum power conversion efficiency (PCE) of 0.19% with V oc of 0.30 V, J sc of 1.72 mA cm-2, and fill factor (FF) of 37%. The PCE decreased with the number of thiophene units. The PCE of SM-2 was lower than that of SM-1. This difference in PCE can be explained by the higher aggregation tendency of the bithiophene compared with the thiophene unit. Introduction of the solubilizing group in the bay position increased the aggregation property, leading to much lower PCE than for the small molecules without solubilizing group.

Why trash don't pass? pharmaceutical licensing and safety performance of drugs.

PubMed

Banerjee, Tannista; Nayak, Arnab

2017-01-01

This paper examines how asymmetric information in pharmaceutical licensing affects the safety standards of licensed drugs. Pharmaceutical companies often license potential drug molecules at different stages of drug development from other pharmaceutical or biotechnology companies and complete the remaining of research stages before submitting the new drug application(NDA) to the food and drug administration. The asymmetric information associated with the quality of licensed molecules might result in the molecules which are less likely to succeed to be licensed out, while those with greater potential of success being held internally for development. We identify the NDAs submitted between 1993 and 2004 where new molecular entities were acquired through licensing. Controlling for other drug area specific and applicant firm specific factors, we investigate whether drugs developed with licensed molecules face higher probability of safety based recall and ultimate withdrawal from the market than drugs developed internally. Results suggest the opposite of Akerlof's (Q J Econ 84:488-500, 1970) lemons problem. Licensed molecules rather have less probability of facing safety based recalls and ultimate withdrawal from the market comparing to internally developed drug molecules. This suggests that biotechnology and small pharmaceutical firms specializing in pharmaceutical research are more efficient in developing good potential molecules because of their concentrated research. Biotechnology firms license out good potential molecules because it increases their market value and reputation. In addition, results suggest that both the number of previous approved drugs in the disease area, and also the applicant firms' total number of previous approvals in all disease areas reduce the probability that an additional approved drug in the same drug area will potentially be harmful.

Breaking the polar-nonpolar division in solvation free energy prediction.

PubMed

Wang, Bao; Wang, Chengzhang; Wu, Kedi; Wei, Guo-Wei

2018-02-05

Implicit solvent models divide solvation free energies into polar and nonpolar additive contributions, whereas polar and nonpolar interactions are inseparable and nonadditive. We present a feature functional theory (FFT) framework to break this ad hoc division. The essential ideas of FFT are as follows: (i) representability assumption: there exists a microscopic feature vector that can uniquely characterize and distinguish one molecule from another; (ii) feature-function relationship assumption: the macroscopic features, including solvation free energy, of a molecule is a functional of microscopic feature vectors; and (iii) similarity assumption: molecules with similar microscopic features have similar macroscopic properties, such as solvation free energies. Based on these assumptions, solvation free energy prediction is carried out in the following protocol. First, we construct a molecular microscopic feature vector that is efficient in characterizing the solvation process using quantum mechanics and Poisson-Boltzmann theory. Microscopic feature vectors are combined with macroscopic features, that is, physical observable, to form extended feature vectors. Additionally, we partition a solvation dataset into queries according to molecular compositions. Moreover, for each target molecule, we adopt a machine learning algorithm for its nearest neighbor search, based on the selected microscopic feature vectors. Finally, from the extended feature vectors of obtained nearest neighbors, we construct a functional of solvation free energy, which is employed to predict the solvation free energy of the target molecule. The proposed FFT model has been extensively validated via a large dataset of 668 molecules. The leave-one-out test gives an optimal root-mean-square error (RMSE) of 1.05 kcal/mol. FFT predictions of SAMPL0, SAMPL1, SAMPL2, SAMPL3, and SAMPL4 challenge sets deliver the RMSEs of 0.61, 1.86, 1.64, 0.86, and 1.14 kcal/mol, respectively. Using a test set of 94 molecules and its associated training set, the present approach was carefully compared with a classic solvation model based on weighted solvent accessible surface area. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Hyperfine coupling constants on inner-sphere water molecules of Gd(III)-based MRI contrast agents.

PubMed

Esteban-Gómez, David; de Blas, Andrés; Rodríguez-Blas, Teresa; Helm, Lothar; Platas-Iglesias, Carlos

2012-11-12

Herein we present a theoretical investigation of the hyperfine coupling constants (HFCCs) on the inner-sphere water molecules of [Gd(H(2)O)(8)](3+) and different Gd(III)-based magnetic resonance imaging contrast agents such as [Gd(DOTA)(H(2)O)](-), [Gd(DTPA)(H(2)O)](2-), [Gd(DTPA-BMA)(H(2)O)] and [Gd(HP-DO3A)(H(2)O)]. DFT calculations performed on the [Gd(H(2)O)(8)](3+) model system show that both hybrid-GGA functionals (BH&HLYP, B3PW91 and PBE1PBE) and the hybrid meta-GGA functional TPSSh provide (17)O HFCCs in close agreement with the experimental data. The use of all-electron relativistic approaches based on the DKH2 approximation and the use of relativistic effective core potentials (RECP) provide results of essentially the same quality. The accurate calculation of HFCCs on the [Gd(DOTA)(H(2)O)](-), [Gd(DTPA)(H(2)O)](2-), [Gd(DTPA-BMA)(H(2)O)] and [Gd(HP-DO3A)(H(2)O)] complexes requires an adequate description of solvent effects. This was achieved by using a mixed cluster/continuum approach that includes explicitly two second-sphere water molecules. The calculated isotropic (17)O HFCCs (A(iso)) fall within the range 0.40-0.56 MHz, and show deviations from the corresponding experimental values typically lower than 0.05 MHz. The A(iso) values are significantly affected by the distance between the oxygen atom of the coordinated water molecule and the Gd(III) ion, as well as by the orientation of the water molecule plane with respect to the Gd-O vector. (1)H HFCCs of coordinated water molecules and (17)O HFCCs of second-sphere water molecules take values close to zero. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Chiroptical properties of an alternatingly functionalized cellotriose bearing two porphyrin groups

USDA-ARS?s Scientific Manuscript database

Alternatingly functionalized cellulose molecules have potential applications in optoelectronics and molecular receptors. For example, cellulose-based solar cells have been proposed. As a prototype for such molecules, the trisaccharide fragment of cellulose was modified by attachment of porphyrin gro...

Molecular recognition of microbial lipid-based antigens by T cells.

PubMed

Gras, Stephanie; Van Rhijn, Ildiko; Shahine, Adam; Le Nours, Jérôme

2018-05-01

The immune system has evolved to protect hosts from pathogens. T cells represent a critical component of the immune system by their engagement in host defence mechanisms against microbial infections. Our knowledge of the molecular recognition by T cells of pathogen-derived peptidic antigens that are presented by the major histocompatibility complex glycoproteins is now well established. However, lipids represent an additional, distinct chemical class of molecules that when presented by the family of CD1 antigen-presenting molecules can serve as antigens, and be recognized by specialized subsets of T cells leading to antigen-specific activation. Over the past decades, numerous CD1-presented self- and bacterial lipid-based antigens have been isolated and characterized. However, our understanding at the molecular level of T cell immunity to CD1 molecules presenting microbial lipid-based antigens is still largely unexplored. Here, we review the insights and the molecular basis underpinning the recognition of microbial lipid-based antigens by T cells.

DNA nanotechnology-enabled biosensors.

PubMed

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

A quantitative study of the clustering of polycyclic aromatic hydrocarbons at high temperatures.

PubMed

Totton, Tim S; Misquitta, Alston J; Kraft, Markus

2012-03-28

The clustering of polycyclic aromatic hydrocarbon (PAH) molecules is investigated in the context of soot particle inception and growth using an isotropic potential developed from the benchmark PAHAP potential. This potential is used to estimate equilibrium constants of dimerisation for five representative PAH molecules based on a statistical mechanics model. Molecular dynamics simulations are also performed to study the clustering of homomolecular systems at a range of temperatures. The results from both sets of calculations demonstrate that at flame temperatures pyrene (C(16)H(10)) dimerisation cannot be a key step in soot particle formation and that much larger molecules (e.g. circumcoronene, C(54)H(18)) are required to form small clusters at flame temperatures. The importance of using accurate descriptions of the intermolecular interactions is demonstrated by comparing results to those calculated with a popular literature potential with an order of magnitude variation in the level of clustering observed. By using an accurate intermolecular potential we are able to show that physical binding of PAH molecules based on van der Waals interactions alone can only be a viable soot inception mechanism if concentrations of large PAH molecules are significantly higher than currently thought.

Theoretical study of the H2 reaction with a Pt4 (111) cluster

NASA Astrophysics Data System (ADS)

Cruz, A.; Bertin, V.; Poulain, E.; Benitez, J. I.; Castillo, S.

2004-04-01

The Cs symmetry reaction of the H2 molecule on a Pt4 (111) clusters, has been studied using ab initio multiconfiguration self-consistent field plus extensive multireference configuration interaction variational and perturbative calculations. The H2 interaction by the vertex and by the base of a tetrahedral Pt4 cluster were studied in ground and excited triplet and singlet states (closed and open shells), where the reaction curves are obtained through many avoided crossings. The Pt4 cluster captures and activates the hydrogen molecule; it shows a similar behavior compared with other Ptn (n=1,2,3) systems. The Pt4 cluster in their lowest five open and closed shell electronic states: 3B2, 1B2, 1A1 3A1, 1A1, respectively, may capture and dissociate the H2 molecule without activation barriers for the hydrogen molecule vertex approach. For the threefolded site reaction, i.e., by the base, the situation is different, the hydrogen adsorption presents some barriers. The potential energy minima occur outside and inside the cluster, with strong activation of the H-H bond. In all cases studied, the Pt4 cluster does not absorb the hydrogen molecule.

Easy-DHPSF open-source software for three-dimensional localization of single molecules with precision beyond the optical diffraction limit.

PubMed

Lew, Matthew D; von Diezmann, Alexander R S; Moerner, W E

2013-02-25

Automated processing of double-helix (DH) microscope images of single molecules (SMs) streamlines the protocol required to obtain super-resolved three-dimensional (3D) reconstructions of ultrastructures in biological samples by single-molecule active control microscopy. Here, we present a suite of MATLAB subroutines, bundled with an easy-to-use graphical user interface (GUI), that facilitates 3D localization of single emitters (e.g. SMs, fluorescent beads, or quantum dots) with precisions of tens of nanometers in multi-frame movies acquired using a wide-field DH epifluorescence microscope. The algorithmic approach is based upon template matching for SM recognition and least-squares fitting for 3D position measurement, both of which are computationally expedient and precise. Overlapping images of SMs are ignored, and the precision of least-squares fitting is not as high as maximum likelihood-based methods. However, once calibrated, the algorithm can fit 15-30 molecules per second on a 3 GHz Intel Core 2 Duo workstation, thereby producing a 3D super-resolution reconstruction of 100,000 molecules over a 20×20×2 μm field of view (processing 128×128 pixels × 20000 frames) in 75 min.

Application of Aptamer-based hybrid molecules in Early Diagnosis and Treatment of Diabetes Mellitus: From the Concepts toward the Future.

PubMed

Ahmadi, Sepideh; Rabiee, Navid; Rabiee, Mohammad

2018-06-06

Aptamers have several positive advantages that made them eminent as a potential factor in diagnosing and treating diseases such as their application in prevention and treatment of diabetes. In this opinion-based mini review article, we aimed to investigate the DNA and RNA-based hybrid molecules specifically aptamers and had a logical conclusion as a promising future prospective in early diagnosis and treatment of diabetes. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Small organic molecule based flow battery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huskinson, Brian; Marshak, Michael; Aziz, Michael J.

The invention provides an electrochemical cell based on a new chemistry for a flow battery for large scale, e.g., gridscale, electrical energy storage. Electrical energy is stored chemically at an electrochemical electrode by the protonation of small organic molecules called quinones to hydroquinones. The proton is provided by a complementary electrochemical reaction at the other electrode. These reactions are reversed to deliver electrical energy. A flow battery based on this concept can operate as a closed system. The flow battery architecture has scaling advantages over solid electrode batteries for large scale energy storage.

Construction of the Fock Matrix on a Grid-Based Molecular Orbital Basis Using GPGPUs.

PubMed

Losilla, Sergio A; Watson, Mark A; Aspuru-Guzik, Alán; Sundholm, Dage

2015-05-12

We present a GPGPU implementation of the construction of the Fock matrix in the molecular orbital basis using the fully numerical, grid-based bubbles representation. For a test set of molecules containing up to 90 electrons, the total Hartree-Fock energies obtained from reference GTO-based calculations are reproduced within 10(-4) Eh to 10(-8) Eh for most of the molecules studied. Despite the very large number of arithmetic operations involved, the high performance obtained made the calculations possible on a single Nvidia Tesla K40 GPGPU card.

A Diffusion-Based and Dynamic 3D-Printed Device That Enables Parallel in Vitro Pharmacokinetic Profiling of Molecules

PubMed Central

Lockwood, Sarah Y.; Meisel, Jayda E.; Monsma, Frederick J.; Spence, Dana M.

2016-01-01

The process of bringing a drug to market involves many steps, including the preclinical stage, where various properties of the drug candidate molecule are determined. These properties, which include drug absorption, distribution, metabolism, and excretion, are often displayed in a pharmacokinetic (PK) profile. While PK profiles are determined in animal models, in vitro systems that model in vivo processes are available, although each possesses shortcomings. Here, we present a 3D-printed, diffusion-based, and dynamic in vitro PK device. The device contains six flow channels, each with integrated porous membrane-based insert wells. The pores of these membranes enable drugs to freely diffuse back and forth between the flow channels and the inserts, thus enabling both loading and clearance portions of a standard PK curve to be generated. The device is designed to work with 96-well plate technology and consumes single-digit milliliter volumes to generate multiple PK profiles, simultaneously. Generation of PK profiles by use of the device was initially performed with fluorescein as a test molecule. Effects of such parameters as flow rate, loading time, volume in the insert well, and initial concentration of the test molecule were investigated. A prediction model was generated from this data, enabling the user to predict the concentration of the test molecule at any point along the PK profile within a coefficient of variation of ~5%. Depletion of the analyte from the well was characterized and was determined to follow first-order rate kinetics, indicated by statistically equivalent (p > 0.05) depletion half-lives that were independent of the starting concentration. A PK curve for an approved antibiotic, levofloxacin, was generated to show utility beyond the fluorescein test molecule. PMID:26727249

DFT analysis on the molecular structure, vibrational and electronic spectra of 2-(cyclohexylamino)ethanesulfonic acid.

PubMed

Renuga Devi, T S; Sharmi kumar, J; Ramkumaar, G R

2015-02-25

The FTIR and FT-Raman spectra of 2-(cyclohexylamino)ethanesulfonic acid were recorded in the regions 4000-400 cm(-1) and 4000-50 cm(-1) respectively. The structural and spectroscopic data of the molecule in the ground state were calculated using Hartee-Fock and Density functional method (B3LYP) with the correlation consistent-polarized valence double zeta (cc-pVDZ) basis set and 6-311++G(d,p) basis set. The most stable conformer was optimized and the structural and vibrational parameters were determined based on this. The complete assignments were performed based on the Potential Energy Distribution (PED) of the vibrational modes, calculated using Vibrational Energy Distribution Analysis (VEDA) 4 program. With the observed FTIR and FT-Raman data, a complete vibrational assignment and analysis of the fundamental modes of the compound were carried out. Thermodynamic properties and Atomic charges were calculated using both Hartee-Fock and density functional method using the cc-pVDZ basis set and compared. The calculated HOMO-LUMO energy gap revealed that charge transfer occurs within the molecule. (1)H and (13)C NMR chemical shifts of the molecule were calculated using Gauge Including Atomic Orbital (GIAO) method and were compared with experimental results. Stability of the molecule arising from hyperconjugative interactions, charge delocalization have been analyzed using Natural Bond Orbital (NBO) analysis. The first order hyperpolarizability (β) and Molecular Electrostatic Potential (MEP) of the molecule was computed using DFT calculations. The electron density based local reactivity descriptor such as Fukui functions were calculated to explain the chemical reactivity site in the molecule. Copyright © 2014 Elsevier B.V. All rights reserved.

Symbol Synchronization for Diffusion-Based Molecular Communications.

PubMed

Jamali, Vahid; Ahmadzadeh, Arman; Schober, Robert

2017-12-01

Symbol synchronization refers to the estimation of the start of a symbol interval and is needed for reliable detection. In this paper, we develop several symbol synchronization schemes for molecular communication (MC) systems where we consider some practical challenges, which have not been addressed in the literature yet. In particular, we take into account that in MC systems, the transmitter may not be equipped with an internal clock and may not be able to emit molecules with a fixed release frequency. Such restrictions hold for practical nanotransmitters, e.g., modified cells, where the lengths of the symbol intervals may vary due to the inherent randomness in the availability of food and energy for molecule generation, the process for molecule production, and the release process. To address this issue, we develop two synchronization-detection frameworks which both employ two types of molecule. In the first framework, one type of molecule is used for symbol synchronization and the other one is used for data detection, whereas in the second framework, both types of molecule are used for joint symbol synchronization and data detection. For both frameworks, we first derive the optimal maximum likelihood (ML) symbol synchronization schemes as performance upper bounds. Since ML synchronization entails high complexity, for each framework, we also propose three low-complexity suboptimal schemes, namely a linear filter-based scheme, a peak observation-based scheme, and a threshold-trigger scheme, which are suitable for MC systems with limited computational capabilities. Furthermore, we study the relative complexity and the constraints associated with the proposed schemes and the impact of the insertion and deletion errors that arise due to imperfect synchronization. Our simulation results reveal the effectiveness of the proposed synchronization schemes and suggest that the end-to-end performance of MC systems significantly depends on the accuracy of the symbol synchronization.

Predicting the pKa and stability of organic acids and bases at an oil-water interface.

PubMed

Andersson, M P; Olsson, M H M; Stipp, S L S

2014-06-10

We have used density functional theory and the implicit solvent model, COSMO-RS, to investigate how the acidity constant, pKa, of organic acids and bases adsorbed at the organic compound-aqueous solution interface changes, compared to its value in the aqueous phase. The pKa determine the surface charge density of the molecules that accumulate at the fluid-fluid interface. We have estimated the pKa by comparing the stability of the protonated and unprotonated forms of a series of molecules in the bulk aqueous solution and at an interface where parts of each molecule reside in the hydrophobic phase and the rest remains in the hydrophilic phase. We found that the pKa for acids is shifted by ∼1 pH unit to higher values compared to the bulk water pKa, whereas they are shifted to lower values by a similar amount for bases. Because this pKa shift is similar in magnitude for each of the molecules studied, we propose that the pKa for molecules at a water-organic compound interface can easily be predicted by adding a small shift to the aqueous pKa. This shift is general and correlates with the functional group. We also found that the relative composition of molecules at the fluid-fluid interface is not the same as in the bulk. For example, species such as carboxylic acids are enriched at the interface, where they can dominate surface properties, even when they are a modest component in the bulk fluid. For high surface concentrations of carboxylic acid groups at an interface, such as a self-assembled monolayer, we have demonstrated that the pKa depends on the degree of deprotonation through direct hydrogen bonding between protonated and deprotonated acidic headgroups.

Effect of chain length on binding of fatty acids to Pluronics in microemulsions.

PubMed

James-Smith, Monica A; Shekhawat, Dushyant; Cheung, Sally; Moudgil, Brij M; Shah, Dinesh O

2008-03-15

We investigated the effect of fatty acid chain length on the binding capacity of drug and fatty acid to Pluronic F127-based microemulsions. This was accomplished by using turbidity experiments. Pluronic-based oil-in-water microemulsions of various compositions were synthesized and titrated to turbidity with concentrated Amitriptyline, an antidepressant drug. Sodium salts of C(8), C(10), or C(12) fatty acid were used in preparation of the microemulsion and the corresponding binding capacities were observed. It has been previously determined that, for microemulsions prepared with sodium caprylate (C(8) fatty acid soap), a maximum of 11 fatty acid molecules bind to the microemulsion per 1 molecule of Pluronic F127 and a maximum of 12 molecules of Amitriptyline bind per molecule of F127. We have found that with increasing the chain length of the fatty acid salt component of the microemulsion, the binding capacity of both the fatty acid and the Amitriptyline to the microemulsion decreases. For sodium salts of C(8), C(10) and C(12) fatty acids, respectively, a maximum of approximately 11, 8.4 and 8.3 molecules of fatty acid molecules bind to 1 Pluronic F127 molecule. We propose that this is due to the decreasing number of free monomers with increasing chain length. As chain length increases, the critical micelle concentration (cmc) decreases, thus leading to fewer monomers. Pluronics are symmetric tri-block copolymers consisting of propylene oxide (PO) and ethylene oxide (EO). The polypropylene oxide block, PPO is sandwiched between two polyethylene oxide (PEO) blocks. The PEO blocks are hydrophilic while PPO is hydrophobic portion in the Pluronic molecule. Due to this structure, we propose that the fatty acid molecules that are in monomeric form most effectively diffuse between the PEO "tails" and bind to the hydrophobic PPO groups.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Investigation of the mechanism for penetration of low density lipoprotein into the arterial wall

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Zyktin, A. A.; Slepchenkov, M. M.

2018-02-01

Currently, the pathology of the cardiovascular system is an extremely urgent problem of fundamental and clinical medicine. These diseases are caused, mainly, by atherosclerotic changes in the wall of blood vessels. The predominant role in the development of atherosclerosis is attributed to the penetration of various kinds of lipoproteins into the arterial intima. In this paper, we in silico investigated the dynamics of the penetration of low density lipoprotein (LDL) through the intercellular gap using molecular modeling methods. The simulation was carried out in the GROMACS software package using a coarse-grained MARTINI model. During investigation we carried out the LDL self-assembly for the first time. The coarse-grained model of LDL was collected from the following molecules: POPC (phosphatidylcholine) - 630 molecules, LPC (lysophosphatidylcholine) - 80 molecules CHOL (cholesterol) - 600 molecules CHYO (cholesteryl oleate) - 1600 molecules TOG (glycerol trioleate) 180 Molecules. The coarse-grained model of the intercellular endothelial gap was based on a model of lipid bilayer consisting of DPPC phospholipids and cholesterol in a percentage ratio of 70% and 30%, respectively. Based on the obtained results, we can predict the mechanism of LDL diffusion. Lipoproteins can be deformed so as to pass through narrow gaps. Our investigations open the way for the research of the behavior dynamics of LDL moving with the blood flow rate when interacting with the intercellular gaps of the endothelial layer of the vessel inner wall.

Structure-property relationships: asymmetric alkylphenyl-substituted anthracene molecules for use in small-molecule solar cells.

PubMed

Kim, Yu Jin; Ahn, Eun Soo; Jang, Sang Hun; An, Tae Kyu; Kwon, Soon-Ki; Chung, Dae Sung; Kim, Yun-Hi; Park, Chan Eon

2015-05-11

Two asymmetric anthracene-based organic molecules, NDHPEA and TNDHPEA, were prepared without or with a thiophene spacer between the anthracene and naphthalene units. These asymmetric oligomers displayed different degrees of coplanarity, as evidenced by differences in the dihedral angles calculated by using DFT. Differential scanning calorimetry and XRD studies were used to probe the crystallization characteristics and molecular packing structures in the active layers. The coplanarity of the molecules in the asymmetric structure significantly affected the crystallization behavior and the formation of crystalline domains in the solid state. The small-molecule crystalline properties were correlated with the device physics by determining the J-V characteristics and hole mobilities of the devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Methods to enable the design of bioactive small molecules targeting RNA

PubMed Central

Disney, Matthew D.; Yildirim, Ilyas; Childs-Disney, Jessica L.

2014-01-01

RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including Structure-Activity Relationships Through Sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome. PMID:24357181

Methods to enable the design of bioactive small molecules targeting RNA.

PubMed

Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L

2014-02-21

RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.

Application of the R-matrix method to photoionization of molecules.

PubMed

Tashiro, Motomichi

2010-04-07

The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

Fluxonium-Based Artificial Molecule with a Tunable Magnetic Moment

NASA Astrophysics Data System (ADS)

Kou, A.; Smith, W. C.; Vool, U.; Brierley, R. T.; Meier, H.; Frunzio, L.; Girvin, S. M.; Glazman, L. I.; Devoret, M. H.

2017-07-01

Engineered quantum systems allow us to observe phenomena that are not easily accessible naturally. The LEGO®-like nature of superconducting circuits makes them particularly suited for building and coupling artificial atoms. Here, we introduce an artificial molecule, composed of two strongly coupled fluxonium atoms, which possesses a tunable magnetic moment. Using an applied external flux, one can tune the molecule between two regimes: one in which the ground-excited state manifold has a magnetic dipole moment and one in which the ground-excited state manifold has only a magnetic quadrupole moment. By varying the applied external flux, we find the coherence of the molecule to be limited by local flux noise. The ability to engineer and control artificial molecules paves the way for building more complex circuits for quantum simulation and protected qubits.

Surface functionalized mesoporous material and method of making same

DOEpatents

Feng, Xiangdong [West Richland, WA; Liu, Jun [West Richland, WA; Fryxell, Glen E [Kennewick, WA

2001-12-04

According to the present invention, an organized assembly of functional molecules with specific interfacial functionality (functional group(s)) is attached to available surfaces including within mesopores of a mesoporous material. The method of the present invention avoids the standard base soak that would digest the walls between the mesopores by boiling the mesoporous material in water for surface preparation then removing all but one or two layers of water molecules on the internal surface of a pore. Suitable functional molecule precursor is then applied to permeate the hydrated pores and the precursor then undergoes condensation to form the functional molecules on the interior surface(s) of the pore(s).

Electronic and mechanical characteristics of stacked dimer molecular junctions.

PubMed

Magyarkuti, András; Adak, Olgun; Halbritter, Andras; Venkataraman, Latha

2018-02-15

Break-junction measurements are typically aimed at characterizing electronic properties of single molecules bound between two metal electrodes. Although these measurements have provided structure-function relationships for such devices, there is little work that studies the impact of molecule-molecule interactions on junction characteristics. Here, we use a scanning tunneling microscope based break-junction technique to study pi-stacked dimer junctions formed with two amine-terminated conjugated molecules. We show that the conductance, force and flicker noise of such dimers differ dramatically when compared with the corresponding monomer junctions and discuss the implications of these results on intra- and inter-molecular charge transport.

Ambipolar nature of dimethyl benzo difuran (DMBDF) molecule: A charge transport study

NASA Astrophysics Data System (ADS)

Sahoo, Smruti Ranjan; Sahu, Sridhar

2017-05-01

We describe a theoretical study of the charge transport properties of the organic dimethyl benzo difuran (DMBDF) molecule based on density functional theory (DFT). Reorganization energy, ionization potential (IP), electron affinity (EA), energy gaps, transfer integral (t) and charge mobility (μ) has been studied to depict the transport properties in the conjugated organic molecules. We computed, large homo transfer integral and IP value leading to high hole mobility (4.46 cm2/V sec). However, the electron reorganization energy (0.34 eV) and the electron mobility of 1.62 cm2/V sec, infers that the DMBDF organic molecule bears an ambipolar character.

Quantum chemical approach for condensed-phase thermochemistry (IV): Solubility of gaseous molecules

NASA Astrophysics Data System (ADS)

Ishikawa, Atsushi; Kamata, Masahiro; Nakai, Hiromi

2016-07-01

The harmonic solvation model (HSM) was applied to the solvation of gaseous molecules and compared to a procedure based on the ideal gas model (IGM). Examination of 25 molecules showed that (i) the accuracy of ΔGsolv was similar for both methods, but the HSM shows advantages for calculating ΔHsolv and TΔSsolv; (ii) TΔSsolv contributes more than ΔHsolv to ΔGsolv in the HSM, i.e. the solvation of gaseous molecules is entropy-driven, which agrees well with experimental understanding (the IGM does not show this); (iii) the temperature dependence of Henry's law coefficient was correctly reproduced with the HSM.

Advantages and application of label-free detection assays in drug screening.

PubMed

Cunningham, Brian T; Laing, Lance G

2008-08-01

Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

Iterative Refinement of a Binding Pocket Model: Active Computational Steering of Lead Optimization

PubMed Central

2012-01-01

Computational approaches for binding affinity prediction are most frequently demonstrated through cross-validation within a series of molecules or through performance shown on a blinded test set. Here, we show how such a system performs in an iterative, temporal lead optimization exercise. A series of gyrase inhibitors with known synthetic order formed the set of molecules that could be selected for “synthesis.” Beginning with a small number of molecules, based only on structures and activities, a model was constructed. Compound selection was done computationally, each time making five selections based on confident predictions of high activity and five selections based on a quantitative measure of three-dimensional structural novelty. Compound selection was followed by model refinement using the new data. Iterative computational candidate selection produced rapid improvements in selected compound activity, and incorporation of explicitly novel compounds uncovered much more diverse active inhibitors than strategies lacking active novelty selection. PMID:23046104

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Estimating the domain of applicability for machine learning QSAR models: a study on aqueous solubility of drug discovery molecules.

PubMed

Schroeter, Timon Sebastian; Schwaighofer, Anton; Mika, Sebastian; Ter Laak, Antonius; Suelzle, Detlev; Ganzer, Ursula; Heinrich, Nikolaus; Müller, Klaus-Robert

2007-12-01

We investigate the use of different Machine Learning methods to construct models for aqueous solubility. Models are based on about 4000 compounds, including an in-house set of 632 drug discovery molecules of Bayer Schering Pharma. For each method, we also consider an appropriate method to obtain error bars, in order to estimate the domain of applicability (DOA) for each model. Here, we investigate error bars from a Bayesian model (Gaussian Process (GP)), an ensemble based approach (Random Forest), and approaches based on the Mahalanobis distance to training data (for Support Vector Machine and Ridge Regression models). We evaluate all approaches in terms of their prediction accuracy (in cross-validation, and on an external validation set of 536 molecules) and in how far the individual error bars can faithfully represent the actual prediction error.

Estimating the domain of applicability for machine learning QSAR models: a study on aqueous solubility of drug discovery molecules.

PubMed

Schroeter, Timon Sebastian; Schwaighofer, Anton; Mika, Sebastian; Ter Laak, Antonius; Suelzle, Detlev; Ganzer, Ursula; Heinrich, Nikolaus; Müller, Klaus-Robert

2007-09-01

We investigate the use of different Machine Learning methods to construct models for aqueous solubility. Models are based on about 4000 compounds, including an in-house set of 632 drug discovery molecules of Bayer Schering Pharma. For each method, we also consider an appropriate method to obtain error bars, in order to estimate the domain of applicability (DOA) for each model. Here, we investigate error bars from a Bayesian model (Gaussian Process (GP)), an ensemble based approach (Random Forest), and approaches based on the Mahalanobis distance to training data (for Support Vector Machine and Ridge Regression models). We evaluate all approaches in terms of their prediction accuracy (in cross-validation, and on an external validation set of 536 molecules) and in how far the individual error bars can faithfully represent the actual prediction error.

Estimating the domain of applicability for machine learning QSAR models: a study on aqueous solubility of drug discovery molecules

NASA Astrophysics Data System (ADS)

Schroeter, Timon Sebastian; Schwaighofer, Anton; Mika, Sebastian; Ter Laak, Antonius; Suelzle, Detlev; Ganzer, Ursula; Heinrich, Nikolaus; Müller, Klaus-Robert

2007-12-01

We investigate the use of different Machine Learning methods to construct models for aqueous solubility. Models are based on about 4000 compounds, including an in-house set of 632 drug discovery molecules of Bayer Schering Pharma. For each method, we also consider an appropriate method to obtain error bars, in order to estimate the domain of applicability (DOA) for each model. Here, we investigate error bars from a Bayesian model (Gaussian Process (GP)), an ensemble based approach (Random Forest), and approaches based on the Mahalanobis distance to training data (for Support Vector Machine and Ridge Regression models). We evaluate all approaches in terms of their prediction accuracy (in cross-validation, and on an external validation set of 536 molecules) and in how far the individual error bars can faithfully represent the actual prediction error.

Estimating the domain of applicability for machine learning QSAR models: a study on aqueous solubility of drug discovery molecules

NASA Astrophysics Data System (ADS)

Schroeter, Timon Sebastian; Schwaighofer, Anton; Mika, Sebastian; Ter Laak, Antonius; Suelzle, Detlev; Ganzer, Ursula; Heinrich, Nikolaus; Müller, Klaus-Robert

2007-09-01

We investigate the use of different Machine Learning methods to construct models for aqueous solubility. Models are based on about 4000 compounds, including an in-house set of 632 drug discovery molecules of Bayer Schering Pharma. For each method, we also consider an appropriate method to obtain error bars, in order to estimate the domain of applicability (DOA) for each model. Here, we investigate error bars from a Bayesian model (Gaussian Process (GP)), an ensemble based approach (Random Forest), and approaches based on the Mahalanobis distance to training data (for Support Vector Machine and Ridge Regression models). We evaluate all approaches in terms of their prediction accuracy (in cross-validation, and on an external validation set of 536 molecules) and in how far the individual error bars can faithfully represent the actual prediction error.

Photoisomerization-induced manipulation of single-electron tunneling for novel Si-based optical memory.

PubMed

Hayakawa, Ryoma; Higashiguchi, Kenji; Matsuda, Kenji; Chikyow, Toyohiro; Wakayama, Yutaka

2013-11-13

We demonstrated optical manipulation of single-electron tunneling (SET) by photoisomerization of diarylethene molecules in a metal-insulator-semiconductor (MIS) structure. Stress is placed on the fact that device operation is realized in the practical device configuration of MIS structure and that it is not achieved in structures based on nanogap electrodes and scanning probe techniques. Namely, this is a basic memory device configuration that has the potential for large-scale integration. In our device, the threshold voltage of SET was clearly modulated as a reversible change in the molecular orbital induced by photoisomerization, indicating that diarylethene molecules worked as optically controllable quantum dots. These findings will allow the integration of photonic functionality into current Si-based memory devices, which is a unique feature of organic molecules that is unobtainable with inorganic materials. Our proposed device therefore has enormous potential for providing a breakthrough in Si technology.

How To Design a Successful p53-MDM2/X Interaction Inhibitor: A Thorough Overview Based on Crystal Structures.

PubMed

Estrada-Ortiz, Natalia; Neochoritis, Constantinos G; Dömling, Alexander

2016-04-19

A recent therapeutic strategy in oncology is based on blocking the protein-protein interaction between the murine double minute (MDM) homologues MDM2/X and the tumor-suppressor protein p53. Inhibiting the binding between wild-type (WT) p53 and its negative regulators MDM2 and/or MDMX has become an important target in oncology to restore the antitumor activity of p53, the so-called guardian of our genome. Interestingly, based on the multiple disclosed compound classes and structural analysis of small-molecule-MDM2 adducts, the p53-MDM2 complex is perhaps the best studied and most targeted protein-protein interaction. Several classes of small molecules have been identified as potent, selective, and efficient inhibitors of the p53-MDM2/X interaction, and many co-crystal structures with the protein are available. Herein we review the properties as well as preclinical and clinical studies of these small molecules and peptides, categorized by scaffold type. A particular emphasis is made on crystallographic structures and the observed binding modes of these compounds, including conserved water molecules present. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nanoparticle assisted laser desorption/ionization mass spectrometry for small molecule analytes.

PubMed

Abdelhamid, Hani Nasser

2018-03-01

Nanoparticle assisted laser desorption/ionization mass spectrometry (NPs-ALDI-MS) shows remarkable characteristics and has a promising future in terms of real sample analysis. The incorporation of NPs can advance several methods including surface assisted LDI-MS, and surface enhanced LDI-MS. These methods have advanced the detection of many thermally labile and nonvolatile biomolecules. Nanoparticles circumvent the drawbacks of conventional organic matrices for the analysis of small molecules. In most cases, NPs offer a clear background without interfering peaks, absence of fragmentation of thermally labile molecules, and allow the ionization of species with weak noncovalent interactions. Furthermore, an enhancement in sensitivity and selectivity can be achieved. NPs enable straightforward analysis of target species in a complex sample. This review (with 239 refs.) covers the progress made in laser-based mass spectrometry in combination with the use of metallic NPs (such as AuNPs, AgNPs, PtNPs, and PdNPs), NPs consisting of oxides and chalcogenides, silicon-based NPs, carbon-based nanomaterials, quantum dots, and metal-organic frameworks. Graphical abstract An overview is given on nanomaterials for use in surface-assisted laser desorption/ionization mass spectrometry of small molecules.

Peptide-based ambidextrous bifunctional gelator: applications in oil spill recovery and removal of toxic organic dyes for waste water management.

PubMed

Basu, Kingshuk; Nandi, Nibedita; Mondal, Biplab; Dehsorkhi, Ashkan; Hamley, Ian W; Banerjee, Arindam

2017-12-06

A low molecular weight peptide-based ambidextrous gelator molecule has been discovered for efficient control of water pollution. The gelator molecules can gel various organic solvents with diverse polarity, e.g. n -hexane, n -octane, petroleum ether, petrol, diesel, aromatic solvents like chlorobenzene, toluene, benzene, o -xylene and even aqueous phosphate buffer of pH 7.5. These gels have been thoroughly characterized using various techniques including field emission scanning electron microscopy, Fourier transform infrared spectroscopy, X-ray powder diffraction analysis, small angle X-ray scattering and rheological experiments. Interestingly, hydrogel obtained from the gelator molecule has been found to absorb toxic organic dyes (both cationic and anionic dyes) from dye-contaminated water. The gelator molecule can be reused for several cycles, indicating its possible future use in waste water management. Moreover, this gelator can selectively gel petrol, diesel, pump oil from an oil-water mixture in the presence of a carrier solvent, ethyl acetate, suggesting its efficient application for oil spill recovery. These results indicate that the peptide-based ambidextrous gelator produces soft materials (gels) with dual function: (i) removal of toxic organic dyes in waste water treatment and (ii) oil spill recovery.

Development of Phase-Stable Photon Upconverters for Efficient Solar Energy Utilization

NASA Astrophysics Data System (ADS)

Murakami, Yoichi

Photon upconversion based on triplet-triplet annihilation (TTA) of excited triplet molecules is drawing attention due to its applicability for weak incident light, possessing a potential for improving efficiencies of solar energy conversion devices. Since energy transfer between triplet levels of different molecules and TTA are based on the Dexter mechanism, inter-molecular collision is necessary and hence the majority of previous studies have been done with organic solvents, which are volatile and flammable. This paper presents the development and characterization of phase-stable photon upconverters fabricated with ionic liquids, which are room temperature molten salts with negligible vapor pressure and high thermal stability. The employed aromatic molecules, which are carrier of photo-created energies and are non-polar (or weakly polar) molecules, are found to be stable in the polar environment of ionic liquids, contrary to expectation. The mechanism of the stable solvation is proposed. The upconversion quantum yields are found to rapidly saturate as the excitation light power increases. An analytical model was developed and compared with the experimental data. It is shown that ionic liquids are not viscous media for the purpose of TTA-based upconversion.

Gears Based on Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Jaffe, Richard; Han, Jie; Globus, Al; Deardorff, Glenn

2005-01-01

Gears based on carbon nanotubes (see figure) have been proposed as components of an emerging generation of molecular- scale machines and sensors. In comparison with previously proposed nanogears based on diamondoid and fullerene molecules, the nanotube-based gears would have simpler structures and are more likely to be realizable by practical fabrication processes. The impetus for the practical development of carbon-nanotube- based gears arises, in part, from rapid recent progress in the fabrication of carbon nanotubes with prescribed diameters, lengths, chiralities, and numbers of concentric shells. The shafts of the proposed gears would be made from multiwalled carbon nanotubes. The gear teeth would be rigid molecules (typically, benzyne molecules), bonded to the nanotube shafts at atomically precise positions. For fabrication, it may be possible to position the molecular teeth by use of scanning tunneling microscopy (STM) or other related techniques. The capability to position individual organic molecules at room temperature by use of an STM tip has already been demonstrated. Routes to the chemical synthesis of carbon-nanotube-based gears are also under investigation. Chemical and physical aspects of the synthesis of molecular scale gears based on carbon nanotubes and related molecules, and dynamical properties of nanotube- based gears, have been investigated by computational simulations using established methods of quantum chemistry and molecular dynamics. Several particularly interesting and useful conclusions have been drawn from the dynamical simulations performed thus far: The forces acting on the gears would be more sensitive to local molecular motions than to gross mechanical motions of the overall gears. Although no breakage of teeth or of chemical bonds is expected at temperatures up to at least 3,000 K, the gears would not work well at temperatures above a critical range from about 600 to about 1,000 K. Gear temperature could probably be controlled by use of coolant gases. For a given application, the gears would work well at temperatures below the critical range, provided that the rotational energy was less than the energy required to tilt the teeth through an angle of 20 . The predominant mechanism of gear failure would be slippage caused by tilting of teeth. Gears would resume functioning if the slipping gears were decelerated sufficiently.

Protein-Based Nanomedicine Platforms for Drug Delivery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma Ham, Aihui; Tang, Zhiwen; Wu, Hong

2009-08-03

Drug delivery systems have been developed for many years, however some limitations still hurdle the pace of going to clinical phase, for example, poor biodistribution, drug molecule cytotoxicity, tissue damage, quick clearance from the circulation system, solubility and stability of drug molecules. To overcome the limitations of drug delivery, biomaterials have to be developed and applied to drug delivery to protect the drug molecules and to enhance the drug’s efficacy. Protein-based nanomedicine platforms for drug delivery are platforms comprised of naturally self-assembled protein subunits of the same protein or a combination of proteins making up a complete system. They aremore » ideal for drug delivery platforms due to their biocompatibility and biodegradability coupled with low toxicity. A variety of proteins have been used and characterized for drug delivery systems including the ferritin/apoferritin protein cage, plant derived viral capsids, the small Heat shock protein (sHsp) cage, albumin, soy and whey protein, collagen, and gelatin. There are many different types and shapes that have been prepared to deliver drug molecules using protein-based platforms including the various protein cages, microspheres, nanoparticles, hydrogels, films, minirods and minipellets. There are over 30 therapeutic compounds that have been investigated with protein-based drug delivery platforms for the potential treatment of various cancers, infectious diseases, chronic diseases, autoimmune diseases. In protein-based drug delivery platforms, protein cage is the most newly developed biomaterials for drug delivery and therapeutic applications. Their uniform sizes, multifunctions, and biodegradability push them to the frontier for drug delivery. In this review, the recent strategic development of drug delivery has been discussed with a special emphasis upon the polymer based, especially protein-based nanomedicine platforms for drug delivery. The advantages and disadvantages are also discussed for each type of protein based drug delivery system.« less

Single molecule junction conductance and binding geometry

NASA Astrophysics Data System (ADS)

Kamenetska, Maria

This Thesis addresses the fundamental problem of controlling transport through a metal-organic interface by studying electronic and mechanical properties of single organic molecule-metal junctions. Using a Scanning Tunneling Microscope (STM) we image, probe energy-level alignment and perform STM-based break junction (BJ) measurements on molecules bound to a gold surface. Using Scanning Tunneling Microscope-based break-junction (STM-BJ) techniques, we explore the effect of binding geometry on single-molecule conductance by varying the structure of the molecules, metal-molecule binding chemistry and by applying sub-nanometer manipulation control to the junction. These experiments are performed both in ambient conditions and in ultra high vacuum (UHV) at cryogenic temperatures. First, using STM imaging and scanning tunneling spectroscopy (STS) measurements we explore binding configurations and electronic properties of an amine-terminated benzene derivative on gold. We find that details of metal-molecule binding affect energy-level alignment at the interface. Next, using the STM-BJ technique, we form and rupture metal-molecule-metal junctions ˜104 times to obtain conductance-vs-extension curves and extract most likely conductance values for each molecule. With these measurements, we demonstrated that the control of junction conductance is possible through a choice of metal-molecule binding chemistry and sub-nanometer positioning. First, we show that molecules terminated with amines, sulfides and phosphines bind selectively on gold and therefore demonstrate constant conductance levels even as the junction is elongated and the metal-molecule attachment point is modified. Such well-defined conductance is also obtained with paracyclophane molecules which bind to gold directly through the pi system. Next, we are able to create metal-molecule-metal junctions with more than one reproducible conductance signatures that can be accessed by changing junction geometry. In the case of pyridine-linked molecules, conductance can be reliably switched between two distinct conductance states using sub-nanometer mechanical manipulation. Using a methyl sulfide linker attached to an oligoene backbone, we are able to create a 3-nm-long molecular potentiometer, whose resistance can be tuned exponentially with Angstom-scale modulations in metal-molecule configuration. These experiments points to a new paradigm for attaining reproducible electrical characteristics of metal-organic devices which involves controlling linker-metal chemistry rather than fabricating identically structured metal-molecule interfaces. By choosing a linker group which is either insensitive to or responds reproducibly to changes in metal-molecule configuration, one can design single molecule devices with functionality more complex than a simple resistor. These ambient temperature experiments were combined with UHV conductance measurements performed in a commercial STM on amine-terminated benzene derivatives which conduct through a non-resonant tunneling mechanism, at temperatures varying from 5 to 300 Kelvin. Our results indicate that while amine-gold binding remains selective irrespective of environment, conductance is not temperature independent, in contrast to what is expected for a tunneling mechanism. Furthermore, using temperature-dependent measurements in ambient conditions we find that HOMO-conducting amines and LUMO-conducting pyridines show opposite dependence of conductance on temperature. These results indicate that energy-level alignment between the molecule and the electrodes changes as a result of varying electrode structure at different temperatures. We find that temperature can serve as a knob with which to tune transport properties of single molecule-metal junctions.

MLViS: A Web Tool for Machine Learning-Based Virtual Screening in Early-Phase of Drug Discovery and Development

PubMed Central

Korkmaz, Selcuk; Zararsiz, Gokmen; Goksuluk, Dincer

2015-01-01

Virtual screening is an important step in early-phase of drug discovery process. Since there are thousands of compounds, this step should be both fast and effective in order to distinguish drug-like and nondrug-like molecules. Statistical machine learning methods are widely used in drug discovery studies for classification purpose. Here, we aim to develop a new tool, which can classify molecules as drug-like and nondrug-like based on various machine learning methods, including discriminant, tree-based, kernel-based, ensemble and other algorithms. To construct this tool, first, performances of twenty-three different machine learning algorithms are compared by ten different measures, then, ten best performing algorithms have been selected based on principal component and hierarchical cluster analysis results. Besides classification, this application has also ability to create heat map and dendrogram for visual inspection of the molecules through hierarchical cluster analysis. Moreover, users can connect the PubChem database to download molecular information and to create two-dimensional structures of compounds. This application is freely available through www.biosoft.hacettepe.edu.tr/MLViS/. PMID:25928885

Elucidating the Key Role of a Lewis Base Solvent in the Formation of Perovskite Films Fabricated from the Lewis Adduct Approach.

PubMed

Cao, Xiaobing; Zhi, Lili; Li, Yahui; Fang, Fei; Cui, Xian; Yao, Youwei; Ci, Lijie; Ding, Kongxian; Wei, Jinquan

2017-09-27

High-quality perovskite films can be fabricated from Lewis acid-base adducts through molecule exchange. Substantial work is needed to fully understand the formation mechanism of the perovskite films, which helps to further improve their quality. Here, we study the formation of CH 3 NH 3 PbI 3 perovskite films by introducing some dimethylacetamide into the PbI 2 /N,N-dimethylformamide solution. We reveal that there are three key processes during the formation of perovskite films through the Lewis acid-base adduct approach: molecule intercalation of solvent into the PbI 2 lattice, molecule exchange between the solvent and CH 3 NH 3 I, and dissolution-recrystallization of the perovskite grains during annealing. The Lewis base solvents play multiple functions in the above processes. The properties of the solvent, including Lewis basicity and boiling point, play key roles in forming smooth perovskite films with large grains. We also provide some rules for choosing Lewis base additives to prepare high-quality perovskite films through the Lewis adduct approach.

Constant size descriptors for accurate machine learning models of molecular properties

NASA Astrophysics Data System (ADS)

Collins, Christopher R.; Gordon, Geoffrey J.; von Lilienfeld, O. Anatole; Yaron, David J.

2018-06-01

Two different classes of molecular representations for use in machine learning of thermodynamic and electronic properties are studied. The representations are evaluated by monitoring the performance of linear and kernel ridge regression models on well-studied data sets of small organic molecules. One class of representations studied here counts the occurrence of bonding patterns in the molecule. These require only the connectivity of atoms in the molecule as may be obtained from a line diagram or a SMILES string. The second class utilizes the three-dimensional structure of the molecule. These include the Coulomb matrix and Bag of Bonds, which list the inter-atomic distances present in the molecule, and Encoded Bonds, which encode such lists into a feature vector whose length is independent of molecular size. Encoded Bonds' features introduced here have the advantage of leading to models that may be trained on smaller molecules and then used successfully on larger molecules. A wide range of feature sets are constructed by selecting, at each rank, either a graph or geometry-based feature. Here, rank refers to the number of atoms involved in the feature, e.g., atom counts are rank 1, while Encoded Bonds are rank 2. For atomization energies in the QM7 data set, the best graph-based feature set gives a mean absolute error of 3.4 kcal/mol. Inclusion of 3D geometry substantially enhances the performance, with Encoded Bonds giving 2.4 kcal/mol, when used alone, and 1.19 kcal/mol, when combined with graph features.

DFT study of adsorption behavior of NO, CO, NO2, and NH3 molecules on graphene-like BC3: A search for highly sensitive molecular sensor

NASA Astrophysics Data System (ADS)

Mehdi Aghaei, Sadegh; Monshi, M. M.; Torres, I.; Zeidi, S. M. J.; Calizo, I.

2018-01-01

The adsorption behaviors of toxic gas molecules (NO, CO, NO2, and NH3) on the graphene-like boron carbide (BC3) are investigated using first-principle density functional theory. The graphene-like BC3 monolayer is a semiconductor with a band gap of 0.733 eV. It is discovered that all the above gas molecules are chemisorbed on the BC3 sheet while they retain their molecular forms. It is also revealed that the NO2 gas molecule could be dissociated into NO and O species through the adsorption process. The amounts of charge transfer upon adsorption of CO and NH3 gas molecules on the BC3 are found to be small. The band gap changes in BC3 as a result of interactions with CO and NH3 are only 4.63% and 16.7%, indicating that the BC3-based sensor has a low and moderate sensitivity to CO and NH3, respectively. Contrariwise, upon adsorption of NO or NO2 on the BC3, significant charges are transferred from the molecules to the BC3 sheet, causing a semiconductor-metal and semiconductor-p type semiconductor transition. Our study suggests that the BC3-based sensor has a high potential for NO and NO2 detection due to the significant conductance changes, moderate adsorption energy, and short recovery time. More excitingly, the BC3 is a likely catalyst for dissociation of the NO2 gas molecule.

Hydration of Atmospheric Molecular Clusters: Systematic Configurational Sampling.

PubMed

Kildgaard, Jens; Mikkelsen, Kurt V; Bilde, Merete; Elm, Jonas

2018-05-09

We present a new systematic configurational sampling algorithm for investigating the potential energy surface of hydrated atmospheric molecular clusters. The algo- rithm is based on creating a Fibonacci sphere around each atom in the cluster and adding water molecules to each point in 9 different orientations. To allow the sam- pling of water molecules to existing hydrogen bonds, the cluster is displaced along the hydrogen bond and a water molecule is placed in between in three different ori- entations. Generated redundant structures are eliminated based on minimizing the root mean square distance (RMSD) of different conformers. Initially, the clusters are sampled using the semiempirical PM6 method and subsequently using density func- tional theory (M06-2X and ωB97X-D) with the 6-31++G(d,p) basis set. Applying the developed algorithm we study the hydration of sulfuric acid with up to 15 water molecules. We find that the additions of the first four water molecules "saturate" the sulfuric acid molecule and are more thermodynamically favourable than the addition of water molecule 5-15. Using the large generated set of conformers, we assess the performance of approximate methods (ωB97X-D, M06-2X, PW91 and PW6B95-D3) in calculating the binding energies and assigning the global minimum conformation compared to high level CCSD(T)-F12a/VDZ-F12 reference calculations. The tested DFT functionals systematically overestimates the binding energies compared to cou- pled cluster calculations, and we find that this deficiency can be corrected by a simple scaling factor.

Silk-based delivery systems of bioactive molecules

PubMed Central

Numata, Keiji; Kaplan, David L

2010-01-01

Silks are biodegradable, biocompatible, self-assemblying proteins that can also be tailored via genetic engineering to contain specific chemical features, offering utility for drug and gene delivery. Silkworm silk has been used in biomedical sutures for decades and has recently achieved Food and Drug Administration approval for expanded biomaterials device utility. With the diversity and control of size, structure and chemistry, modified or recombinant silk proteins can be designed and utilized in various biomedical application, such as for the delivery of bioactive molecules. This review focuses on the biosynthesis and applications of silk-based multi-block copolymer systems and related silk protein drug delivery systems. The utility of these systems for the delivery of small molecule drugs, proteins and genes are reviewed. PMID:20298729

Nanotubule and Tour Molecule Based Molecular Electronics: Suggestion for a Hybrid Approach

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Saini, Subhash (Technical Monitor)

1998-01-01

Recent experimental and theoretical attempts and results indicate two distinct broad pathways towards future molecular electronic devices and architectures. The first is the approach via Tour type ladder molecules and their junctions which can be fabricated with solution phase chemical approaches. Second are fullerenes or nanotubules and their junctions which may have better conductance, switching and amplifying characteristics but can not be made through well controlled and defined chemical means. A hybrid approach combining the two pathways to take advantage of the characteristics of both is suggested. Dimension and scale of such devices would be somewhere in between isolated molecule and nanotubule based devices but it maybe possible to use self-assembly towards larger functional and logicalunits.

Effect of multi-dimensional ultraviolet light exposure on the growth of pentacene film and application to organic field-effect transistors.

PubMed

Bae, Jin-Hyuk; Lee, Sin-Doo; Choi, Jong Sun; Park, Jaehoon

2012-05-01

We report on the multi-dimensional alignment of pentacene molecules on a poly(methyl methacrylate)-based photosensitive polymer (PMMA-polymer) and its effect on the electrical performance of the pentacene-based field-effect transistor (FET). Pentacene molecules are shown to be preferentially aligned on the linearly polarized ultraviolet (LPUV)-exposed PMMA-polymer layer, which is contrast to an isotropic alignment on the bare PMMA-polymer layer. Multi-dimensional alignment of pentacene molecules in the film could be achieved by adjusting the direction of LPUV exposed to the PMMA-polymer. The control of pentacene molecular alignment is found to be promising for the field-effect mobility enhancement in the pentacene FET.

Can time-dependent density functional theory predict intersystem crossing in organic chromophores? A case study on benzo(bis)-X-diazole based donor-acceptor-donor type molecules.

PubMed

Tam, Teck Lip Dexter; Lin, Ting Ting; Chua, Ming Hui

2017-06-21

Here we utilized new diagnostic tools in time-dependent density functional theory to explain the trend of intersystem crossing in benzo(bis)-X-diazole based donor-acceptor-donor type molecules. These molecules display a wide range of fluorescence quantum yields and triplet yields, making them excellent candidates for testing the validity of these diagnostic tools. We believe that these tools are cost-effective and can be applied to structurally similar organic chromophores to predict/explain the trends of intersystem crossing, and thus fluorescence quantum yields and triplet yields without the use of complex and expensive multireference configuration interaction or multireference pertubation theory methods.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

An algorithm to identify functional groups in organic molecules.

PubMed

Ertl, Peter

2017-06-07

The concept of functional groups forms a basis of organic chemistry, medicinal chemistry, toxicity assessment, spectroscopy and also chemical nomenclature. All current software systems to identify functional groups are based on a predefined list of substructures. We are not aware of any program that can identify all functional groups in a molecule automatically. The algorithm presented in this article is an attempt to solve this scientific challenge. An algorithm to identify functional groups in a molecule based on iterative marching through its atoms is described. The procedure is illustrated by extracting functional groups from the bioactive portion of the ChEMBL database, resulting in identification of 3080 unique functional groups. A new algorithm to identify all functional groups in organic molecules is presented. The algorithm is relatively simple and full details with examples are provided, therefore implementation in any cheminformatics toolkit should be relatively easy. The new method allows the analysis of functional groups in large chemical databases in a way that was not possible using previous approaches. Graphical abstract .

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Automatic Compound Annotation from Mass Spectrometry Data Using MAGMa

PubMed Central

Ridder, Lars; van der Hooft, Justin J. J.; Verhoeven, Stefan

2014-01-01

The MAGMa software for automatic annotation of mass spectrometry based fragmentation data was applied to 16 MS/MS datasets of the CASMI 2013 contest. Eight solutions were submitted in category 1 (molecular formula assignments) and twelve in category 2 (molecular structure assignment). The MS/MS peaks of each challenge were matched with in silico generated substructures of candidate molecules from PubChem, resulting in penalty scores that were used for candidate ranking. In 6 of the 12 submitted solutions in category 2, the correct chemical structure obtained the best score, whereas 3 molecules were ranked outside the top 5. All top ranked molecular formulas submitted in category 1 were correct. In addition, we present MAGMa results generated retrospectively for the remaining challenges. Successful application of the MAGMa algorithm required inclusion of the relevant candidate molecules, application of the appropriate mass tolerance and a sufficient degree of in silico fragmentation of the candidate molecules. Furthermore, the effect of the exhaustiveness of the candidate lists and limitations of substructure based scoring are discussed. PMID:26819876

Automatic Compound Annotation from Mass Spectrometry Data Using MAGMa.

PubMed

Ridder, Lars; van der Hooft, Justin J J; Verhoeven, Stefan

2014-01-01

The MAGMa software for automatic annotation of mass spectrometry based fragmentation data was applied to 16 MS/MS datasets of the CASMI 2013 contest. Eight solutions were submitted in category 1 (molecular formula assignments) and twelve in category 2 (molecular structure assignment). The MS/MS peaks of each challenge were matched with in silico generated substructures of candidate molecules from PubChem, resulting in penalty scores that were used for candidate ranking. In 6 of the 12 submitted solutions in category 2, the correct chemical structure obtained the best score, whereas 3 molecules were ranked outside the top 5. All top ranked molecular formulas submitted in category 1 were correct. In addition, we present MAGMa results generated retrospectively for the remaining challenges. Successful application of the MAGMa algorithm required inclusion of the relevant candidate molecules, application of the appropriate mass tolerance and a sufficient degree of in silico fragmentation of the candidate molecules. Furthermore, the effect of the exhaustiveness of the candidate lists and limitations of substructure based scoring are discussed.

Reaction-based small-molecule fluorescent probes for dynamic detection of ROS and transient redox changes in living cells and small animals.

PubMed

Lü, Rui

2017-09-01

Dynamic detection of transient redox changes in living cells and animals has broad implications for human health and disease diagnosis, because intracellular redox homeostasis regulated by reactive oxygen species (ROS) plays important role in cell functions, normal physiological functions and some serious human diseases (e.g., cancer, Alzheimer's disease, diabetes, etc.) usually have close relationship with the intracellular redox status. Small-molecule ROS-responsive fluorescent probes can act as powerful tools for dynamic detection of ROS and redox changes in living cells and animals through fluorescence imaging techniques; and great advances have been achieved recently in the design and synthesis of small-molecule ROS-responsive fluorescent probes. This article highlights up-to-date achievements in designing and using the reaction-based small-molecule fluorescent probes (with high sensitivity and selectivity to ROS and redox cycles) in the dynamic detection of ROS and transient redox changes in living cells and animals through fluorescence imaging. Copyright © 2017. Published by Elsevier Ltd.

Dynamically fluctuating electric dipole moments in fullerene-based magnets.

PubMed

Kambe, Takashi; Oshima, Kokichi

2014-09-19

We report here the direct evidence of the existence of a permanent electric dipole moment in both crystal phases of a fullerene-based magnet--the ferromagnetic α-phase and the antiferromagnetic α'-phase of tetra-kis-(dimethylamino)-ethylene-C60 (TDAE-C60)--as determined by dielectric measurements. We propose that the permanent electric dipole originates from the pairing of a TDAE molecule with surrounding C60 molecules. The two polymorphs exhibit clear differences in their dielectric responses at room temperature and during the freezing process with dynamically fluctuating electric dipole moments, although no difference in their room-temperature structures has been previously observed. This result implies that two polymorphs have different local environment around the molecules. In particular, the ferromagnetism of the α-phase is founded on the homogeneous molecule displacement and orientational ordering. The formation of the different phases with respect to the different rotational states in the Jahn-Teller distorted C60s is also discussed.

Dynamically fluctuating electric dipole moments in fullerene-based magnets

PubMed Central

Kambe, Takashi; Oshima, Kokichi

2014-01-01

We report here the direct evidence of the existence of a permanent electric dipole moment in both crystal phases of a fullerene-based magnet—the ferromagnetic α-phase and the antiferromagnetic α′-phase of tetra-kis-(dimethylamino)-ethylene-C60 (TDAE-C60)—as determined by dielectric measurements. We propose that the permanent electric dipole originates from the pairing of a TDAE molecule with surrounding C60 molecules. The two polymorphs exhibit clear differences in their dielectric responses at room temperature and during the freezing process with dynamically fluctuating electric dipole moments, although no difference in their room-temperature structures has been previously observed. This result implies that two polymorphs have different local environment around the molecules. In particular, the ferromagnetism of the α-phase is founded on the homogeneous molecule displacement and orientational ordering. The formation of the different phases with respect to the different rotational states in the Jahn–Teller distorted C60s is also discussed. PMID:25236361

Sequence-based design of bioactive small molecules that target precursor microRNAs.

PubMed

Velagapudi, Sai Pradeep; Gallo, Steven M; Disney, Matthew D

2014-04-01

Oligonucleotides are designed to target RNA using base pairing rules, but they can be hampered by poor cellular delivery and nonspecific stimulation of the immune system. Small molecules are preferred as lead drugs or probes but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA hairpin precursors, and it identified bioactive small molecules that inhibit biogenesis by binding nuclease-processing sites (44% hit rate). Among 27 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Markedly, microRNA profiling shows that 1 only affects microRNA-96 biogenesis and is at least as selective as an oligonucleotide.

Sequence-based design of bioactive small molecules that target precursor microRNAs

PubMed Central

Velagapudi, Sai Pradeep; Gallo, Steven M.; Disney, Matthew D.

2014-01-01

Oligonucleotides are designed to target RNA using base pairing rules, however, they are hampered by poor cellular delivery and non-specific stimulation of the immune system. Small molecules are preferred as lead drugs or probes, but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA precursors and identified bioactive small molecules that inhibit biogenesis by binding to nuclease processing sites (41% hit rate). Amongst 29 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Importantly, microRNA profiling shows that 1 only significantly effects microRNA-96 biogenesis and is more selective than an oligonucleotide. PMID:24509821

An ultrasensitive universal detector based on neutralizer displacement

NASA Astrophysics Data System (ADS)

Das, Jagotamoy; Cederquist, Kristin B.; Zaragoza, Alexandre A.; Lee, Paul E.; Sargent, Edward H.; Kelley, Shana O.

2012-08-01

Diagnostic technologies that can provide the simultaneous detection of nucleic acids for gene expression, proteins for host response and small molecules for profiling the human metabolome will have a significant advantage in providing comprehensive patient monitoring. Molecular sensors that report changes in the electrostatics of a sensor's surface on analyte binding have shown unprecedented sensitivity in the detection of charged biomolecules, but do not lend themselves to the detection of small molecules, which do not carry significant charge. Here, we introduce the neutralizer displacement assay that allows charge-based sensing to be applied to any class of molecule irrespective of the analyte charge. The neutralizer displacement assay starts with an aptamer probe bound to a neutralizer. When analyte binding occurs the neutralizer is displaced, which results in a dramatic change in the surface charge for all types of analytes. We have tested the sensitivity, speed and specificity of this system in the detection of a panel of molecules: (deoxy)ribonucleic acid, ribonucleic acid, cocaine, adenosine triphosphate and thrombin.

Self-assembly formation of palm-based esters nano-emulsion: A molecular dynamics study

NASA Astrophysics Data System (ADS)

Abdul Rahman, Mohd. Basyaruddin; Huan, Qiu-Yi; Tejo, Bimo A.; Basri, Mahiran; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Abdul

2009-10-01

Palm-oil esters (POEs) are unsaturated and non-ionic esters that can be prepared by enzymatic synthesis from palm oil. Their nano-emulsion properties possess great potential to act as drug carrier for transdermal drug delivery system. A ratio of 75:5:20 (water/POEs/Span20) was chosen from homogenous region in the phase diagram of our previous experimental work to undergo molecular dynamics simulation. A 15 ns molecular dynamics simulation of nano-emulsion system (water/POEs/Span20) was carried out using OPLS-AA force field. The aggregations of the oil and surfactant molecules are observed throughout the simulation. After 8 ns of simulation, the molecules start to aggregate to form one spherical micelle where the POEs molecules are surrounded by the non-ionic surfactant (Span20) molecules with an average size of 4.2 ± 0.05 nm. The size of the micelle and the ability of palm-based nano-emulsion to self-assemble suggest that this nano-emulsion can potentially use in transdermal drug delivery system.

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE PAGES

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian; ...

2017-12-12

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

Structure–property relationships in atomic-scale junctions: Histograms and beyond

DOE PAGES

Mark S. Hybertsen; Venkataraman, Latha

2016-03-03

Over the past 10 years, there has been tremendous progress in the measurement, modeling and understanding of structure–function relationships in single molecule junctions. Numerous research groups have addressed significant scientific questions, directed both to conductance phenomena at the single molecule level and to the fundamental chemistry that controls junction functionality. Many different functionalities have been demonstrated, including single-molecule diodes, optically and mechanically activated switches, and, significantly, physical phenomena with no classical analogues, such as those based on quantum interference effects. Experimental techniques for reliable and reproducible single molecule junction formation and characterization have led to this progress. In particular, themore » scanning tunneling microscope based break-junction (STM-BJ) technique has enabled rapid, sequential measurement of large numbers of nanoscale junctions allowing a statistical analysis to readily distinguish reproducible characteristics. Furthermore, harnessing fundamental link chemistry has provided the necessary chemical control over junction formation, enabling measurements that revealed clear relationships between molecular structure and conductance characteristics.« less

Structure–property relationships in atomic-scale junctions: Histograms and beyond

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mark S. Hybertsen; Venkataraman, Latha

Over the past 10 years, there has been tremendous progress in the measurement, modeling and understanding of structure–function relationships in single molecule junctions. Numerous research groups have addressed significant scientific questions, directed both to conductance phenomena at the single molecule level and to the fundamental chemistry that controls junction functionality. Many different functionalities have been demonstrated, including single-molecule diodes, optically and mechanically activated switches, and, significantly, physical phenomena with no classical analogues, such as those based on quantum interference effects. Experimental techniques for reliable and reproducible single molecule junction formation and characterization have led to this progress. In particular, themore » scanning tunneling microscope based break-junction (STM-BJ) technique has enabled rapid, sequential measurement of large numbers of nanoscale junctions allowing a statistical analysis to readily distinguish reproducible characteristics. Furthermore, harnessing fundamental link chemistry has provided the necessary chemical control over junction formation, enabling measurements that revealed clear relationships between molecular structure and conductance characteristics.« less

Single molecule transistor based nanopore for the detection of nicotine

NASA Astrophysics Data System (ADS)

Ray, S. J.

2014-12-01

A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

Stable Au–C bonds to the substrate for fullerene-based nanostructures

PubMed Central

Chutora, Taras; Redondo, Jesús; de la Torre, Bruno; Švec, Martin

2017-01-01

We report on the formation of fullerene-derived nanostructures on Au(111) at room temperature and under UHV conditions. After low-energy ion sputtering of fullerene films deposited on Au(111), bright spots appear at the herringbone corner sites when measured using a scanning tunneling microscope. These features are stable at room temperature against diffusion on the surface. We carry out DFT calculations of fullerene molecules having one missing carbon atom to simulate the vacancies in the molecules resulting from the sputtering process. These modified fullerenes have an adsorption energy on the Au(111) surface that is 1.6 eV higher than that of C60 molecules. This increased binding energy arises from the saturation by the Au surface of the bonds around the molecular vacancy defect. We therefore interpret the observed features as adsorbed fullerene-derived molecules with C vacancies. This provides a pathway for the formation of fullerene-based nanostructures on Au at room temperature. PMID:28685108

Unified analysis of optical absorption spectra of carotenoids based on a stochastic model.

PubMed

Uragami, Chiasa; Saito, Keisuke; Yoshizawa, Masayuki; Molnár, Péter; Hashimoto, Hideki

2018-05-03

The chemical structures of the carotenoid molecules are very simple and one might think that the electronic feature of it is easily predicted. However, it still has so much unknown information except the correlation between the electronic energy state and the length of effective conjugation chain of carotenoids. To investigate the electronic feature of the carotenoids, the most essential method is measuring the optical absorption spectra, but simulating it from the resonance Raman spectra is also the effective way. From this reason, we studied the optical absorption spectra as well as resonance Raman spectra of 15 different kinds of cyclic carotenoid molecules, recorded in tetrahydrofuran (THF) solutions at room temperature. The whole band shapes of the absorption spectra of all these carotenoid molecules were successfully simulated based on a stochastic model using Brownian oscillators. The parameters obtained from the simulation made it possible to discuss the intermolecular interaction between carotenoids and solvent THF molecules quantitatively. Copyright © 2018. Published by Elsevier Inc.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

Tuning the conductance of H2O@C60 by position of the encapsulated H2O

PubMed Central

Zhu, Chengbo; Wang, Xiaolin

2015-01-01

The change of conductance of single-molecule junction in response to various external stimuli is the fundamental mechanism for the single-molecule electronic devices with multiple functionalities. We propose the concept that the conductance of molecular systems can be tuned from inside. The conductance is varied in C60 with encapsulated H2O, H2O@C60. The transport properties of the H2O@C60-based nanostructure sandwiched between electrodes are studied using first-principles calculations combined with the non-equilibrium Green’s function formalism. Our results show that the conductance of the H2O@C60 is sensitive to the position of the H2O and its dipole direction inside the cage with changes in conductance up to 20%. Our study paves a way for the H2O@C60 molecule to be a new platform for novel molecule-based electronics and sensors. PMID:26643873

Subclass-specific labeling of protein-reactive natural products with customized nucleophilic probes.

PubMed

Rudolf, Georg C; Koch, Maximilian F; Mandl, Franziska A M; Sieber, Stephan A

2015-02-23

Natural products represent a rich source of bioactive compounds that constitute a large fraction of approved drugs. Among those are molecules with electrophilic scaffolds, such as Michael acceptors, β-lactams, and epoxides that irreversibly inhibit essential enzymes based on their catalytic mechanism. In the search for novel bioactive molecules, current methods are challenged by the frequent rediscovery of known chemical entities. Herein small nucleophilic probes that attack electrophilic natural products and enhance their detection by HPLC-UV and HPLC-MS are introduced. A screen of diverse probe designs revealed one compound with a desired selectivity for epoxide- and maleimide-based antibiotics. Correspondingly, the natural products showdomycin and phosphomycin could be selectively targeted in extracts of their natural producing organism, in which the probe-modified molecules exhibited superior retention and MS detection relative to their unmodified counterparts. This method may thus help to discover small, electrophilic molecules that might otherwise easily elude detection in complex samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electronic structure of Fe- vs. Ru-based dye molecules

NASA Astrophysics Data System (ADS)

Johnson, Phillip S.; Cook, Peter L.; Zegkinoglou, Ioannis; García-Lastra, J. M.; Rubio, Angel; Ruther, Rose E.; Hamers, Robert J.; Himpsel, F. J.

2013-01-01

In order to explore whether Ru can be replaced by inexpensive Fe in dye molecules for solar cells, the differences in the electronic structure of Fe- and Ru-based dyes are investigated by X-ray absorption spectroscopy and first-principles calculations. Molecules with the metal in a sixfold, octahedral N cage, such as tris(bipyridines) and tris(phenanthrolines), exhibit a systematic downward shift of the N 1s-to-π* transition when Ru is replaced by Fe. This shift is explained by an extra transfer of negative charge from the metal to the N ligands in the case of Fe, which reduces the binding energy of the N 1s core level. The C 1s-to-π* transitions show the opposite trend, with an increase in the transition energy when replacing Ru by Fe. Molecules with the metal in a fourfold, planar N cage (porphyrins) exhibit a more complex behavior due to a subtle competition between the crystal field, axial ligands, and the 2+ vs. 3+ oxidation states.

GREEN: A program package for docking studies in rational drug design

NASA Astrophysics Data System (ADS)

Tomioka, Nobuo; Itai, Akiko

1994-08-01

A program package, GREEN, has been developed that enables docking studies between ligand molecules and a protein molecule. Based on the structure of the protein molecule, the physical and chemical environment of the ligand-binding site is expressed as three-dimensional grid-point data. The grid-point data are used for the real-time evaluation of the protein-ligand interaction energy, as well as for the graphical representation of the binding-site environment. The interactive docking operation is facilitated by various built-in functions, such as energy minimization, energy contribution analysis and logging of the manipulation trajectory. Interactive modeling functions are incorporated for designing new ligand molecules while considering the binding-site environment and the protein-ligand interaction. As an example of the application of GREEN, a docking study is presented on the complex between trypsin and a synthetic trypsin inhibitor. The program package will be useful for rational drug design, based on the 3D structure of the target protein.

Automatic superposition of drug molecules based on their common receptor site

NASA Astrophysics Data System (ADS)

Kato, Yuichi; Inoue, Atsushi; Yamada, Miho; Tomioka, Nobuo; Itai, Akiko

1992-10-01

We have prevously developed a new rational method for superposing molecules in terms of submolecular physical and chemical properties, but not in terms of atom positions or chemical structures as has been done in the conventional methods. The program was originally developed for interactive use on a three-dimensional graphic display, providing goodness-of-fit indices on molecular shape, hydrogen bonds, electrostatic interactions and others. Here, we report a new unbiased searching method for the best superposition of molecules, covering all the superposing modes and conformational freedom, as an additional function of the program. The function is based on a novel least-squares method which superposes the expected positions and orientations of hydrogen bonding partners in the receptor that are deduced from both molecules. The method not only gives reliability and reproducibility to the result of the superposition, but also allows us to save labor and time. It is demonstrated that this method is very efficient for finding the correct superposing mode in such systems where hydrogen bonds play important roles.

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

The separation between the 5'-3' ends in long RNA molecules is short and nearly constant.

PubMed

Leija-Martínez, Nehemías; Casas-Flores, Sergio; Cadena-Nava, Rubén D; Roca, Joan A; Mendez-Cabañas, José A; Gomez, Eduardo; Ruiz-Garcia, Jaime

2014-12-16

RNA molecules play different roles in coding, decoding and gene expression regulation. Such roles are often associated to the RNA secondary or tertiary structures. The folding dynamics lead to multiple secondary structures of long RNA molecules, since an RNA molecule might fold into multiple distinct native states. Despite an ensemble of different structures, it has been theoretically proposed that the separation between the 5' and 3' ends of long single-stranded RNA molecules (ssRNA) remains constant, independent of their base content and length. Here, we present the first experimental measurements of the end-to-end separation in long ssRNA molecules. To determine this separation, we use single molecule Fluorescence Resonance Energy Transfer of fluorescently end-labeled ssRNA molecules ranging from 500 to 5500 nucleotides in length, obtained from two viruses and a fungus. We found that the end-to-end separation is indeed short, within 5-9 nm. It is remarkable that the separation of the ends of all RNA molecules studied remains small and similar, despite the origin, length and differences in their secondary structure. This implies that the ssRNA molecules are 'effectively circularized' something that might be a general feature of RNAs, and could result in fine-tuning for translation and gene expression regulation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mapping the Small Molecule Interactome by Mass Spectrometry.

PubMed

Flaxman, Hope A; Woo, Christina M

2018-01-16

Mapping small molecule interactions throughout the proteome provides the critical structural basis for functional analysis of their impact on biochemistry. However, translation of mass spectrometry-based proteomics methods to directly profile the interaction between a small molecule and the whole proteome is challenging because of the substoichiometric nature of many interactions, the diversity of covalent and noncovalent interactions involved, and the subsequent computational complexity associated with their spectral assignment. Recent advances in chemical proteomics have begun fill this gap to provide a structural basis for the breadth of small molecule-protein interactions in the whole proteome. Innovations enabling direct characterization of the small molecule interactome include faster, more sensitive instrumentation coupled to chemical conjugation, enrichment, and labeling methods that facilitate detection and assignment. These methods have started to measure molecular interaction hotspots due to inherent differences in local amino acid reactivity and binding affinity throughout the proteome. Measurement of the small molecule interactome is producing structural insights and methods for probing and engineering protein biochemistry. Direct structural characterization of the small molecule interactome is a rapidly emerging area pushing new frontiers in biochemistry at the interface of small molecules and the proteome.

Chemical Selectivity and Sensitivity of a 16-Channel Electronic Nose for Trace Vapour Detection

PubMed Central

Strle, Drago; Trifkovič, Mario; Van Miden, Marion; Kvasić, Ivan; Zupanič, Erik; Muševič, Igor

2017-01-01

Good chemical selectivity of sensors for detecting vapour traces of targeted molecules is vital to reliable detection systems for explosives and other harmful materials. We present the design, construction and measurements of the electronic response of a 16 channel electronic nose based on 16 differential microcapacitors, which were surface-functionalized by different silanes. The e-nose detects less than 1 molecule of TNT out of 10+12 N2 molecules in a carrier gas in 1 s. Differently silanized sensors give different responses to different molecules. Electronic responses are presented for TNT, RDX, DNT, H2S, HCN, FeS, NH3, propane, methanol, acetone, ethanol, methane, toluene and water. We consider the number density of these molecules and find that silane surfaces show extreme affinity for attracting molecules of TNT, DNT and RDX. The probability to bind these molecules and form a surface-adsorbate is typically 10+7 times larger than the probability to bind water molecules, for example. We present a matrix of responses of differently functionalized microcapacitors and we propose that chemical selectivity of multichannel e-nose could be enhanced by using artificial intelligence deep learning methods. PMID:29292764

Large scale study of multiple-molecule queries

PubMed Central

2009-01-01

Background In ligand-based screening, as well as in other chemoinformatics applications, one seeks to effectively search large repositories of molecules in order to retrieve molecules that are similar typically to a single molecule lead. However, in some case, multiple molecules from the same family are available to seed the query and search for other members of the same family. Multiple-molecule query methods have been less studied than single-molecule query methods. Furthermore, the previous studies have relied on proprietary data and sometimes have not used proper cross-validation methods to assess the results. In contrast, here we develop and compare multiple-molecule query methods using several large publicly available data sets and background. We also create a framework based on a strict cross-validation protocol to allow unbiased benchmarking for direct comparison in future studies across several performance metrics. Results Fourteen different multiple-molecule query methods were defined and benchmarked using: (1) 41 publicly available data sets of related molecules with similar biological activity; and (2) publicly available background data sets consisting of up to 175,000 molecules randomly extracted from the ChemDB database and other sources. Eight of the fourteen methods were parameter free, and six of them fit one or two free parameters to the data using a careful cross-validation protocol. All the methods were assessed and compared for their ability to retrieve members of the same family against the background data set by using several performance metrics including the Area Under the Accumulation Curve (AUAC), Area Under the Curve (AUC), F1-measure, and BEDROC metrics. Consistent with the previous literature, the best parameter-free methods are the MAX-SIM and MIN-RANK methods, which score a molecule to a family by the maximum similarity, or minimum ranking, obtained across the family. One new parameterized method introduced in this study and two previously defined methods, the Exponential Tanimoto Discriminant (ETD), the Tanimoto Power Discriminant (TPD), and the Binary Kernel Discriminant (BKD), outperform most other methods but are more complex, requiring one or two parameters to be fit to the data. Conclusion Fourteen methods for multiple-molecule querying of chemical databases, including novel methods, (ETD) and (TPD), are validated using publicly available data sets, standard cross-validation protocols, and established metrics. The best results are obtained with ETD, TPD, BKD, MAX-SIM, and MIN-RANK. These results can be replicated and compared with the results of future studies using data freely downloadable from http://cdb.ics.uci.edu/. PMID:20298525

Identification of a Broad-Spectrum Antiviral Small Molecule against Severe Acute Respiratory Syndrome Coronavirus and Ebola, Hendra, and Nipah Viruses by Using a Novel High-Throughput Screening Assay

PubMed Central

Elshabrawy, Hatem A.; Fan, Jilao; Haddad, Christine S.; Ratia, Kiira; Broder, Christopher C.; Caffrey, Michael

2014-01-01

ABSTRACT Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. IMPORTANCE We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug. PMID:24501399

Identification of a broad-spectrum antiviral small molecule against severe acute respiratory syndrome coronavirus and Ebola, Hendra, and Nipah viruses by using a novel high-throughput screening assay.

PubMed

Elshabrawy, Hatem A; Fan, Jilao; Haddad, Christine S; Ratia, Kiira; Broder, Christopher C; Caffrey, Michael; Prabhakar, Bellur S

2014-04-01

Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug.

Sub-500 fs electronically nonadiabatic chemical dynamics of energetic molecules from the S1 excited state: Ab initio multiple spawning study

NASA Astrophysics Data System (ADS)

Ghosh, Jayanta; Gajapathy, Harshad; Konar, Arindam; Narasimhaiah, Gowrav M.; Bhattacharya, Atanu

2017-11-01

Energetic materials store a large amount of chemical energy. Different ignition processes, including laser ignition and shock or compression wave, initiate the energy release process by first promoting energetic molecules to the electronically excited states. This is why a full understanding of initial steps of the chemical dynamics of energetic molecules from the excited electronic states is highly desirable. In general, conical intersection (CI), which is the crossing point of multidimensional electronic potential energy surfaces, is well established as a controlling factor in the initial steps of chemical dynamics of energetic molecules following their electronic excitations. In this article, we have presented different aspects of the ultrafast unimolecular relaxation dynamics of energetic molecules through CIs. For this task, we have employed ab initio multiple spawning (AIMS) simulation using the complete active space self-consistent field (CASSCF) electronic wavefunction and frozen Gaussian-based nuclear wavefunction. The AIMS simulation results collectively reveal that the ultrafast relaxation step of the best energetic molecules (which are known to exhibit very good detonation properties) is completed in less than 500 fs. Many, however, exhibit sub-50 fs dynamics. For example, nitro-containing molecules (including C-NO2, N-NO2, and O-NO2 active moieties) relax back to the ground state in approximately 40 fs through similar (S1/S0)CI conical intersections. The N3-based energetic molecule undergoes the N2 elimination process in 40 fs through the (S1/S0)CI conical intersection. Nitramine-Fe complexes exhibit sub-50 fs Fe-O and N-O bond dissociation through the respective (S1/S0)CI conical intersection. On the other hand, tetrazine-N-oxides, which are known to exhibit better detonation properties than tetrazines, undergo internal conversion in a 400-fs time scale, while the relaxation time of tetrazine is very long (about 100 ns). Many other characteristics of sub-500 fs nonadiabatic decay of energetic molecules are discussed. In the end, many unresolved issues associated with the ultrafast nonadiabatic chemical dynamics of energetic molecules are presented.

Mutation of Surface Residues to Promote Crystallization of Activated Factor XI as a Complex with Benzamidine: an Essential Step for the Iterative Structure-Based Design of Factor XI Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin,L.; Pandey, P.; Babine, R.

Activated factor XI (FXIa) is a key enzyme in the amplification phase of the blood-coagulation cascade. Thus, a selective FXIa inhibitor may have lesser bleeding liabilities and provide a safe alternative for antithrombosis therapy to available drugs on the market. In a previous report, the crystal structures of the catalytic domain of FXIa (rhFXI370-607) in complex with various ecotin mutants have been described [Jin et al. (2005), Journal of Biological Chemistry 280, 4704-4712]. However, ecotin forms a matrix-like interaction with rhFXI370-607 and is impossible to displace with small-molecule inhibitors; ecotin crystals are therefore not suitable for iterative structure-based ligand design.more » In addition, rhFXI370-607 did not crystallize in the presence of small-molecule ligands. In order to obtain the crystal structure of rhFXI370-607 with a weak small-molecule ligand, namely benzamidine, several rounds of surface-residue mutation were implemented to promote crystal formation of rhFXI370-607. A quadruple mutant of rhFXI370-607 (rhFXI370-607-S434A, T475A, C482S, K437A) readily crystallized in the presence of benzamidine. The benzamidine in the preformed crystals was easily exchanged with other FXIa small-molecule inhibitors. These crystals have facilitated the structure-based design of small-molecule FXIa inhibitors.« less

FLASHFLOOD: A 3D Field-based similarity search and alignment method for flexible molecules

NASA Astrophysics Data System (ADS)

Pitman, Michael C.; Huber, Wolfgang K.; Horn, Hans; Krämer, Andreas; Rice, Julia E.; Swope, William C.

2001-07-01

A three-dimensional field-based similarity search and alignment method for flexible molecules is introduced. The conformational space of a flexible molecule is represented in terms of fragments and torsional angles of allowed conformations. A user-definable property field is used to compute features of fragment pairs. Features are generalizations of CoMMA descriptors (Silverman, B.D. and Platt, D.E., J. Med. Chem., 39 (1996) 2129.) that characterize local regions of the property field by its local moments. The features are invariant under coordinate system transformations. Features taken from a query molecule are used to form alignments with fragment pairs in the database. An assembly algorithm is then used to merge the fragment pairs into full structures, aligned to the query. Key to the method is the use of a context adaptive descriptor scaling procedure as the basis for similarity. This allows the user to tune the weights of the various feature components based on examples relevant to the particular context under investigation. The property fields may range from simple, phenomenological fields, to fields derived from quantum mechanical calculations. We apply the method to the dihydrofolate/methotrexate benchmark system, and show that when one injects relevant contextual information into the descriptor scaling procedure, better results are obtained more efficiently. We also show how the method works and include computer times for a query from a database that represents approximately 23 million conformers of seventeen flexible molecules.

Single-molecule electronics: Cooling individual vibrational modes by the tunneling current.

PubMed

Lykkebo, Jacob; Romano, Giuseppe; Gagliardi, Alessio; Pecchia, Alessandro; Solomon, Gemma C

2016-03-21

Electronic devices composed of single molecules constitute the ultimate limit in the continued downscaling of electronic components. A key challenge for single-molecule electronics is to control the temperature of these junctions. Controlling heating and cooling effects in individual vibrational modes can, in principle, be utilized to increase stability of single-molecule junctions under bias, to pump energy into particular vibrational modes to perform current-induced reactions, or to increase the resolution in inelastic electron tunneling spectroscopy by controlling the life-times of phonons in a molecule by suppressing absorption and external dissipation processes. Under bias the current and the molecule exchange energy, which typically results in heating of the molecule. However, the opposite process is also possible, where energy is extracted from the molecule by the tunneling current. Designing a molecular "heat sink" where a particular vibrational mode funnels heat out of the molecule and into the leads would be very desirable. It is even possible to imagine how the vibrational energy of the other vibrational modes could be funneled into the "cooling mode," given the right molecular design. Previous efforts to understand heating and cooling mechanisms in single molecule junctions have primarily been concerned with small models, where it is unclear which molecular systems they correspond to. In this paper, our focus is on suppressing heating and obtaining current-induced cooling in certain vibrational modes. Strategies for cooling vibrational modes in single-molecule junctions are presented, together with atomistic calculations based on those strategies. Cooling and reduced heating are observed for two different cooling schemes in calculations of atomistic single-molecule junctions.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Three-dimensional single-molecule localization with nanometer accuracy using Metal-Induced Energy Transfer (MIET) imaging

NASA Astrophysics Data System (ADS)

Karedla, Narain; Chizhik, Anna M.; Stein, Simon C.; Ruhlandt, Daja; Gregor, Ingo; Chizhik, Alexey I.; Enderlein, Jörg

2018-05-01

Our paper presents the first theoretical and experimental study using single-molecule Metal-Induced Energy Transfer (smMIET) for localizing single fluorescent molecules in three dimensions. Metal-Induced Energy Transfer describes the resonant energy transfer from the excited state of a fluorescent emitter to surface plasmons in a metal nanostructure. This energy transfer is strongly distance-dependent and can be used to localize an emitter along one dimension. We have used Metal-Induced Energy Transfer in the past for localizing fluorescent emitters with nanometer accuracy along the optical axis of a microscope. The combination of smMIET with single-molecule localization based super-resolution microscopy that provides nanometer lateral localization accuracy offers the prospect of achieving isotropic nanometer localization accuracy in all three spatial dimensions. We give a thorough theoretical explanation and analysis of smMIET, describe its experimental requirements, also in its combination with lateral single-molecule localization techniques, and present first proof-of-principle experiments using dye molecules immobilized on top of a silica spacer, and of dye molecules embedded in thin polymer films.

Anomalous Kondo resonance mediated by semiconducting graphene nanoribbons in a molecular heterostructure

DOE PAGES

Li, Yang; Ngo, Anh T.; DiLullo, Andrew; ...

2017-10-16

An unusually large spin-coupling of almost 100% is found in vertically stacked molecular hetrostructures composed of cobalt-porphyrin based magnetic molecules adsorbed on semiconducting armchair graphene nanoribbon on a Au(111) surface. Although the graphene nanoribbons are electronically decoupled from the gold substrate due to their band gaps and weak adsorption, they enable spin coupling between the magnetic moment of the molecule and the electrons from the substrate exhibiting a Kondo resonance. Surprisingly, the Kondo temperatures corresponding to three adsorption sites of the molecules on Au(111) surface are reproduced on the molecules adsorb on the graphene nanoribbons although the molecules are locatedmore » 7.5 Å away from the surface. This finding suggests that the molecules on graphene nanoribbons experience almost the same environment for spin-electron interactions as the ones directly adsorb on Au(111). This puzzling effect is further confirmed by density functional theory calculations that reveal no spin electron interactions if the molecule is left at the same height from the Au(111) surface without the graphene nanoribbon in between.« less

Watching cellular machinery in action, one molecule at a time.

PubMed

Monachino, Enrico; Spenkelink, Lisanne M; van Oijen, Antoine M

2017-01-02

Single-molecule manipulation and imaging techniques have become important elements of the biologist's toolkit to gain mechanistic insights into cellular processes. By removing ensemble averaging, single-molecule methods provide unique access to the dynamic behavior of biomolecules. Recently, the use of these approaches has expanded to the study of complex multiprotein systems and has enabled detailed characterization of the behavior of individual molecules inside living cells. In this review, we provide an overview of the various force- and fluorescence-based single-molecule methods with applications both in vitro and in vivo, highlighting these advances by describing their applications in studies on cytoskeletal motors and DNA replication. We also discuss how single-molecule approaches have increased our understanding of the dynamic behavior of complex multiprotein systems. These methods have shown that the behavior of multicomponent protein complexes is highly stochastic and less linear and deterministic than previously thought. Further development of single-molecule tools will help to elucidate the molecular dynamics of these complex systems both inside the cell and in solutions with purified components. © 2017 Monachino et al.

Statistical Mechanical Theory of Coupled Slow Dynamics in Glassy Polymer-Molecule Mixtures

NASA Astrophysics Data System (ADS)

Zhang, Rui; Schweizer, Kenneth

The microscopic Elastically Collective Nonlinear Langevin Equation theory of activated relaxation in one-component supercooled liquids and glasses is generalized to polymer-molecule mixtures. The key idea is to account for dynamic coupling between molecule and polymer segment motion. For describing the molecule hopping event, a temporal casuality condition is formulated to self-consistently determine a dimensionless degree of matrix distortion relative to the molecule jump distance based on the concept of coupled dynamic free energies. Implementation for real materials employs an established Kuhn sphere model of the polymer liquid and a quantitative mapping to a hard particle reference system guided by the experimental equation-of-state. The theory makes predictions for the mixture dynamic shear modulus, activated relaxation time and diffusivity of both species, and mixture glass transition temperature as a function of molecule-Kuhn segment size ratio and attraction strength, composition and temperature. Model calculations illustrate the dynamical behavior in three distinct mixture regimes (fully miscible, bridging, clustering) controlled by the molecule-polymer interaction or chi-parameter. Applications to specific experimental systems will be discussed.

Anomalous Kondo resonance mediated by semiconducting graphene nanoribbons in a molecular heterostructure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Ngo, Anh T.; DiLullo, Andrew

An unusually large spin-coupling of almost 100% is found in vertically stacked molecular hetrostructures composed of cobalt-porphyrin based magnetic molecules adsorbed on semiconducting armchair graphene nanoribbon on a Au(111) surface. Although the graphene nanoribbons are electronically decoupled from the gold substrate due to their band gaps and weak adsorption, they enable spin coupling between the magnetic moment of the molecule and the electrons from the substrate exhibiting a Kondo resonance. Surprisingly, the Kondo temperatures corresponding to three adsorption sites of the molecules on Au(111) surface are reproduced on the molecules adsorb on the graphene nanoribbons although the molecules are locatedmore » 7.5 Å away from the surface. This finding suggests that the molecules on graphene nanoribbons experience almost the same environment for spin-electron interactions as the ones directly adsorb on Au(111). This puzzling effect is further confirmed by density functional theory calculations that reveal no spin electron interactions if the molecule is left at the same height from the Au(111) surface without the graphene nanoribbon in between.« less

Femtogram-scale photothermal spectroscopy of explosive molecules on nanostrings.

PubMed

Biswas, T S; Miriyala, N; Doolin, C; Liu, X; Thundat, T; Davis, J P

2014-11-18

We demonstrate detection of femtogram-scale quantities of the explosive molecule 1,3,5-trinitroperhydro-1,3,5-triazine (RDX) via combined nanomechanical photothermal spectroscopy and mass desorption. Photothermal spectroscopy provides a spectroscopic fingerprint of the molecule, which is unavailable using mass adsorption/desorption alone. Our measurement, based on thermomechanical measurement of silicon nitride nanostrings, represents the highest mass resolution ever demonstrated via nanomechanical photothermal spectroscopy. This detection scheme is quick, label-free, and is compatible with parallelized molecular analysis of multicomponent targets.

Fullerene-free small molecule organic solar cells with a high open circuit voltage of 1.15 V.

PubMed

Ni, Wang; Li, Miaomiao; Kan, Bin; Liu, Feng; Wan, Xiangjian; Zhang, Qian; Zhang, Hongtao; Russell, Thomas P; Chen, Yongsheng

2016-01-11

A new small molecule named DTBTF with thiobarbituric acid as a terminal group was designed and synthesized as an acceptor for organic photovoltaic applications. DTBTF exhibits strong absorption in the visible region, and a relatively high lying LUMO energy level (-3.62 eV). All-small-molecule organic solar cells based on DR3TSBDT:DTBTF blend films show a considerable PCE of 3.84% with a high V(oc) of 1.15 V.

Spin relaxation in ultracold collisions of molecular radicals with alkali-metal atoms

NASA Astrophysics Data System (ADS)

Tscherbul, Timur; Klos, Jacek; Zukowski, Piotr

2016-05-01

We present accurate quantum scattering calculations of spin relaxation in ultracold collisions of alkali-metal atoms and polar 2 Σ molecules CaH, SrF, and SrOH. The calculations employ state-of-the-art ab initio interaction potentials and a rigorous quantum theory of atom-molecule collisions in a magnetic field based on the total angular momentum representation. We will further discuss the relevance of the results to atom-molecule sympathetic cooling experiments in a magnetic trap.

Conserved nematode signaling molecules elicit plant defenses and pathogen resistance

USDA-ARS?s Scientific Manuscript database

Nematodes, which are ubiquitous in soil and are estimated to cause $100 B of agricultural damage annually, produce novel, highly conserved small sugar-based molecules call ascarosides. Ascarosides play critical roles in nematode development and behavior. We report here that plants recognize these un...

Force and Conductance Spectroscopy of Single Molecule Junctions

NASA Astrophysics Data System (ADS)

Frei, Michael

Investigation of mechanical properties of single molecule junctions is crucial to develop an understanding and enable control of single molecular junctions. This work presents an experimental and analytical approach that enables the statistical evaluation of force and simultaneous conductance data of metallic atomic point contacts and molecular junctions. A conductive atomic force microscope based break junction technique is developed to form single molecular junctions and collect conductance and force data simultaneously. Improvements of the optical components have been achieved through the use of a super-luminescent diode, enabling tremendous increases in force resolution. An experimental procedure to collect data for various molecular junctions has been developed and includes deposition, calibration, and analysis methods. For the statistical analysis of force, novel approaches based on two dimensional histograms and a direct force identification method are presented. The two dimensional method allows for an unbiased evaluation of force events that are identified using corresponding conductance signatures. This is not always possible however, and in these situations, the force based identification of junction rearrangement events is an attractive alternative method. This combined experimental and analytical approach is then applied to three studies: First, the impact of molecular backbones to the mechanical behavior of single molecule junctions is investigated and it is found that junctions formed with identical linkers but different backbone structure result in junctions with varying breaking forces. All molecules used show a clear molecular signature and force data can be evaluated using the 2D method. Second, the effects of the linker group used to attach molecules to gold electrodes are investigated. A study of four alkane molecules with different linkers finds a drastic difference in the evolution of donor-acceptor and covalently bonded molecules respectively. In fact, the covalent bond is found to significantly distort the metal electrode rearrangement such that junction rearrangement events can no longer be identified with a clean and well defined conductance signature. For this case, the force based identification process is used. Third, results for break junction measurements with different metals are presented. It is found that silver and palladium junctions rupture with forces different from those of gold contacts. In the case of silver experiments in ambient conditions, we can also identify oxygen impurities in the silver contact formation process, leading to force and conductance measurements of silver-oxygen structures. For the future, this work provides an experimental and analytical foundation that will enable insights into single molecule systems not previously accessible.

A chiroptical switch based on supramolecular chirality transfer through alkyl chain entanglement and dynamic covalent bonding.

PubMed

Lv, Kai; Qin, Long; Wang, Xiufeng; Zhang, Li; Liu, Minghua

2013-12-14

Chirality transfer is an interesting phenomenon in Nature, which represents an important step to understand the evolution of chiral bias and the amplification of the chirality. In this paper, we report the chirality transfer via the entanglement of the alkyl chains between chiral gelator molecules and achiral amphiphilic Schiff base. We have found that although an achiral Schiff base amphiphile could not form organogels in any kind of organic solvents, it formed co-organogels when mixed with a chiral gelator molecule. Interestingly, the chirality of the gelator molecules was transferred to the Schiff base chromophore in the mixed co-gels and there was a maximum mixing ratio for the chirality transfer. Furthermore, the supramolecular chirality was also produced based on a dynamic covalent chemistry of an imine formed by the reaction between an aldehyde and an amine. Such a covalent bond of imine was formed reversibly depending on the pH variation. When the covalent bond was formed the chirality transfer occurred, when it was destroyed, the transfer stopped. Thus, a supramolecular chiroptical switch is obtained based on supramolecular chirality transfer and dynamic covalent chemistry.

Recent advance in the pharmacology of dihydropyrimidinone.

PubMed

Wan, J-P; Pan, Y

2012-04-01

Dihydropyrimidinones (DHPMs) are a series of highly valuable small molecules possessing versatile pharmaceutical properties. Although the first one-pot synthesis of DHPMs had been reported more than 100 years ago, the fascinating achievement in DHPMs-based pharmacology during the past century promoted durative interests to the pharmacological and related studies of the scaffold, which lead to the discovery of many new biological functions of DHPMs. Recent pharmacological development on DHPMs-based molecules have been summarized in this review.

The Schwinger Variational Method

NASA Technical Reports Server (NTRS)

Huo, Winifred M.

1995-01-01

Variational methods have proven invaluable in theoretical physics and chemistry, both for bound state problems and for the study of collision phenomena. For collisional problems they can be grouped into two types: those based on the Schroedinger equation and those based on the Lippmann-Schwinger equation. The application of the Schwinger variational (SV) method to e-molecule collisions and photoionization has been reviewed previously. The present chapter discusses the implementation of the SV method as applied to e-molecule collisions.

Investigations of Reactive Processes at Temperatures Relevant to the Hypersonic Flight Regime

DTIC Science & Technology

2014-10-31

molecule is constructed based on high- level ab-initio calculations and interpolated using the reproducible kernel Hilbert space (RKHS) method and...a potential energy surface (PES) for the ground state of the NO2 molecule is constructed based on high- level ab initio calculations and interpolated...between O(3P) and NO(2Π) at higher temperatures relevant to the hypersonic flight regime of reentering space- crafts. At a more fundamental level , we

Microfluidic electroporation for delivery of small molecules and genes into cells using a common DC power supply.

PubMed

Wang, Hsiang-Yu; Lu, Chang

2008-06-15

Electroporation is an efficient method of introducing foreign impermeant molecules such as drugs and genes into cells. Conventional electroporation has been based on the application of short electrical pulses (electropulsation). Electropulsation requires specialized equipment and cannot be integrated easily with techniques such as electrophoresis which is based on constant voltage. Here we demonstrate the delivery of small molecules and genes into cells, using a microfluidic electroporation technique based on constant direct current (DC) voltage that we developed earlier. We demonstrate the delivery of two molecules into Chinese hamster ovary (CHO-K1) cells: a membrane impermeable nucleic acid dye (SYTOX Green) and a plasmid vector carrying the gene for green fluorescent protein (pEGFP-C1). Our devices can exert field variations to flowing cells that are analogous to the application of single or multiple pulses by having different geometries. We investigate the effects of the electrical parameters and different geometries of the device on the transfection efficiency and cell viability. Our technique provides a simple solution to electroporation-based drug and gene delivery by eliminating the need for a pulse generator. We envision that these simple microscale electroporation devices will have the potential to work in parallel on a microchip platform and such technology will allow high-throughput functional screening of drugs and genes. (c) 2008 Wiley Periodicals, Inc.

Strain-induced formation of fourfold symmetric SiGe quantum dot molecules.

PubMed

Zinovyev, V A; Dvurechenskii, A V; Kuchinskaya, P A; Armbrister, V A

2013-12-27

The strain field distribution at the surface of a multilayer structure with disklike SiGe nanomounds formed by heteroepitaxy is exploited to arrange the symmetric quantum dot molecules typically consisting of four elongated quantum dots ordered along the [010] and [100] directions. The morphological transition from fourfold quantum dot molecules to continuous fortresslike quantum rings with an increasing amount of deposited Ge is revealed. We examine key mechanisms underlying the formation of lateral quantum dot molecules by using scanning tunneling microscopy and numerical calculations of the strain energy distribution on the top of disklike SiGe nanomounds. Experimental data are well described by a simple thermodynamic model based on the accurate evaluation of the strain dependent part of the surface chemical potential. The spatial arrangement of quantum dots inside molecules is attributed to the effect of elastic property anisotropy.

Multi-Excitonic Quantum Dot Molecules

NASA Astrophysics Data System (ADS)

Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

2006-03-01

With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.

Ab initio studies of electronic transport through amine-Au-linked junctions of photoactive molecules

NASA Astrophysics Data System (ADS)

Strubbe, David A.; Quek, Su Ying; Venkataraman, Latha; Choi, Hyoung Joon; Neaton, J. B.; Louie, Steven G.

2008-03-01

Molecules linked to Au electrodes via amine groups have been shown to result in reproducible molecular conductance values for a wide range of single-molecule junctions [1,2]. Recent calculations have shown that these linkages result in a junction conductance relatively insensitive to atomic structure [3]. Here we exploit these well-defined linkages to study the effect of isomerization on conductance for the photoactive molecule 4,4'-diaminoazobenzene. We use a first-principles scattering-state method based on density-functional theory to explore structure and transport properties of the cis and trans isomers of the molecule, and we discuss implications for experiment. [1] L Venkataraman et al., Nature 442, 904-907 (2006); [2] L Venkataraman et al., Nano Lett. 6, 458-462 (2006); [3] SY Quek et al., Nano Lett. 7, 3477-3482 (2007).

Delivery of small molecules for bone regenerative engineering: preclinical studies and potential clinical applications.

PubMed

Laurencin, Cato T; Ashe, Keshia M; Henry, Nicole; Kan, Ho Man; Lo, Kevin W-H

2014-06-01

Stimulation of bone regeneration using growth factors is a promising approach for musculoskeletal regenerative engineering. However, common limitations with protein growth factors, such as high manufacturing costs, protein instability, contamination issues, and unwanted immunogenic responses of the host reduce potential clinical applications. New strategies for bone regeneration that involve inexpensive and stable small molecules can obviate these problems and have a significant impact on the treatment of skeletal injury and diseases. Over the past decade, a large number of small molecules with the potential of regenerating skeletal tissue have been reported in the literature. Here, we review this literature, paying specific attention to the prospects for small molecule-based bone-regenerative engineering. We also review the preclinical study of small molecules associated with bone regeneration. Copyright © 2014 Elsevier Ltd. All rights reserved.

Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

NASA Astrophysics Data System (ADS)

Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

2015-09-01

Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

Photo-activation of Single Molecule Magnet Behavior in a Manganese-based Complex

NASA Astrophysics Data System (ADS)

Fetoh, Ahmed; Cosquer, Goulven; Morimoto, Masakazu; Irie, Masahiro; El-Gammal, Ola; El-Reash, Gaber Abu; Breedlove, Brian K.; Yamashita, Masahiro

2016-03-01

A major roadblock to fully realizing molecular electronic devices is the ability to control the properties of each molecule in the device. Herein we report the control of the magnetic properties of single-molecule magnets (SMMs), which can be used in memory devices, by using a photo-isomerizable diarthylenthene ligand. Photo-isomerization of the diarylethene ligand bridging two manganese salen complexes with visible light caused a significant change in the SMM behavior due to opening of the six-membered ring of diarylethene ligand, accompanied by reorganization of the entire molecule. The ring-opening activated the frequency-dependent magnetization of the complex. Our results are a major step towards the realization of molecular memory devices composed of SMMs because the SMM behaviour can be turned on and off simply by irradiating the molecule.

The successful merger of theoretical thermochemistry with fragment-based methods in quantum chemistry.

PubMed

Ramabhadran, Raghunath O; Raghavachari, Krishnan

2014-12-16

CONSPECTUS: Quantum chemistry and electronic structure theory have proven to be essential tools to the experimental chemist, in terms of both a priori predictions that pave the way for designing new experiments and rationalizing experimental observations a posteriori. Translating the well-established success of electronic structure theory in obtaining the structures and energies of small chemical systems to increasingly larger molecules is an exciting and ongoing central theme of research in quantum chemistry. However, the prohibitive computational scaling of highly accurate ab initio electronic structure methods poses a fundamental challenge to this research endeavor. This scenario necessitates an indirect fragment-based approach wherein a large molecule is divided into small fragments and is subsequently reassembled to compute its energy accurately. In our quest to further reduce the computational expense associated with the fragment-based methods and overall enhance the applicability of electronic structure methods to large molecules, we realized that the broad ideas involved in a different area, theoretical thermochemistry, are transferable to the area of fragment-based methods. This Account focuses on the effective merger of these two disparate frontiers in quantum chemistry and how new concepts inspired by theoretical thermochemistry significantly reduce the total number of electronic structure calculations needed to be performed as part of a fragment-based method without any appreciable loss of accuracy. Throughout, the generalized connectivity based hierarchy (CBH), which we developed to solve a long-standing problem in theoretical thermochemistry, serves as the linchpin in this merger. The accuracy of our method is based on two strong foundations: (a) the apt utilization of systematic and sophisticated error-canceling schemes via CBH that result in an optimal cutting scheme at any given level of fragmentation and (b) the use of a less expensive second layer of electronic structure method to recover all the missing long-range interactions in the parent large molecule. Overall, the work featured here dramatically decreases the computational expense and empowers the execution of very accurate ab initio calculations (gold-standard CCSD(T)) on large molecules and thereby facilitates sophisticated electronic structure applications to a wide range of important chemical problems.

Comparative Analysis of Immune Checkpoint Molecules and Their Potential Role in the Transmissible Tasmanian Devil Facial Tumor Disease

PubMed Central

Flies, Andrew S.; Blackburn, Nicholas B.; Lyons, Alan Bruce; Hayball, John D.; Woods, Gregory M.

2017-01-01

Immune checkpoint molecules function as a system of checks and balances that enhance or inhibit immune responses to infectious agents, foreign tissues, and cancerous cells. Immunotherapies that target immune checkpoint molecules, particularly the inhibitory molecules programmed cell death 1 and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), have revolutionized human oncology in recent years, yet little is known about these key immune signaling molecules in species other than primates and rodents. The Tasmanian devil facial tumor disease is caused by transmissible cancers that have resulted in a massive decline in the wild Tasmanian devil population. We have recently demonstrated that the inhibitory checkpoint molecule PD-L1 is upregulated on Tasmanian devil (Sarcophilus harrisii) facial tumor cells in response to the interferon-gamma cytokine. As this could play a role in immune evasion by tumor cells, we performed a thorough comparative analysis of checkpoint molecule protein sequences among Tasmanian devils and eight other species. We report that many of the key signaling motifs and ligand-binding sites in the checkpoint molecules are highly conserved across the estimated 162 million years of evolution since the last common ancestor of placental and non-placental mammals. Specifically, we discovered that the CTLA-4 (MYPPPY) ligand-binding motif and the CTLA-4 (GVYVKM) inhibitory domain are completely conserved across all nine species used in our comparative analysis, suggesting that the function of CTLA-4 is likely conserved in these species. We also found that cysteine residues for intra- and intermolecular disulfide bonds were also highly conserved. For instance, all 20 cysteine residues involved in disulfide bonds in the human 4-1BB molecule were also present in devil 4-1BB. Although many key sequences were conserved, we have also identified immunoreceptor tyrosine-based inhibitory motifs (ITIMs) and immunoreceptor tyrosine-based switch motifs (ITSMs) in genes and protein domains that have not been previously reported in any species. This checkpoint molecule analysis and review of salient features for each of the molecules presented here can serve as road map for the development of a Tasmanian devil facial tumor disease immunotherapy. Finally, the strategies can be used as a guide for veterinarians, ecologists, and other researchers willing to venture into the nascent field of wild immunology. PMID:28515726

Non-additivity of molecule-surface van der Waals potentials from force measurements.

PubMed

Wagner, Christian; Fournier, Norman; Ruiz, Victor G; Li, Chen; Müllen, Klaus; Rohlfing, Michael; Tkatchenko, Alexandre; Temirov, Ruslan; Tautz, F Stefan

2014-11-26

Van der Waals (vdW) forces act ubiquitously in condensed matter. Despite being weak on an atomic level, they substantially influence molecular and biological systems due to their long range and system-size scaling. The difficulty to isolate and measure vdW forces on a single-molecule level causes our present understanding to be strongly theory based. Here we show measurements of the attractive potential between differently sized organic molecules and a metal surface using an atomic force microscope. Our choice of molecules and the large molecule-surface separation cause this attraction to be purely of vdW type. The experiment allows testing the asymptotic vdW force law and its validity range. We find a superlinear growth of the vdW attraction with molecular size, originating from the increased deconfinement of electrons in the molecules. Because such non-additive vdW contributions are not accounted for in most first-principles or empirical calculations, we suggest further development in that direction.

Design and engineering of organic molecules for customizable Terahertz tags

NASA Astrophysics Data System (ADS)

Ray, Shaumik; Dash, Jyotirmayee; Nallappan, Kathirvel; Kaware, Vaibhav; Basutkar, Nitin; Ambade, Ashootosh; Joshi, Kavita; Pesala, Bala

2014-03-01

Terahertz (THz) frequency band lies between the microwave and infrared region of the electromagnetic spectrum. Molecules having strong resonances in this frequency range are ideal for realizing "Terahertz tags" which can be easily incorporated into various materials. THz spectroscopy of molecules, especially at frequencies below 10 THz, provides valuable information on the low frequency vibrational modes, viz. intermolecular vibrational modes, hydrogen bond stretching, torsional vibrations in several chemical and biological compounds. So far there have been very few attempts to engineer molecules which can demonstrate customizable resonances in the THz frequency region. In this paper, Diamidopyridine (DAP) based molecules are used as a model system to demonstrate engineering of THz resonances (< 10 THz) by fine-tuning the molecular mass and bond strengths. Density Functional Theory (DFT) simulations have been carried out to explain the origin of THz resonances and factors contributing to the shift in resonances due to the addition of various functional groups. The design approach presented here can be easily extended to engineer various organic molecules suitable for THz tags application.

Two-dimensional networks of brominated Y-shaped molecules on Au(111)

NASA Astrophysics Data System (ADS)

Jeon, Un Seung; Chang, Min Hui; Jang, Won-Jun; Lee, Soon-Hyung; Han, Seungwu; Kahng, Se-Jong

2018-02-01

In the design of supramolecular structures, Y-shaped molecules are useful to expand the structures in three different directions. The supramolecular structures of Y-shaped molecules with three halogen-ligands on surfaces have been extensively studied, but much less are done for those with six halogen-ligands. Here, we report on the intermolecular interactions of a Y-shaped molecule, 1,3,5-Tris(3,5-dibromophenyl)benzene, with six Br-ligands studied using scanning tunneling microscopy (STM). Honeycomb-like structures were observed on Au(111), and could be explained with chiral triple-nodes made of three Br···Br halogen bonds. Molecular models were proposed based on STM images and reproduced with density-functional theory calculations. Although the molecule has six Br-ligands, only three of them form Br···Br halogen bonds because of geometrical restrictions. Our study shows that halogenated Y-shaped molecules will be useful components for building supramolecular structures.

Toward Generalization of Iterative Small Molecule Synthesis

PubMed Central

Lehmann, Jonathan W.; Blair, Daniel J.; Burke, Martin D.

2018-01-01

Small molecules have extensive untapped potential to benefit society, but access to this potential is too often restricted by limitations inherent to the customized approach currently used to synthesize this class of chemical matter. In contrast, the “building block approach”, i.e., generalized iterative assembly of interchangeable parts, has now proven to be a highly efficient and flexible way to construct things ranging all the way from skyscrapers to macromolecules to artificial intelligence algorithms. The structural redundancy found in many small molecules suggests that they possess a similar capacity for generalized building block-based construction. It is also encouraging that many customized iterative synthesis methods have been developed that improve access to specific classes of small molecules. There has also been substantial recent progress toward the iterative assembly of many different types of small molecules, including complex natural products, pharmaceuticals, biological probes, and materials, using common building blocks and coupling chemistry. Collectively, these advances suggest that a generalized building block approach for small molecule synthesis may be within reach. PMID:29696152

Assembly and diploid architecture of an individual human genome via single-molecule technologies

PubMed Central

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-01-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality. PMID:26121404

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Assembly and diploid architecture of an individual human genome via single-molecule technologies.

PubMed

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-08-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality.

Characterization of individual polynucleotide molecules using a membrane channel

NASA Technical Reports Server (NTRS)

Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

1996-01-01

We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

Photoelectrochemical molecular comb

DOEpatents

Thundat, Thomas G [Knoxville, TN; Ferrell, Thomas L [Knoxville, TN; Brown,; Gilbert, M [Knoxville, TN

2007-05-01

A method, system, and apparatus are provided for separating molecules, such as biomolecules. The method, system, and apparatus utilize an electrochemical cell having at least to electrodes, one electrode comprising a photo-sensitive material capable of generating a photopotential. Molecules are moved through an electrolyte medium between the at least two electrodes based upon localized photopotentials.

Photoelectrochemical molecular comb

DOEpatents

Thundat, Thomas G [Knoxville, TN; Ferrell, Thomas L [Knoxville, TN; Brown, Gilbert M [Knoxville, TN

2012-02-07

A method, system, and apparatus are provided for separating molecules, such as biomolecules. The method, system, and apparatus utilize an electrochemical cell having at least two electrodes, one electrode comprising a photo-sensitive material capable of generating a photopotential. Molecules are moved through an electrolyte medium between the at least two electrodes based upon localized photopotentials.

iSpec: A Web-Based Activity for Spectroscopy Teaching

ERIC Educational Resources Information Center

Vosegaard, Thomas

2018-01-01

Students' skills in structure elucidation of organic molecules are developed by training them to understand advanced spectroscopic measurements and elucidate structures of small organic molecules from mass spectrometry (MS) and infrared (IR), ultraviolet (UV), and [superscript 1]H and [superscript 13]C nuclear magnetic resonance (NMR)…

A small molecule sensor for fluoride based on an autoinductive, colorimetric signal amplification reaction.

PubMed

Baker, Matthew S; Phillips, Scott T

2012-05-14

This article describes a small molecule reagent that is capable of detecting fluoride down to 0.12 mM (2.3 ppm) in water. The reagent reveals this level of fluoride through a novel autoinductive signal amplification reaction that produces an unambiguous colorimetric readout.

Time-Delayed Two-Step Selective Laser Photodamage of Dye-Biomolecule Complexes

NASA Astrophysics Data System (ADS)

Andreoni, A.; Cubeddu, R.; de Silvestri, S.; Laporta, P.; Svelto, O.

1980-08-01

A scheme is proposed for laser-selective photodamage of biological molecules, based on time-delayed two-step photoionization of a dye molecule bound to the biomolecule. The validity of the scheme is experimentally demonstrated in the case of the dye Proflavine, bound to synthetic polynucleotides.

Evaluation of Soyscreen in an Oil-based Formulation for UV Protection of Beauveria bassiana Conidia

USDA-ARS?s Scientific Manuscript database

SoyScreen oil was studied as a formulation ingredient to protect Beauveria bassiana (Balsamo) Vuillemin conidia from UV degradation. Feruloylated soy glycerides, referred to as SoyScreen oil, are biobased ultraviolet-absorbing molecules made by combining molecules of soybean oil with ferulic acid. ...

Molecules-to-Ecosphere View Emerges From Study of Student-Chosen Organisms

ERIC Educational Resources Information Center

Schmit, Palma J.

1973-01-01

Describes a high school biology program based on student investigations. The comparative study of different topics in plants and animals is stressed. First phase of the course centers around relationships between the ecosphere and the individual; the second phase considers the molecules and the individual. (PS)

Identification of Biomolecular Building Blocks by Recognition Tunneling: Stride towards Nanopore Sequencing of Biomolecules

NASA Astrophysics Data System (ADS)

Sen, Suman

DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition, Pyrene reader showed higher DNA base-calling accuracy compare to Imidazole reader, the workhorse in our previous projects. In my other projects, various amino acids and RNA nucleoside monophosphates were also classified with significantly high accuracy using RT. Twenty naturally occurring amino acids and various RNA nucleosides (four canonical and two modified) were successfully identified. Thus, we envision nanopore sequencing biomolecules using Recognition Tunneling (RT) that should provide comprehensive betterment over current technologies in terms of time, chemical and instrumental cost and capability of de novo sequencing.

Degradation of Alkali-Based Photocathodes from Exposure to Residual Gases: A First-Principles Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Gaoxue; Pandey, Ravindra; Moody, Nathan A.

Photocathodes are a key component in the production of electron beams in systems such as X-ray free-electron lasers and X-ray energy-recovery linacs. Alkali-based materials display high quantum efficiency (QE), however, their QE undergoes degradation faster than metal photocathodes even in the high vacuum conditions where they operate. The high reactivity of alkali-based surfaces points to surface reactions with residual gases as one of the most important factors for the degradation of QE. In order to advance the understanding on the degradation of the QE, we investigated the surface reactivity of common residual gas molecules (e.g., O 2, CO 2, CO,more » H 2O, N 2, and H 2) on one of the best-known alkali-based photocathode materials, cesium antimonide (Cs 3Sb), using first-principles calculations based on density functional theory. Furthermore, the reaction sites, adsorption energy, and effect in the local electronic structure upon reaction of these molecules on (001), (110), and (111) surfaces of Cs 3Sb were computed and analyzed. The adsorption energy of these molecules on Cs3Sb follows the trend of O 2 (-4.5 eV) > CO 2 (-1.9 eV) > H 2O (-1.0 eV) > CO (-0.8 eV) > N 2 (-0.3 eV) ≈ H 2 (-0.2 eV), which agrees with experimental data on the effect of these gases on the degradation of QE. The interaction strength is determined by the charge transfer from the surfaces to the molecules. The adsorption and dissociation of O containing molecules modify the surface chemistry such as the composition, structure, charge distribution, surface dipole, and work function of Cs 3Sb, resulting in the degradation of QE with exposure to O 2, CO 2, H 2O, and CO.« less

Degradation of Alkali-Based Photocathodes from Exposure to Residual Gases: A First-Principles Study

DOE PAGES

Wang, Gaoxue; Pandey, Ravindra; Moody, Nathan A.; ...

2017-03-31

Photocathodes are a key component in the production of electron beams in systems such as X-ray free-electron lasers and X-ray energy-recovery linacs. Alkali-based materials display high quantum efficiency (QE), however, their QE undergoes degradation faster than metal photocathodes even in the high vacuum conditions where they operate. The high reactivity of alkali-based surfaces points to surface reactions with residual gases as one of the most important factors for the degradation of QE. In order to advance the understanding on the degradation of the QE, we investigated the surface reactivity of common residual gas molecules (e.g., O 2, CO 2, CO,more » H 2O, N 2, and H 2) on one of the best-known alkali-based photocathode materials, cesium antimonide (Cs 3Sb), using first-principles calculations based on density functional theory. Furthermore, the reaction sites, adsorption energy, and effect in the local electronic structure upon reaction of these molecules on (001), (110), and (111) surfaces of Cs 3Sb were computed and analyzed. The adsorption energy of these molecules on Cs3Sb follows the trend of O 2 (-4.5 eV) > CO 2 (-1.9 eV) > H 2O (-1.0 eV) > CO (-0.8 eV) > N 2 (-0.3 eV) ≈ H 2 (-0.2 eV), which agrees with experimental data on the effect of these gases on the degradation of QE. The interaction strength is determined by the charge transfer from the surfaces to the molecules. The adsorption and dissociation of O containing molecules modify the surface chemistry such as the composition, structure, charge distribution, surface dipole, and work function of Cs 3Sb, resulting in the degradation of QE with exposure to O 2, CO 2, H 2O, and CO.« less

Electron collisions with atoms, ions, molecules, and surfaces: Fundamental science empowering advances in technology

PubMed Central

Bartschat, Klaus; Kushner, Mark J.

2016-01-01

Electron collisions with atoms, ions, molecules, and surfaces are critically important to the understanding and modeling of low-temperature plasmas (LTPs), and so in the development of technologies based on LTPs. Recent progress in obtaining experimental benchmark data and the development of highly sophisticated computational methods is highlighted. With the cesium-based diode-pumped alkali laser and remote plasma etching of Si3N4 as examples, we demonstrate how accurate and comprehensive datasets for electron collisions enable complex modeling of plasma-using technologies that empower our high-technology–based society. PMID:27317740

Crystal structure of a four-stranded intercalated DNA: d(C4)

NASA Technical Reports Server (NTRS)

Chen, L.; Cai, L.; Zhang, X.; Rich, A.

1994-01-01

The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.

Noncontiguous atom matching structural similarity function.

PubMed

Teixeira, Ana L; Falcao, Andre O

2013-10-28

Measuring similarity between molecules is a fundamental problem in cheminformatics. Given that similar molecules tend to have similar physical, chemical, and biological properties, the notion of molecular similarity plays an important role in the exploration of molecular data sets, query-retrieval in molecular databases, and in structure-property/activity modeling. Various methods to define structural similarity between molecules are available in the literature, but so far none has been used with consistent and reliable results for all situations. We propose a new similarity method based on atom alignment for the analysis of structural similarity between molecules. This method is based on the comparison of the bonding profiles of atoms on comparable molecules, including features that are seldom found in other structural or graph matching approaches like chirality or double bond stereoisomerism. The similarity measure is then defined on the annotated molecular graph, based on an iterative directed graph similarity procedure and optimal atom alignment between atoms using a pairwise matching algorithm. With the proposed approach the similarities detected are more intuitively understood because similar atoms in the molecules are explicitly shown. This noncontiguous atom matching structural similarity method (NAMS) was tested and compared with one of the most widely used similarity methods (fingerprint-based similarity) using three difficult data sets with different characteristics. Despite having a higher computational cost, the method performed well being able to distinguish either different or very similar hydrocarbons that were indistinguishable using a fingerprint-based approach. NAMS also verified the similarity principle using a data set of structurally similar steroids with differences in the binding affinity to the corticosteroid binding globulin receptor by showing that pairs of steroids with a high degree of similarity (>80%) tend to have smaller differences in the absolute value of binding activity. Using a highly diverse set of compounds with information about the monoamine oxidase inhibition level, the method was also able to recover a significantly higher average fraction of active compounds when the seed is active for different cutoff threshold values of similarity. Particularly, for the cutoff threshold values of 86%, 93%, and 96.5%, NAMS was able to recover a fraction of actives of 0.57, 0.63, and 0.83, respectively, while the fingerprint-based approach was able to recover a fraction of actives of 0.41, 0.40, and 0.39, respectively. NAMS is made available freely for the whole community in a simple Web based tool as well as the Python source code at http://nams.lasige.di.fc.ul.pt/.

Single-molecule designs for electric switches and rectifiers.

PubMed

Kornilovitch, Pavel; Bratkovsky, Alexander; Williams, Stanley

2003-12-01

A design for molecular rectifiers is proposed. Current rectification is based on the spatial asymmetry of a molecule and requires only one resonant conducting molecular orbital. Rectification is caused by asymmetric coupling of the orbital to the electrodes, which results in asymmetric movement of the two Fermi levels with respect to the orbital under external bias. Results from numerical studies of the family of suggested molecular rectifiers, HS-(CH(2))(n)-C(6)H(4)(CH(2))(m)SH, are presented. Current rectification ratios in excess of 100 are achievable for n = 2 and m > 6. A class of bistable stator-rotor molecules is proposed. The stationary part connects the two electrodes and facilitates electron transport between them. The rotary part, which has a large dipole moment, is attached to an atom of the stator via a single sigma bond. Electrostatic bonds formed between the oxygen atom of the rotor and hydrogen atoms of the stator make the symmetric orientation of the dipole unstable. The rotor has two potential minima with equal energy for rotation about the sigma bond. The dipole can be flipped between the two states by an external electric field. Both rotor-orientation states have asymmetric current-voltage characteristics that are the reverse of each other, so they are distinguishable electrically. Theoretical results on conformation, energy barriers, retention times, switching voltages, and current-voltage characteristics are presented for a particular stator-rotor molecule. Such molecules could be the base for single-molecule switches, reversible diodes, and other molecular electronic devices.

Silk-based delivery systems of bioactive molecules.

PubMed

Numata, Keiji; Kaplan, David L

2010-12-30

Silks are biodegradable, biocompatible, self-assembling proteins that can also be tailored via genetic engineering to contain specific chemical features, offering utility for drug and gene delivery. Silkworm silk has been used in biomedical sutures for decades and has recently achieved Food and Drug Administration approval for expanded biomaterials device utility. With the diversity and control of size, structure and chemistry, modified or recombinant silk proteins can be designed and utilized in various biomedical application, such as for the delivery of bioactive molecules. This review focuses on the biosynthesis and applications of silk-based multi-block copolymer systems and related silk protein drug delivery systems. The utility of these systems for the delivery of small molecule drugs, proteins and genes is reviewed. Copyright © 2010 Elsevier B.V. All rights reserved.

Solution-processed small-molecule solar cells: breaking the 10% power conversion efficiency.

PubMed

Liu, Yongsheng; Chen, Chun-Chao; Hong, Ziruo; Gao, Jing; Yang, Yang Michael; Zhou, Huanping; Dou, Letian; Li, Gang; Yang, Yang

2013-11-28

A two-dimensional conjugated small molecule (SMPV1) was designed and synthesized for high performance solution-processed organic solar cells. This study explores the photovoltaic properties of this molecule as a donor, with a fullerene derivative as an acceptor, using solution processing in single junction and double junction tandem solar cells. The single junction solar cells based on SMPV1 exhibited a certified power conversion efficiency of 8.02% under AM 1.5 G irradiation (100 mW cm(-2)). A homo-tandem solar cell based on SMPV1 was constructed with a novel interlayer (or tunnel junction) consisting of bilayer conjugated polyelectrolyte, demonstrating an unprecedented PCE of 10.1%. These results strongly suggest solution-processed small molecular materials are excellent candidates for organic solar cells.

A Colloidal Route to Detection of Organic Molecules Based on Surface-Enhanced Raman Spectroscopy Using Nanostructured Substrate Derived from Aerosols

NASA Astrophysics Data System (ADS)

Gen, Masao; Kakuta, Hideo; Kamimoto, Yoshihito; Wuled Lenggoro, I.

2011-06-01

A detection method based on the surface-enhanced Raman spectroscopy (SERS)-active substrate derived from aerosol nanoparticles and a colloidal suspension for detecting organic molecules of a model analyte (a pesticide) is proposed. This approach can detect the molecules of the derived from its solution with the concentration levels of ppb. For substrate fabrication, a gas-phase method is used to directly deposit Ag nanoparticles on to a silicon substrate having pyramidal structures. By mixing the target analyte with a suspension of Ag colloids purchased in advance, clotianidin analyte on Ag colloid can exist in junctions of co-aggregated Ag colloids. Using (i) a nanostructured substrate made from aerosol nanoparticles and (ii) colloidal suspension can increase the number of activity spots.

Another expert system rule inference based on DNA molecule logic gates

NASA Astrophysics Data System (ADS)

WÄ siewicz, Piotr

2013-10-01

With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

TMRG studies on spin alignment in molecule-based ferrimagnetics [rapid communication

NASA Astrophysics Data System (ADS)

Liu, Q. M.; Yao, K. L.; Liu, Z. L.

2005-05-01

A physical picture of spin alignment in organic molecule-based ferrimagnets is presented from studying the thermal effective magnetic moment of the sublattice by use of the transfer matrix renormalization group. We conclude that the classical antiparallel spin alignment is not the most stable state. The three-spin system tends to parallel alignment when the exchange interaction between the biradical and the monoradical molecules is much weaker than that within the biradical, which can result in the decrease of the effective magnetic moment upon lowering the temperature. More importantly, we give the theoretical evidence that even the antiparallel spin alignment in the biradical monoradical alternating chain does not necessarily lead to ferrimagnetic spin ordering due to the formation of the spin singlet pairs, which suppresses the ferrimagnetic spin alignment.

A FRAP-Based Method for Monitoring Molecular Transport in Ciliary Photoreceptor Cells In Vivo.

PubMed

Wunderlich, Kirsten A; Wolfrum, Uwe

2016-01-01

The outer segment of rod and cone photoreceptor cells represents a highly modified primary sensory cilium. It renews on a daily basis throughout lifetime and effective vectorial transport to the cilium is essential for the maintenance of the photoreceptor cell function. Defects in molecules of transport modules lead to severe retinal ciliopathies. We have recently established a fluorescence recovery after photobleaching (FRAP)-based method to monitor molecular trafficking in living rodent photoreceptor cells. We irreversibly bleach the fluorescence of tagged molecules (e.g. eGFP-Rhodopsin) in photoreceptor cells of native vibratome sections through the retina by high laser intensity. In the laser scanning microscope, the recovery of the fluorescent signal is monitored over time and the kinetics of movements of molecules can be quantitatively ascertained.

Superresolution microscopy with transient binding.

PubMed

Molle, Julia; Raab, Mario; Holzmeister, Susanne; Schmitt-Monreal, Daniel; Grohmann, Dina; He, Zhike; Tinnefeld, Philip

2016-06-01

For single-molecule localization based superresolution, the concentration of fluorescent labels has to be thinned out. This is commonly achieved by photophysically or photochemically deactivating subsets of molecules. Alternatively, apparent switching of molecules can be achieved by transient binding of fluorescent labels. Here, a diffusing dye yields bright fluorescent spots when binding to the structure of interest. As the binding interaction is weak, the labeling is reversible and the dye ligand construct diffuses back into solution. This approach of achieving superresolution by transient binding (STB) is reviewed in this manuscript. Different realizations of STB are discussed and compared to other localization-based superresolution modalities. We propose the development of labeling strategies that will make STB a highly versatile tool for superresolution microscopy at highest resolution. Copyright © 2015 Elsevier Ltd. All rights reserved.

Computational biology of RNA interactions.

PubMed

Dieterich, Christoph; Stadler, Peter F

2013-01-01

The biodiversity of the RNA world has been underestimated for decades. RNA molecules are key building blocks, sensors, and regulators of modern cells. The biological function of RNA molecules cannot be separated from their ability to bind to and interact with a wide space of chemical species, including small molecules, nucleic acids, and proteins. Computational chemists, physicists, and biologists have developed a rich tool set for modeling and predicting RNA interactions. These interactions are to some extent determined by the binding conformation of the RNA molecule. RNA binding conformations are approximated with often acceptable accuracy by sequence and secondary structure motifs. Secondary structure ensembles of a given RNA molecule can be efficiently computed in many relevant situations by employing a standard energy model for base pair interactions and dynamic programming techniques. The case of bi-molecular RNA-RNA interactions can be seen as an extension of this approach. However, unbiased transcriptome-wide scans for local RNA-RNA interactions are computationally challenging yet become efficient if the binding motif/mode is known and other external information can be used to confine the search space. Computational methods are less developed for proteins and small molecules, which bind to RNA with very high specificity. Binding descriptors of proteins are usually determined by in vitro high-throughput assays (e.g., microarrays or sequencing). Intriguingly, recent experimental advances, which are mostly based on light-induced cross-linking of binding partners, render in vivo binding patterns accessible yet require new computational methods for careful data interpretation. The grand challenge is to model the in vivo situation where a complex interplay of RNA binders competes for the same target RNA molecule. Evidently, bioinformaticians are just catching up with the impressive pace of these developments. Copyright © 2012 John Wiley & Sons, Ltd.

Data-mining of potential antitubercular activities from molecular ingredients of traditional Chinese medicines.

PubMed

Jamal, Salma; Scaria, Vinod

2014-01-01

Background. Traditional Chinese medicine encompasses a well established alternate system of medicine based on a broad range of herbal formulations and is practiced extensively in the region for the treatment of a wide variety of diseases. In recent years, several reports describe in depth studies of the molecular ingredients of traditional Chinese medicines on the biological activities including anti-bacterial activities. The availability of a well-curated dataset of molecular ingredients of traditional Chinese medicines and accurate in-silico cheminformatics models for data mining for antitubercular agents and computational filters to prioritize molecules has prompted us to search for potential hits from these datasets. Results. We used a consensus approach to predict molecules with potential antitubercular activities from a large dataset of molecular ingredients of traditional Chinese medicines available in the public domain. We further prioritized 160 molecules based on five computational filters (SMARTSfilter) so as to avoid potentially undesirable molecules. We further examined the molecules for permeability across Mycobacterial cell wall and for potential activities against non-replicating and drug tolerant Mycobacteria. Additional in-depth literature surveys for the reported antitubercular activities of the molecular ingredients and their sources were considered for drawing support to prioritization. Conclusions. Our analysis suggests that datasets of molecular ingredients of traditional Chinese medicines offer a new opportunity to mine for potential biological activities. In this report, we suggest a proof-of-concept methodology to prioritize molecules for further experimental assays using a variety of computational tools. We also additionally suggest that a subset of prioritized molecules could be used for evaluation for tuberculosis due to their additional effect against non-replicating tuberculosis as well as the additional hepato-protection offered by the source of these ingredients.

Electroactive crown ester-Cu2+ complex with in-situ modification at molecular beacon probe serving as a facile electrochemical DNA biosensor for the detection of CaMV 35s.

PubMed

Zhan, Fengping; Liao, Xiaolei; Gao, Feng; Qiu, Weiwei; Wang, Qingxiang

2017-06-15

A novel electrochemical DNA biosensor has been facilely constructed by in-situ assembly of electroactive 4'-aminobenzo-18-crown-6-copper(II) complex (AbC-Cu 2+ ) on the free terminal of the hairpin-structured molecule beacon. The 3'-SH modified molecule beacon probe was first immobilized on the gold electrode (AuE) surface through self-assembly chemistry of Au-S bond. Then the crow ester of AbC was covalently coupled with 5'-COOH on the molecule beacon, and served as a platform to attach the Cu 2+ by coordination with ether bond (-O-) of the crown cycle. Thus, an electroactive molecule beacon-based biosensing interface was constructed. In comparison with conventional methods for preparation of electroactive molecule beacon, the approach presented in this work is much simpler, reagent- and labor-saving. Selectivity study shows that the in-situ fabricated electroactive molecule beacon remains excellent recognition ability of pristine molecule beacon probe to well differentiate various DNA fragments. The target DNA can be quantatively determined over the range from 0.10pM to 0.50nM. The detection limit of 0.060pM was estimated based on signal-to-noise ratio of 3. When the biosensor was applied for the detection cauliflower mosaic virus 35s (CaMV 35s) in soybean extraction samples, satisfactory results are achieved. This work opens a new strategy for facilely fabricating electrochemical sensing interface, which also shows great potential in aptasensor and immurosensor fabrication. Copyright © 2016 Elsevier B.V. All rights reserved.

Data-mining of potential antitubercular activities from molecular ingredients of traditional Chinese medicines

PubMed Central

Jamal, Salma

2014-01-01

Background. Traditional Chinese medicine encompasses a well established alternate system of medicine based on a broad range of herbal formulations and is practiced extensively in the region for the treatment of a wide variety of diseases. In recent years, several reports describe in depth studies of the molecular ingredients of traditional Chinese medicines on the biological activities including anti-bacterial activities. The availability of a well-curated dataset of molecular ingredients of traditional Chinese medicines and accurate in-silico cheminformatics models for data mining for antitubercular agents and computational filters to prioritize molecules has prompted us to search for potential hits from these datasets. Results. We used a consensus approach to predict molecules with potential antitubercular activities from a large dataset of molecular ingredients of traditional Chinese medicines available in the public domain. We further prioritized 160 molecules based on five computational filters (SMARTSfilter) so as to avoid potentially undesirable molecules. We further examined the molecules for permeability across Mycobacterial cell wall and for potential activities against non-replicating and drug tolerant Mycobacteria. Additional in-depth literature surveys for the reported antitubercular activities of the molecular ingredients and their sources were considered for drawing support to prioritization. Conclusions. Our analysis suggests that datasets of molecular ingredients of traditional Chinese medicines offer a new opportunity to mine for potential biological activities. In this report, we suggest a proof-of-concept methodology to prioritize molecules for further experimental assays using a variety of computational tools. We also additionally suggest that a subset of prioritized molecules could be used for evaluation for tuberculosis due to their additional effect against non-replicating tuberculosis as well as the additional hepato-protection offered by the source of these ingredients. PMID:25081126

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage.

PubMed

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J

2013-03-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.

Label-free detection of protein molecules secreted from an organ-on-a-chip model for drug toxicity assays

NASA Astrophysics Data System (ADS)

Morales, Andres W.; Zhang, Yu S.; Aleman, Julio; Alerasool, Parissa; Dokmeci, Mehmet R.; Khademhosseini, Ali; Ye, Jing Yong

2016-03-01

Clinical attrition is about 30% from failure of drug candidates due to toxic side effects, increasing the drug development costs significantly and slowing down the drug discovery process. This partly originates from the fact that the animal models do not accurately represent human physiology. Hence there is a clear unmet need for developing drug toxicity assays using human-based models that are complementary to traditional animal models before starting expensive clinical trials. Organ-on-a-chip techniques developed in recent years have generated a variety of human organ models mimicking different human physiological conditions. However, it is extremely challenging to monitor the transient and long-term response of the organ models to drug treatments during drug toxicity tests. First, when an organ-on-a-chip model interacts with drugs, a certain amount of protein molecules may be released into the medium due to certain drug effects, but the amount of the protein molecules is limited, since the organ tissue grown inside microfluidic bioreactors have minimum volume. Second, traditional fluorescence techniques cannot be utilized for real-time monitoring of the concentration of the protein molecules, because the protein molecules are continuously secreted from the tissue and it is practically impossible to achieve fluorescence labeling in the dynamically changing environment. Therefore, direct measurements of the secreted protein molecules with a label-free approach is strongly desired for organs-on-a-chip applications. In this paper, we report the development of a photonic crystal-based biosensor for label-free assays of secreted protein molecules from a liver-on-a-chip model. Ultrahigh detection sensitivity and specificity have been demonstrated.

On the role of hydrogel structure and degradation in controlling the transport of cell-secreted matrix molecules for engineered cartilage

PubMed Central

Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J.; Vernerey, Franck J.

2012-01-01

Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one’s quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. PMID:23276516

Prediction of Ordered Water Molecules in Protein Binding Sites from Molecular Dynamics Simulations: The Impact of Ligand Binding on Hydration Networks.

PubMed

Rudling, Axel; Orro, Adolfo; Carlsson, Jens

2018-02-26

Water plays a major role in ligand binding and is attracting increasing attention in structure-based drug design. Water molecules can make large contributions to binding affinity by bridging protein-ligand interactions or by being displaced upon complex formation, but these phenomena are challenging to model at the molecular level. Herein, networks of ordered water molecules in protein binding sites were analyzed by clustering of molecular dynamics (MD) simulation trajectories. Locations of ordered waters (hydration sites) were first identified from simulations of high resolution crystal structures of 13 protein-ligand complexes. The MD-derived hydration sites reproduced 73% of the binding site water molecules observed in the crystal structures. If the simulations were repeated without the cocrystallized ligands, a majority (58%) of the crystal waters in the binding sites were still predicted. In addition, comparison of the hydration sites obtained from simulations carried out in the absence of ligands to those identified for the complexes revealed that the networks of ordered water molecules were preserved to a large extent, suggesting that the locations of waters in a protein-ligand interface are mainly dictated by the protein. Analysis of >1000 crystal structures showed that hydration sites bridged protein-ligand interactions in complexes with different ligands, and those with high MD-derived occupancies were more likely to correspond to experimentally observed ordered water molecules. The results demonstrate that ordered water molecules relevant for modeling of protein-ligand complexes can be identified from MD simulations. Our findings could contribute to development of improved methods for structure-based virtual screening and lead optimization.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lykkebo, Jacob; Solomon, Gemma C., E-mail: gsolomon@nano.ku.dk; Romano, Giuseppe

Electronic devices composed of single molecules constitute the ultimate limit in the continued downscaling of electronic components. A key challenge for single-molecule electronics is to control the temperature of these junctions. Controlling heating and cooling effects in individual vibrational modes can, in principle, be utilized to increase stability of single-molecule junctions under bias, to pump energy into particular vibrational modes to perform current-induced reactions, or to increase the resolution in inelastic electron tunneling spectroscopy by controlling the life-times of phonons in a molecule by suppressing absorption and external dissipation processes. Under bias the current and the molecule exchange energy, whichmore » typically results in heating of the molecule. However, the opposite process is also possible, where energy is extracted from the molecule by the tunneling current. Designing a molecular “heat sink” where a particular vibrational mode funnels heat out of the molecule and into the leads would be very desirable. It is even possible to imagine how the vibrational energy of the other vibrational modes could be funneled into the “cooling mode,” given the right molecular design. Previous efforts to understand heating and cooling mechanisms in single molecule junctions have primarily been concerned with small models, where it is unclear which molecular systems they correspond to. In this paper, our focus is on suppressing heating and obtaining current-induced cooling in certain vibrational modes. Strategies for cooling vibrational modes in single-molecule junctions are presented, together with atomistic calculations based on those strategies. Cooling and reduced heating are observed for two different cooling schemes in calculations of atomistic single-molecule junctions.« less

A first-principles study on adsorption behaviors of pristine and Li-decorated graphene sheets toward hydrazine molecules

NASA Astrophysics Data System (ADS)

Zeng, Huadong; Cheng, Xinlu; Wang, Wei

2018-03-01

The adsorption behaviors and properties of hydrazine (N2H4) molecules on pristine and Li-decorated graphene sheets were investigated by means of first-principles based on density functional theory. We systematically analyzed the optimal geometry, average binding energy, charge transfer, charge density difference and density of states of N2H4 molecules adsorbed on pristine and Li-decorated graphene sheets. It is found that the interaction between single N2H4 molecule and pristine graphene is weak physisorption with the low binding energy of -0.026 eV, suggesting that the pristine graphene sheet is insensitive to the presence of N2H4 molecule. However, it is markedly enhanced after lithium decoration with the high binding energy of -1.004 eV, verifying that the Li-decorated graphene sheet is significantly sensitive to detect N2H4 molecule. Meanwhile, the effects of the concentrations of N2H4 molecules on two different substrates were studied detailedly. For pristine graphene substrate, the average binding energy augments apparently with increasing the number of N2H4 molecules, which is mainly attributed to the van der Waals interactions and hydrogen bonds among N2H4 clusters. Li-decorated graphene sheet has still a strong affinity to N2H4 molecules despite the corresponding average binding energy emerges a contrary tendency. Overall, Li-decorated graphene sheet could be considered as a potential gas sensor in field of hydrazine molecules.

Partition functions and equilibrium constants for diatomic molecules and atoms of astrophysical interest

NASA Astrophysics Data System (ADS)

Barklem, P. S.; Collet, R.

2016-04-01

Partition functions and dissociation equilibrium constants are presented for 291 diatomic molecules for temperatures in the range from near absolute zero to 10 000 K, thus providing data for many diatomic molecules of astrophysical interest at low temperature. The calculations are based on molecular spectroscopic data from the book of Huber & Herzberg (1979, Constants of Diatomic Molecules) with significant improvements from the literature, especially updated data for ground states of many of the most important molecules by Irikura (2007, J. Phys. Chem. Ref. Data, 36, 389). Dissociation energies are collated from compilations of experimental and theoretical values. Partition functions for 284 species of atoms for all elements from H to U are also presented based on data collected at NIST. The calculated data are expected to be useful for modelling a range of low density astrophysical environments, especially star-forming regions, protoplanetary disks, the interstellar medium, and planetary and cool stellar atmospheres. The input data, which will be made available electronically, also provides a possible foundation for future improvement by the community. Full Tables 1-8 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/588/A96

Beneficial effects of bacteria-plant communication based on quorum sensing molecules of the N-acyl homoserine lactone group.

PubMed

Schikora, Adam; Schenk, Sebastian T; Hartmann, Anton

2016-04-01

Bacterial quorum sensing (QS) mechanisms play a crucial role in the proper performance and ecological fitness of bacterial populations. Many key physiological processes are regulated in a QS-dependent manner by auto-inducers, like the N-acyl homoserine lactones (AHLs) in numerous Gram-negative bacteria. In addition, also the interaction between bacteria and eukaryotic hosts can be regulated by AHLs. Those mechanisms gained much attention, because of the positive effects of different AHL molecules on plants. This positive impact ranges from growth promotion to induced resistance and is quite contrasting to the rather negative effects observed in the interactions between bacterial AHL molecules and animals. Only very recently, we began to understand the molecular mechanisms underpinning plant responses to AHL molecules. In this review, we gathered the latest information in this research field. The first part gives an overview of the bacterial aspects of quorum sensing. Later we focus on the impact of AHLs on plant growth and AHL-priming, as one of the most understood phenomena in respect to the inter-kingdom interactions based on AHL-quorum sensing molecules. Finally, we discuss the potential benefits of the understanding of bacteria-plant interaction for the future agricultural applications.

Towards fundamental understanding of ultracold KRb

NASA Astrophysics Data System (ADS)

Kotochigova, Svetlana

2009-05-01

The recent formation of ultracold KRb molecules in their absolute rovibrational ground state [1] has created great promise for study of collective phenomena that rely on the long-range interactions between polar molecules. Here we discuss the theoretical analysis of various essential properties of the KRb molecules [2] that accompanied these experimental advances. This analysis is based on multi-channel bound-state calculations of both ground and excited electronic states. We have found that the theoretical hyperfine and Zeeman mixed X^1&+circ; and a^3&+circ; vibrational structure shows excellent agreement with the experimentally observed structure. In addition, multi-channel calculations of the rovibrational structure of the excited state potentials have allowed us to find the optimal transitions to the lowest v=0 vibrational levels. Finally, we examine the dynamic polarizability of vibrationally cold KRb molecules as a function of laser frequency. Based on this knowledge, laser frequencies can be selected to minimize decoherence from loss of molecules due to spontaneous or laser-induced transitions. [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science 322, 231 (2008). [2] S. Kotochigova, E. Tiesinga, and P. S. Julienne, submitted to New J. Phys. (2009).

Förster-Induced Energy Transfer in Functionalized Graphene

PubMed Central

2014-01-01

Carbon nanostructures are ideal substrates for functionalization with molecules since they consist of a single atomic layer giving rise to an extraordinary sensitivity to changes in their surrounding. The functionalization opens a new research field of hybrid nanostructures with tailored properties. Here, we present a microscopic view on the substrate–molecule interaction in the exemplary hybrid material consisting of graphene functionalized with perylene molecules. First experiments on similar systems have been recently realized illustrating an extremely efficient transfer of excitation energy from adsorbed molecules to the carbon substrate, a process with a large application potential for high-efficiency photovoltaic devices and biomedical imaging and sensing. So far, there has been no microscopically founded explanation for the observed energy transfer. Based on first-principle calculations, we have explicitly investigated the different transfer mechanisms revealing the crucial importance of Förster coupling. Due to the efficient Coulomb interaction in graphene, we obtain strong Förster rates in the range of 1/fs. We investigate its dependence on the substrate–molecule distance R and describe the impact of the momentum transfer q for an efficient energy transfer. Furthermore, we find that the Dexter transfer mechanism is negligibly small due to the vanishing overlap between the involved strongly localized orbital functions. The gained insights are applicable to a variety of carbon-based hybrid nanostructures. PMID:24808936

A theoretical study on metal atom-modified BC3 sheets for effects of gas molecule adsorptions

NASA Astrophysics Data System (ADS)

Tang, Yanan; Cui, Xiao; Chen, Weiguang; Zhu, Dalei; Chai, Huaduo; Dai, Xianqi

2018-06-01

Based on the first-principle calculations, the chemical reactivity of transition metal (Fe, Co, Ni, and Cu) dopants within BC3 sheets toward toxic gas molecules (CO, NO, NO2, SO2, and HCN) is comparably investigated. First, the adsorbed gases on metal-modified BC3 sheets exhibit the different stability. Compared with other gases, the metal-modified BC3 substrates exhibit the stronger affinity toward the NO and NO2 molecules (> 1.0 eV), while the adsorbed HCN has the smallest adsorption energy, illustrating that the NO and NO2 as specific toxic gas molecule can be easily detected. Second, the adsorbed gas molecules can effectively regulate the electronic structure and magnetic property of BC3 systems. Fox example, the strong adsorption of NO and NO2 on Fe-modified BC3 systems exhibits non-magnetic property, yet these gases on Co modified BC3 systems exhibit the magnetic character. In addition, the adsorbed NO and SO2 can induce and turn the degree of magnetic moments of Ni- and Cu-modified BC3 systems. Therefore, the different kinds of adsorbed gases on metal-modified BC3 sheets can be distinguished through investigating the changed magnetic moments of system, which would provide important information for designing the functional BC3-based materials.

Yeast-based biosensors: design and applications.

PubMed

Adeniran, Adebola; Sherer, Michael; Tyo, Keith E J

2015-02-01

Yeast-based biosensing (YBB) is an exciting research area, as many studies have demonstrated the use of yeasts to accurately detect specific molecules. Biosensors incorporating various yeasts have been reported to detect an incredibly large range of molecules including but not limited to odorants, metals, intracellular metabolites, carcinogens, lactate, alcohols, and sugars. We review the detection strategies available for different types of analytes, as well as the wide range of output methods that have been incorporated with yeast biosensors. We group biosensors into two categories: those that are dependent upon transcription of a gene to report the detection of a desired molecule and those that are independent of this reporting mechanism. Transcription-dependent biosensors frequently depend on heterologous expression of sensing elements from non-yeast organisms, a strategy that has greatly expanded the range of molecules available for detection by YBBs. Transcription-independent biosensors circumvent the problem of sensing difficult-to-detect analytes by instead relying on yeast metabolism to generate easily detected molecules when the analyte is present. The use of yeast as the sensing element in biosensors has proven to be successful and continues to hold great promise for a variety of applications. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel

NASA Astrophysics Data System (ADS)

He, Lidong

Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.

A comprehensive study of extended tetrathiafulvalene cruciform molecules for molecular electronics: synthesis and electrical transport measurements.

PubMed

Parker, Christian R; Leary, Edmund; Frisenda, Riccardo; Wei, Zhongming; Jennum, Karsten S; Glibstrup, Emil; Abrahamsen, Peter Bæch; Santella, Marco; Christensen, Mikkel A; Della Pia, Eduardo Antonio; Li, Tao; Gonzalez, Maria Teresa; Jiang, Xingbin; Morsing, Thorbjørn J; Rubio-Bollinger, Gabino; Laursen, Bo W; Nørgaard, Kasper; van der Zant, Herre; Agrait, Nicolas; Nielsen, Mogens Brøndsted

2014-11-26

Cruciform-like molecules with two orthogonally placed π-conjugated systems have in recent years attracted significant interest for their potential use as molecular wires in molecular electronics. Here we present synthetic protocols for a large selection of cruciform molecules based on oligo(phenyleneethynylene) (OPE) and tetrathiafulvalene (TTF) scaffolds, end-capped with acetyl-protected thiolates as electrode anchoring groups. The molecules were subjected to a comprehensive study of their conducting properties as well as their photophysical and electrochemical properties in solution. The complex nature of the molecules and their possible binding in different configurations in junctions called for different techniques of conductance measurements: (1) conducting-probe atomic force microscopy (CP-AFM) measurements on self-assembled monolayers (SAMs), (2) mechanically controlled break-junction (MCBJ) measurements, and (3) scanning tunneling microscopy break-junction (STM-BJ) measurements. The CP-AFM measurements showed structure-property relationships from SAMs of series of OPE3 and OPE5 cruciform molecules; the conductance of the SAM increased with the number of dithiafulvene (DTF) units (0, 1, 2) along the wire, and it increased when substituting two arylethynyl end groups of the OPE3 backbone with two DTF units. The MCBJ and STM-BJ studies on single molecules both showed that DTFs decreased the junction formation probability, but, in contrast, no significant influence on the single-molecule conductance was observed. We suggest that the origins of the difference between SAM and single-molecule measurements lie in the nature of the molecule-electrode interface as well as in effects arising from molecular packing in the SAMs. This comprehensive study shows that for complex molecules care should be taken when directly comparing single-molecule measurements and measurements of SAMs and solid-state devices thereof.

Single Molecule Nano-Metronome

PubMed Central

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Study of the High Resolution Spectrum of the S18O16O Molecule in the Hot 2ν2 + ν3 - ν2 Band

NASA Astrophysics Data System (ADS)

Ziatkova, A. G.; Gromova, O. V.; Ulenikov, O. N.

2018-05-01

The hot 2ν2 + ν3 - ν2 hybrid band of the S18O16O molecule is assigned in the range 1800-1900 cm-1 for the first time. The spectrum is analyzed based on the method of combination differences. 56 energy levels (Jmax = 15, {K}a^{max}=12 ) are determined based on the experimental data obtained. Rotational parameters of the (021) vibrational state are determined.

Characterization of New Materials for Photovoltaic Thin Films: Aggregation Phenomena in Self-Assembled Perylene-Based Diimides

DTIC Science & Technology

2005-07-21

or solution-based methods such as spin casting or drop casting,’ 1ś󈧖 self-assembly,1922 Langmuir - Blodgett techniques,23 or electrochemical methods...and Langmuir - exist. Molecules containing a perylene diimide core have Blodgett techniques.’ 8 In many situations, the molecules also been proposed for...remain soluble in the W. J. Langmuir 1996, 12, 2169. absence of other ionic species. These systems represent (35) Antonietti, M.; Conrad, J. Angew

Polarization sensitive localization based super-resolution microscopy with a birefringent wedge

NASA Astrophysics Data System (ADS)

Sinkó, József; Gajdos, Tamás; Czvik, Elvira; Szabó, Gábor; Erdélyi, Miklós

2017-03-01

A practical method has been presented for polarization sensitive localization based super-resolution microscopy using a birefringent dual wedge. The measurement of the polarization degree at the single molecule level can reveal the chemical and physical properties of the local environment of the fluorescent dye molecule and can hence provide information about the sub-diffraction sized structure of biological samples. Polarization sensitive STORM imaging of the F-Actins proved correlation between the orientation of fluorescent dipoles and the axis of the fibril.