The ADMA/DDAH/NO pathway in human vein endothelial cells exposed to arsenite.

PubMed

Osorio-Yáñez, Citlalli; Chin-Chan, Miguel; Sánchez-Peña, Luz C; Atzatzi-Aguilar, Octavio G; Olivares-Reyes, Jesus A; Segovia, José; Del Razo, Luz M

2017-08-01

Inorganic arsenic (iAs) exposure is related to cardiovascular disease, which is characterized by endothelial dysfunction and nitric oxide (NO) depletion. The mechanisms underlying NO depletion as related to iAs exposure are not fully understood. The endogenous inhibitor of nitric oxide synthase, asymmetric dimethylarginine (ADMA), might be a molecular target of iAs. ADMA concentrations are regulated by proteins involved in its synthesis (arginine methyl transferase 1 [PRMT-1]) and degradation (dimethylarginine dimethylaminohydrolase [DDAH]). Both, ADMA and NO are susceptible to oxidative stress. We aimed to determine the ADMA/DDAH/NO pathway in human vein endothelial cells (HUVEC-CS) exposed to arsenite. We exposed HUVEC-CS cells to 1, 2.5 and 5μM of arsenite for 24h. We proved that arsenite at 5μM was able to decrease NO levels with an associated increase in ADMA and depletion of l-arginine in HUVEC-CS cells. We also found a decrease in DDAH-1 protein expression with 5μM of arsenite compared to the control group. However, we did not observe significant differences in PRMT-1 protein expression at any of the concentrations of arsenite employed. Finally, arsenite (2.5 and 5μM) increased NADPH oxidase 4 protein levels compared with the control group. We conclude that ADMA, l-arginine and DDAH are involved in NO depletion produced by arsenite, and that the mechanism is related to oxidative stress. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

PubMed Central

Piedade, Ana Paula; Morais, Paula V.

2015-01-01

Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104

Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto, E

Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a{sup fh318}. After treatment with 1 mM sodium arsenite, the survival of nrf2a{sup fh318} larvae was significantly shortermore » than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity. - Highlights: • The role of Nrf2 under arsenite exposure was valuated using zebrafish. • Nrf2 mutant zebrafish was highly sensitive to acute arsenic toxicity. • Nrf2 induced anti-arsenic genes in response to arsenite. • Sulforaphane attenuated arsenic toxicity through Nrf2 activation. • Nrf2 system plays an important role in the defense against acute arsenic toxicity.« less

Arsenic biotransformation potential of microbial arsH responses in the biogeochemical cycling of arsenic-contaminated groundwater.

PubMed

Chang, Jin-Soo; Yoon, In-Ho; Kim, Kyoung-Woong

2018-01-01

ArsH encodes an oxidoreductase, an NAD(P)H-dependent mononucleotide reductase, with an unknown function, frequently within an ars operon, and is widely distributed in bacteria. Novel arsenite-oxidizing bacteria have been isolated from arsenic-contaminated groundwater and surface soil in Vietnam. We found that ArsH gene activity, with arsenite oxidase in the periplasm; it revealed arsenic oxidation potential of the arsH system. Batch experiment results revealed Citrobacter freundii strain VTan4 (DQ481466) and Pseudomonas putida strain VTw33 (DQ481482) completely oxidized 1 mM of arsenite to arsenate within 30-50 h. High concentrations of arsenic were detected in groundwater and surrounding soil obtained from Vinh Tru village in Ha Nam province (groundwater: 11.0 μg/L to 37.0 μg/L; and soil: 2.5 mg/kg, 390.1 mg/kg), respectively. An arsH gene encoding an organoarsenical oxidase protein was observed in arsenite-oxidizing Citrobacter freundii strain VTan4 (DQ481466), whereas arsB, arsH, and arsH were detected in Pseudomonas putida strain VTw33 (DQ481482). arsH gene in bacteria was first reported from Vietnam for resistance and arsenite oxidase. We proposed that residues, Ser 43, Arg 45, Ser 48, and Tyr 49 are required for arsenic binding and activation of arsH. The ars-mediated biotransformation strongly influenced potential arsenite oxidase enzyme of the operon encoding a homogeneous arsH. Results suggest that the further study of arsenite-oxidizing bacteria may lead to a better understanding of arsenite oxidase responses, such as those of arsH, that may be applied to control biochemical properties; for example, speciation, detoxification, bioremediation, biotransformation, and mobilization of arsenic in contaminated groundwater. Copyright © 2017 Elsevier Ltd. All rights reserved.

Arsenite suppression of BMP signaling in human keratinocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Phillips, Marjorie A.; Qin, Qin; Hu, Qin

2013-06-15

Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction,more » BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of

Draft genome sequence of Bosea sp. WAO an arsenite and sulfide oxidizer isolated from a pyrite rock outcrop in New Jersey.

PubMed

Walczak, Alexandra B; Yee, Nathan; Young, Lily Y

2018-01-01

This genome report describes the draft genome and physiological characteristics of Bosea sp. WAO (=DSM 102914), a novel strain of the genus Bosea in the family Bradyrhizobiaceae . Bosea sp. WAO was isolated from pulverized pyritic shale containing elevated levels of arsenic. This aerobic, gram negative microorganism is capable of facultative chemolithoautotrophic growth under aerobic conditions by oxidizing the electron donors arsenite, elemental sulfur, thiosulfate, polysulfide, and amorphous sulfur. The draft genome is of a single circular chromosome 6,125,776 bp long consisting of 21 scaffolds with a G + C content of 66.84%. A total 5727 genes were predicted of which 5665 or 98.92% are protein-coding genes and 62 RNA genes. We identified the genes aioA and aioB , which encode the large and small subunits of the arsenic oxidase respectively. We also identified the genes for the complete sulfur oxidation pathway sox which is used to oxidize thiosulfate to sulfate.

Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture

PubMed Central

Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

2015-01-01

The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination. PMID:26064886

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans

PubMed Central

Godebo, Tewodros R.; Bhatt, Dhaval P.; Ilkayeva, Olga R.; Maurer, Laura L.; Hirschey, Matthew D.; Meyer, Joel N.

2016-01-01

Millions of people worldwide are chronically exposed to arsenic through contaminated drinking water. Despite decades of research studying the carcinogenic potential of arsenic, the mechanisms by which arsenic causes cancer and other diseases remain poorly understood. Mitochondria appear to be an important target of arsenic toxicity. The trivalent arsenical, arsenite, can induce mitochondrial reactive oxygen species production, inhibit enzymes involved in energy metabolism, and induce aerobic glycolysis in vitro, suggesting that metabolic dysfunction may be important in arsenic-induced disease. Here, using the model organism Caenorhabditis elegans and a novel metabolic inhibition assay, we report an in vivo induction of aerobic glycolysis following arsenite exposure. Furthermore, arsenite exposure induced severe mitochondrial dysfunction, including altered pyruvate metabolism; reduced steady-state ATP levels, ATP-linked respiration and spare respiratory capacity; and increased proton leak. We also found evidence that induction of autophagy is an important protective response to arsenite exposure. Because these results demonstrate that mitochondria are an important in vivo target of arsenite toxicity, we hypothesized that deficiencies in mitochondrial electron transport chain genes, which cause mitochondrial disease in humans, would sensitize nematodes to arsenite. In agreement with this, nematodes deficient in electron transport chain complexes I, II, and III, but not ATP synthase, were sensitive to arsenite exposure, thus identifying a novel class of gene-environment interactions that warrant further investigation in the human populace. PMID:27208080

Arsenite-induced autophagy is associated with proteotoxicity in human lymphoblastoid cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolt, Alicia M.; Zhao, Fei; Pacheco, Samantha

2012-10-15

Epidemiological studies of arsenic-exposed populations have provided evidence that arsenic exposure in humans is associated with immunosuppression. Previously, we have reported that arsenite-induced toxicity is associated with the induction of autophagy in human lymphoblastoid cell lines (LCL). Autophagy is a cellular process that functions in the degradation of damaged cellular components, including protein aggregates formed by misfolded or damaged proteins. Accumulation of misfolded or damaged proteins in the endoplasmic reticulum (ER) lumen causes ER stress and activates the unfolded protein response (UPR). In an effort to investigate the mechanism of autophagy induction by arsenite in the LCL model, we examinedmore » the potential contribution of ER stress and activation of the UPR. LCL exposed to sodium arsenite for 8-days induced expression of UPR-activated genes, including CHOP and GRP78, at the RNA and the protein level. Evidence for activation of the three arms of the UPR was observed. The arsenite-induced activation of the UPR was associated with an accumulation of protein aggregates containing p62 and LC3, proteins with established roles in the sequestration and autophagic clearance of protein aggregates. Taken together, these data provide evidence that arsenite-induced autophagy is associated with the generation of ER stress, activation of the UPR, and formation of protein aggregates that may be targeted to the lysosome for degradation. -- Highlights: ► Arsenite induces endoplasmic reticulum stress and the unfolded protein response. ► Arsenite induces the formation of protein aggregates that contain p62 and LC3-II. ► Time-course data suggests that arsenite-induced autophagy precedes ER stress.« less

Genes associated with pro-apoptotic and protective mechanisms are affected differently on exposure of neuronal cell cultures to arsenite. No indication for endoplasmic reticulum stress despite activation of grp78 and gadd153 expression.

PubMed

Mengesdorf, Thorsten; Althausen, Sonja; Paschen, Wulf

2002-08-15

The effect of arsenite exposure on cell viability, protein synthesis, energy metabolism and the expression of genes coding for cytoplasmic (hsp70) and endoplasmic reticulum (ER; gadd153, grp78, grp94) stress proteins was investigated in primary neuronal cell cultures. Furthermore, signs of ER stress were evaluated by investigating xbp1 mRNA processing. Arsenite levels of 30 and 100 microM induced severe cell injury. Protein synthesis was reduced to below 20% of control in cultures exposed to 30 and 100 microM arsenite for 1 h, and it remained markedly suppressed until 24 h of exposure. Arsenite induced a transient inhibition of energy metabolism after 1 h of exposure, but energy state recovered completely after 3 h. Arsenite exposure affected the expression and translation of genes coding for HSP70 and GRP78, GRP94, GADD153 to different extents. While hsp70 mRNA levels rose drastically, approximally 550-fold after 6 h exposure, HSP70 protein levels did not change over the first 6 h. On the other hand, gadd153 mRNA levels rose only approximately 14-fold after 6 h exposure, while GADD153 protein levels were markedly increased after 3 and 6 h exposure. HSP70 protein levels were markedly increased and GADD153 protein levels decreased to almost control levels in cultures left in arsenite solution for 24 h, i.e. when only a small fraction of cells had escaped arsenite toxicity. Arsenite exposure of neurons thus induced an imbalance between pro-apoptotic and survival-activating pathways. Despite the marked increase in gadd153 mRNA levels, we did not observe signs of xbp1 processing in arsenite exposed cultures, indicating that arsenite did not produce ER stress.

Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young

2007-12-01

In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response elementmore » (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.« less

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Two distinct arsenite-resistant variants of Leishmania amazonensis take different routes to achieve resistance as revealed by comparative transcriptomics.

PubMed

Lin, Yi-Chun; Hsu, Ju-Yu; Shu, Jui-Hsu; Chi, Yi; Chiang, Su-Chi; Lee, Sho Tone

2008-11-01

Genome-wide search for the genes involved in arsenite resistance in two distinct variants A and A' of Leishmania amazonensis revealed that the two variants used two different mechanisms to achieve resistance, even though these two variants were derived from the same clone and selected against arsenite under the same conditions. In variant A, the variant with DNA amplification, the biochemical pathways for detoxification of oxidative stress, the energy generation system to support the biochemical and physiological needs of the variant for DNA and protein synthesis and the arsenite translocating system to dispose arsenite are among the primary biochemical events that are upregulated under the arsenite stress to gain resistance. In variant A', the variant without DNA amplification, the upregulation of aquaglyceroporin (AQP) gene and the high level of resistance to arsenate point to the direction that the resistance gained by the variant is due to arsenate which is probably oxidized from arsenite in the arsenite solution used for selection and the maintenance of the cell culture. As a result of the AQP upregulation for arsenite disposal, a different set of biochemical pathways for detoxification of oxidative stress, energy generation and cellular signaling are upregulated to sustain the growth of the variant to gain resistance to arsenate. From current evidences, reactive oxygen species (ROS) overproduced by the parasite soon after exposure to arsenite appear to play an instrumental role in both variants to initiate the subsequent biochemical events that allow the same clone of L. amazonensis to take two totally different routes to diverge into two different variants.

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Altered Hepatic Transport by Fetal Arsenite Exposure in Diet-Induced Fatty Liver Disease.

PubMed

Ditzel, Eric J; Li, Hui; Foy, Caroline E; Perrera, Alec B; Parker, Patricia; Renquist, Benjamin J; Cherrington, Nathan J; Camenisch, Todd D

2016-07-01

Non-alcoholic fatty liver disease can result in changes to drug metabolism and disposition potentiating adverse drug reactions. Furthermore, arsenite exposure during development compounds the severity of diet-induced fatty liver disease. This study examines the effects of arsenite potentiated diet-induced fatty liver disease on hepatic transport in male mice. Changes were detected for Mrp2/3/4 hepatic transporter gene expression as well as for Oatp1a4/2b1/1b2. Plasma concentrations of Mrp and Oatp substrates were increased in arsenic exposure groups compared with diet-only controls. In addition, murine embryonic hepatocytes and adult primary hepatocytes show significantly altered transporter expression after exposure to arsenite alone: a previously unreported phenomenon. These data indicate that developmental exposure to arsenite leads to changes in hepatic transport which could increase the risk for ADRs during fatty liver disease. © 2016 Wiley Periodicals, Inc.

Molecular evolution of the polyamine oxidase gene family in Metazoa

PubMed Central

2012-01-01

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

Molecular evolution of the polyamine oxidase gene family in Metazoa.

PubMed

Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

2012-06-20

Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

PubMed Central

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

Anaerobic oxidation of arsenite in Mono Lake water and by a facultative, arsenite-oxidizing chemoautotroph, strain MLHE-1

USGS Publications Warehouse

Oremland, R.S.; Hoeft, S.E.; Santini, J.M.; Bano, N.; Hollibaugh, R.A.; Hollibaugh, J.T.

2002-01-01

Arsenite [As(III)]-enriched anoxic bottom water from Mono Lake, California, produced arsenate [As(V)] during incubation with either nitrate or nitrite. No such oxidation occurred in killed controls or in live samples incubated without added nitrate or nitrite. A small amount of biological As(III) oxidation was observed in samples amended with Fe(III) chelated with nitrolotriacetic acid, although some chemical oxidation was also evident in killed controls. A pure culture, strain MLHE-1, that was capable of growth with As(III) as its electron donor and nitrate as its electron acceptor was isolated in a defined mineral salts medium. Cells were also able to grow in nitrate-mineral salts medium by using H2 or sulfide as their electron donor in lieu of As(III). Arsenite-grown cells demonstrated dark 14CO2 fixation, and PCR was used to indicate the presence of a gene encoding ribulose-1,5-biphosphate carboxylase/oxygenase. Strain MLHE-1 is a facultative chemoautotroph, able to grow with these inorganic electron donors and nitrate as its electron acceptor, but heterotrophic growth on acetate was also observed under both aerobic and anaerobic (nitrate) conditions. Phylogenetic analysis of its 16S ribosomal DNA sequence placed strain MLHE-1 within the haloalkaliphilic Ectothiorhodospira of the ??-Proteobacteria. Arsenite oxidation has never been reported for any members of this subgroup of the Proteobacteria.

Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity

PubMed Central

Tang, Zhong; Lv, Yanling; Chen, Fei; Zhang, Wenwen; Rosen, Barry P.; Zhao, Fang-Jie

2016-01-01

Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species. PMID:26998776

A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

PubMed

Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

1998-01-01

The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

The H-bond network surrounding the pyranopterins modulates redox cooperativity in the molybdenum-bisPGD cofactor in arsenite oxidase.

PubMed

Duval, Simon; Santini, Joanne M; Lemaire, David; Chaspoul, Florence; Russell, Michael J; Grimaldi, Stephane; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

2016-09-01

While the molybdenum cofactor in the majority of bisPGD enzymes goes through two consecutive 1-electron redox transitions, previous protein-film voltammetric results indicated the possibility of cooperative (n=2) redox behavior in the bioenergetic enzyme arsenite oxidase (Aio). Combining equilibrium redox titrations, optical and EPR spectroscopies on concentrated samples obtained via heterologous expression, we unambiguously confirm this claim and quantify Aio's redox cooperativity. The stability constant, Ks, of the Mo(V) semi-reduced intermediate is found to be lower than 10(-3). Site-directed mutagenesis of residues in the vicinity of the Mo-cofactor demonstrates that the degree of redox cooperativity is sensitive to H-bonding interactions between the pyranopterin moieties and amino acid residues. Remarkably, in particular replacing the Gln-726 residue by Gly results in stabilization of (low-temperature) EPR-observable Mo(V) with KS=4. As evidenced by comparison of room temperature optical and low temperature EPR titrations, the degree of stabilization is temperature-dependent. This highlights the importance of room-temperature redox characterizations for correctly interpreting catalytic properties in this group of enzymes. Geochemical and phylogenetic data strongly indicate that molybdenum played an essential biocatalytic roles in early life. Molybdenum's redox versatility and in particular the ability to show cooperative (n=2) redox behavior provide a rationale for its paramount catalytic importance throughout the evolutionary history of life. Implications of the H-bonding network modulating Molybdenum's redox properties on details of a putative inorganic metabolism at life's origin are discussed. Copyright © 2016. Published by Elsevier B.V.

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Low dose arsenite confers resistance to UV induced apoptosis via p53-MDM2 pathway in ketatinocytes

PubMed Central

Zhou, Y; Zeng, W; Qi, M; Duan, Y; Su, J; Zhao, S; Zhong, W; Gao, M; Li, F; He, Y; Hu, X; Xu, X; Chen, X; Peng, C; Zhang, J

2017-01-01

Chronic arsenite and ultraviolet (UV) exposure are associated with skin tumor. To investigate the details by low concentrations of arsenite and UV induced carcinogenesis in skin, hTERT-immortalized human keratinocytes were used as a cellular model with exposure to low concentrations of sodium arsenite and UV. The effect of NaAsO2 on UV treatment-induced apoptosis was measured by flow cytometry and Hoechst staining. We found that the cell apoptosis induced by UV exposure was significantly attenuated after exposure to low-dose arsenite, and knockdown of p53 could block UV-induced apoptosis indicating that this phenomenon depended on p53. Interestingly, the expression of murine double minute 2 (MDM2), including its protein and transcriptional levels, was remarkably high after exposure to low-dose arsenite. Moreover, low-dose arsenite treatment dramatically decreased the MDM2 gene promoter activity, suggesting that this effect has been mediated through transcription. In addition, treatment of PD98059 reversed low-dose arsenite-induced MDM2 expression, and the inhibition of ERK2 expression could significantly block MDM2 expression as a consequence, and p53 expression automatically was increased. To validate the role of p53 in exposure to low-dose arsenite, the expression of p53 was examined by immunohistochemistry in the skin of Sprague−Dawley rats model by chronic arsenite exposure for 6 months and in patients with arsenic keratosis, and the results showed that the expression of p53 was decreased in those samples. Taken together, our results demonstrated that low-dose arsenite-induced resistance to apoptosis through p53 mediated by MDM2 in keratinocytes. PMID:28785074

METHYLATION OF SODIUM ARSENITE BY VARIOUS MAMMALIAN CELLS

EPA Science Inventory

Methylation of Sodium Arsenite by various Mammalian Cells

Methylation of arsenite (As 3-1) is thought to play an important role in the carcinogenicity of arsenic. AIM: I. Characterization of methylation of arsenite in primary rodent and transformed human cell lines. ...

Facultative anoxygenic photosynthesis in cyanobacteria driven by arsenite and sulfide with evidence for the support of nitrogen fixation

NASA Astrophysics Data System (ADS)

Wolfe-Simon, F.; Hoeft, S. E.; Baesman, S. M.; Oremland, R. S.

2010-12-01

The rise in atmospheric oxygen (O2) over geologic time is attributed to the evolution and widespread proliferation of oxygenic photosynthesis in cyanobacteria. However, cyanobacteria maintain a metabolic flexibility that may not always result in O2 release. In the environment, cyanobacteria may use a variety of alternative electron donors rather than water that are known to be used by other anoxygenic phototrophs (eg. purple sulfur bacteria) including reduced forms of sulfur, iron, nitrogen, and arsenic. Recent evidence suggests cyanobacteria actively take advantage of at least a few of these alternatives. We used a classical Winogradsky approach to enrich for cyanobacteria from the high salinity, elevated pH and arsenic-enriched waters of Mono Lake (CA). Experiments, optimized for cyanobacteria, revealed light-dependent, anaerobic arsenite-oxidation in sub-cultured sediment-free enrichments dominated by a filamentous cyanobacteria. We isolated and identified the dominant member of this enrichment to be a member of the Oscillatoriales by 16S rDNA. Addition of 1 mM arsenite induced facultative anoxygenic photosynthesis under continuous and circadian light. This isolate also oxidized sulfide under the same light-based conditions. Aerobic conditions elicited no arsenite oxidation in the light or dark and the isolate grew as a typical cyanobacterium using oxygenic photosynthesis. Under near-infrared light (700 nm) there was a direct correlation of enhanced growth with an increase in the rate arsenite or sulfide oxidation suggesting the use of photosystem I. Additionally, to test the wide-spread nature of this metabolism in the Oscillatoriales, we followed similar arsenite- and sulfide-driven facultative anoxygenic photosynthesis as well as nitrogen fixation (C2H2 reduction) in the axenic isolate Oscillatoria sp. CCMP 1731. Future characterization includes axenic isolation of the Mono Lake Oscillatoria sp. as well as the arsenite oxidase responsible for electron

Genomic Evidence Reveals the Extreme Diversity and Wide Distribution of the Arsenic-Related Genes in Burkholderiales

PubMed Central

Li, Xiangyang; Zhang, Linshuang; Wang, Gejiao

2014-01-01

So far, numerous genes have been found to associate with various strategies to resist and transform the toxic metalloid arsenic (here, we denote these genes as “arsenic-related genes”). However, our knowledge of the distribution, redundancies and organization of these genes in bacteria is still limited. In this study, we analyzed the 188 Burkholderiales genomes and found that 95% genomes harbored arsenic-related genes, with an average of 6.6 genes per genome. The results indicated: a) compared to a low frequency of distribution for aio (arsenite oxidase) (12 strains), arr (arsenate respiratory reductase) (1 strain) and arsM (arsenite methytransferase)-like genes (4 strains), the ars (arsenic resistance system)-like genes were identified in 174 strains including 1,051 genes; b) 2/3 ars-like genes were clustered as ars operon and displayed a high diversity of gene organizations (68 forms) which may suggest the rapid movement and evolution for ars-like genes in bacterial genomes; c) the arsenite efflux system was dominant with ACR3 form rather than ArsB in Burkholderiales; d) only a few numbers of arsM and arrAB are found indicating neither As III biomethylation nor AsV respiration is the primary mechanism in Burkholderiales members; (e) the aio-like gene is mostly flanked with ars-like genes and phosphate transport system, implying the close functional relatedness between arsenic and phosphorus metabolisms. On average, the number of arsenic-related genes per genome of strains isolated from arsenic-rich environments is more than four times higher than the strains from other environments. Compared with human, plant and animal pathogens, the environmental strains possess a larger average number of arsenic-related genes, which indicates that habitat is likely a key driver for bacterial arsenic resistance. PMID:24632831

Genome sequence of the photoarsenotrophic bacterium Ectothiorhodospira sp. strain BSL-9, isolated from a hypersaline alkaline arsenic-rich extreme environment

USGS Publications Warehouse

Hernandez-Maldonado, Jaime; Stoneburner, Brendon; Boren, Alison; Miller, Laurence; Rosen, Michael R.; Oremland, Ronald S.; Saltikov, Chad W

2016-01-01

The full genome sequence of Ectothiorhodospira sp. strain BSL-9 is reported here. This purple sulfur bacterium encodes an arxA-type arsenite oxidase within the arxB2AB1CD gene island and is capable of carrying out “photoarsenotrophy” anoxygenic photosynthetic arsenite oxidation. Its genome is composed of 3.5 Mb and has approximately 63% G+C content.

Prophylactic neuroprotective efficiency of co-administration of Ginkgo biloba and Trifolium pretense against sodium arsenite-induced neurotoxicity and dementia in different regions of brain and spinal cord of rats.

PubMed

Abdou, Heba M; Yousef, Mokhtar I; El Mekkawy, Desouki A; Al-Shami, Ahmed S

2016-08-01

The present study was carried out to evaluate the potential protective role of co-administration of Ginkgo biloba, Trifolium pretenseagainst sodium arsenite-induced neurotoxicity in different parts of brain (Cerebral cortex, Hippocampus, striatum and Hind brain) and in the spinal cord of rats. Sodium arsenite caused impairment in the acquisition and learning in all the behavioral tasks and caused significant increase in tumor necrosis factor-α,thiobarbituric acid-reactive substances andlipid profile, while caused significant decrease in glutathione, total thiol content, total antioxidant capacity, acetylcholinesterase, monoamine oxidase and ATPases activities. These results were confirmed by histopathological, fluorescence and scanning electron microscopy examination of different regions of brain. From these results sodium arsenite-induced neurodegenerative disorder in different regions of brain and spinal cord and this could be mediated through modifying the intracellular brain ions homeostasis, cholinergic dysfunction and oxidative damage. The presence of Ginkgo biloba and/orTrifolium pretense with sodium arsenite minimized its neurological damages. It was pronounced that using Ginkgo biloba and Trifolium pretense in combination was more effective as protective agents compared to use eachone of them alone. Copyright © 2016 Elsevier Ltd. All rights reserved.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

PubMed

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Characterization of two brassinosteroid C-6 oxidase genes in pea.

PubMed

Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

2007-04-01

C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

Copy number of ArsR reporter plasmid determines its arsenite response and metal specificity.

PubMed

Fang, Yun; Zhu, Chunjie; Chen, Xingjuan; Wang, Yan; Xu, Meiying; Sun, Guoping; Guo, Jun; Yoo, Jinnon; Tie, Cuijuan; Jiang, Xin; Li, Xianqiang

2018-05-16

The key component in bacteria-based biosensors is a transcriptional reporter employed to monitor induction or repression of a reporter gene corresponding to environmental change. In this study, we made a series of reporters in order to achieve highly sensitive detection of arsenite. From these reporters, two biosensors were developed by transformation of Escherichia coli DH5α with pLHPars9 and pLLPars9, consisting of either a high or low copy number plasmid, along with common elements of ArsR-luciferase fusion and addition of two binding sequences, one each from E. coli and Acidithiobacillus ferrooxidans chromosome, in front of the R773 ArsR operon. Both of them were highly sensitive to arsenite, with a low detection limit of 0.04 μM arsenite (~ 5 μg/L). They showed a wide dynamic range of detection up to 50 μM using high copy number pLHPars9 and 100 μM using low copy number pLLPars9. Significantly, they differ in metal specificity, pLLPars9 more specific to arsenite, while pLHPars9 to both arsenite and antimonite. The only difference between pLHPars9 and pLLPars9 is their copy numbers of plasmid and corresponding ratios of ArsR to its binding promoter/operator sequence. Therefore, we propose a working model in which DNA bound-ArsR is different from its free form in metal specificity.

Enzyme phylogenies as markers for the oxidation state of the environment: the case of respiratory arsenate reductase and related enzymes.

PubMed

Duval, Simon; Ducluzeau, Anne-Lise; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

2008-07-16

Phylogenies of certain bioenergetic enzymes have proved to be useful tools for deducing evolutionary ancestry of bioenergetic pathways and their relationship to geochemical parameters of the environment. Our previous phylogenetic analysis of arsenite oxidase, the molybdopterin enzyme responsible for the biological oxidation of arsenite to arsenate, indicated its probable emergence prior to the Archaea/Bacteria split more than 3 billion years ago, in line with the geochemical fact that arsenite was present in biological habitats on the early Earth. Respiratory arsenate reductase (Arr), another molybdopterin enzyme involved in microbial arsenic metabolism, serves as terminal oxidase, and is thus situated at the opposite end of bioenergetic electron transfer chains as compared to arsenite oxidase. The evolutionary history of the Arr-enzyme has not been studied in detail so far. We performed a genomic search of genes related to arrA coding for the molybdopterin subunit. The multiple alignment of the retrieved sequences served to reconstruct a neighbor-joining phylogeny of Arr and closely related enzymes. Our analysis confirmed the previously proposed proximity of Arr to the cluster of polysulfide/thiosulfate reductases but also unravels a hitherto unrecognized clade even more closely related to Arr. The obtained phylogeny strongly suggests that Arr originated after the Bacteria/Archaea divergence in the domain Bacteria, and was subsequently laterally distributed within this domain. It further more indicates that, as a result of accumulation of arsenate in the environment, an enzyme related to polysulfide reductase and not to arsenite oxidase has evolved into Arr. These findings are paleogeochemically rationalized by the fact that the accumulation of arsenate over arsenite required the increase in oxidation state of the environment brought about by oxygenic photosynthesis.

An Oxidoreductase AioE is Responsible for Bacterial Arsenite Oxidation and Resistance

PubMed Central

Wang, Qian; Han, Yushan; Shi, Kaixiang; Fan, Xia; Wang, Lu; Li, Mingshun; Wang, Gejiao

2017-01-01

Previously, we found that arsenite (AsIII) oxidation could improve the generation of ATP/NADH to support the growth of Agrobacterium tumefaciens GW4. In this study, we found that aioE is induced by AsIII and located in the arsenic island near the AsIII oxidase genes aioBA and co-transcripted with the arsenic resistant genes arsR1-arsC1-arsC2-acr3-1. AioE belongs to TrkA family corresponding the electron transport function with the generation of NADH and H+. An aioE in-frame deletion strain showed a null AsIII oxidation and a reduced AsIII resistance, while a cytC mutant only reduced AsIII oxidation efficiency. With AsIII, aioE was directly related to the increase of NADH, while cytC was essential for ATP generation. In addition, cyclic voltammetry analysis showed that the redox potential (ORP) of AioBA and AioE were +0.297 mV vs. NHE and +0.255 mV vs. NHE, respectively. The ORP gradient is AioBA > AioE > CytC (+0.217 ~ +0.251 mV vs. NHE), which infers that electron may transfer from AioBA to CytC via AioE. The results indicate that AioE may act as a novel AsIII oxidation electron transporter associated with NADH generation. Since AsIII oxidation contributes AsIII detoxification, the essential of AioE for AsIII resistance is also reasonable. PMID:28128323

How sodium arsenite improve amyloid β-induced memory deficit?

PubMed

Nassireslami, Ehsan; Nikbin, Parmida; Amini, Elham; Payandemehr, Borna; Shaerzadeh, Fatemeh; Khodagholi, Fariba; Yazdi, Behnoosh Bonakdar; Kebriaeezadeh, Abbas; Taghizadeh, Ghorban; Sharifzadeh, Mohammad

2016-09-01

Evidence has shown that arsenic exposure, besides its toxic effects results in impairment of learning and memory, but its molecular mechanisms are not fully understood. In the present study, we examined sodium arsenite (1, 5, 10, 100nM) effects on contextual and tone memory of male rats in Pavlovian fear conditioning paradigm alone and in co-administration with β-amyloid. We detected changes in the level of caspase-3, nuclear factor kappa-B (NF-κB), cAMP response element-binding (CREB), heme oxygenase-1 and NF-E2-related factor-2 (Nrf2) by Western blot. Sodium arsenite in high doses induced significant memory impairment 9 and 16days after infusion. By contrast, low doses of sodium arsenite attenuate memory deficit in Aβ injected rats after 16days. Our data revealed that treatment with high concentration of sodium arsenite increased caspase-3 cleavage and NF-κB level, 9days after injection. Whereas, low doses of sodium arsenite cause Nrf2 and HO-1 activation and increased CREB phosphorylation in the hippocampus. These findings suggest the concentration dependent effects of sodium arsenite on contextual and tone memory. Moreover, it seems that the neuroprotective effects of ultra-low concentrations of sodium arsenite on Aβ-induced memory impairment is mediated via an increase Nrf2, HO-1 and CREB phosphorylation levels and decrease caspase-3 and NF-κB amount. Copyright © 2016. Published by Elsevier Inc.

Do Si/As ratios in growth medium affect arsenic uptake, arsenite efflux and translocation of arsenite in rice (Oryza sativa)?

PubMed

Zhang, Min; Zhao, Quanli; Xue, Peiying; Zhang, Shijie; Li, Bowen; Liu, Wenju

2017-10-01

Silicon (Si) may decrease the uptake and accumulation of arsenic (As) in rice. However, the effects of Si/As ratios in growth medium on arsenic uptake, arsenite efflux to the external medium and translocation of arsenite in rice are currently unclear. Rice seedlings (Oryza sativa L.) were exposed to nutrient solutions with 10 μM arsenite [As(III)] or 10 μM arsenate [As(V)] to explore the influence of different silicic acid concentrations (0, 10, 100, 1000 μM) on arsenic uptake and translocation of arsenite with or without 91 μM phosphate for 24 h. Arsenic speciation was determined in nutrient solutions, roots, and shoots. In the arsenite treatments, different Si/As ratios (1:1, 10:1, 100:1) did not affect As(III) uptake by rice roots, however they did inhibit translocation of As(III) from roots to shoots significantly (P < 0.001) in the absence of P. In the arsenate treatments, a Si/As ratio of 100:1 significantly decreased As(V) uptake and As(III) efflux compared with the control (Si/As at 0:1), accounting for decreases of 27.4% and 15.1% for -P treatment and 47.8% and 61.1% for + P treatment, respectively. As(III) is the predominant species of arsenic in rice roots and shoots. A Si/As ratio of 100:1 reduced As(III) translocation from roots to shoots markedly without phosphate. When phosphate was supplied, As(III) translocation from roots to shoots was significantly inhibited by Si/As ratios of 10:1 and 100:1. The results indicated that in the presence of P, different silicic acid concentrations did not impact arsenite uptake and transport in rice when arsenite was supplied. However, a Si/As ratio of 100:1 inhibited As(V) uptake, as well as As(III) efflux and translocation from roots to shoots when arsenate was supplied. Copyright © 2017 Elsevier Ltd. All rights reserved.

ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

EPA Science Inventory

ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

Useful biomarkers of arsenic effects in both experimental animals and humans are needed. Arsenate and arsenite are good inducers of rat hepatic and renal heme oxygenase (HO); monomethylarsonic acid (MMA) and dimethylarsi...

Embryonic exposure to sodium arsenite perturbs vascular development in zebrafish.

PubMed

McCollum, Catherine W; Hans, Charu; Shah, Shishir; Merchant, Fatima A; Gustafsson, Jan-Åke; Bondesson, Maria

2014-07-01

Exposure to arsenic in its inorganic form, arsenite, causes adverse effects to many different organs and tissues. Here, we have investigated arsenite-induced adverse effects on vascular tissues in the model organism zebrafish, Danio rerio. Zebrafish embryos were exposed to arsenite at different exposure windows and the susceptibility to vascular tissue damage was recorded at 72hours post fertilization (hpf). Intersegmental vessel sprouting and growth was most perturbed by exposure to arsenite during the 24-48hpf window, while disruption in the condensation of the caudal vein plexus was more often observed at the 48-72hpf exposure window, reflecting when these structures develop during normal embryogenesis. The vascular growth rate was decreased by arsenite exposure, and deviated from that of control embryos at around 24-26.5hpf. We further mapped changes in expression of key regulators of angiogenesis and vasculogenesis. Downregulation of vascular endothelial growth factor receptor 1/fms-related tyrosine kinase 1 (vegfr1/flt1) expression was evident already at 24hpf, coinciding with the decreased vascular growth rate. At later time points, matrix metalloproteinase 9 (mmp9) expression was upregulated, suggesting that arsenite affects the composition of the extracellular matrix. In total, the expression of eight key factors involved in different aspects of vascularization was significantly altered by arsenic exposure. In conclusion, our results show that arsenite is a potent vascular disruptor in the developing zebrafish embryo, a finding that calls for an evaluation of arsenite as a developmental vascular toxicant in mammalian model systems. Copyright © 2014 Elsevier B.V. All rights reserved.

Enzyme phylogenies as markers for the oxidation state of the environment: The case of respiratory arsenate reductase and related enzymes

PubMed Central

2008-01-01

Background Phylogenies of certain bioenergetic enzymes have proved to be useful tools for deducing evolutionary ancestry of bioenergetic pathways and their relationship to geochemical parameters of the environment. Our previous phylogenetic analysis of arsenite oxidase, the molybdopterin enzyme responsible for the biological oxidation of arsenite to arsenate, indicated its probable emergence prior to the Archaea/Bacteria split more than 3 billion years ago, in line with the geochemical fact that arsenite was present in biological habitats on the early Earth. Respiratory arsenate reductase (Arr), another molybdopterin enzyme involved in microbial arsenic metabolism, serves as terminal oxidase, and is thus situated at the opposite end of bioenergetic electron transfer chains as compared to arsenite oxidase. The evolutionary history of the Arr-enzyme has not been studied in detail so far. Results We performed a genomic search of genes related to arrA coding for the molybdopterin subunit. The multiple alignment of the retrieved sequences served to reconstruct a neighbor-joining phylogeny of Arr and closely related enzymes. Our analysis confirmed the previously proposed proximity of Arr to the cluster of polysulfide/thiosulfate reductases but also unravels a hitherto unrecognized clade even more closely related to Arr. The obtained phylogeny strongly suggests that Arr originated after the Bacteria/Archaea divergence in the domain Bacteria, and was subsequently laterally distributed within this domain. It further more indicates that, as a result of accumulation of arsenate in the environment, an enzyme related to polysulfide reductase and not to arsenite oxidase has evolved into Arr. Conclusion These findings are paleogeochemically rationalized by the fact that the accumulation of arsenate over arsenite required the increase in oxidation state of the environment brought about by oxygenic photosynthesis. PMID:18631373

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

METHYLATION OF ARSENITE BY SOME MAMMALIAN CELL LINES

EPA Science Inventory

THIS ABSTRACT WAS SUBMITTED ELECTRONICALLY;. SPACE CONSTRAINTS WERE SEVERE)

Methylation of Arsenite by Some Mammalian Cell Lines.

Methylation of arsenite is thought to play an important role in the carcinogenicity of arsenic.
Aim 1: Determine if there is diffe...

Augmenting effects of gestational arsenite exposure of C3H mice on the hepatic tumors of the F₂ male offspring via the F₁ male offspring.

PubMed

Nohara, Keiko; Okamura, Kazuyuki; Suzuki, Takehiro; Murai, Hikari; Ito, Takaaki; Shinjo, Keiko; Takumi, Shota; Michikawa, Takehiro; Kondo, Yutaka; Hata, Kenichiro

2016-01-01

Gestational exposure can affect the F2 generation through exposure of F1 germline cells. Previous studies reported that arsenite exposure of only F0 females during their pregnancy increases hepatic tumors in the F1 males in C3H mice, whose males are predisposed spontaneously to develop hepatic tumors later in life. The present study addressed the effects of gestational arsenite exposure on tumorigenesis of the F2 males in C3H mice. Expression analysis of several genes in the normal livers at 53 and 80 weeks of age clearly showed significant changes in the F2 males obtained by crossing gestational arsenite-exposed F1 (arsenite-F1) males and females compared to the control F2 males. Some of the changes were shown to occur in a late-onset manner. Then the tumor incidence was assessed at 75-82 weeks of age in the F2 males obtained by reciprocal crossing between the control and arsenite-F1 males and females. The results demonstrated that the F2 males born to arsenite-F1 males developed tumors at a significantly higher rate than the F2 males born to the control F1 males, irrespective of exposure of F1 females. Gene expressions of hepatocellular carcinoma markers β-catenin (CTNNB1) and interleukin-1 receptor antagonist in the tumors were significantly upregulated in the F2 males born to arsenite-F1 males compared to those born to the control F1 males. These results show that arsenite exposure of only F0 pregnant mice causes late-onset changes and augments tumors in the livers of the F2 males by affecting the F1 male offspring. Copyright © 2015 John Wiley & Sons, Ltd.

Diversity surveys and evolutionary relationships of aoxB genes in aerobic arsenite-oxidizing bacteria.

PubMed

Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N; Garrido, Francis; Joulian, Catherine

2008-07-01

A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers.

Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

PubMed

Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

2002-07-19

The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

Arsenite-induced mitotic death involves stress response and is independent of tubulin polymerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, B. Frazier; McNeely, Samuel C.; Miller, Heather L.

2008-07-15

Arsenite, a known mitotic disruptor, causes cell cycle arrest and cell death at anaphase. The mechanism causing mitotic arrest is highly disputed. We compared arsenite to the spindle poisons nocodazole and paclitaxel. Immunofluorescence analysis of {alpha}-tubulin in interphase cells demonstrated that, while nocodazole and paclitaxel disrupt microtubule polymerization through destabilization and hyperpolymerization, respectively, microtubules in arsenite-treated cells remain comparable to untreated cells even at supra-therapeutic concentrations. Immunofluorescence analysis of {alpha}-tubulin in mitotic cells showed spindle formation in arsenite- and paclitaxel-treated cells but not in nocodazole-treated cells. Spindle formation in arsenite-treated cells appeared irregular and multi-polar. {gamma}-tubulin staining showed that cellsmore » treated with nocodazole and therapeutic concentrations of paclitaxel contained two centrosomes. In contrast, most arsenite-treated mitotic cells contained more than two centrosomes, similar to centrosome abnormalities induced by heat shock. Of the three drugs tested, only arsenite treatment increased expression of the inducible isoform of heat shock protein 70 (HSP70i). HSP70 and HSP90 proteins are intimately involved in centrosome regulation and mitotic spindle formation. HSP90 inhibitor 17-DMAG sensitized cells to arsenite treatment and increased arsenite-induced centrosome abnormalities. Combined treatment of 17-DMAG and arsenite resulted in a supra-additive effect on viability, mitotic arrest, and centrosome abnormalities. Thus, arsenite-induced abnormal centrosome amplification and subsequent mitotic arrest is independent of effects on tubulin polymerization and may be due to specific stresses that are protected against by HSP90 and HSP70.« less

MONOAMINE OXIDASE: From Genes to Behavior

PubMed Central

Shih, J. C.; Chen, K.; Ridd, M. J.

2010-01-01

Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

PubMed

Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

2015-10-01

Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. Published by Elsevier Ltd.

Chemolithoautotrophic arsenite oxidation by a thermophilic Anoxybacillus flavithermus strain TCC9-4 from a hot spring in Tengchong of Yunnan, China

PubMed Central

Jiang, Dawei; Li, Ping; Jiang, Zhou; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Guo, Qinghai; Wang, Yanxin

2015-01-01

A new facultative chemolithoautotrophic arsenite (AsIII)-oxidizing bacterium TCC9-4 was isolated from a hot spring microbial mat in Tengchong of Yunnan, China. This strain could grow with AsIII as an energy source, CO2–HCO3- as a carbon source and oxygen as the electron acceptor in a minimal salts medium. Under chemolithoautotrophic conditions, more than 90% of 100 mg/L AsIII could be oxidized by the strain TCC9-4 in 36 h. Temperature was an important environmental factor that strongly influenced the AsIII oxidation rate and AsIII oxidase (Aio) activity; the highest Aio activity was found at the temperature of 40∘C. Addition of 0.01% yeast extract enhanced the growth significantly, but delayed the AsIII oxidation. On the basis of 16S rRNA phylogenetic sequence analysis, strain TCC9-4 was identified as Anoxybacillus flavithermus. To our best knowledge, this is the first report of arsenic (As) oxidation by A. flavithermus. The Aio gene in TCC9-4 might be quite novel relative to currently known gene sequences. The results of this study expand our current understanding of microbially mediated As oxidation in hot springs. PMID:25999920

Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite.

PubMed

Ahlborn, Gene J; Nelson, Gail M; Ward, William O; Knapp, Geremy; Allen, James W; Ouyang, Ming; Roop, Barbara C; Chen, Yan; O'Brien, Thomas; Kitchin, Kirk T; Delker, Don A

2008-03-15

Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips, and pathway analysis was conducted with DAVID (NIH), Ingenuity Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers.

Inorganic arsenite alters macrophage generation from human peripheral blood monocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakurai, Teruaki; Ohta, Takami; Fujiwara, Kitao

2005-03-01

Inorganic arsenite has caused severe inflammatory chronic poisoning in humans through the consumption of contaminated well water. In this study, we examined the effects of arsenite at nanomolar concentrations on the in vitro differentiation of human macrophages from peripheral blood monocytes. While arsenite was found to induce cell death in a culture system containing macrophage colony stimulating factor (M-CSF), macrophages induced by granulocyte-macrophage CSF (GM-CSF) survived the treatment, but were morphologically, phenotypically, and functionally altered. In particular, arsenite-induced cells expressed higher levels of a major histocompatibility complex (MHC) class II antigen, HLA-DR, and CD14. They were more effective at inducingmore » allogeneic or autologous T cell responses and responded more strongly to bacterial lipopolysaccharide (LPS) by inflammatory cytokine release as compared to cells induced by GM-CSF alone. On the other hand, arsenite-induced cells expressed lower levels of CD11b and CD54 and phagocytosed latex beads or zymosan particles less efficiently. We also demonstrated that the optimum amount of cellular reactive oxygen species (ROS) induced by nM arsenite might play an important role in this abnormal monocyte differentiation. This work may have implications in chronic arsenic poisoning because the total peripheral blood arsenic concentrations of these patients are at nM levels.« less

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Diversity Surveys and Evolutionary Relationships of aoxB Genes in Aerobic Arsenite-Oxidizing Bacteria▿ †

PubMed Central

Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N.; Garrido, Francis; Joulian, Catherine

2008-01-01

A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers. PMID:18502920

Population structure and abundance of arsenite-oxidizing bacteria along an arsenic pollution gradient in waters of the upper isle River Basin, France.

PubMed

Quéméneur, Marianne; Cébron, Aurélie; Billard, Patrick; Battaglia-Brunet, Fabienne; Garrido, Francis; Leyval, Corinne; Joulian, Catherine

2010-07-01

Denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR) were successfully developed to monitor functional aoxB genes as markers of aerobic arsenite oxidizers. DGGE profiles showed a shift in the structure of the aoxB-carrying bacterial population, composed of members of the Alpha-, Beta- and Gammaproteobacteria, depending on arsenic (As) and E(h) levels in Upper Isle River Basin waters. The highest aoxB gene densities were found in the most As-polluted oxic surface waters but without any significant correlation with environmental factors. Arsenite oxidizers seem to play a key role in As mobility in As-impacted waters.

Novel synergistic hydrous iron-nickel-manganese (HINM) trimetal oxide for hazardous arsenite removal.

PubMed

Nasir, A M; Goh, P S; Ismail, A F

2018-06-01

A novel hydrous iron-nickel-manganese (HINM) trimetal oxide was successfully fabricated using oxidation and coprecipitation method for metalloid arsenite removal. The atomic ratio of Fe:Ni:Mn for this adsorbent is 3:2:1. HINM adsorbent was identified as an amorphous nanosized adsorbent with particle size ranged from 30 nm to 60 nm meanwhile the total active surface area and pore diameter of HINM area of 195.78 m 2 /g and 2.43 nm, respectively. Experimental data of arsenite adsorption is best fitted into pseudo-second order and Freundlich isotherm model. The maximum adsorption capacity of arsenite onto HINM was 81.9 mg/g. Thermodynamic study showed that the adsorption of arsenite was a spontaneous and endothermic reaction with enthalpy change of 14.04 kJ/mol and Gibbs energy of -12 to -14 kJ/mol. Zeta potential, thermal gravimetric (TGA) and Fourier transform infrared (FTIR) analysis were applied to elucidate the mechanism of arsenite adsorption by HINM. Mechanism of arsenite adsorption by HINM involved both chemisorption and physisorption based on the electrostatic attraction between arsenite ions and surface charge of HINM. It also involved the hydroxyl substitution by arsenite ions through the formation of inner-sphere complex. Reusability of HINM trimetal oxide was up to 89% after three cycles of testing implied that HINM trimetal oxide is a promising and practical adsorbent for arsenite. Copyright © 2018 Elsevier Ltd. All rights reserved.

APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

EPA Science Inventory

Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

Population Structure and Abundance of Arsenite-Oxidizing Bacteria along an Arsenic Pollution Gradient in Waters of the Upper Isle River Basin, France▿ †

PubMed Central

Quéméneur, Marianne; Cébron, Aurélie; Billard, Patrick; Battaglia-Brunet, Fabienne; Garrido, Francis; Leyval, Corinne; Joulian, Catherine

2010-01-01

Denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR) were successfully developed to monitor functional aoxB genes as markers of aerobic arsenite oxidizers. DGGE profiles showed a shift in the structure of the aoxB-carrying bacterial population, composed of members of the Alpha-, Beta- and Gammaproteobacteria, depending on arsenic (As) and Eh levels in Upper Isle River Basin waters. The highest aoxB gene densities were found in the most As-polluted oxic surface waters but without any significant correlation with environmental factors. Arsenite oxidizers seem to play a key role in As mobility in As-impacted waters. PMID:20453153

Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

Removal of arsenite by a microbial bioflocculant produced from swine wastewater.

PubMed

Guo, Junyuan; Chen, Cheng

2017-08-01

This paper focused on the production and characteristics of a bioflocculant by using swine wastewater and its application in removing arsenite from aqueous solution. A series of experimental parameters including bioflocculant dose, calcium ions concentration, and solution pH value on arsenite uptake were evaluated. Results have demonstrated that a bioflocculant of 3.11 g L -1 was achieved as the maximum yield after 60 h fermentation, with a main backbone of polysaccharides. Maximum arsenite removal efficiency of 99.2% can be reached by adding bioflocculant in two stages: 3 × 10 -3 % (w/w) in the 1.0 min's rapid mixing (180 rpm) and 2 × 10 -3 % (w/w) after 2.0 min's slow mixing (80 rpm) with pH value fixed at 7. Negative Gibbs free energy change (ΔG o ) indicated the spontaneous nature of arsenite removal. Arsenite was removed by the bioflocculant through bridging mechanisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

PubMed

Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

2017-09-15

Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Arsenite inhibits mitotic division and perturbs spindle dynamics in HeLa S3 cells.

PubMed

Huang, S C; Lee, T C

1998-05-01

Arsenical compounds, known to be human carcinogens, were shown to disturb cell cycle progression and induce cytogenetic alterations in a variety of cell systems. We report here that a 24 h treatment of arsenite induced mitotic accumulation in human cell lines. HeLa S3 and KB cells were most susceptible: 35% of the total cell population was arrested at the mitotic stage after treatment with 5 microM sodium arsenite in HeLa S3 cells and after 10 microM in KB cells. Under a microscope, we observed abnormal mitotic figures in arsenite-arrested mitotic cells, including deranged chromosome congression, elongated polar distance of mitotic spindle, and enhanced microtubule immunofluorescence. The spindle microtubules of arsenite-arrested mitotic cells were more resistant to nocodazole-induced dissolution than those of control mitotic cells. According to turbidity assay, arsenite at concentrations below 100 microM significantly enhanced polymerization of tubulins. Since spindle dynamics play a crucial role in mitotic progression, our results suggest that arsenite-induced mitotic arrest may be due to arsenite's effects on attenuation of spindle dynamics.

Effect of vitamin E on sperm parameters and DNA integrity in sodium arsenite-treated rats.

PubMed

Momeni, Hamid Reza; Eskandari, Najmeh

2012-05-01

Arsenic as an environmental toxicant is able to exert malformations in male reproductive system by inducing oxidative stress. Vitamin E (Vit.E) is known as antioxidant vitamin. The aim of this study was to investigate the harmful effects of sodium arsenite on sperm parameters and the antioxidant effects of Vit.E on sperm anomalies in sodium arsenite treated rats. Adult male rats were divided into 4 groups: control, sodium arsenite (8 mg/kg/day), Vit.E (100 mg/kg/day) and sodium arsenite+Vit.E. Oral treatments were performed till 8 weeks. Body and left testis weight were recorded and then left caudal epididymis was cut in Ham's F10. Released spermatozoa were used to analyze number, motility, viability and abnormalities of the sperm. Sperm chromatin quality was assessed by nuclear staining using acridine orange and aniline blue. Body and testis weight showed no significant change in 4 groups (p>0.05). A significant decrease in the number, motility, viability and normal sperm morphology was found in sodium arsenite-treated rats compared to the control (p<0.001). Sodium arsenite had no effect on sperm DNA integrity and histon-protamine replacement (p>0.05). In sodium arsenite+Vit.E group, Vit.E could significantly compensate the harmful effects of sodium arsenite on sperm number, motility, viability and morphology compared to sodium arsenite group. In addition, sperm viability and motility was significantly increased in rats treated with Vit.E alone compared to the control and sodium arsenite+Vit.E group. Vitamin E could compensate the adverse effects of sodium arsenite on sperm parameters in adult rats.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Label-free signal-on aptasensor for sensitive electrochemical detection of arsenite.

PubMed

Cui, Lin; Wu, Jie; Ju, Huangxian

2016-05-15

A signal-on aptasensor was fabricated for highly sensitive and selective electrochemical detection of arsenite with a label-free Ars-3 aptamer self-assembled on a screen-printed carbon electrode (SPCE) via Au-S bond. The Ars-3 aptamer could adsorb cationic polydiallyldimethylammonium (PDDA) via electrostatic interaction to repel other cationic species. In the presence of arsenite, the change of Ars-3 conformation due to the formation of Ars-3/arsenite complex led to less adsorption of PDDA, and the complex could adsorb more positively charged [Ru(NH3)6](3+) as an electrochemically active indicator on the aptasensor surface, which produced a sensitive "turn-on" response. The target-induced structure switching could be used for sensitive detection of arsenite with a linear range from 0.2 nM to 100 nM and a detection limit down to 0.15 nM. Benefiting from Ars-3 aptamer, the proposed system exhibited excellent specificity against other heavy metal ions. The SPCE-based aptasensor exhibited the advantages of low cost and simple fabrication, providing potential application of arsenite detection in environment. Copyright © 2016 Elsevier B.V. All rights reserved.

Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

PubMed

Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

2017-09-15

Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

PubMed Central

Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

2013-01-01

Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Conjugative plasmid in Corynebacterium flaccumfaciens subsp. oortii that confers resistance to arsenite, arsenate, and antimony(III)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hendrick, C.A.; Haskins, W.P.; Vidaver, A.K.

1984-07-01

Gene transfer systems for phytopathogenic corynebacteria have not been reported previously. In this paper a conjugative 46-megadalton plasmid (pDG101) found in Corynebacterium flaccumfaciens subsp. oorii CO101 is described that mediates resistance to arsenite, arsenate, and antimony(III). Transfer of the plasmid from CO101 to four other strains from the C. flaccumfaciens group occurred between cells immobilized on nitrocellulose filters or on agar surfaces. Transconjugant strains expressed the same levels of metal resistance as the donor strain and were able to act as donor strains in subsequent matings. The physical presence of the plasmid was detected by agarose gel electrophoresis. Arsenite-sensitive derivativesmore » of the donor and transconjugant strains were obtained after heat treatment; these were cured of pDG101.« less

Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

Curcumin Inhibits The Adverse Effects of Sodium Arsenite in Mouse Epididymal Sperm

PubMed Central

Momeni, Hamid Reza; Eskandari, Najmeh

2016-01-01

Background The aim of this study was to investigate the effects of curcumin on epididy- mal sperm parameters in adult male Navel Medical Research Institute (NMRI) mice ex- posed to sodium arsenite. Materials and Methods In this experimental study, we divided the animals into four groups: control, sodium arsenite (5 mg/kg), curcumin (100 mg/kg) and curcumin+sodium arsenite. Exposures were performed by intraperitoneal injections for a 5-week period. After the exposure period, we recorded the animals’ body and left testes weights. The left caudal epididymis was used to count the sperm number and analyze motility, viability, morphological abnormalities, acrosome reaction, DNA integrity, and histone-protamine replacement in the spermatozoa. One-way analysis of variance (ANOVA) followed by the Tukey’s test was used to assess the statistical significance of the data with SPSS 16.0. P<0.05 was considered significant. Results Mice exposed to sodium arsenite showed a significant decrease in the num- ber, motility, viability, normal sperm morphology and acrosome integrity of spermato- zoa compared to the control group. In the curcumin+sodium arsenite group, curcumin significantly reversed these adverse effects to the point where they approximated the control. In addition, the application of curcumin alone had no significant difference in these parameters compared to the control and curcumin+sodium arsenite groups. However, we observed no significant differences in the body and the testis weight as well as the DNA integrity and histone-protamine replacement in the spermatozoa of the four groups. Conclusion Curcumin compensated for the toxic effects of sodium arsenite on a number of sperm parameters in adult mice. PMID:27441059

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

USDA-ARS?s Scientific Manuscript database

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

PubMed

Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

2003-10-01

Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

Proteomics and genetic analyses reveal the effects of arsenite oxidation on metabolic pathways and the roles of AioR in Agrobacterium tumefaciens GW4.

PubMed

Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao

2018-04-01

A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin Xujun; Department of Toxicology, Fourth Military Medical University, Xi'an, Shaanxi, 710032; Hudson, Laurie G.

2008-10-01

Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/ormore » UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.« less

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Mobilization of arsenite by dissimilatory reduction of adsorbed arsenate

USGS Publications Warehouse

Zobrist, J.; Dowdle, P.R.; Davis, J.A.; Oremland, R.S.

2000-01-01

Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite, a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was influenced by the method in which arsenate became associated with the mineral phases and may have been strongly coupled with arsenate desorption rates. The extent of release of arsenite into solution was governed by adsorption of arsenite onto the ferrihydrite or alumina phases. The results of these experiments have interpretive significance to the mobilization of arsenic in large alluvial aquifers, such as those of the Ganges in India and Bangladesh, and in the hyporheic zones of contaminated streams.Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was

Worldwide Diversity and Occurrence of Arsenite Transporter acr3(2) Suggests an Important and Overlooked Pathway

NASA Astrophysics Data System (ADS)

Mailloux, B. J.; Wagner, P.; Foster, R.; Stolz, J. F.; Scholz, M.; Wovkulich, K.; Freyer, G. A.

2009-12-01

Arsenic is a toxic element that occurs naturally in the environment. Microorganisms have detoxification pathways that involve the expulsion of arsenite from the cytoplasm. The genes encoding these processes, including acr3(2), have been well studied in laboratory. However, comparatively less is known of detoxification genes in the environment. Here we report on the environmental diversity of acr3(2), an arsenite transporter gene, in 15 samples from a variety of habitats, including 2 marine samples from near the Amazon River plume, 2 sediment samples from California Soda Lakes (Mono and Searle), 8 groundwater samples from Bangladesh, 1 sediment sample from Union Lake, NJ, and 2 microcosm experiments using sediment from the Vineland Chemical Co Superfund site, NJ amended with acetate and arsenate. These sites were chosen to represent a variety arsenic impacted environments. Aqueous concentrations of arsenic ranged from below 13 nM to 5.6 mM (1 ppb to 422 ppm). Fifteen clone libraries were generated, and the 304 unique sequences clustered with or near Proteobacteria, Cyanobacteria , Euryarchaeota (Archaea),Acidobacteria, Thermatogae (Archaea), Planctomycetes, Bacteroidetes and Firmicutes. Thus, the acr3(2) gene appears to be highly conserved worldwide and across the domains of Archaea and Bacteria. Comparison of clone libraries, however, indicated that individual sites had distinct communities. Rarefraction analysis and CHAO1 estimation of species richness showed that even with 1406 available acr sequences from JGI and this study, the known diversity of the gene is not saturated. These results suggests that the acr3(2) gene and detoxification in general may be more important than previously thought in environmental arsenic cycling and mobilization.

Autophagy is the predominant process induced by arsenite in human lymphoblastoid cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolt, Alicia M.; Byrd, Randi M.; Klimecki, Walter T., E-mail: klimecki@pharmacy.arizona.ed

2010-05-01

Arsenic is a widespread environmental toxicant with a diverse array of molecular targets and associated diseases, making the identification of the critical mechanisms and pathways of arsenic-induced cytotoxicity a challenge. In a variety of experimental models, over a range of arsenic exposure levels, apoptosis is a commonly identified arsenic-induced cytotoxic pathway. Human lymphoblastoid cell lines (LCL) have been used as a model system in arsenic toxicology for many years, but the exact mechanism of arsenic-induced cytotoxicity in LCL is still unknown. We investigated the cytotoxicity of sodium arsenite in LCL 18564 using a set of complementary markers for cell deathmore » pathways. Markers indicative of apoptosis (phosphatidylserine externalization, PARP cleavage, and sensitivity to caspase inhibition) were uniformly negative in arsenite exposed cells. Interestingly, electron microscopy, acidic vesicle fluorescence, and expression of LC3 in LCL 18564 identified autophagy as an arsenite-induced process that was associated with cytotoxicity. Autophagy, a cellular programmed response that is associated with both cellular stress adaptation as well as cell death appears to be the predominant process in LCL cytotoxicity induced by arsenite. It is unclear, however, whether LCL autophagy is an effector mechanism of arsenite cytotoxicity or alternatively a cellular compensatory mechanism. The ability of arsenite to induce autophagy in lymphoblastoid cell lines introduces a potentially novel mechanistic explanation of the well-characterized in vitro and in vivo toxicity of arsenic to lymphoid cells.« less

Arsenite Stress Down-regulates Phosphorylation and 14-3-3 Binding of Leucine-rich Repeat Kinase 2 (LRRK2), Promoting Self-association and Cellular Redistribution*

PubMed Central

Mamais, Adamantios; Chia, Ruth; Beilina, Alexandra; Hauser, David N.; Hall, Christine; Lewis, Patrick A.; Cookson, Mark R.; Bandopadhyay, Rina

2014-01-01

Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are a common genetic cause of Parkinson disease, but the mechanisms whereby LRRK2 is regulated are unknown. Phosphorylation of LRRK2 at Ser910/Ser935 mediates interaction with 14-3-3. Pharmacological inhibition of its kinase activity abolishes Ser910/Ser935 phosphorylation and 14-3-3 binding, and this effect is also mimicked by pathogenic mutations. However, physiological situations where dephosphorylation occurs have not been defined. Here, we show that arsenite or H2O2-induced stresses promote loss of Ser910/Ser935 phosphorylation, which is reversed by phosphatase inhibition. Arsenite-induced dephosphorylation is accompanied by loss of 14-3-3 binding and is observed in wild type, G2019S, and kinase-dead D2017A LRRK2. Arsenite stress stimulates LRRK2 self-association and association with protein phosphatase 1α, decreases kinase activity and GTP binding in vitro, and induces translocation of LRRK2 to centrosomes. Our data indicate that signaling events induced by arsenite and oxidative stress may regulate LRRK2 function. PMID:24942733

The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

PubMed

Nawathean, P; Maslov, D A

2000-08-01

By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

Arsenite-Oxidizing Hydrogenobaculum Strain Isolated from an Acid-Sulfate-Chloride Geothermal Spring in Yellowstone National Park

PubMed Central

Donahoe-Christiansen, Jessica; D'Imperio, Seth; Jackson, Colin R.; Inskeep, William P.; McDermott, Timothy R.

2004-01-01

An arsenite-oxidizing Hydrogenobaculum strain was isolated from a geothermal spring in Yellowstone National Park, Wyo., that was previously shown to contain microbial populations engaged in arsenite oxidation. The isolate was sensitive to both arsenite and arsenate and behaved as an obligate chemolithoautotroph that used H2 as its sole energy source and had an optimum temperature of 55 to 60°C and an optimum pH of 3.0. The arsenite oxidation in this organism displayed saturation kinetics and was strongly inhibited by H2S. PMID:15006819

A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

PubMed

Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

1979-12-01

Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

Single strand DNA functionalized single wall carbon nanotubes as sensitive electrochemical labels for arsenite detection.

PubMed

Wang, Yonghong; Wang, Ping; Wang, Yiqiang; He, Xiaoxiao; Wang, Kemin

2015-08-15

In this work, a simple and sensitive electrochemical strategy for arsenite detection based on the ability of arsenite bound to single-strand DNA (ssDNA) and the signal transduction of single wall carbon nanotubes (SWCNTs) is developed. To realize this purpose, the ssDNA/SWCNTs complexes were formed at first by making ssDNA wrapped around SWCNTs via π-stacking. In the presence of arsenite, the arsenite could strongly bind with the G/T bases of ssDNA and decrease the π-π interaction between ssDNA and SWCNTs, resulting in a certain amount of ssDNA dissociating from the complexes. The separated SWCNTs were selectively assembled on the self-assembled monolayer (SAM) modified Au electrode. Then the SWCNTs onto the SAM-modified Au electrode substantially restored heterogeneous electron transfer that was almost totally blocked by the SAM. The assembled SWCNTs could generate a considerably sensitive and specific tactic for signal transduction, which was related to the concentration of the arsenite. Through detecting the currents mediated by SWCNTs, a linear response to concentration of arsenite ranging from 0.5 to 10ppb and a detection limit of 0.5ppb was readily achieved with desirable specificity and sensitivity. Such a SWCNTs-based biosensor creates a simple, sensitive, nonradioactive route for detection of arsenite. In addition, this demonstration provides a new approach to fabrication of stable biosensors with favorable electrochemical properties believed to be appealing to electroanalytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of arsenic on modification of promyelocytic leukemia (PML): PML responds to low levels of arsenite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirano, Seishiro, E-mail: seishiro@nies.go.jp; Graduate School of Pharmaceutical Sciences, Chiba University; Watanabe, Takayuki

2013-12-15

Inorganic arsenite (iAs{sup 3+}) is a two-edged sword. iAs{sup 3+} is a well-known human carcinogen; nevertheless, it has been used as a therapeutic drug for acute promyelocytic leukemia (APL), which is caused by a fusion protein comprising retinoic acid receptor-α and promyelocytic leukemia (PML). PML, a nuclear transcription factor, has a RING finger domain with densely positioned cysteine residues. To examine PML-modulated cellular responses to iAs{sup 3+}, CHO-K1 and HEK293 cells were each used to establish cell lines that expressed ectopic human PML. Overexpression of PML increased susceptibility to iAs{sup 3+} in CHO-K1 cells, but not in HEK293 cells. Exposuremore » of PML-transfected cells to iAs{sup 3+} caused PML to change from a soluble form to less soluble forms, and this modification of PML was observable even with just 0.1 μM iAs{sup 3+} (7.5 ppb). Western blot and immunofluorescent microscopic analyses revealed that the biochemical changes of PML were caused at least in part by conjugation with small ubiquitin-like modifier proteins (SUMOylation). A luciferase reporter gene was used to investigate whether modification of PML was caused by oxidative stress or activation of antioxidant response element (ARE) in CHO-K1 cells. Modification of PML protein occurred faster than activation of the ARE in response to iAs{sup 3+}, suggesting that PML was not modified as a consequence of oxidative stress-induced ARE activation. - Highlights: • PML was found in nuclear microspecles in response to arsenite. • Arsenite triggers SUMOylation of PML. • Arsenite modifies PML at as low as 0.1 μM. • Modification of PML is not caused by ARE activation.« less

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Isolation and characterization of the pea cytochrome c oxidase Vb gene.

PubMed

Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

2006-11-01

Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

Sodium arsenite induces chromosome endoreduplication and inhibits protein phosphatase activity in human fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong-Nan Huang; I-Ching Ho; Ling-Hui Yih

Arsenic, strongly associated with increased risks of human cancers, is a potent clastogen in a variety of mammalian cell systems. The effect of sodium arsenite (a trivalent arsenic compound) on chromatid separation was studied in human skin fibroblasts (HFW). Human fibroblasts were arrested in S phase by the aid of serum starvation and aphidicolin blocking and then these cells were allowed to synchronously progress into G2 phase. Treatment of the G2-enriched HFW cells with sodium arsenite (0-200 {mu}M) resulted in arrest of cells in the G2 phase, interference with mitotic division, inhibition of spindle assembly, and induction of chromosome endoreduplicationmore » in their second mitosis. Sodium arsenite treatment also inhibited the activities of serine/threonine protein phosphatases and enhanced phosphorylation levels of a small heat shock protein (HSP27). These results suggest that sodium arsenite may mimic okadaic acid to induce chromosome endoreduplication through its inhibitory effect on protein phosphatase activity. 61 refs., 6 figs., 2 tabs.« less

A novel role of the NRF2 transcription factor in the regulation of arsenite-mediated keratin 16 gene expression in human keratinocytes.

PubMed

Endo, Hitoshi; Sugioka, Yoshihiko; Nakagi, Yoshihiko; Saijo, Yasuaki; Yoshida, Takahiko

2008-07-01

Inorganic sodium arsenite (iAs) is a ubiquitous environmental contaminant and is associated with an increased risk of skin hyperkeratosis and cancer. We investigated the molecular mechanisms underlying the regulation of the keratin 16 (K16) gene by iAs in the human keratinocyte cell line HaCaT. We performed reverse transcriptase polymerase chain reaction, luciferase assays, Western blots, and electrophoretic mobility shift assays to determine the transcriptional regulation of the K16 gene by iAs. We used gene overexpression approaches to elucidate the nuclear factor erythroid-derived 2 related factor 2 (NRF2) involved in the K16 induction. iAs induced the mRNA and protein expression of K16. We also found that the expression of K16 was transcriptionally induced by iAs through activator protein-1-like sites and an antioxidant response element (ARE) in its gene promoter region. Treatment with iAs also enhanced the production and translocation of the NRF2 transcription factor, an ARE-binding protein, into the nucleus without modification of its mRNA expression. In addition, iAs elongated the half-life of the NRF2 protein. When overexpressed in HaCaT cells, NRF2 was also directly involved in not only the up-regulation of the detoxification gene thioredoxin but also K16 gene expression. Our data clearly indicate that the K16 gene is a novel target of NRF2. Furthermore, our findings also suggest that NRF2 has opposing roles in the cell--in the activation of detoxification pathways and in promoting the development of skin disorders.

Aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) protect against sodium arsenite-induced hepatotoxicity in Wistar rats.

PubMed

Gbadegesin, M A; Odunola, O A

2010-11-25

We evaluated the effects of aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) on sodium arsenite-induced hepatotoxicity in Wistar rats. We observed that treatment of the animals with the extracts before or just after sodium arsenite administration significantly (p < 0.05) reduced mean liver and serum γ-Glutamyl transferase (γGT), and serum alkaline phosphatase (ALP) activities when compared with the group administered the toxin alone. In addition, treatments of the animals with aqueous or ethanolic extract of O. basilicum before the administration of sodium arsenite resulted in the attenuation of the sodium arsenite-induced aspartate and alanine aminotransferase activities: ALT (from 282.6% to 167.7% and 157.8%), AST (from 325.1% to 173.5% and 164.2%) for the group administered sodium arsenite alone, the aqueous extracts plus sodium arsenite, and ethanolic extracts plus sodium arsenite respectively, expressed as percentage of the negative control. These findings support the presence of hepatoprotective activity in the O.basilicum extracts.

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

Characterization of the arsenite oxidizer Aliihoeflea sp. strain 2WW and its potential application in the removal of arsenic from groundwater in combination with Pf-ferritin.

PubMed

Corsini, Anna; Colombo, Milena; Muyzer, Gerard; Cavalca, Lucia

2015-09-01

A heterotrophic arsenite-oxidizing bacterium, strain 2WW, was isolated from a biofilter treating arsenic-rich groundwater. Comparative analysis of 16S rRNA gene sequences showed that it was closely related (98.7 %) to the alphaproteobacterium Aliihoeflea aesturari strain N8(T). However, it was physiologically different by its ability to grow at relatively low substrate concentrations, low temperatures and by its ability to oxidize arsenite. Here we describe the physiological features of strain 2WW and compare these to its most closely related relative, A. aestuari strain N8(T). In addition, we tested its efficiency to remove arsenic from groundwater in combination with Pf-ferritin. Strain 2WW oxidized arsenite to arsenate between pH 5.0 and 8.0, and from 4 to 30 °C. When the strain was used in combination with a Pf-ferritin-based material for arsenic removal from natural groundwater, the removal efficiency was significantly higher (73 %) than for Pf-ferritin alone (64 %). These results showed that arsenite oxidation by strain 2WW combined with Pf-ferritin-based material has a potential in arsenic removal from contaminated groundwater.

[Chronic combined effects of fluoride and arsenite on the Runx2 and downstream related factors of bone metabolism in rats].

PubMed

Hong, Feng; Zheng, Chong; Xu, De-gan; Qian, Ya-li

2013-09-01

To observe the chronic combined effects of sodium fluoride and sodium arsenite on the Runx2 and downstream related factors of bone metabolism in SD rats. SD rats were divided randomly into nine groups of 6 each by factorial experimental design (half female and half male) , and supplied with the different doses of fluoride, arsenite and fluoride plus arsenite containing in deionized water (untreated control containing 0 mg/kg fluoride and 0 mg/kg arsenite, and low-fluoride and high supplemented with 5 and 20 mg/kg fluoride, and low-arsenite and high supplemented with 2.5 and 10 mg/kg arsenite, and low-fluoride plus low-arsenite, and low-fluoride plus high-arsenite, and high-fluoride plus low-arsenite, and high-fluoride plus high-arsenite, respectively) . After 6 months exposure, the concentration of Runx2, matrix metallopeptidase 9 (MMP-9) ,Osterix, Receptor activator for nuclear factor-κ β ligand (RANKL) were detected by enzyme-linked immunosorbent assay method, respectively. There were no dental fluorosis found in the control group, low-arsenic group and high-arsenic group. There were significant differences in the constituent ratio of dental fluorosis among the rats from low-fluoride and high-fluoride (that is 5 rats out of 6 and 6 rats out of 6) compared with the control group (0 rat out of 6) (χ(2) = 8.57, 12.00, P < 0.05). The bone fluorine level increased with the increase of fluoride dose, the groups without fluoride supply (control group, low-arsenite and high-arsenite group's geometric mean (minimum-maximum) were 0.005 (0.003-0.009), 0.006 (0.003-0.021), 0.003 (0.002-0.100) mg/g, respectively), low-fluorine groups (low-fluoride group, low-fluoride plus low-arsenite, and low-fluoride plus high-arsenite group were 3.395 (2.416-5.871), 3.809 (1.471-7.799), 1.471 (1.473-6.732)mg/g, respectively) , the high-fluorine groups (high-fluoride, high-fluoride plus low-arsenite, and high-fluoride plus high-arsenite group were 70.086 (46.183-131.927), 69.925 (40

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

Pharmacokinetic and Genomic Effects of Arsenite in Drinking Water on Mouse Lung in a 30-Day Exposure

PubMed Central

Chilakapati, Jaya; Wallace, Kathleen; Hernandez-Zavala, Araceli; Moore, Tanya; Ren, Hongzu

2015-01-01

The 2 objectives of this subchronic study were to determine the arsenite drinking water exposure dependent increases in female C3H mouse liver and lung tissue arsenicals and to characterize the dose response (to 0, 0.05, 0.25, 1, 10, and 85 ppm arsenite in drinking water for 30 days and a purified AIN-93M diet) for genomic mouse lung expression patterns. Mouse lungs were analyzed for inorganic arsenic, monomethylated, and dimethylated arsenicals by hydride generation atomic absorption spectroscopy. The total lung mean arsenical levels were 1.4, 22.5, 30.1, 50.9, 105.3, and 316.4 ng/g lung tissue after 0, 0.05, 0.25, 1, 10, and 85 ppm, respectively. At 85 ppm, the total mean lung arsenical levels increased 14-fold and 131-fold when compared to either the lowest noncontrol dose (0.05 ppm) or the control dose, respectively. We found that arsenic exposure elicited minimal numbers of differentially expressed genes (DEGs; 77, 38, 90, 87, and 87 DEGs) after 0.05, 0.25, 1, 10, and 85 ppm, respectively, which were associated with cardiovascular disease, development, differentiation, apoptosis, proliferation, and stress response. After 30 days of arsenite exposure, this study showed monotonic increases in mouse lung arsenical (total arsenic and dimethylarsinic acid) concentrations but no clear dose-related increases in DEG numbers. PMID:26674514

Pharmacokinetic and Genomic Effects of Arsenite in Drinking Water on Mouse Lung in a 30-Day Exposure.

PubMed

Chilakapati, Jaya; Wallace, Kathleen; Hernandez-Zavala, Araceli; Moore, Tanya; Ren, Hongzu; Kitchin, Kirk T

2015-01-01

The 2 objectives of this subchronic study were to determine the arsenite drinking water exposure dependent increases in female C3H mouse liver and lung tissue arsenicals and to characterize the dose response (to 0, 0.05, 0.25, 1, 10, and 85 ppm arsenite in drinking water for 30 days and a purified AIN-93M diet) for genomic mouse lung expression patterns. Mouse lungs were analyzed for inorganic arsenic, monomethylated, and dimethylated arsenicals by hydride generation atomic absorption spectroscopy. The total lung mean arsenical levels were 1.4, 22.5, 30.1, 50.9, 105.3, and 316.4 ng/g lung tissue after 0, 0.05, 0.25, 1, 10, and 85 ppm, respectively. At 85 ppm, the total mean lung arsenical levels increased 14-fold and 131-fold when compared to either the lowest noncontrol dose (0.05 ppm) or the control dose, respectively. We found that arsenic exposure elicited minimal numbers of differentially expressed genes (DEGs; 77, 38, 90, 87, and 87 DEGs) after 0.05, 0.25, 1, 10, and 85 ppm, respectively, which were associated with cardiovascular disease, development, differentiation, apoptosis, proliferation, and stress response. After 30 days of arsenite exposure, this study showed monotonic increases in mouse lung arsenical (total arsenic and dimethylarsinic acid) concentrations but no clear dose-related increases in DEG numbers.

Life in an Arsenic-Containing Gold Mine: Genome and Physiology of the Autotrophic Arsenite-Oxidizing Bacterium Rhizobium sp. NT-26

PubMed Central

Andres, Jérémy; Arsène-Ploetze, Florence; Barbe, Valérie; Brochier-Armanet, Céline; Cleiss-Arnold, Jessica; Coppée, Jean-Yves; Dillies, Marie-Agnès; Geist, Lucie; Joublin, Aurélie; Koechler, Sandrine; Lassalle, Florent; Marchal, Marie; Médigue, Claudine; Muller, Daniel; Nesme, Xavier; Plewniak, Frédéric; Proux, Caroline; Ramírez-Bahena, Martha Helena; Schenowitz, Chantal; Sismeiro, Odile; Vallenet, David; Santini, Joanne M.; Bertin, Philippe N.

2013-01-01

Arsenic is widespread in the environment and its presence is a result of natural or anthropogenic activities. Microbes have developed different mechanisms to deal with toxic compounds such as arsenic and this is to resist or metabolize the compound. Here, we present the first reference set of genomic, transcriptomic and proteomic data of an Alphaproteobacterium isolated from an arsenic-containing goldmine: Rhizobium sp. NT-26. Although phylogenetically related to the plant-associated bacteria, this organism has lost the major colonizing capabilities needed for symbiosis with legumes. In contrast, the genome of Rhizobium sp. NT-26 comprises a megaplasmid containing the various genes, which enable it to metabolize arsenite. Remarkably, although the genes required for arsenite oxidation and flagellar motility/biofilm formation are carried by the megaplasmid and the chromosome, respectively, a coordinate regulation of these two mechanisms was observed. Taken together, these processes illustrate the impact environmental pressure can have on the evolution of bacterial genomes, improving the fitness of bacterial strains by the acquisition of novel functions. PMID:23589360

Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

PubMed

Allam, Mai A; Saker, Mahmoud M

2017-01-01

The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

DISSOCIATION OF ARSENITE-PEPTIDE COMPLEXES: TRIPHASIC NATURE, RATE CONSTANTS, HALF LIVES AND BIOLOGICAL IMPORTANCE

EPA Science Inventory

We determined the number and the dissociation rate constants of different complexes formed from arsenite and two peptides containing either one (RV AVGNDYASGYHYGV for peptide 20) or three cysteines (LE AWQGK VEGTEHLYSMK K for peptide 10) via radioactive 73As labeled arsenite and ...

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

PubMed Central

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Arsenite induced oxidative damage in mouse liver is associated with increased cytokeratin 18 expression.

PubMed

Gonsebatt, M E; Del Razo, L M; Cerbon, M A; Zúñiga, O; Sanchez-Peña, L C; Ramírez, P

2007-09-01

Cytokeratins (CK) constitute a family of cytoskeletal intermediate filament proteins that are typically expressed in epithelial cells. An abnormal structure and function are effects that are clearly related to liver diseases as non-alcoholic steatohepatitis, cirrhosis and hepatocellular carcinoma. We have previously observed that sodium arsenite (SA) induced the synthesis of CK18 protein and promotes a dose-related disruption of cytoplasmic CK18 filaments in a human hepatic cell line. Both abnormal gene expression and disturbance of structural organization are toxic effects that are likely to cause liver disease by interfering with normal hepatocyte function. To investigate if a disruption in the CK18 expression pattern is associated with arsenite liver damage, we investigated CK18 mRNA and protein levels in liver slices treated with low levels of SA. Organotypic cultures were incubated with 0.01, 1 and 10 microM of SA in the absence and presence of N-acetyl cysteine (NAC). Cell viability and inorganic arsenic metabolism were determined. Increased expression of CK18 was observed after exposure to SA. The addition of NAC impeded the oxidative effects of SA exposure, decreasing the production of thiobarbituric acid-reactive substances and significantly diminishing the up regulation of CK18 mRNA and protein. Liver arsenic levels correlated with increased levels of mRNA. Mice treated with intragastric single doses of 2.5 and 5 mg/kg of SA showed an increased expression of CK18. Results suggest that CK18 expression may be a sensible early biomarker of oxidative stress and damage induced by arsenite in vitro and in vivo. Then, during SA exposure, altered CK expression may compromise liver function.

Arsenite induces endothelial cell permeability increase through a reactive oxygen species-vascular endothelial growth factor pathway.

PubMed

Bao, Lingzhi; Shi, Honglian

2010-11-15

As a potent environmental oxidative stressor, arsenic exposure has been reported to exacerbate cardiovascular diseases and increase vascular endothelial cell monolayer permeability. However, the underlying mechanism of this effect is not well understood. In this paper, we test our hypothesis that reactive oxygen species (ROS)-induced vascular endothelial growth factor (VEGF) expression may play an important role in an arsenic-caused increase of endothelial cell monolayer permeability. The mouse brain vascular endothelial cell bEnd3 monolayer was exposed to arsenite for 1, 3, and 6 days. The monolayer permeability, VEGF protein release, and ROS generation were determined. In addition, VE-cadherin and zonula occludens-1 (ZO-1), two membrane structure proteins, were immunostained to elucidate the effects of arsenite on the cell-cell junction. The roles of ROS and VEGF in arsenite-induced permeability was determined by inhibiting ROS with antioxidants and immuno-depleting VEGF with a VEGF antibody. We observed that arsenite increased bEnd3 monolayer permeability, elevated the production of cellular ROS, and increased VEGF release. VE-cadherin and ZO-1 disruptions were also found in cells treated with arsenite. Furthermore, both antioxidant (N-acetyl cysteine and tempol) and the VEGF antibody treatments significantly lowered the arsenite-induced permeability of the bEnd3 monolayer as well as VEGF expression. VE-cadherin and ZO-1 disruptions were also diminished by N-acetyl cysteine and the VEGF antibody. Our data suggest that the increase in VEGF expression caused by ROS may play an important role in the arsenite-induced increase in endothelial cell permeability.

Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

PubMed Central

Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

2017-01-01

Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

Arsenite promotes centrosome abnormalities under a p53 compromised status induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, W.-T.; Center of Excellence for Environmental Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; Graduate Institute of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan

2010-02-15

Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 muM. Under NNK exposure, arsenite wasmore » able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.« less

Genetics Home Reference: cytochrome c oxidase deficiency

MedlinePlus

... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

Cyanotrophic and arsenic oxidizing activities of Pseudomonas mendocina P6115 isolated from mine tailings containing high cyanide concentration.

PubMed

Miranda-Carrazco, Alejandra; Vigueras-Cortés, Juan M; Villa-Tanaca, Lourdes; Hernández-Rodríguez, César

2018-04-11

Mine tailings and wastewater generate man-made environments with several selective pressures, including the presence of heavy metals, arsenic and high cyanide concentrations, but severe nutritional limitations. Some oligotrophic and pioneer bacteria can colonise and grow in mine wastes containing a low concentration of organic matter and combined nitrogen sources. In this study, Pseudomonas mendocina P6115 was isolated from mine tailings in Durango, Mexico, and identified through a phylogenetic approach of 16S rRNA, gyrB, rpoB, and rpoD genes. Cell growth, cyanide consumption, and ammonia production kinetics in a medium with cyanide as sole nitrogen source showed that at the beginning, the strain grew assimilating cyanide, when cyanide was removed, ammonium was produced and accumulated in the culture medium. However, no clear stoichiometric relationship between both nitrogen sources was observed. Also, cyanide complexes were assimilated as nitrogen sources. Other phenotypic tasks that contribute to the strain's adaptation to a mine tailing environment included siderophores production in media with moderate amounts of heavy metals, arsenite and arsenate tolerance, and the capacity of oxidizing arsenite. P. mendocina P6115 harbours cioA/cioB and aoxB genes encoding for a cyanide-insensitive oxidase and an arsenite oxidase, respectively. This is the first report where P. mendocina is described as a cyanotrophic and arsenic oxidizing species. Genotypic and phenotypic tasks of P. mendocina P6115 autochthonous from mine wastes are potentially relevant for biological treatment of residues contaminated with cyanide and arsenic.

Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

PubMed

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-08-01

A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

PubMed

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

Altered gene expression in early postnatal monoamine oxidase A knockout mice.

PubMed

Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C

2017-08-15

We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

PubMed Central

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-01-01

Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

PubMed

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

PubMed

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

The oxidative transformation of sodium arsenite at the interface of alpha-MnO2 and water.

PubMed

Li, Xiu-juan; Liu, Cheng-shuai; Li, Fang-bai; Li, Yong-tao; Zhang, Li-jia; Liu, Chuan-ping; Zhou, Yong-zhang

2010-01-15

Arsenite is acute contaminant to human health in soil and water environment. In this study, Pyrolusite (alpha-MnO(2)) was used to investigate the oxidative transformation of arsenite into arsenate with batch experiments under different reaction conditions. The results showed that arsenite transformation occurred and was accompanied by the adsorption and fixation of both As(III) and As(V) on alpha-MnO(2). About 90% of sodium arsenite (10mg/L) were transformed by alpha-MnO(2) under the conditions of 25 degrees C and pH 6.0, 36.6% of which was adsorbed and 28.9% fixed by alpha-MnO(2). Increased alpha-MnO(2) dosages promoted As (III) transformation rate and adsorption of arsenic species. The transformation rate and adsorption of arsenic species raised with increasing pH values of reaction solution from 4.7 to 8.0. The oxidation rate decreased and adsorbed As(III) and As(V) increased with increasing initial arsenite concentration. The enhancement on oxidative transformation of sodium arsenite may result from abundant active sites of alpha-MnO(2). Along with adsorption and fixation of arsenic species during the reaction, the crystal structure of alpha-MnO(2) did not change, but the surface turned petty and loosen. Our results demonstrated that alpha-MnO(2) has important potential in arsenic transformation and removal as the environmentally friendly natural oxidant in soil and surface water.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

A bacterial view of the periodic table: genes and proteins for toxic inorganic ions.

PubMed

Silver, Simon; Phung, Le T

2005-12-01

Essentially all bacteria have genes for toxic metal ion resistances and these include those for Ag+, AsO2-, AsO4(3-), Cd2+ Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. The largest group of resistance systems functions by energy-dependent efflux of toxic ions. Fewer involve enzymatic transformations (oxidation, reduction, methylation, and demethylation) or metal-binding proteins (for example, metallothionein SmtA, chaperone CopZ and periplasmic silver binding protein SilE). Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. For example, Cd2+-efflux pumps of bacteria are either inner membrane P-type ATPases or three polypeptide RND chemiosmotic complexes consisting of an inner membrane pump, a periplasmic-bridging protein and an outer membrane channel. In addition to the best studied three-polypeptide chemiosmotic system, Czc (Cd2+, Zn2+, and Co2), others are known that efflux Ag+, Cu+, Ni2+, and Zn2+. Resistance to inorganic mercury, Hg2+ (and to organomercurials, such as CH3Hg+ and phenylmercury) involve a series of metal-binding and membrane transport proteins as well as the enzymes mercuric reductase and organomercurial lyase, which overall convert more toxic to less toxic forms. Arsenic resistance and metabolizing systems occur in three patterns, the widely-found ars operon that is present in most bacterial genomes and many plasmids, the more recently recognized arr genes for the periplasmic arsenate reductase that functions in anaerobic respiration as a terminal electron acceptor, and the aso genes for the periplasmic arsenite oxidase that functions as an initial electron donor in aerobic resistance to arsenite.

Arsenic(III) fuels anoxygenic photosynthesis in hot spring biofilms from Mono Lake, California

USGS Publications Warehouse

Kulp, T.R.; Hoeft, S.E.; Asao, M.; Madigan, M.T.; Hollibaugh, J.T.; Fisher, J.C.; Stolz, J.F.; Culbertson, C.W.; Miller, L.G.; Oremland, R.S.

2008-01-01

Phylogenetic analysis indicates that microbial arsenic metabolism is ancient and probably extends back to the primordial Earth. In microbial biofilms growing on the rock surfaces of anoxic brine pools fed by hot springs containing arsenite and sulfide at high concentrations, we discovered light-dependent oxidation of arsenite [As(III)] to arsenate [As(V)] occurring under anoxic conditions. The communities were composed primarily of Ectothiorhodospira-like purple bacteria or Oscillatoria-like cyanobacteria. A pure culture of a photosynthetic bacterium grew as a photoautotroph when As(III) was used as the sole photosynthetic electron donor. The strain contained genes encoding a putative As(V) reductase but no detectable homologs of the As(III) oxidase genes of aerobic chemolithotrophs, suggesting a reverse functionality for the reductase. Production of As(V) by anoxygenic photosynthesis probably opened niches for primordial Earth's first As(V)-respiring prokaryotes.

The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

ZERO-VALENT IRON FOR HIGH-LEVEL ARSENITE REMOVAL

EPA Science Inventory

This study conducted by flow through column systems was aimed at investigating the feasibility of using zero-valent iron for arsenic remediation in groundwater. A high concentration arsenic solution (50 mg l-1) was prepared by using sodium arsenite (arsenic (III)) to simulate gr...

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

PubMed

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Respiratory arsenate reductase as a bidirectional enzyme

USGS Publications Warehouse

Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

2009-01-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Effects of cultivation conditions on the uptake of arsenite and arsenic chemical species accumulated by Pteris vittata in hydroponics.

PubMed

Hatayama, Masayoshi; Sato, Takahiko; Shinoda, Kozo; Inoue, Chihiro

2011-03-01

The physiological responses of the arsenic-hyperaccumulator, Pteris vittata, such as arsenic uptake and chemical transformation in the fern, have been investigated. However, a few questions remain regarding arsenic treatment in hydroponics. Incubation conditions such as aeration, arsenic concentration, and incubation period might affect those responses of P. vittata in hydroponics. Arsenite uptake was low under anaerobic conditions, as previously reported. However, in an arsenite uptake experiment, phosphorous (P) starvation-dependent uptake of arsenate was observed under aerobic conditions. Time course-dependent analysis of arsenite oxidation showed that arsenite was gradually oxidized to arsenate during incubation. Arsenite oxidation was not observed in any of the control conditions, such as exposure to a nutrient solution or to culture medium only, or with the use of dried root; arsenite oxidation was only observed when live root was used. This result suggests that sufficient aeration allows the rhizosphere system to oxidize arsenite and enables the fern to efficiently take up arsenite as arsenate. X-ray absorption near edge structure (XANES) analyses showed that long-duration exposure to arsenic using a hydroponic system led to the accumulation of arsenate as the dominant species in the root tips, but not in the whole roots, partly because up-regulation of arsenate uptake by P starvation of the fern was caused and retained by long-time incubation. Analysis of concentration-dependent arsenate uptake by P. vittata showed that the uptake switched from a high-affinity transport system to a low-affinity system at high arsenate concentrations, which partially explains the increased arsenate abundance in the whole root. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Formation of dimethylarsinic acid from methylation of sodium arsenite in lumbricus terrestris.

PubMed

Lin, K W; Behl, S; Furst, A; Chien, P; Toia, R F

1998-04-01

Arsenic is ubiquitous in the environment and the toxicological response of various organisms to it is dependent on the particular chemical form involved. In general, methylation of inorganic arsenic is considered to be a detoxification reaction. While this transformation is known to be mediated by methyltransferases in several species of mammals, less is known about the fate of arsenic in invertebrates. As part of a continuing interest in heavy metals and metalloid toxicology, the alkylating activity of cytosol prepared from the common earthworm, Lumbricus terrestris, towards sodium arsenite has now been investigated. Thus, S-adenosyl-l-[(14)C]methionine ([(14)C-methyl]SAM) fortified earthworm cytosol was incubated with sodium arsenite at 37 degrees C for 90 min. Initial TLC analysis of the incubation mixture suggested incorporation of radiolabel into dimethylarsinic acid. This was subsequently proven by isolation of the metabolite through radiodilution followed by recrystallization of the recovered material to constant specific activity. This result suggests that earthworm cytosol has the same methylating reactivity towards arsenite as do similar preparations from various tissues of several species of mammals.

Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xu; Wang, Dapeng; Department of Toxicology, School of Public Health, Guizhou Medical University, Guiyang, Guizhou

Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuousmore » low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

PubMed

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Respiratory arsenate reductase as a bidirectional enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richey, Christine; Chovanec, Peter; Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282

2009-05-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function asmore » a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.« less

The Arsenite Oxidation Potential of Native Microbial Communities from Arsenic-Rich Freshwaters.

PubMed

Fazi, Stefano; Crognale, Simona; Casentini, Barbara; Amalfitano, Stefano; Lotti, Francesca; Rossetti, Simona

2016-07-01

Microorganisms play an important role in speciation and mobility of arsenic in the environment, by mediating redox transformations of both inorganic and organic species. Since arsenite [As(III)] is more toxic than arsenate [As(V)] to the biota, the microbial driven processes of As(V) reduction and As(III) oxidation may play a prominent role in mediating the environmental impact of arsenic contamination. However, little is known about the ecology and dynamics of As(III)-oxidizing populations within native microbial communities exposed to natural high levels of As. In this study, two techniques for single cell quantification (i.e., flow cytometry, CARD-FISH) were used to analyze the structure of aquatic microbial communities across a gradient of arsenic (As) contamination in different freshwater environments (i.e., groundwaters, surface and thermal waters). Moreover, we followed the structural evolution of these communities and their capacity to oxidize arsenite, when experimentally exposed to high As(III) concentrations in experimental microcosms. Betaproteobacteria and Deltaproteobacteria were the main groups retrieved in groundwaters and surface waters, while Beta and Gammaproteobacteria dominated the bacteria community in thermal waters. At the end of microcosm incubations, the communities were able to oxidize up to 95 % of arsenite, with an increase of Alphaproteobacteria in most of the experimental conditions. Finally, heterotrophic As(III)-oxidizing strains (one Alphaproteobacteria and two Gammaproteobacteria) were isolated from As rich waters. Our findings underlined that native microbial communities from different arsenic-contaminated freshwaters can efficiently perform arsenite oxidation, thus contributing to reduce the overall As toxicity to the aquatic biota.

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

1995-12-18

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

Essential roles of PI-3K/Akt/IKKbeta/NFkappaB pathway in cyclin D1 induction by arsenite in JB6 Cl41 cells.

PubMed

Ouyang, Weiming; Li, Jingxia; Ma, Qian; Huang, Chuanshu

2006-04-01

Skin is a major target of carcinogenic trivalent arsenic (arsenite, As3+). It has been thought that cell proliferation is one of the central events involved in the carcinogenic effect of arsenite. Cyclin D1, a nuclear protein playing a pivotal role in cell proliferation and cell cycle transition from G1 to S phases, has been reported to be induced in human fibroblast by arsenite via uncertain molecular mechanisms. In the present study, the potential roles of PI-3K/Akt/IKKbeta/NFkappaB signal pathway in cyclin D1 induction by arsenite were addressed in mouse epidermal Cl41 cells. We found that exposure of Cl41 cells to arsenite was able to induce cell proliferation, activate PI-3K-->Akt/p70(S6k) signal pathway and increase cyclin D1 expression at both transcription and protein levels. Pre-treatment of Cl41 cells with PI-3K inhibitor, wortmannin, significantly inhibited the phosphorylation of Akt and p70(S6k) and thereby dramatically impaired the cyclin D1 induction by arsenite, implicating the importance of the PI-3K signal pathway in the cyclin D1 induction by arsenite. Furthermore, inhibition of PI-3K/Akt by overexpression of Deltap85 or DN-Akt blocked arsenite-induced IKK phosphorylation, IkappaBalpha degradation and cyclin D1 expression, indicating that IKK/NFkappaB is the downstream transducer of arsenite-triggered PI-3K/Akt cascade. Moreover, inhibition of IKKbeta/NFkappaB signal pathway by overexpression of its dominant negative mutant, IKKbeta-KM, also significantly blocked arsenite-induced cyclin D1 expression. Overall, arsenite exposure triggered PI-3K/Akt/IKKbeta/NFkappaB signal cascade which in turn plays essential roles in inducing cyclin D1 expression.

Arsenite-oxidizing and arsenate-reducing bacteria associated with arsenic-rich groundwater in Taiwan

NASA Astrophysics Data System (ADS)

Liao, Vivian Hsiu-Chuan; Chu, Yu-Ju; Su, Yu-Chen; Hsiao, Sung-Yun; Wei, Chia-Cheng; Liu, Chen-Wuing; Liao, Chung-Min; Shen, Wei-Chiang; Chang, Fi-John

2011-04-01

Drinking highly arsenic-contaminated groundwater is a likely cause of blackfoot disease in Taiwan, but microorganisms that potentially control arsenic mobility in the subsurface remain unstudied. The objective of this study was to investigate the relevant arsenite-oxidizing and arsenate-reducing microbial community that exists in highly arsenic-contaminated groundwater in Taiwan. We cultured and identified arsenic-transforming bacteria, analyzed arsenic resistance and transformation, and determined the presence of genetic markers for arsenic transformation. In total, 11 arsenic-transforming bacterial strains with different colony morphologies and varying arsenic transformation abilities were isolated, including 10 facultative anaerobic arsenate-reducing bacteria and one strictly aerobic arsenite-oxidizing bacterium. All of the isolates exhibited high levels of arsenic resistance with minimum inhibitory concentrations of arsenic ranging from 2 to 200 mM. Strain AR-11 was able to rapidly oxidize arsenite to arsenate at concentrations relevant to environmental groundwater samples without the addition of any electron donors or acceptors. We provide evidence that arsenic-reduction activity may be conferred by the ars operon(s) that were not amplified by the designed primers currently in use. The 16S rRNA sequence analysis grouped the isolates into the following genera: Pseudomonas, Bacillus, Psychrobacter, Vibrio, Citrobacter, Enterobacter, and Bosea. Among these genera, we present the first report of the genus Psychrobacter being involved in arsenic reduction. Our results further support the hypothesis that bacteria capable of either oxidizing arsenite or reducing arsenate coexist and are ubiquitous in arsenic-contaminated groundwater.

Arsenite Accumulation in the Mouse Eye

PubMed Central

Kleiman, Norman J.; Quinn, Adrienne M.; Fields, Kara G.; Slavkovich, Vesna; Graziano, Joseph H.

2016-01-01

Elevated arsenic (As) concentrations in drinking water are a major worldwide public health concern. Exposure to As is associated with carcinogenesis, skin lesions, cardiovascular disease, cognitive deficits and other disorders. However little is known regarding chronic As-mediated effects on the eye. Oxidative stress is believed to be an important factor in As-related pathology and is also implicated in certain eye diseases such as cataract. Thus, elevated exposure to arsenic could potentially be a contributing factor for ocular pathology. A pilot study was therefore initiated to determine if As could be detected in eye tissue of mice exposed to sodium arsenite in drinking water. Total As concentrations were determined by ICP/Mass Spectroscopy in whole eyes, lens, liver, heart, lung, kidneys, spleen, brain and hair from mice given 0, 10, 50 or 250 ppm sodium arsenite in their drinking water for 4 weeks or 0, 10 or 50 ppm for 6 months. Dose dependent increases in As concentration were observed in all organs and tissues. Surprisingly, As concentrations in the eye and lens were significantly higher than those in liver, lung, heart, spleen and brain and similar to that found in kidneys. The relatively high concentration in the eye and the lens in particular suggests As exposure may be a contributing factor in cataract formation in parts of the world where As in drinking water is endemic. PMID:27267701

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

PubMed Central

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Biosorption and toxicity responses to arsenite (As[III]) in Scenedesmus quadricauda.

PubMed

Zhang, Jianying; Ding, Tengda; Zhang, Chunlong

2013-08-01

Toxicity and biosorption responses to arsenite (As[III]) were examined in a 96-h exposure study using Scenedesmus quadricauda, one of the most popular green algae distributed in freshwaters in China. Results indicated that the pH-dependent distribution of two arsenite species (H2AsO3(-) and H3AsO3) played an important role in biosorption and toxicity. The undissociated H3AsO3 was more toxic than its monoanionic H2AsO3(-) through comparison of algal cell numbers, chlorophyll-a contents, and algal ultrastructural changes observed with transmission electron microscopy. An effective biosorption of 89.0mgg(-1) at 100mgL(-1) As[III] was found in the treatments with an initial pH of 9.3 and 25.2μgg(-1) at 0.03mgL(-1) As[III] at an initial pH of 8.2 as a result of the predominant species of H2AsO3(-) under the ambient pH and Eh conditions. Our results imply that S. quadricauda may provide a new means for the removal of toxic arsenite species present in contaminated surface water. Copyright © 2013 Elsevier Ltd. All rights reserved.

Arsenite induces cell transformation by reactive oxygen species, AKT, ERK1/2, and p70S6K1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carpenter, Richard L.; Jiang, Yue; Jing, Yi

2011-10-28

Highlights: Black-Right-Pointing-Pointer Chronic exposure to arsenite induces cell proliferation and transformation. Black-Right-Pointing-Pointer Arsenite-induced transformation increases ROS production and downstream signalings. Black-Right-Pointing-Pointer Inhibition of ROS levels via catalase reduces arsenite-induced cell transformation. Black-Right-Pointing-Pointer Interruption of AKT, ERK, or p70S6K1 inhibits arsenite-induced cell transformation. -- Abstract: Arsenic is naturally occurring element that exists in both organic and inorganic formulations. The inorganic form arsenite has a positive association with development of multiple cancer types. There are significant populations throughout the world with high exposure to arsenite via drinking water. Thus, human exposure to arsenic has become a significant public health problem. Recent evidencemore » suggests that reactive oxygen species (ROS) mediate multiple changes to cell behavior after acute arsenic exposure, including activation of proliferative signaling and angiogenesis. However, the role of ROS in mediating cell transformation by chronic arsenic exposure is unknown. We found that cells chronically exposed to sodium arsenite increased proliferation and gained anchorage-independent growth. This cell transformation phenotype required constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. We also observed these cells constitutively produce ROS, which was required for the constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. Suppression of ROS levels by forced expression of catalase also reduced cell proliferation and anchorage-independent growth. These results indicate cell transformation induced by chronic arsenic exposure is mediated by increased cellular levels of ROS, which mediates activation of AKT, ERK1/2, and p70S6K1.« less

Sodium arsenite-induced myocardial bruise in rats: Ameliorative effect of naringin via TGF-β/Smad and Nrf/HO pathways.

PubMed

Adil, Mohammad; Kandhare, Amit D; Ghosh, Pinaki; Bodhankar, Subhash L

2016-06-25

Arsenic poisoning is a serious medical condition caused by consumption of contaminated food and water. Cardiovascular toxicity is one of the important risk factors associated with arsenic toxicity. To elucidate efficacy and possible mechanism of action of naringin in arsenic-induced cardiac toxicity in laboratory rats. Arsenic toxicity was induced in Sprague-Dawley rats by sodium arsenite (5 mg/kg, p.o., 28 days). Rats were either concomitantly treated with vehicle (5 mL/kg, p.o.) or naringin (20, 40 and 80 mg/kg, p.o.) for 28 days. Chronic administration of sodium arsenite caused significant alterations in electrocardiographic, hemodynamic and left ventricle contractile functions. Treatment with naringin (40 and 80 mg/kg, p.o.) significantly restored (p < 0.05) these altered myocardial functions. Administration of naringin (40 and 80 mg/kg, p.o.) significantly inhibited (p < 0.05) arsenite-induced increased cardiac markers (LDH, CK-MB, AST, ALT, and ALP) and altered lipid metabolism (total cholesterol, triglyceride, LDL, HDL, and VLDL). The elevated level of heart oxido-nitrosative stress and decreased cardiac Na-K-ATPase level after arsenite administration was significantly attenuated (p < 0.05) by naringin (40 and 80 mg/kg, p.o.) treatment. Naringin also significantly increased (p < 0.05) myocardial mitochondrial enzymes (I-IV) activity. Arsenite-induced alteration in heart Nrf-2, HO-1, Smad-3, and TGF-β mRNA expression were significantly restored (p < 0.05) by naringin (40 and 80 mg/kg) treatment. Treatment with naringin (40 and 80 mg/kg) significantly inhibited (p < 0.05) arsenite-induce apoptosis revealed by flow cytometric analysis. Naringin administration reduced histopathological aberrations (measured using transmission electron microscopy) induced by sodium arsenite. The results of present investigation suggest that naringin ameliorates arsenite-induced cardiotoxicity via modulation of TGF-β/Smad-3 and Nrf-2/HO-1 pathways along with

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

PubMed Central

2012-01-01

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

Epistatic interaction between the monoamine oxidase A and serotonin transporter genes in anorexia nervosa.

PubMed

Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick

2005-03-01

The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

Depth-resolved microbial community analyses in two contrasting soil cores contaminated by antimony and arsenic.

PubMed

Xiao, Enzong; Krumins, Valdis; Xiao, Tangfu; Dong, Yiran; Tang, Song; Ning, Zengping; Huang, Zhengyu; Sun, Weimin

2017-02-01

Investigation of microbial communities of soils contaminated by antimony (Sb) and arsenic (As) is necessary to obtain knowledge for their bioremediation. However, little is known about the depth profiles of microbial community composition and structure in Sb and As contaminated soils. Our previous studies have suggested that historical factors (i.e., soil and sediment) play important roles in governing microbial community structure and composition. Here, we selected two different types of soil (flooded paddy soil versus dry corn field soil) with co-contamination of Sb and As to study interactions between these metalloids, geochemical parameters and the soil microbiota as well as microbial metabolism in response to Sb and As contamination. Comprehensive geochemical analyses and 16S rRNA amplicon sequencing were used to shed light on the interactions of the microbial communities with their environments. A wide diversity of taxonomical groups was present in both soil cores, and many were significantly correlated with geochemical parameters. Canonical correspondence analysis (CCA) and co-occurrence networks further elucidated the impact of geochemical parameters (including Sb and As contamination fractions and sulfate, TOC, Eh, and pH) on vertical distribution of soil microbial communities. Metagenomes predicted from the 16S data using PICRUSt included arsenic metabolism genes such as arsenate reductase (ArsC), arsenite oxidase small subunit (AoxA and AoxB), and arsenite transporter (ArsA and ACR3). In addition, predicted abundances of arsenate reductase (ArsC) and arsenite oxidase (AoxA and AoxB) genes were significantly correlated with Sb contamination fractions, These results suggest potential As biogeochemical cycling in both soil cores and potentially dynamic Sb biogeochemical cycling as well. Copyright © 2016 Elsevier Ltd. All rights reserved.

Recovery of choline oxidase activity by in vitro recombination of individual segments.

PubMed

Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

2008-11-01

Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

Arsenite induced poly(ADP-ribosyl)ation of tumor suppressor P53 in human skin keratinocytes as a possible mechanism for carcinogenesis associated with arsenic exposure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komissarova, Elena V.; Rossman, Toby G., E-mail: toby.rossman@nyumc.or

2010-03-15

Arsenite is an environmental pollutant. Exposure to inorganic arsenic in drinking water is associated with elevated cancer risk, especially in skin. Arsenite alone does not cause skin cancer in animals, but arsenite can enhance the carcinogenicity of solar UV. Arsenite is not a significant mutagen at non-toxic concentrations, but it enhances the mutagenicity of other carcinogens. The tumor suppressor protein P53 and nuclear enzyme PARP-1 are both key players in DNA damage response. This laboratory demonstrated earlier that in cells treated with arsenite, the P53-dependent increase in p21{sup WAF1/CIP1} expression, normally a block to cell cycle progression after DNA damage,more » is deficient. Here we show that although long-term exposure of human keratinocytes (HaCaT) to a nontoxic concentration (0.1 muM) of arsenite decreases the level of global protein poly(ADP-ribosyl)ation, it increases poly(ADP-ribosyl)ation of P53 protein and PARP-1 protein abundance. We also demonstrate that exposure to 0.1 muM arsenite depresses the constitutive expression of p21 mRNA and P21 protein in HaCaT cells. Poly(ADP-ribosyl)ation of P53 is reported to block its activation, DNA binding and its functioning as a transcription factor. Our results suggest that arsenite's interference with activation of P53 via poly(ADP-ribosyl)ation may play a role in the comutagenic and cocarcinogenic effects of arsenite.« less

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

PubMed

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

ARSENITE BINDING TO SUBSETS OF THE HUMAN ESTROGEN RECEPTOR-ALPHA

EPA Science Inventory

Enzyme inhibition by arsenicals has been described many times, but the underlying binding of trivalent arsenicals to peptides and proteins has received little attention. The purpose of this study was to determine Kd and Bmax values for arsenite binding to nine synthetic peptides ...

Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

PubMed

Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

2015-10-01

Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. Copyright © 2015 Elsevier Inc. All rights reserved.

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

PubMed

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Depth-resolved abundance and diversity of arsenite-oxidizing bacteria in the groundwater of Beimen, a blackfoot disease endemic area of southwestern Taiwan.

PubMed

Das, Suvendu; Kar, Sandeep; Jean, Jiin-Shuh; Rathod, Jagat; Chakraborty, Sukalyan; Liu, Hsiao-Sheng; Bundschuh, Jochen

2013-12-01

The role of arsenite oxidizers in natural attenuation of arsenic pollution necessitates studies on their abundance and diversity in arsenic-contaminated aquifers. In this study, most probable number-polymerase chain reaction (MPN-PCR) and denaturing gradient gel electrophoresis (DGGE) was applied to monitor depth-wise abundance and diversity of aerobic arsenite oxidizers in arsenic-enriched groundwater of Beimen, southwestern Taiwan. The results revealed that the abundance of arsenite oxidizers ranged from 0.04 to 0.22, and the lowest ratio was observed in the most arsenic-enriched and comparatively more reduced groundwater (depth 200 m) of Beimen 1. The highest ratio was observed in the less arsenic-enriched and less reduced groundwater (depth 60 m) of Beimen 2B. DGGE profiles showed a shift in diversity of arsenite oxidizers, consisting of members of the Betaproteobacteria (61%), Alphaproteobacteria (28%) and Gammaproteobacteria (11%), depending on mainly arsenic concentration and redox level in groundwater. Groundwater with the lowest arsenic and highest dissolved oxygen at Beimen 2B harbored 78% of the arsenite oxidizers communities, while groundwater with the highest arsenic and lowest dissolved oxygen at Beimen 1 and Beimen-Jinhu harbored 17 and 22% of arsenite oxidizers communities, respectively. Pseudomonas sp. was found only in groundwater containing high arsenic at Beimen 1 and Beimen-Jinhu, while arsenite oxidizers belonging to Alpha- and Betaproteobacteria were dominated in groundwater containing low arsenic. Copyright © 2013 Elsevier Ltd. All rights reserved.

Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1.

PubMed

Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke

2013-08-01

Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

Arsenic methylation by an arsenite S-adenosylmethionine methyltransferase from Spirulina platensis.

PubMed

Guo, Yuqing; Xue, Ximei; Yan, Yu; Zhu, Yongguan; Yang, Guidi; Ye, Jun

2016-11-01

Arsenic-contaminated water is a serious hazard for human health. Plankton plays a critical role in the fate and toxicity of arsenic in water by accumulation and biotransformation. Spirulina platensis (S. platensis), a typical plankton, is often used as a supplement or feed for pharmacy and aquiculture, and may introduce arsenic into the food chain, resulting in a risk to human health. However, there are few studies about how S. platensis biotransforms arsenic. In this study, we investigated arsenic biotransformation by S. platensis. When exposed to arsenite (As(III)), S. platensis accumulated arsenic up to 4.1mg/kg dry weight. After exposure to As(III), arsenate (As(V)) was the predominant species making up 64% to 86% of the total arsenic. Monomethylarsenate (MMA(V)) and dimethylarsenate (DMA(V)) were also detected. An arsenite S-adenosylmethionine methyltransferase from S. platensis (SpArsM) was identified and characterized. SpArsM showed low identity with other reported ArsM enzymes. The Escherichia coli AW3110 bearing SparsM gene resulted in As(III) methylation and conferring resistance to As(III). The in vitro assay showed that SpArsM exhibited As(III) methylation activity. DMA(V) and a small amount of MMA(V) were detected in the reaction system within 0.5hr. A truncated SpArsM derivative lacking the last 34 residues still had the ability to methylate As(III). The three single mutants of SpArsM (C59S, C186S, and C238S) abolished the capability of As(III) methylation, suggesting the three cysteine residues are involved in catalysis. We propose that SpArsM is responsible for As methylation and detoxification of As(III) and may contribute to As biogeochemistry. Copyright © 2016. Published by Elsevier B.V.

c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Dongyun; Li Jingxia; Gao Jimin

2009-02-15

Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cellmore » transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure.« less

Genetics Home Reference: isolated sulfite oxidase deficiency

MedlinePlus

... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

PubMed Central

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

2014-01-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

Proteomic Profiling of Bladders from Mice Exposed with Sodium Arsenite

EPA Science Inventory

Arsenic, an environmental contaminant, has been linked with cancer of the bladder in humans. To study the mode of action of arsenic, female CH3 mice were exposed to 85 ppm sodium arsenite in their drinking water for 30 days. Following the exposure a comparative proteomic analysis...

Effect of silicic acid on arsenate and arsenite retention mechanisms on 6-L ferrihydrite: A spectroscopic and batch adsorption approach

PubMed Central

Gao, Xiaodong; Root, Robert A.; Farrell, James; Ela, Wendell; Chorover, Jon

2014-01-01

The competitive adsorption of arsenate and arsenite with silicic acid at the ferrihydrite-water interface was investigated over a wide pH range using batch sorption experiments, attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy, extended X-ray absorption fine structure (EXAFS) spectroscopy, and density functional theory (DFT) modeling. Batch sorption results indicate that the adsorption of arsenate and arsenite on the 6-L ferrihydrite surface exhibits a strong pH-dependence, and the effect of pH on arsenic sorption differs between arsenate and arsenite. Arsenate adsorption decreases consistently with increasing pH; whereas arsenite adsorption initially increases with pH to a sorption maximum at pH 7–9, where after sorption decreases with further increases in pH. Results indicate that competitive adsorption between silicic acid and arsenate is negligible under the experimental conditions; whereas strong competitive adsorption was observed between silicic acid and arsenite, particularly at low and high pH. In-situ, flow-through ATR-FTIR data reveal that in the absence of silicic acid, arsenate forms inner-sphere, binuclear bidentate, complexes at the ferrihydrite surface across the entire pH range. Silicic acid also forms inner-sphere complexes at ferrihydrite surfaces throughout the entire pH range probed by this study (pH 2.8 – 9.0). The ATR-FTIR data also reveal that silicic acid undergoes polymerization at the ferrihydrite surface under the environmentally-relevant concentrations studied (e.g., 1.0 mM). According to ATR-FTIR data, arsenate complexation mode was not affected by the presence of silicic acid. EXAFS analyses and DFT modeling confirmed that arsenate tetrahedra were bonded to Fe metal centers via binuclear bidentate complexation with average As(V)-Fe bond distance of 3.27 Å. The EXAFS data indicate that arsenite forms both mononuclear bidentate and binuclear bidentate complexes with 6-L ferrihydrite as indicated by

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

PubMed

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

Ameliorative Effects of Acacia Honey against Sodium Arsenite-Induced Oxidative Stress in Some Viscera of Male Wistar Albino Rats.

PubMed

Aliyu, Muhammad; Ibrahim, Sani; Inuwa, Hajiya M; Sallau, Abdullahi B; Abbas, Olagunju; Aimola, Idowu A; Habila, Nathan; Uche, Ndidi S

2013-01-01

Cancer is a leading cause of death worldwide and its development is frequently associated with oxidative stress-induced by carcinogens such as arsenicals. Most foods are basically health-promoting or disease-preventing and a typical example of such type is honey. This study was undertaken to investigate the ameliorative effects of Acacia honey on sodium arsenite-induced oxidative stress in the heart, lung and kidney tissues of male Wistar rats. Male Wistar albino rats divided into four groups of five rats each were administered distilled water, Acacia honey (20%), sodium arsenite (5 mg/kg body weight), Acacia honey, and sodium arsenite daily for one week. They were sacrificed anesthetically using 60 mg/kg sodium pentothal. The tissues were used for the assessment of glutathione peroxidase, catalase, and superoxide dismutase activities, protein content and lipid peroxidation. Sodium arsenite significantly (P < 0.05) suppressed the glutathione peroxidase, catalase, superoxide dismutase activities with simultaneous induction of lipid peroxidation. Administration of Acacia honey significantly increased (P < 0.05) glutathione peroxidase, catalase, and superoxide dismutase activities with concomitant suppression of lipid peroxidation as evident by the decrease in malondialdehyde level. From the results obtained, Acacia honey mitigates sodium arsenite induced-oxidative stress in male Wistar albino rats, which suggest that it may attenuate oxidative stress implicated in chemical carcinogenesis.

Arsenite evokes IL-6 secretion, autocrine regulation of STAT3 signaling, and miR-21 expression, processes involved in the EMT and malignant transformation of human bronchial epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Fei; Xu, Yuan; The Key Laboratory of Modern Toxicology, Ministry of Education, School of Public Health, Nanjing Medical University

2013-11-15

Arsenite is an established human carcinogen, and arsenite-induced inflammation contributes to malignant transformation of cells, but the molecular mechanisms by which cancers are produced remain to be established. The present results showed that, evoked by arsenite, secretion of interleukin-6 (IL-6), a pro-inflammatory cytokine, led to the activation of STAT3, a transcription activator, and to increased levels of a microRNA, miR-21. Blocking IL-6 with anti-IL-6 antibody and inhibiting STAT3 activation reduced miR-21 expression. For human bronchial epithelial cells, cultured in the presence of anti-IL-6 antibody for 3 days, the arsenite-induced EMT and malignant transformation were reversed. Thus, IL-6, acting on STAT3more » signaling, which up-regulates miR-21in an autocrine manner, contributes to the EMT induced by arsenite. These data define a link from inflammation to EMT in the arsenite-induced malignant transformation of HBE cells. This link, mediated through miRNAs, establishes a mechanism for arsenite-induced lung carcinogenesis. - Highlights: • Arsenite evokes IL-6 secretion. • IL-6 autocrine mediates STAT3 signaling and up-regulates miR-21expression. • Inflammation is involved in arsenite-induced EMT.« less

High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

PubMed

Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

2012-03-01

The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Effect of Sodium Arsenite on Mouse Skin Carcinogenesis.

PubMed

Palmieri, Mónica A; Molinari, Beatriz L

2015-07-01

Arsenic is carcinogenic in human beings, and environmental exposure to arsenic is a public health issue that affects large populations worldwide. Thus, studies are needed to determine the mode of action of arsenic and prevent harmful effects arising from arsenic intake. The present study assessed the influence of sodium arsenite (As(3+)) on potentially carcinogenic processes that are either pre-existing or concomitant with chronic intake of water containing As(3+). Experiments using SenCar mice were designed to evaluate the effect of chronic administration of As(3+) (2, 20, or 200 mg of As(3+)/L) in drinking water that overlapped to varying degrees with a 2-stage carcinogenesis protocol carried out over 9 months. The results showed a time-dependent pattern. During early stages of carcinogenesis (6-12 weeks), animals exposed to As(3+) and the carcinogenesis protocol showed increased numbers of tumors compared to control animals. During late carcinogenesis (16-30 weeks), the number of tumors stabilized to below control values, but the tumors showed increased malignancy. These findings indicate that the outcomes of the 2-stage skin carcinogenesis protocol are modified by the presence of arsenite in drinking water, which increases the rate of carcinoma development. © 2015 by The Author(s).

Y Chromosome Regulation of Autism Susceptibility Genes

DTIC Science & Technology

2009-06-01

with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

PubMed

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

2014-09-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

PubMed

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Immobilization of Ochrobactrum tritici As5 on PTFE thin films for arsenite biofiltration.

PubMed

Branco, Rita; Sousa, Tânia; Piedade, Ana P; Morais, Paula V

2016-03-01

Ochrobactrum tritici SCII24T bacteria is an environmental strain with high capacity to resist to arsenic (As) toxicity, which makes it able to grow in the presence of As(III). The inactivation of the two functional arsenite efflux pumps, ArsB and ACR3_1, resulted in the mutant O. tritici As5 exhibiting a high accumulation of arsenite. This work describes a method for the immobilization of the mutant cells O. tritici As5, on a commercial polymeric net after sputtered modified by the deposition of poly(tetrafluoroethylene) (PTFE) thin films, and demonstrates the capacity of immobilized cells to accumulate arsenic from solutions. Six different set of deposition parameters for PTFE thin films were developed and tested in vitro regarding their ability to immobilize the bacterial cells. The surface that exhibited a mild zeta potential value, hydrophobic characteristics, the lowest surface free energy but with a high polar component and the appropriate ratio of chemical reactive groups allowed cells to proliferate and to grow as a biofilm. These immobilized cells maintained their ability to accumulate the surrounding arsenite, making it a great arsenic biofilter to be used in bioremediation processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Could vitamin C and zinc chloride protect the germ cells against sodium arsenite?

PubMed

Altoé, L S; Reis, I B; Gomes, Mlm; Dolder, H; Pirovani, Jc Monteiro

2017-10-01

Arsenic (As) is commonly associated with natural and human processes such as volcanic emissions, mining and herbicides production, being an important pollutant. Several studies have associated As intake with male fertility reduction, thus the aim of the present study was to evaluate whether vitamin C and/or zinc would counteract As side effects within the testicles. Adult male Wistar rats were divided into six experimental groups: control, sodium arsenite (5 mg/kg/day), vitamin C (100 mg/kg/day), zinc chloride (ZnCl 2 ; 20 mg/kg/day), sodium arsenite + vitamin C and sodium arsenite + ZnCl 2 . Testicles and epididymis were harvested and either frozen or routinely processed to be embedded in glycol methacrylate resin. As reduced the seminiferous epithelium and tubules diameter due to germ cell loss. In addition, both the round spermatids population and the daily sperm production were reduced. However, ZnCl 2 and vitamin C showed to be effective against such side effects, mainly regarding to sperm morphology. Long-term As intake increased the proportions of abnormal sperm, whereas the concomitant intake of As with zinc or vitamin C enhanced the proportions of normal sperm, showing that such compounds could be used to protect this cell type against morphological defects.

Acetylacetone as an efficient electron shuttle for concerted redox conversion of arsenite and nitrate in the opposite direction.

PubMed

Chen, Zhihao; Song, Xiaojie; Zhang, Shujuan; Wu, Bingdang; Zhang, Guoyang; Pan, Bingcai

2017-11-01

The redox conversion of arsenite and nitrate has direct effects on their potential environment risks. Due to the similar reduction potentials, there are few technologies that can simultaneously oxidize arsenite and reduce nitrate in one process. Here, we demonstrate that a diketone-mediated photochemical process could efficiently do this. A combined experimental and theoretical investigation was conducted to elucidate the mechanisms behind the redox conversion in the UV/acetylacetone (AA) process. Our key finding is that UV irradiation significantly changed the redox potential of AA. The excited AA, 3 (AA)*, acted as a semiquinone radical-like electron shuttle. For arsenite oxidation, the efficiency of 3 (AA)* was 1-2 orders of magnitude higher than those of quinone-type electron shuttles, whereas the consumption of AA was 2-4 orders of magnitude less than those of benzonquinones. The oxidation of arsenite and reduction of nitrate could be both accelerated when they existed together in UV/AA process. The results indicate that small diketones are some neglected but potent electron shuttles of great application potential in regulating aquatic redox reactions with the combination of UV irradiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Xi; Zhou, Xixi; Du, Libo

2014-01-15

Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects ofmore » arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of

The monoamine oxidase A gene promoter repeat and prostate cancer risk.

PubMed

White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

2012-11-01

Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-01-01

Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension

PubMed Central

FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.

2010-01-01

Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159

Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of NADPH oxidase family members associated with cold stress in strawberry.

PubMed

Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

2018-04-01

NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

PubMed Central

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

PubMed

Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

2017-01-01

Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

[Purification of arsenic-binding proteins in hamster plasma after oral administration of arsenite].

PubMed

Wang, Wenwen; Zhang, Min; Li, Chunhui; Qin, Yingjie; Hua, Naranmandura

2013-01-01

To purify the arsenic-binding proteins (As-BP) in hamster plasma after a single oral administration of arsenite (iAs(III)). Arsenite was given to hamsters in a single dose. Three types of HPLC columns, size exclusion, gel filtration and anion exchange columns, combined with an inductively coupled argon plasma mass spectrometer (ICP MS) were used to purify the As-BP in hamster plasma. SDS-PAGE was used to confirm the arsenic-binding proteins at each purification step. The three-step purification process successfully separated As-BP from other proteins (ie, arsenic unbound proteins) in hamster plasma. The molecular mass of purified As-BP in plasma was approximately 40-50 kD on SDS-PAGE. The three-step purification method is a simple and fast approach to purify the As-BP in plasma samples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia

We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O{sub 2}{sup .-}) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5 μM, arsenite elicited selective formation of O{sub 2}{sup .-} in the respiratory chain of RP cells, with hardlymore » any contribution of the above mechanisms. Under these conditions, O{sub 2}{sup .-} triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O{sub 2}{sup .-} because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O{sub 2}{sup .-} mediated by NADPH oxidase. Interestingly, extramitochondrial O{sub 2}{sup .-} triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O{sub 2}{sup .-} availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. - Highlights: • Mitochondrial superoxide mediates arsenite toxicity in respiration-proficient cells. • NADPH-derived superoxide mediates arsenite toxicity in respiration-deficient cells. • Arsenite causes

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunner, H.G.; Nelen, M.; Ropers, H.H.

1993-10-22

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

Arsenite Elicits Anomalous Sulfur Starvation Responses in Barley1[W

PubMed Central

Reid, Rob; Gridley, Kate; Kawamata, Yuta; Zhu, Yongguan

2013-01-01

Treatment of barley (Hordeum vulgare) seedlings with arsenite (AsIII) rapidly induced physiological and transcriptional changes characteristic of sulfur deficiency, even in plants replete with sulfur. AsIII and sulfur deficiency induced 5- to 20-fold increases in the three genes responsible for sulfate reduction. Both treatments also caused up-regulation of a sulfate transporter, but only in the case of sulfur deficiency was there an increase in sulfate influx. Longer-term changes included reduction in transfer of sulfur from roots to shoots and an increase in root growth relative to shoot growth. Genes involved in complexation and compartmentation of arsenic were up-regulated by AsIII, but not by sulfur deficiency. The rate at which arsenic accumulated appeared to be controlled by the rate of thiol synthesis. Over a range of AsIII concentrations and growth periods, the ratio of thiols to arsenic was always close to 3:1, which is consistent with the formation of a stable complex between three glutathione molecules per AsIII. The greater toxicity of arsenic under sulfur-limiting conditions is likely to be due to an intensification of sulfur deficiency as a result of thiol synthesis, rather than to a direct toxicity to metabolism. Because influx of AsIII was nearly 20-fold faster than the rate of synthesis of thiols, it is questionable whether this complexation strategy can be effective in preventing arsenic toxicity, unless arsenic uptake becomes limited by diffusive resistances in the rhizosphere. PMID:23482871

Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

PubMed

Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

2001-06-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

PubMed Central

Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

2001-01-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

SPARC Gene Expression is Repressed in Human Urothelial Cells (UROtsa) Exposed to or Malignantly Transformed by Cadmium or Arsenite

PubMed Central

Larson, Jennifer; Yasmin, Tahmina; Sens, Donald A.; Zhou, Xu Dong; Sens, Mary Ann; Garrett, Scott H.; Dunlevy, Jane R.; Cao, Ling; Somji, Seema

2010-01-01

SPARC belongs to a class of extracellular matrix-associated proteins that have counteradhesive properties. The ability of SPARC to modulate cell-cell and cell-matrix interactions provides a strong rationale for studies designed to determine its expression in cancer. The objective of this study was to determine if SPARC expression was altered in cadmium (Cd+2) and arsenite (As+3) induced bladder cancer and if these alterations were present in archival specimens of human bladder cancer. The expression of SPARC was determined in human parental UROtsa cells, their Cd+2 and As+3 transformed counterparts and derived tumors, and in archival specimens of human bladder cancer using a combination of real time reverse transcriptase polymerase chain reaction, western blotting, immunofluoresence localization and immunohistochemical staining. It was demonstrated that SPARC expression was down-regulated in Cd+2 and As+3 transformed UROtsa cells. In addition, the malignant epithelial component of tumors derived from these cell lines were also down-regulated for SPARC expression, but the stromal cells recruited to these tumors was highly reactive for SPARC. This finding was shown to translate to specimens of human bladder cancer where tumor cells were SPARC negative, but stromal cells were positive. Acute exposure of UROtsa cells to both cadmium and arsenite reduced the expression of SPARC through a mechanism that did not involve changes in DNA methylation or histone acetylation. These studies suggest that environmental exposure to As+3 or Cd+2 can alter cell-cell and cell-matrix interactions in normal urothelial cells through a reduction in the expression of SPARC. The SPARC associated loss of cell-cell and cell-matrix contacts may participate in the multi-step process of bladder carcinogenesis. PMID:20837119

An unusual Tn21-like transposon containing an ars operon is present in highly arsenic-resistant strains of the biomining bacterium Acidithiobacillus caldus.

PubMed

Tuffin, I Marla; de Groot, Peter; Deane, Shelly M; Rawlings, Douglas E

2005-09-01

A transposon, TnAtcArs, that carries a set of arsenic-resistance genes was isolated from a strain of the moderately thermophilic, sulfur-oxidizing, biomining bacterium Acidithiobacillus caldus. This strain originated from a commercial plant used for the bio-oxidation of gold-bearing arsenopyrite concentrates. Continuous selection for arsenic resistance over many years had made the bacterium resistant to high concentrations of arsenic. Sequence analysis indicated that TnAtcArs is 12 444 bp in length and has 40 bp terminal inverted repeat sequences and divergently transcribed resolvase and transposase genes that are related to the Tn21-transposon subfamily. A series of genes consisting of arsR, two tandem copies of arsA and arsD, two ORFs (7 and 8) and arsB is situated between the resolvase and transposase genes. Although some commercial strains of At. caldus contained the arsDA duplication, when transformed into Escherichia coli, the arsDA duplication was unstable and was frequently lost during cultivation or if a plasmid containing TnAtcArs was conjugated into a recipient strain. TnAtcArs conferred resistance to arsenite and arsenate upon E. coli cells. Deletion of one copy of arsDA had no noticeable effect on resistance to arsenite or arsenate in E. coli. ORFs 7 and 8 had clear sequence similarity to an NADH oxidase and a CBS-domain-containing protein, respectively, but their deletion did not affect resistance to arsenite or arsenate in E. coli. TnAtcArs was actively transposed in E. coli, but no increase in transposition frequency in the presence of arsenic was detected. Northern hybridization and reporter gene studies indicated that although ArsR regulated the 10 kb operon containing the arsenic-resistance genes in response to arsenic, ArsR had no effect on the regulation of genes associated with transposition activity.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

PubMed Central

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

ARSENITE BINDING TO SYNTHETIC PEPTIDES: THE EFFECT OF INCREASING LENGTH BETWEEN TWO CYSTEINES

EPA Science Inventory

Binding of trivalent arsenicals to peptides and proteins can alter peptide/protein structure and enzyme function and thereby contribute to arsenic toxicity and carcinogenicity. We utilized radioactive 73As- labeled arsenite and vacuum filtration methodology to determine the bindi...

[Lead adsorption and arsenite oxidation by cobalt doped birnessite].

PubMed

Yin, Hui; Feng, Xiong-Han; Qiu, Guo-Hong; Tan, Wen-Feng; Liu, Fan

2011-07-01

In order to study the effects of transition metal ions on the physic-chemical properties of manganese dioxides as environmental friendly materials, three-dimensional nano-microsphere cobalt-doped birnessite was synthesized by reduction of potassium permanganate by mixtures of concentrated hydrochloride and cobalt (II) chloride. Powder X-ray diffraction, chemical analysis, N2 physical adsorption, field emission scanning electron microscopy (FE-SEM) and X-ray photoelectron spectra (XPS) were used to characterize the crystal structure, chemical composition and micro-morphologies of products. In the range of molar ratios from 0.05 to 0.20, birnessite was fabricated exclusively. It was observed that cobalt incorporated into the layers of birnessite and had little effect on the crystal structure and micromorpholgy, but crystallinity decreased after cobalt doping. Both chemical analysis and XPS results showed that manganese average oxidation state decreased after cobalt doping, and the percentage of Mn3+ increased. Co(III) OOH existed mainly in the structure. With the increase of cobalt, hydroxide oxygen percentage in molar increased from 12.79% for undoped birnessite to 13.05%, 17.69% and 17.79% for doped samples respectively. Adsorption capacity for lead and oxidation of arsenite of birnessite were enhanced by cobalt doping. The maximum capacity of Pb2+ adsorption increased in the order HB (2 538 mmol/kg) < CoB5 (2798 mmol/kg) < CoB10 (2932 mmol/kg) < CoB20 (3 146 mmol/kg). Oxidation percentage of arsenite in simulated waste water by undoped birnessite was 76.5%, those of doped ones increased by 2.0%, 12.8% and 18.9% respectively. Partial of Co3+ substitution for Mn4+ results in the increase of negative charge of the layer and the content of hydroxyl group, which could account for the improved adsorption capacity of Pb2+. After substitution of manganese by cobalt, oxidation capacity of arsenite by birnessite increases likely due to the higher standard redox potential of

Arsenite in drinking water produces glucose intolerance in pregnant rats and their female offspring.

PubMed

Bonaventura, María Marta; Bourguignon, Nadia Soledad; Bizzozzero, Marianne; Rodriguez, Diego; Ventura, Clara; Cocca, Claudia; Libertun, Carlos; Lux-Lantos, Victoria Adela

2017-02-01

Drinking water is the main source of arsenic exposure. Chronic exposure has been associated with metabolic disorders. Here we studied the effects of arsenic on glucose metabolism, in pregnant and post-partum of dams and their offspring. We administered 5 (A5) or 50 (A50) mg/L of sodium arsenite in drinking water to rats from gestational day 1 (GD1) until two months postpartum (2MPP), and to their offspring from weaning until 8 weeks old. Liver arsenic dose-dependently increased in arsenite-treated rats to levels similar to exposed population. Pregnant A50 rats gained less weight than controls and recovered normal weight at 2MPP. Arsenite-treated pregnant animals showed glucose intolerance on GD16-17, with impaired insulin secretion but normal insulin sensitivity; they showed dose-dependent increased pancreas insulin on GD18. All alterations reverted at 2MPP. Offspring from A50-treated mothers showed lower body weight at birth, 4 and 8 weeks of age, and glucose intolerance in adult females, probably due to insulin secretion and sensitivity alterations. Arsenic alters glucose homeostasis during pregnancy by altering beta-cell function, increasing risk of developing gestational diabetes. In pups, it induces low body weight from birth to 8 weeks of age, and glucose intolerance in females, demonstrating a sex specific response. Copyright © 2016 Elsevier Ltd. All rights reserved.

COMPARATIVE GENOTOXIC RESPONSES TO ARSENITE IN GUINEA PIG, MOUSE, RAT AND HUMAN LYMPHOCYTES

EPA Science Inventory

Comparative genotoxic responses to arsenite in guinea pig, mouse, rat and human
lymphocytes.

Inorganic arsenic is a known human carcinogen causing skin, lung, and bladder cancer following chronic exposures. Yet, long-term laboratory animal carcinogenicity studies have ...

INFLUENCE OF SODIUM ARSENITE ON GAP JUNCTION COMMUNICATION IN RAT LIVER EPITHELIAL CELLS

EPA Science Inventory

Influence of sodium arsenite on gap junction communication in rat-Iiver epitheiial cells.

Arsenic is known to cause certain types of cancers, hepatitis, cirrhosis and neurological disorders as well as cardiovascular and reproductive effects and skin lesions. The mechanism...

Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

PubMed Central

Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

2017-01-01

Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

A small quantity of sodium arsenite will kill large cull hardwoods

Treesearch

Francis M. Rushmore

1956-01-01

Although it is well known that sodium arsenite is an effective silvicide, forestry literature contains little information about the minimum quantities of this chemical that are required to kill large cull trees. Such information would be of value because if small quantities of a chemical will produce satisfactory results, small holes or frills in the tree will hold it...

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

PubMed

Wang, Wei; Liu, Ji-Hong

2015-01-25

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

Zinc adsorption effects on arsenite oxidation kinetics at the birnessite-water interface

USGS Publications Warehouse

Power, L.E.; Arai, Y.; Sparks, D.L.

2005-01-01

Arsenite is more toxic and mobile than As(V) in soil and sediment environments, and thus it is advantageous to explore factors that enhance oxidation of As(III) to As(V). Previous studies showed that manganese oxides, such as birnessite (??-MnO2), directly oxidized As(III). However, these studies did not explore the role that cation adsorption has on As(III) oxidation. Accordingly, the effects of adsorbed and nonadsorbed Zn on arsenite (As(III)) oxidation kinetics at the birnessite-water interface were investigated using batch adsorption experiments (0.1 g L-1; pH 4.5 and 6.0; I = 0.01 M NaCl). Divalent Zn adsorption on synthetic ??-MnO 2 in the absence of As(III) increased with increasing pH and caused positive shifts in electrophoretic mobility values at pH 4-6, indirectly suggesting inner-sphere Zn adsorption mechanisms. Arsenite was readily oxidized on birnessite in the absence of Zn. The initial As(III) oxidation rate constant decreased with increasing pH from 4.5 to 6.0 and initial As(III) concentrations from 100 to 300 ??M. Similar pH and initial As(III) concentration effects were observed in systems when Zn was present (i.e., presorbed Zn prior to As(III) addition and simultaneously added Zn-As(III) systems), but As(III) oxidation reactions were suppressed compared to the respective control systems. The suppression was more pronounced when Zn was presorbed on the ??-MnO 2 surfaces as opposed to added simultaneously with As(III). This study provides further understanding of As(III) oxidation reactions on manganese oxide surfaces under environmentally applicable conditions where metals compete for reactive sites.

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

PubMed Central

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Involvement of miR528 in the Regulation of Arsenite Tolerance in Rice (Oryza sativa L.).

PubMed

Liu, Qingpo; Hu, Haichao; Zhu, Leyi; Li, Ruochen; Feng, Ying; Zhang, Liqing; Yang, Yuyan; Liu, Xingquan; Zhang, Hengmu

2015-10-14

Tens of miRNAs were previously established as being arsenic (As) stress responsive in rice. However, their functional role in As tolerance remains unclear. This study demonstrates that transgenic plants overexpressing miR528 (Ubi::MIR528) were more sensitive to arsenite [As(III)] compared with wild-type (WT) rice. Under normal and stress conditions, miR528-5p and -3p were highly up-regulated in both the roots and leaves of transgenic plants, which exhibited a negative correlation with the expression of seven target genes. Compared with WT plants, Ubi::MIR528 plants showed excessive oxidative stress generation and remarkable amino acid content changes in the roots and leaves upon As(III) exposure. Notably, the expression profiles of diverse functional genes were clearly different between WT and transgenic plants. Thus, the observed As(III) sensitivity of Ubi::MIR528 plants was likely due to the strong alteration of antioxidant enzyme activity and amino acid profiles and the impairment of the As(III) uptake, translocation, and tolerance systems of rice.

ARSENICALS IN MATERNAL AND FETAL MOUSE TISSUES AFTER GESTATIONAL EXPOSURE TO ARSENITE

EPA Science Inventory

Exposure of pregnant C3H/HeNCR mice to 42.5- or 85-ppm of arsenic as sodium arsenite in drinking water between days 8 to 18 of gestation markedly increases tumor incidence in their offspring. In the work reported here, distribution of inorganic arsenic and its metabolites, methy...

Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

PubMed

Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

2015-03-24

L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

PubMed Central

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

Hyper-O-GlcNAcylation inhibits the induction of heat shock protein 70 (Hsp 70) by sodium arsenite in HeLa cells.

PubMed

Miura, Yuri; Sato, Takatoshi; Sakurai, Yoko; Sakai, Ryo; Hiraoka, Wakako; Endo, Tamao

2014-01-01

O-Linked β-N-acetylglucosamine-modification (O-GlcNAcylation) is a reversible, post-translational, and regulatory modification of nuclear, mitochondrial, and cytoplasmic proteins that is responsive to cellular stress. However, the role of O-GlcNAcylation in the induction of heat shock proteins (Hsps) by arsenite remains unclear. We used O-(2-acetamido-2-deoxy-D-glucopyranosylidene) amino N-phenyl carbamate (PUGNAc), an inhibitor of O-GlcNAcase, and glucosamine (GlcN), an enhancer of the hexosamine biosynthesis pathway, or O-GlcNAc transferase (OGT) short interfering RNA (siRNA) to enhance or suppress cellular O-GlcNAcylation levels, respectively, in HeLa cells. The exposure to arsenite increased O-GlcNAcylation and Hsp 70 levels in HeLa cells. However, the pre-treatment with PUGNAc or GlcN, which enhanced O-GlcNAcylation levels, decreased the arsenite-induced expression of Hsp 70. The pre-treatment with OGT siRNA, which suppressed O-GlcNAcylation levels, did not affect the induction of Hsp 70. We then examined the effects of O-GlcNAcylation on the nuclear translocation and phosphorylation of heat shock factor 1 (HSF1), and found that neither the nuclear translocation nor phosphorylation of HSF1 was regulated by O-GlcNAcylation. Finally, Hsp 70 mRNA expression was induced by arsenite, whereas the addition of PUGNAc slightly suppressed its induction. These results indicate that O-GlcNAcylation is related to arsenite-induced Hsp 70 expression, and demonstrated that hyper-O-GlcNAcylation inhibited the induction of Hsp 70 via transcriptional factors instead of HSF1.

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

PubMed

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

PubMed

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

PubMed Central

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

PubMed

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.

[Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

PubMed

Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

2010-11-01

Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

PubMed Central

Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

2008-01-01

Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

PubMed

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

Microbial contributions to coupled arsenic and sulfur cycling in the acid-sulfide hot spring Champagne Pool, New Zealand.

PubMed

Hug, Katrin; Maher, William A; Stott, Matthew B; Krikowa, Frank; Foster, Simon; Moreau, John W

2014-01-01

Acid-sulfide hot springs are analogs of early Earth geothermal systems where microbial metal(loid) resistance likely first evolved. Arsenic is a metalloid enriched in the acid-sulfide hot spring Champagne Pool (Waiotapu, New Zealand). Arsenic speciation in Champagne Pool follows reaction paths not yet fully understood with respect to biotic contributions and coupling to biogeochemical sulfur cycling. Here we present quantitative arsenic speciation from Champagne Pool, finding arsenite dominant in the pool, rim and outflow channel (55-75% total arsenic), and dithio- and trithioarsenates ubiquitously present as 18-25% total arsenic. In the outflow channel, dimethylmonothioarsenate comprised ≤9% total arsenic, while on the outflow terrace thioarsenates were present at 55% total arsenic. We also quantified sulfide, thiosulfate, sulfate and elemental sulfur, finding sulfide and sulfate as major species in the pool and outflow terrace, respectively. Elemental sulfur concentration reached a maximum at the terrace. Phylogenetic analysis of 16S rRNA genes from metagenomic sequencing revealed the dominance of Sulfurihydrogenibium at all sites and an increased archaeal population at the rim and outflow channel. Several phylotypes were found closely related to known sulfur- and sulfide-oxidizers, as well as sulfur- and sulfate-reducers. Bioinformatic analysis revealed genes underpinning sulfur redox transformations, consistent with sulfur speciation data, and illustrating a microbial role in sulfur-dependent transformation of arsenite to thioarsenate. Metagenomic analysis also revealed genes encoding for arsenate reductase at all sites, reflecting the ubiquity of thioarsenate and a need for microbial arsenate resistance despite anoxic conditions. Absence of the arsenite oxidase gene, aio, at all sites suggests prioritization of arsenite detoxification over coupling to energy conservation. Finally, detection of methyl arsenic in the outflow channel, in conjunction with

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

Semen characteristics and sperm morphology of Pistia stratiotes Linn. (Araceae) protected male albino rats (Wistar strain) exposed to sodium arsenite.

PubMed

Ola-Davies, Olufunke; Ajani, O Samuel

2016-09-01

Sodium arsenite has been proven to be abundant in nature and released into the environment through human activities, including agricultural and industrial processes. The objective of our study was to investigate the sperm protective potential of Pistia stratiotes Linn. in arsenic-treated rats. The sperm protective potential of P. stratiotes Linn. (Araceae) was carried out in arsenic-exposed rats using 24 male albino rats (225 to 228 g) aged between 14 and 16 weeks old. They were grouped into 4 (A-D), each group containing 6 rats. Group A animals were orally treated with 100 mg/kg ethanol leaf extract of P. stratiotes Linn. daily for 14 days; group B (sodium arsenite at 2.5 mg/kg body weight; positive control); group C (P. stratiotes extract for 14 days and single dose of sodium arsenite on day 14; group D (0.1 mL propylene glycol; negative control/vehicle). Group B had a significantly lower (p<0.05) percentage sperm motility (26.7±6.67 %) while group A had a significantly (p<0.05) higher mean value (63.3±3.33 %) when compared across the groups. The sperm motility of rats in group D was significantly higher (p<0.05) than groups B and C. This implies that P. stratiotes extract had no adverse effect on sperm motility. The presence of P. stratiotes with sodium arsenite alleviated its harmful effect on sperm motility. The mean value obtained for sperm viability, semen volume and sperm count followed a similar pattern although the difference was not significant (p>0.05) for semen volume and the sperm count of rats across the groups. Total sperm abnormality was 10.44 and 14.27 % with the sodium arsenite treated group having the highest value when compared with groups A treated with P. stratiotes extract and D treated with propylene, although the differences were not significant (p>0.05). The study concluded that ethanol leaf extract of P. stratiotes has no negative effect on sperm motility, viability and morphology and also protected spermatozoa against

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

PubMed Central

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

A complex effect of arsenite on the formation of alpha-ketoglutarate in rat liver mitochondria.

PubMed

Lenartowicz, E

1990-12-01

This investigation presents disturbances of the mitochondrial metabolism by arsenite, a hydrophilic dithiol reagent known as an inhibitor of mitochondrial alpha-keto acid dehydrogenases. Arsenite at concentrations of 0.1-1.0 mM was shown to induce a considerable oxidation of intramitochondrial NADPH, NADH, and glutathione without decreasing the mitochondrial membrane potential. The oxidation of NAD(P)H required the presence of phosphate and was sensitive to ruthenium red, but occurred without the addition of calcium salts. Mitochondrial reactions producing alpha-ketoglutarate from glutamate and isocitrate were modulated by arsenite through various mechanisms: (i) both glutamate transaminations, with oxaloacetate and with pyruvate, were inhibited by accumulating alpha-ketoglutarate; however, at low concentrations of alpha-ketoglutarate the aspartate aminotransferase reaction was stimulated due to the increase of NAD+ content; (ii) the oxidation of isocitrate was stimulated at its low concentration only, due to the oxidation of NADPH and NADH; this oxidation was prevented by concentrations of citrate or isocitrate greater than 1 mM; (iii) the conversion of isocitrate to citrate was suppressed, presumably as a result of the decrease of Mg2+ concentration in mitochondria. Thus the depletion of mitochondrial vicinal thiol groups in hydrophilic domains disturbs the mitochondrial metabolism not only by the inhibition of alpha-keto acid dehydrogenases but also by the oxidation of NAD(P)H and, possibly, by the change in the ion concentrations.

Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

PubMed

Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

2011-01-01

Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

PubMed

Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

2016-01-10

Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

PubMed

Kita, K; Konishi, K; Anraku, Y

1986-01-01

Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

PubMed Central

Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

1999-01-01

Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

PubMed

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Co-delivery of doxorubicin and arsenite with reduction and pH dual-sensitive vesicle for synergistic cancer therapy

NASA Astrophysics Data System (ADS)

Zhang, Lu; Xiao, Hong; Li, Jingguo; Cheng, Du; Shuai, Xintao

2016-06-01

Drug resistance is the underlying cause for therapeutic failure in clinical cancer chemotherapy. A prodrug copolymer mPEG-PAsp(DIP-co-BZA-co-DOX) (PDBD) was synthesized and assembled into a nanoscale vesicle comprising a PEG corona, a reduction and pH dual-sensitive hydrophobic membrane and an aqueous lumen encapsulating doxorubicin hydrochloride (DOX.HCl) and arsenite (As). The dual stimulation-sensitive design of the vesicle gave rise to rapid release of the physically entrapped DOX.HCl and arsenite inside acidic lysosomes, and chemically conjugated DOX inside the cytosol with high glutathione (GSH) concentration. In the optimized concentration range, arsenite previously recognized as a promising anticancer agent from traditional Chinese medicine can down-regulate the expressions of anti-apoptotic and multidrug resistance proteins to sensitize cancer cells to chemotherapy. Consequently, the DOX-As-co-loaded vesicle demonstrated potent anticancer activity. Compared to the only DOX-loaded vesicle, the DOX-As-co-loaded one induced more than twice the apoptotic ratio of MCF-7/ADR breast cancer cells at a low As concentration (0.5 μM), due to the synergistic effects of DOX and As. The drug loading strategy integrating chemical conjugation and physical encapsulation in stimulation-sensitive carriers enabled efficient drug loading in the formulation.Drug resistance is the underlying cause for therapeutic failure in clinical cancer chemotherapy. A prodrug copolymer mPEG-PAsp(DIP-co-BZA-co-DOX) (PDBD) was synthesized and assembled into a nanoscale vesicle comprising a PEG corona, a reduction and pH dual-sensitive hydrophobic membrane and an aqueous lumen encapsulating doxorubicin hydrochloride (DOX.HCl) and arsenite (As). The dual stimulation-sensitive design of the vesicle gave rise to rapid release of the physically entrapped DOX.HCl and arsenite inside acidic lysosomes, and chemically conjugated DOX inside the cytosol with high glutathione (GSH) concentration. In the

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Monoamine oxidase-A polymorphisms might modify the association between the dopamine D2 receptor gene and alcohol dependence.

PubMed

Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band

2007-05-01

Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.

Autecology of an arsenite chemolithotroph: sulfide constraints on function and distribution in a geothermal spring.

PubMed

D'Imperio, Seth; Lehr, Corinne R; Breary, Michele; McDermott, Timothy R

2007-11-01

Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H(2)S exceeds approximately 5 microM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H(2)S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H(2)S is removed. Cultivation experiments initiated with mat samples taken from along the H(2)S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H(2)S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H(2)S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H(2)S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H(2)S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs.

Autecology of an Arsenite Chemolithotroph: Sulfide Constraints on Function and Distribution in a Geothermal Spring▿

PubMed Central

D'Imperio, Seth; Lehr, Corinne R.; Breary, Michele; McDermott, Timothy R.

2007-01-01

Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H2S exceeds ∼5 μM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H2S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H2S is removed. Cultivation experiments initiated with mat samples taken from along the H2S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H2S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H2S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H2S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H2S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs. PMID:17827309

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

PubMed

Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

2002-04-01

Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

Enhanced Detoxification of Arsenic Under Carbon Starvation: A New Insight into Microbial Arsenic Physiology.

PubMed

Nandre, Vinod S; Bachate, Sachin P; Salunkhe, Rahul C; Bagade, Aditi V; Shouche, Yogesh S; Kodam, Kisan M

2017-05-01

Nutrient availability in nature influenced the microbial ecology and behavior present in existing environment. In this study, we have focused on isolation of arsenic-oxidizing cultures from arsenic devoid environment and studied effect of carbon starvation on rate of arsenite oxidation. In spite of the absence of arsenic, a total of 40 heterotrophic, aerobic, arsenic-transforming bacterial strains representing 18 different genera were identified. Nineteen bacterial species were isolated from tannery effluent and twenty-one from tannery soil. A strong co-relation between the carbon starvation and arsenic oxidation potential of the isolates obtained from the said niche was observed. Interestingly, low carbon content enhanced the arsenic oxidation ability of the strains across different genera in Proteobacteria obtained. This represents the impact of physiological response of carbon metabolism under metal stress conditions. Enhanced arsenic-oxidizing ability of the strains was validated by the presence of aio gene and RT-PCR, where 0.5- to 26-fold up-regulation of arsenite oxidase gene in different genera was observed. The cultures isolated from tannery environment in this study show predominantly arsenic oxidation ability. This detoxification of arsenic in lack of carbon content can aid in effective in situ arsenic bioremediation.

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

PubMed

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

Regulation of apoptosis in human melanoma and neuroblastoma cells by statins, sodium arsenite and TRAIL: a role of combined treatment versus monotherapy

PubMed Central

Ivanov, Vladimir N.; Hei, Tom K.

2015-01-01

Treatment of melanoma cells by sodium arsenite or statins (simvastatin and lovastatin) dramatically modified activities of the main cell signaling pathways resulting in the induction of heme oxygenase-1 (HO-1) and in a downregulation of cyclooxygenase-2 (COX-2) protein levels. Through heme degradation and the production of carbon monoxide and biliverdin, HO-1 plays a protective role in different scenario of oxidative stress followed by mitochondrial apoptosis. Both sodium arsenite and statins could be efficient inducers of apoptosis in some melanoma cell lines, but often exhibited only modest proapoptotic activity in others, due to numerous protective mechanisms. We demonstrated in the present study that treatment by sodium arsenite or statins with an additional inhibition of HO-1 expression (or activation) caused a substantial upregulation of apoptosis in melanoma cells. Sodium arsenite- or statin-induced apoptosis was independent of BRAF status (wild type versus V600E) in melanoma lines. Monotreatment required high doses of statins (20–40 μM) for effective induction of apoptosis. As an alternative approach, pretreatment of melanoma cells with statin at decreased doses (5–20 μM) dramatically enhanced TRAIL-induced apoptosis, due to suppression of the NF-κB and STAT3-transcriptional targets (including COX-2) and downregulation of cFLIP-L (a caspase-8 inhibitor) protein levels. Furthermore, combined treatment with sodium arsenite and TRAIL or simvastatin and TRAIL efficiently induced apoptotic commitment in human neuroblastoma cells. In summary, our findings on enhancing effects of combined treatment of cancer cells using statin and TRAIL provide the rationale for further preclinical evaluation. PMID:21910007

NADPH oxidases in the arbuscular mycorrhizal symbiosis.

PubMed

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

NADPH oxidases in the arbuscular mycorrhizal symbiosis

PubMed Central

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

PubMed

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

Effects of choline on sodium arsenite-induced neural tube defects in chick embryos.

PubMed

Song, Ge; Cui, Yi; Han, Zhong-Ji; Xia, Hong-Fei; Ma, Xu

2012-12-01

Arsenic passes through the placenta and accumulates in the neuroepithelium of embryo, whereby inducing congenital malformations such as neural tube defects (NTDs) in animals. Choline (CHO), a methyl-rich nutrient, functions as a methyl donor to participate in methyl group metabolism. Arsenic methylation has been regarded as a detoxification process and choline (CHO) is the major source of methyl-groups. However, whether CHO intake reverses the abnormal embryo development induced by sodium arsenite (SA) and the relationship between CHO intake and arsenite-induced NTDs are still unclear. In this study, we used chick embryos as animal model to investigate the effects of SA and CHO supplementation on the early development of nervous system. Our results showed that the administration of SA led to reduction in embryo viability, embryo body weight and extraembryonic vascular area, accompanied by a significantly increased incidence of the failed closure of the caudal end of the neural tube. CHO, at low dose (25 μg/μL), reversed the decrease in embryo viability and the increase in the failed closure of the caudal end of the neural tube, which were induced by SA. In addition, CHO (25 μg/μL) inhibited not only the SA-induced cell apoptosis by up-regulating Bcl-2 level, but also the global DNA methylation by increasing the expressions of DNMT1 and DNMT3a. However, less significant difference was found between the embryos co-treated with SA and CHO (50 μg/μL) and the ones treated with SA alone. Taken together, these findings suggest that low dose CHO could protect chick embryos from arsenite-induced NTDs by a possible mechanism related to the methyl metabolism. Copyright © 2012 Elsevier Ltd. All rights reserved.

Oxidative stress-related liver dysfunction by sodium arsenite: Alleviation by Pistacia lentiscus oil.

PubMed

Klibet, Fahima; Boumendjel, Amel; Khiari, Mohamed; El Feki, Abdelfattah; Abdennour, Cherif; Messarah, Mahfoud

2016-01-01

Pistacia lentiscus L. (Anacardiaceae) is an evergreen shrub widely distributed throughout the Mediterranean region. Pistacia lentiscus oil (PLo) was particularly known in North African traditional medicine. Thus, people of these regions have used it externally to treat sore throats, burns and wounds, as well as they employed it internally for respiratory allergies. PLo is rich in essential fatty acids, vitamin E and polyphenols. As a very active site of metabolism, liver is reported to be susceptible to arsenic (As) intoxication. The present study evaluates the protective effect of PLo against sodium arsenite-induced hepatic dysfunction and oxidative stress in experimental Wistar rats. Twenty-eight rats were equally divided into four groups; the first served as a control, the remaining groups were respectively treated with PLo (3.3 mL/kg body weight), sodium arsenite (5.55 mg/kg body weight) and a combination of sodium arsenite and PLo. After 21 consecutive days, cellular functions were evaluated by hematological, biochemical and oxidative stress markers. A significant decrease in the levels of red blood cells, haemoglobin (p ≤ 0.001), hematocrit (p ≤ 0.001), reduced glutathione and metallothionein (p ≤ 0.05) associated with a significant increase of malondialdehyde (p ≤ 0.001) were noticed in the arsenic-exposed group when compared to the control. The As-treated group also exhibited an increase in hepatic antioxidant enzymes namely superoxide dismutase, glutathione peroxidase (p ≤ 0.01) and catalase (p ≤ 0.05). However, the co-administration of PLo has relatively reduced arsenic effect. The results showed that arsenic intoxication disturbed the liver pro-oxidant/antioxidant status. PLo co-administration mitigates arsenic-induced oxidative damage in rat.

The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

PubMed Central

Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

2016-01-01

The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

Haloarchaea from the Andean Puna: Biological Role in the Energy Metabolism of Arsenic.

PubMed

Ordoñez, Omar Federico; Rasuk, María Cecilia; Soria, Mariana Noelia; Contreras, Manuel; Farías, María Eugenia

2018-03-08

Biofilms, microbial mats, and microbialites dwell under highly limiting conditions (high salinity, extreme aridity, pH, and elevated arsenic concentration) in the Andean Puna. Only recent pioneering studies have described the microbial diversity of different Altiplano lakes and revealed their unexpectedly diverse microbial communities. Arsenic metabolism is proposed to be an ancient mechanism to obtain energy by microorganisms. Members of Bacteria and Archaea are able to exploit arsenic as a bioenergetic substrate in either anaerobic arsenate respiration or chemolithotrophic growth on arsenite. Only six aioAB sequences coding for arsenite oxidase and three arrA sequences coding for arsenate reductase from haloarchaea were previously deposited in the NCBI database. However, no experimental data on their expression and function has been reported. Recently, our working group revealed the prevalence of haloarchaea in a red biofilm from Diamante Lake and microbial mat from Tebenquiche Lake using a metagenomics approach. Also, a surprisingly high abundance of genes used for anaerobic arsenate respiration (arr) and arsenite oxidation (aio) was detected in the Diamante's metagenome. In order to study in depth the role of arsenic in these haloarchaeal communities, in this work, we obtained 18 haloarchaea belonging to the Halorubrum genus, tolerant to arsenic. Furthermore, the identification and expression analysis of genes involved in obtaining energy from arsenic compounds (aio and arr) showed that aio and arr partial genes were detected in 11 isolates, and their expression was verified in two selected strains. Better growth of two isolates was obtained in presence of arsenic compared to control. Moreover, one of the isolates was able to oxidize As[III]. The confirmation of the oxidation of arsenic and the transcriptional expression of these genes by RT-PCR strongly support the hypothesis that the arsenic can be used in bioenergetics processes by the microorganisms

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Treesearch

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

PubMed

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

PubMed

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Estimating costs of improving Adirondack timber stands by killing culls with frills and sodium arsenite

Treesearch

Robert O. Curtis

1956-01-01

Although it has been known for many years that sodium arsenite solution applied in ax frills is an effective means of killing cull trees (1), no published information could be found on the cost of stand-improvement work with this method under Adirondack conditions.

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

PubMed

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Synergism between arsenite and proteasome inhibitor MG132 over cell death in myeloid leukaemic cells U937 and the induction of low levels of intracellular superoxide anion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lombardo, Tomás; Cavaliere, Victoria; Costantino, Susana N.

Increased oxygen species production has often been cited as a mechanism determining synergism on cell death and growth inhibition effects of arsenic-combined drugs. However the net effect of drug combination may not be easily anticipated solely from available knowledge of drug-induced death mechanisms. We evaluated the combined effect of sodium arsenite with the proteasome inhibitor MG132, and the anti-leukaemic agent CAPE, on growth-inhibition and cell death effect in acute myeloid leukaemic cells U937 and Burkitt's lymphoma-derived Raji cells, by the Chou–Talalay method. In addition we explored the association of cytotoxic effect of drugs with changes in intracellular superoxide anion (O{submore » 2}{sup −}) levels. Our results showed that combined arsenite + MG132 produced low levels of O{sub 2}{sup −} at 6 h and 24 h after exposure and were synergic on cell death induction in U937 cells over the whole dose range, although the combination was antagonistic on growth inhibition effect. Exposure to a constant non-cytotoxic dose of 80 μM hydrogen peroxide together with arsenite + MG132 changed synergism on cell death to antagonism at all effect levels while increasing O{sub 2}{sup −} levels. Arsenite + hydrogen peroxide also resulted in antagonism with increased O{sub 2}{sup −} levels in U937 cells. In Raji cells, arsenite + MG132 also produced low levels of O{sub 2}{sup −} at 6 h and 24 h but resulted in antagonism on cell death and growth inhibition. By contrast, the combination arsenite + CAPE showed high levels of O{sub 2}{sup −} production at 6 h and 24 h post exposure but resulted in antagonism over cell death and growth inhibition effects in U937 and Raji cells. We conclude that synergism between arsenite and MG132 in U937 cells is negatively associated to O{sub 2}{sup −} levels at early time points after exposure. -- Highlights: ► Arsenic combined cytotoxic and anti-proliferative effects by Chou–Talalay method. ► Cytotoxic effect

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

PubMed

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

AN INTEGRATED PHARMACOKINETIC AND PHARMACODYNAMIC STUDY OF ARSENITE ACTION 2. HEME OXYGENASE INDUCTION IN MICE

EPA Science Inventory

Heme oxygenase (HO) is the rate-limiting enzyme in heme degradation and its activity has a significant impact on intracellular heme pools. Rat studies indicate that HO induction is a sensitive, dose-dependent response to arsenite (AsIII) exposure in both liver and kidney. The o...

NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

PubMed Central

Ushio-Fukai, Masuko; Malik, Asrar B.

2009-01-01

Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

PubMed

Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

2018-05-12

The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

PubMed Central

Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

2015-01-01

Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Treesearch

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

PubMed Central

Giacomelli, Lisa

2013-01-01

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

PubMed

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Modulatory role of Acacia honey from north-west Nigeria on sodium arsenite-induced clastogenicity and oxidative stress in male Wistar rats.

PubMed

Muhammad, Aliyu; Odunola, Oyeronke A; Gbadegesin, Michael A; Adegoke, Ayodeji M; Olugbami, J Olorunjuwon; Uche, Ndidi S

2015-01-01

Effect of Acacia honey from north-west Nigeria on sodium arsenite-induced oxidative damage and clastogenicity in male Wistar rats was investigated. Animals were divided into four groups and were treated daily via oral gavage for one week before they were sacrificed. Brain, liver and blood serum were collected for antioxidant and protein assays. Clastogenicity, in vitro antioxidant activity, vitamins and minerals were also evaluated. From the results, co-administration of Acacia honey with sodium arsenite on the animals increased (P < 0.05) glutathione peroxidase, superoxide dismutase and catalase activities with concomitant decrease in malondialdehyde levels and anti-clastogenic effects relative to the group treated with sodium arsenite only. The honey possesses reducing power, high hydrogen peroxide scavenging activity, good amount of vitamins (A, C and E), flavonoids (5.08 ± 0.92 mg QE/100 g) and phenolics (5.40 ± 0.69 mg GAE/100 g). The minerals present include zinc, iron, sodium, magnesium, potassium and calcium. In conclusion, Acacia honey from Nigeria may mitigate oxidative stress and clastogenicity.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

NADPH oxidase inhibitors: a patent review.

PubMed

Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

2011-08-01

NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

PubMed

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

2014-03-11

Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

[Relationship between the Fnu4HI site polymorphism of monoamine oxidase A gene and Parkinson's disease].

PubMed

Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao

2003-06-01

To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.

The Chromobacterium violaceum ArsR Arsenite Repressor Exerts Tighter Control on Its Cognate Promoter Than the Escherichia coli System

PubMed Central

Arruda, Letícia M.; Monteiro, Lummy M. O.; Silva-Rocha, Rafael

2016-01-01

Environmental bacteria are endowed with several regulatory systems that have potential applications in biotechnology. In this report, we characterize the arsenic biosensing features of the ars response system from Chromobacterium violaceum in the heterologous host Escherichia coli. We show that the native Pars/arsR system of C. violaceum outperforms the chromosomal ars copy of E. coli when exposed to micromolar concentrations of arsenite. To understand the molecular basis of this phenomenon, we analyzed the interaction between ArsR regulators and their promoter target sites as well as induction of the system at saturating concentrations of the regulators. In vivo titration experiments indicate that ArsR from C. violaceum has stronger binding affinity for its target promoter than the regulator from E. coli does. Additionally, arsenite induction experiments at saturating regulator concentration demonstrates that although the Pars/arsR system from E. coli displays a gradual response to increasing concentration of the inducer, the system from C. violaceum has a steeper response with a stronger promoter induction after a given arsenite threshold. Taken together, these data demonstrate the characterization of a novel arsenic response element from an environmental bacterium with potentially enhanced performance that could be further explored for the construction of an arsenic biosensor. PMID:27917165

The Chromobacterium violaceum ArsR Arsenite Repressor Exerts Tighter Control on Its Cognate Promoter Than the Escherichia coli System.

PubMed

Arruda, Letícia M; Monteiro, Lummy M O; Silva-Rocha, Rafael

2016-01-01

Environmental bacteria are endowed with several regulatory systems that have potential applications in biotechnology. In this report, we characterize the arsenic biosensing features of the ars response system from Chromobacterium violaceum in the heterologous host Escherichia coli . We show that the native Pars/arsR system of C. violaceum outperforms the chromosomal ars copy of E. coli when exposed to micromolar concentrations of arsenite. To understand the molecular basis of this phenomenon, we analyzed the interaction between ArsR regulators and their promoter target sites as well as induction of the system at saturating concentrations of the regulators. In vivo titration experiments indicate that ArsR from C. violaceum has stronger binding affinity for its target promoter than the regulator from E. coli does. Additionally, arsenite induction experiments at saturating regulator concentration demonstrates that although the Pars/arsR system from E. coli displays a gradual response to increasing concentration of the inducer, the system from C. violaceum has a steeper response with a stronger promoter induction after a given arsenite threshold. Taken together, these data demonstrate the characterization of a novel arsenic response element from an environmental bacterium with potentially enhanced performance that could be further explored for the construction of an arsenic biosensor.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

[Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

PubMed

Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

2011-01-01

The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

PubMed

Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

2001-05-01

Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

Examination of in vivo mutagenicity of sodium arsenite and dimethylarsinic acid in gpt delta rats.

PubMed

Fujioka, Masaki; Gi, Min; Kawachi, Satoko; Tatsumi, Kumiko; Ishii, Naomi; Doi, Kenichiro; Kakehashi, Anna; Wanibuchi, Hideki

2016-11-01

Arsenic is a well-known human bladder and liver carcinogen, but its exact mechanism of carcinogenicity is not fully understood. Dimethylarsinic acid (DMA V ) is a major urinary metabolite of sodium arsenite (iAs III ) and induces urinary bladder cancers in rats. DMA V and iAs III are negative in in vitro mutagenicity tests. However, their in vivo mutagenicities have not been determined. The purpose of present study is to evaluate the in vivo mutagenicities of DMA V and iAs III in rat urinary bladder epithelium and liver using gpt delta F344 rats. Ten-week old male gpt delta F344 rats were randomized into 3 groups and administered 0, 92mg/L DMA V , or 87mg/L iAs III (each 50mg/L As) for 13weeks in the drinking water. In the mutation assay, point mutations are detected in the gpt gene by 6-thioguanine selection (gpt assay) and deletion mutations are identified in the red/gam genes by Spi - selection (Spi - assay). Results of the gpt and Spi - assays showed that DMA V and iAs III had no effects on the mutant frequencies or mutation spectrum in urinary bladder epithelium or liver. These findings indicate that DMA V and iAs III are not mutagenic in urinary bladder epithelium or liver in rats. Copyright © 2016. Published by Elsevier B.V.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

Genetically Engineering Bacillus subtilis with a Heat-Resistant Arsenite Methyltransferase for Bioremediation of Arsenic-Contaminated Organic Waste

PubMed Central

Huang, Ke; Chen, Chuan; Shen, Qirong; Rosen, Barry P.

2015-01-01

Organic manures may contain high levels of arsenic (As) due to the use of As-containing growth-promoting substances in animal feed. To develop a bioremediation strategy to remove As from organic waste, Bacillus subtilis 168, a bacterial strain which can grow at high temperature but is unable to methylate and volatilize As, was genetically engineered to express the arsenite S-adenosylmethionine methyltransferase gene (CmarsM) from the thermophilic alga Cyanidioschyzon merolae. The genetically engineered B. subtilis 168 converted most of the inorganic As in the medium into dimethylarsenate and trimethylarsine oxide within 48 h and volatized substantial amounts of dimethylarsine and trimethylarsine. The rate of As methylation and volatilization increased with temperature from 37 to 50°C. When inoculated into an As-contaminated organic manure composted at 50°C, the modified strain significantly enhanced As volatilization. This study provides a proof of concept of using genetically engineered microorganisms for bioremediation of As-contaminated organic waste during composting. PMID:26187966

Metagenomic analysis revealed highly diverse microbial arsenic metabolism genes in paddy soils with low-arsenic contents.

PubMed

Xiao, Ke-Qing; Li, Li-Guan; Ma, Li-Ping; Zhang, Si-Yu; Bao, Peng; Zhang, Tong; Zhu, Yong-Guan

2016-04-01

Microbe-mediated arsenic (As) metabolism plays a critical role in global As cycle, and As metabolism involves different types of genes encoding proteins facilitating its biotransformation and transportation processes. Here, we used metagenomic analysis based on high-throughput sequencing and constructed As metabolism protein databases to analyze As metabolism genes in five paddy soils with low-As contents. The results showed that highly diverse As metabolism genes were present in these paddy soils, with varied abundances and distribution for different types and subtypes of these genes. Arsenate reduction genes (ars) dominated in all soil samples, and significant correlation existed between the abundance of arr (arsenate respiration), aio (arsenite oxidation), and arsM (arsenite methylation) genes, indicating the co-existence and close-relation of different As resistance systems of microbes in wetland environments similar to these paddy soils after long-term evolution. Among all soil parameters, pH was an important factor controlling the distribution of As metabolism gene in five paddy soils (p = 0.018). To the best of our knowledge, this is the first study using high-throughput sequencing and metagenomics approach in characterizing As metabolism genes in the five paddy soil, showing their great potential in As biotransformation, and therefore in mitigating arsenic risk to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

Norrie disease gene is distinct from the monoamine oxidase genes.

PubMed

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Selenite modulates the level of phenolics and nutrient element to alleviate the toxicity of arsenite in rice (Oryza sativa L.).

PubMed

Chauhan, Reshu; Awasthi, Surabhi; Tripathi, Preeti; Mishra, Seema; Dwivedi, Sanjay; Niranjan, Abhishek; Mallick, Shekhar; Tripathi, Pratibha; Pande, Veena; Tripathi, Rudra Deo

2017-04-01

Arsenic (As) contamination of paddy rice is a serious threat all over the world particularly in South East Asia. Selenium (Se) plays important role in protection of plants against various abiotic stresses including heavy metals. Moreover, arsenite (AsIII) and selenite (SeIV) can be biologically antagonistic due to similar electronic configuration and sharing the common transporter for their uptake in plant. In the present study, the response of oxidative stress, phenolic compounds and nutrient elements was analyzed to investigate Se mediated As tolerance in rice seedlings during AsIII and SeIV exposure in hydroponics. Selenite (25µM) significantly decreased As accumulation in plant than As (25µM) alone treated plants. Level of oxidative stress related parameters viz., reactive oxygen species (ROS), lipid peroxidation, electrical conductivity, nitric oxide and pro-oxidant enzyme (NADPH oxidase), were in the order of As>As+Se>control>Se. Selenium ameliorated As phytotoxicity by increased level of phenolic compounds particularly gallic acid, protocatechuic acid, ferulic acid and rutin and thiol metabolism related enzymes viz., serine acetyl transferase (SAT) and cysteine synthase (CS). Selenium supplementation enhanced the uptake of nutrient elements viz., Fe, Mn, Co, Cu, Zn, Mo, and improved plant growth. The results concluded that Se addition in As contaminated environment might be an important strategy to reduce As uptake and associated phytotoxicity in rice plant by modulation of phenolic compounds and increased uptake of nutrient elements. Copyright © 2016 Elsevier Inc. All rights reserved.

Targeting NADPH oxidases in vascular pharmacology

PubMed Central

Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

Norrie disease gene is distinct from the monoamine oxidase genes

PubMed Central

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

SORPTION OF ARSENATE AND ARSENITE ON RUO2.XH2O: A SPECTROSCOPIC AND MACROSCOPIC STUDY

EPA Science Inventory

The sorption of arsenate (As(V)) and arsenite (As(III)) on RuO2 xH2O was examined using macroscopic and microscopic techniques. Constant solid:solution ratio isotherms were constructed from batch sorption experiments to study the sorption of the inorganic arsenic species on RuO2...

Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

PubMed

Poyau, A; Buchet, K; Godinot, C

1999-12-03

The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

PubMed Central

2014-01-01

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

THE EFFECTS OF HEAT SHOCK PROTEIN 70 (HSP70) AND EXPOSURE PROTOCOL ON ARSENITE INDUCED GENOTOXICITY

EPA Science Inventory

The Effects of Heat Shock Protein 70 (Hsp70) and Exposure Protocol on Arsenite Induced Genotoxicity

Barnes, J.A.1,2, Collins, B.W.2, Dix, D.J.3 and Allen J.W2.
1National Research Council, 2Environmental Carcinogenesis Division, 3Reproductive Toxicology Division, Office...

Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

PubMed Central

Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

2012-01-01

Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

PubMed

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

NADPH Oxidases in Vascular Pathology

PubMed Central

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

PubMed

Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

2017-02-01

Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of

Ectopic expression of pumpkin gibberellin oxidases alters gibberellin biosynthesis and development of transgenic Arabidopsis plants.

PubMed

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-02-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.

Arsenate and Arsenite Sorption on Magnetite: Relations to Groundwater Arsenic Treatment Using Zerovalent Iron and Natural Attenuation

EPA Science Inventory

Magnetite (Fe3O4) is a zerovalent iron corrosion product; it is also formed in natural soil and sediment. Sorption of arsenate (As(V)) and arsenite (As(III)) on magnetite is an important process of arsenic removal from groundwater using zerovalent iron-based permeable reactive ba...

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

PubMed

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase gene expression in bees from two populations.

PubMed

Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto

2018-04-01

Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

PubMed

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus

PubMed Central

Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric

2016-01-01

ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

PubMed

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

PubMed

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection

PubMed Central

Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin

2017-01-01

The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

PubMed

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

Identification of arsenic resistant endophytic bacteria from Pteris vittata roots and characterization for arsenic remediation application.

PubMed

Tiwari, Sarita; Sarangi, Bijaya Ketan; Thul, Sanjog T

2016-09-15

Mitigation of arsenic (As) pollution is a topical environmental issue of high R&D priority. The present investigation was carried out to isolate As resistant endophytes from the roots of Indian ecotype Pteris vittata and characterize their As transformation and tolerance ability, plant growth promoting characteristics and their role to facilitate As uptake by the plant. A total of 8 root endophytes were isolated from plants grown in As amended soil (25 mg As kg(-1)). These isolates were studied for minimum inhibitory concentration (MIC), arsenite As(III) - arsenate As(V) transformation ability, plant growth promoting (PGP) characteristics through siderophore, indole acetic acid (IAA) production, phosphatase, ACC deaminase activity, and presence of arsenite oxidase (aox) and arsenite transporter (arsB) genes. On the basis of 16S rDNA sequence analysis, these isolates belong to Proteobacteria, Firmicutes and Bacteroidetes families under the genera Bacillus, Enterobacter, Stenotrophomonas and Rhizobium. All isolates were found As tolerant, of which one isolates showed highest tolerance up to 1000 mg L(-1) concentration in SLP medium. Five isolates were IAA positive with highest IAA production up to 60 mg/L and two isolates exhibited siderophore activity. Phosphatase activity was shown by only one isolate while ACC deaminase activity was absent in all the isolates. The As transformation study by silver nitrate test showed that only two strains had dual characteristics of As(III) oxidation and As (V) reduction, four strains exhibited either of the characteristics while other two didn't confirmed any of the two characteristics. Presence of aox gene was detected in two strains and arsB gene in six isolates. The strain with highest As tolerance also showed highest IAA production and occurrence of arsB gene. Present investigation may open up further scope of utilizing these endophytes for up gradation of phytoextraction process. Copyright © 2016 Elsevier Ltd. All

Protective effect of Corchorus olitorius leaves on sodium arsenite-induced toxicity in experimental rats.

PubMed

Das, Anup K; Bag, Sujit; Sahu, Ranabir; Dua, Tarun K; Sinha, Mohit K; Gangopadhyay, Moumita; Zaman, Kamaruz; Dewanjee, Saikat

2010-01-01

The present study was undertaken to evaluate the protective effect of aqueous extract of Corchorus olitorius leaves (AECO) against sodium arsenite-induced toxicity in experimental rats. The animals exposed to sodium arsenite at a dose of 10mg/kg body weight p.o. for 10days exhibited a significant inhibition (p<0.01) of hepatic and renal antioxidant enzymes namely superoxide dismutase, catalase, glutathione-S-transferase, glutathione peroxidase and glutathione reductase. In addition, arsenic intoxication significantly decreased (p<0.01) the level of reduced glutathione and increased (p<0.01) the levels of oxidized glutathione and thiobarbituric acid reactive substances in selected tissues. Treatment with AECO at doses of 50 and 100mg/kg body weight p.o. for 15days prior to arsenic intoxication significantly improved hepatic and renal antioxidant markers in a dose dependant manner. AECO treatment also significantly reduced the arsenic-induced DNA fragmentation of hepatic and renal tissues. Histological studies on the ultrastructural changes of liver and kidney supported the protective activity of the AECO. The results concluded that the treatment with AECO prior to arsenic intoxication has significant role in protecting animals from arsenic-induced hepatic and renal toxicity. Copyright 2009 Elsevier Ltd. All rights reserved.

SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

PubMed Central

Hirsch, James G.

1953-01-01

Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805

Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

USDA-ARS?s Scientific Manuscript database

In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans

PubMed Central

Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

2013-01-01

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

PubMed

Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

2015-01-01

Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other

Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

PubMed

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

2007-06-01

In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

PubMed Central

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

2013-01-01

Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

Oxidation and detoxification of trivalent arsenic species.

PubMed

Aposhian, H Vasken; Zakharyan, Robert A; Avram, Mihaela D; Kopplin, Michael J; Wollenberg, Michael L

2003-11-15

Arsenic compounds with a +3 oxidation state are more toxic than analogous compounds with a +5 oxidation state, for example, arsenite versus arsenate, monomethylarsonous acid (MMA(III)) versus monomethylarsonic acid (MMA(V)), and dimethylarsinous acid (DMA(III)) versus dimethylarsinic acid (DMA(V)). It is no longer believed that the methylation of arsenite is the beginning of a methylation-mediated detoxication pathway. The oxidation of these +3 compounds to their less toxic +5 analogs by hydrogen peroxide needs investigation and consideration as a potential mechanism for detoxification. Xanthine oxidase uses oxygen to oxidize hypoxanthine to xanthine to uric acid. Hydrogen peroxide and reactive oxygen are also products. The oxidation of +3 arsenicals by the hydrogen peroxide produced in the xanthine oxidase reaction was blocked by catalase or allopurinol but not by scavengers of the hydroxy radical, e.g., mannitol or potassium iodide. Melatonin, the singlet oxygen radical scavenger, did not inhibit the oxidation. The production of H2O2 by xanthine oxidase may be an important route for decreasing the toxicity of trivalent arsenic species by oxidizing them to their less toxic pentavalent analogs. In addition, there are many other reactions that produce hydrogen peroxide in the cell. Although chemists have used hydrogen peroxide for the oxidation of arsenite to arsenate to purify water, we are not aware of any published account of its potential importance in the detoxification of trivalent arsenicals in biological systems. At present, this oxidation of the +3 oxidation state arsenicals is based on evidence from in vitro experiments. In vivo experiments are needed to substantiate the role and importance of H2O2 in arsenic detoxication in mammals.

Arsenite and its metabolites, MMA(III) and DMA(III), modify CYP3A4, PXR and RXR alpha expression in the small intestine of CYP3A4 transgenic mice.

PubMed

Medina-Díaz, I M; Estrada-Muñiz, E; Reyes-Hernández, O D; Ramírez, P; Vega, L; Elizondo, G

2009-09-01

Arsenic is an environmental pollutant that has been associated with an increased risk for the development of cancer and several other diseases through alterations of cellular homeostasis and hepatic function. Cytochrome P450 (P450) modification may be one of the factors contributing to these disorders. Several reports have established that exposure to arsenite modifies P450 expression by decreasing or increasing mRNA and protein levels. Cytochrome P450 3A4 (CYP3A4), the predominant P450 expressed in the human liver and intestines, which is regulated mainly by the Pregnane X Receptor-Retinoid X Receptor alpha (PXR-RXR alpha) heterodimer, contributes to the metabolism of approximately half the drugs in clinical use today. The present study investigates the effect of sodium arsenite and its metabolites monomethylarsonous acid (MMA(III)) and dimethylarsinous acid (DMA(III)) on CYP3A4, PXR, and RXR alpha expression in the small intestine of CYP3A4 transgenic mice. Sodium arsenite treatment increases mRNA, protein and CYP3A4 activity in a dose-dependent manner. However, the increase in protein expression was not as marked as compared to the increase in mRNA levels. Arsenite treatment induces the accumulation of Ub-protein conjugates, indicating that the activation of this mechanism may explain the differences observed between the mRNA and protein expression of CYP3A4 induction. Treatment with 0.05 mg/kg of DMA(III) induces CYP3A4 in a similar way, while treatment with 0.05 mg/kg of MMA(III) increases mostly mRNA, and to a lesser degree, CYP3A4 activity. Sodium arsenite and both its metabolites increase PXR mRNA, while only DMA(III) induces RXR alpha expression. Overall, these results suggest that sodium arsenite and its metabolites induce CYP3A4 expression by increasing PXR expression in the small intestine of CYP3A4 transgenic mice.

Predicting the capability of carboxymethyl cellulose-stabilized iron nanoparticles for the remediation of arsenite from water using the response surface methodology (RSM) model: Modeling and optimization

NASA Astrophysics Data System (ADS)

Mohammadi, Amir; Nemati, Sepideh; Mosaferi, Mohammad; Abdollahnejhad, Ali; Almasian, Mohammad; Sheikhmohammadi, Amir

2017-08-01

This study aimed to investigate the feasibility of carboxymethyl cellulose-stabilized iron nanoparticles (C-nZVI) for the removal of arsenite ions from aqueous solutions. Iron nanoparticles and carboxymethyl cellulose-stabilized iron nanoparticles were freshly synthesized. The synthesized nanomaterials had a size of 10 nm approximately. The transmission electron microscope (TEM) images depicted bulkier dendrite flocs of non-stabilized iron nanoparticles. It described nanoscale particles as not discrete resulting from the aggregation of particles. The scanning electron microscopy (SEM) image showed that C-nZVI is approximately discrete, well-dispersed and an almost spherical shape. The energy dispersive x-ray spectroscopy (EDAX) and X-ray diffraction (XRD) spectrum confirmed the presence of Fe0 in the C-nZVI composite. The central composite design under the Response Surface Methodology (RSM) was employed in order to investigate the effect of independent variables on arsenite removal and to determine the optimum condition. The reduced full second-order model indicated a well-fitted model since the experimental values were in good agreement with it. Therefore, this model is used for the prediction and optimization of arsenite removal from water. The maximum removal efficiency was estimated to be 100% when all parameters are considered simultaneously. The predicted optimal conditions for the maximum removal efficiency were achieved with initial arsenite concentration, 0.68 mg L- 1; C-nZVI, 0.3 (g L- 1); time, 31.25 (min) and pH, 5.2.

Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer

DTIC Science & Technology

2013-10-01

Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal

Towards intrinsic MoS{sub 2} devices for high performance arsenite sensing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Peng, E-mail: pengli@mail.tsinghua.edu.cn, E-mail: dzzhang@upc.edu.cn; Zhang, Dongzhi, E-mail: pengli@mail.tsinghua.edu.cn, E-mail: dzzhang@upc.edu.cn; Sun, Yan'e

2016-08-08

Molybdenum disulphide (MoS{sub 2}) is one of the most attractive two dimensional materials other than graphene, and the exceptional properties make it a promising candidate for bio/chemical sensing. Nevertheless, intrinsic properties and sensing performances of MoS{sub 2} are easily masked by the presence of the Schottky barrier (SB) at source/drain electrodes, and its impact on MoS{sub 2} sensors remains unclear. Here, we systematically investigated the influence of the SB on MoS{sub 2} sensors, revealing the sensing mechanism of intrinsic MoS{sub 2}. By utilizing a small work function metal, Ti, to reduce the SB, excellent electrical properties of this 2D materialmore » were yielded with 2–3 times enhanced sensitivity. We experimentally demonstrated that the sensitivity of MoS{sub 2} is superior to that of graphene. Intrinsic MoS{sub 2} was able to realize rapid detection of arsenite down to 0.1 ppb without the influence of large SB, which is two-fold lower than the World Health Organization (WHO) tolerance level and better than the detection limit of recently reported arsenite sensors. Additionally, accurately discriminating target molecules is a great challenge for sensors based on 2D materials. This work demonstrates MoS{sub 2} sensors encapsulated with ionophore film which only allows certain types of molecules to selectively permeate through it. As a result, multiplex ion detection with superb selectivity was realized. Our results show prominent advantages of intrinsic MoS{sub 2} as a sensing material.« less

Effects of losartan on hepatic expression of nonphagocytic NADPH oxidase and fibrogenic genes in patients with chronic hepatitis C.

PubMed

Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere

2009-10-01

Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

PubMed

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Congenital hypothyroidism, dwarfism, and hearing impairment caused by a missense mutation in the mouse dual oxidase 2 gene, Duox2.

PubMed

Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae

2007-07-01

Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.

New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

PubMed Central

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-01-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

EFFECT OF EXPOSURE PROTOCOL AND HEAT SHOCK PROTEIN EXPRESSION ON ARSENITE INDUCED GENOTOXICITY IN MCF-7 BREAST CANCER CELLS

EPA Science Inventory

Effect of exposure protocol and heat shock protein expression on arsenite induced genotoxicity in MCF-7 breast cancer cells

The genotoxic effects of arsenic (As) are well accepted, yet its mechanism of action is not clearly defined. Heat-shock proteins (HSPs) protect...

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

Characterization of arsenic resistant bacteria from arsenic rich groundwater of West Bengal, India.

PubMed

Sarkar, Angana; Kazy, Sufia K; Sar, Pinaki

2013-03-01

Sixty-four arsenic (As) resistant bacteria isolated from an arsenic rich groundwater sample of West Bengal were characterized to investigate their potential role in subsurface arsenic mobilization. Among the isolated strains predominance of genera Agrobacterium/Rhizobium, Ochrobactrum and Achromobacter which could grow chemolitrophically and utilize arsenic as electron donor were detected. Higher tolerance to As(3+) [maximum tolerable concentration (MTC): ≥10 mM], As(5+) (MTC: ≥100 mM) and other heavy metals like Cu(2+), Cr(2+), Ni(2+) etc. (MTC: ≥10 mM), presence of arsenate reductase and siderophore was frequently observed among the isolates. Ability to produce arsenite oxidase and phosphatase enzyme was detected in 50 and 34 % of the isolates, respectively. Although no direct correlation among taxonomic identity of bacterial strains and their metabolic abilities as mentioned above was apparent, several isolates affiliated to genera Ochrobactrum, Achromobacter and unclassified Rhizobiaceae members were found to be highly resistant to As(3+) and As(5+) and positive for all the test properties. Arsenate reductase activity was found to be conferred by arsC gene, which in many strains was coupled with arsenite efflux gene arsB as well. Phylogenetic incongruence between the 16S rRNA and ars genes lineages indicated possible incidence of horizontal gene transfer for ars genes. Based on the results we propose that under the prevailing low nutrient condition inhabitant bacteria capable of using inorganic electron donors play a synergistic role wherein siderophores and phosphatase activities facilitate the release of sediment bound As(5+), which is subsequently reduced by arsenate reductase resulting into the mobilization of As(3+) in groundwater.

Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†

PubMed Central

Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie

1999-01-01

Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149

Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

PubMed Central

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-01-01

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

NASA Technical Reports Server (NTRS)

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Treesearch

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

PubMed Central

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Arsenite and its metabolites, MMA{sup III} and DMA{sup III}, modify CYP3A4, PXR and RXR alpha expression in the small intestine of CYP3A4 transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Medina-Diaz, I.M.; Estrada-Muniz, E.; Reyes-Hernandez, O.D.

Arsenic is an environmental pollutant that has been associated with an increased risk for the development of cancer and several other diseases through alterations of cellular homeostasis and hepatic function. Cytochrome P450 (P450) modification may be one of the factors contributing to these disorders. Several reports have established that exposure to arsenite modifies P450 expression by decreasing or increasing mRNA and protein levels. Cytochrome P450 3A4 (CYP3A4), the predominant P450 expressed in the human liver and intestines, which is regulated mainly by the Pregnane X Receptor-Retinoid X Receptor alpha (PXR-RXR alpha) heterodimer, contributes to the metabolism of approximately half themore » drugs in clinical use today. The present study investigates the effect of sodium arsenite and its metabolites monomethylarsonous acid (MMA{sup III}) and dimethylarsinous acid (DMA{sup III}) on CYP3A4, PXR, and RXR alpha expression in the small intestine of CYP3A4 transgenic mice. Sodium arsenite treatment increases mRNA, protein and CYP3A4 activity in a dose-dependent manner. However, the increase in protein expression was not as marked as compared to the increase in mRNA levels. Arsenite treatment induces the accumulation of Ub-protein conjugates, indicating that the activation of this mechanism may explain the differences observed between the mRNA and protein expression of CYP3A4 induction. Treatment with 0.05 mg/kg of DMA{sup III} induces CYP3A4 in a similar way, while treatment with 0.05 mg/kg of MMA{sup III} increases mostly mRNA, and to a lesser degree, CYP3A4 activity. Sodium arsenite and both its metabolites increase PXR mRNA, while only DMA{sup III} induces RXR alpha expression. Overall, these results suggest that sodium arsenite and its metabolites induce CYP3A4 expression by increasing PXR expression in the small intestine of CYP3A4 transgenic mice.« less

Application of adenosine triphosphate affinity probe and scheduled multiple-reaction monitoring analysis for profiling global kinome in human cells in response to arsenite treatment.

PubMed

Guo, Lei; Xiao, Yongsheng; Wang, Yinsheng

2014-11-04

Phosphorylation of cellular components catalyzed by kinases plays important roles in cell signaling and proliferation. Quantitative assessment of perturbation in global kinome may provide crucial knowledge for elucidating the mechanisms underlying the cytotoxic effects of environmental toxicants. Here, we utilized an adenosine triphosphate (ATP) affinity probe coupled with stable isotope labeling by amino acids in cell culture (SILAC) to assess quantitatively the arsenite-induced alteration of global kinome in human cells. We constructed a SILAC-compatible kinome library for scheduled multiple-reaction monitoring (MRM) analysis and adopted on-the-fly recalibration of retention time shift, which provided better throughput of the analytical method and enabled the simultaneous quantification of the expression of ∼300 kinases in two LC-MRM runs. With this improved analytical method, we conducted an in-depth quantitative analysis of the perturbation of kinome of GM00637 human skin fibroblast cells induced by arsenite exposure. Several kinases involved in cell cycle progression, including cyclin-dependent kinases (CDK1 and CDK4) and Aurora kinases A, B, and C, were found to be hyperactivated, and the altered expression of CDK1 was further validated by Western analysis. In addition, treatment with a CDK inhibitor, flavopiridol, partially restored the arsenite-induced growth inhibition of human skin fibroblast cells. Thus, sodium arsenite may confer its cytotoxic effect partly through the aberrant activation of CDKs and the resultant perturbation of cell cycle progression. Together, we developed a high-throughput, SILAC-compatible, and MRM-based kinome profiling method and demonstrated that the method is powerful in deciphering the molecular modes of action of a widespread environmental toxicant. The method should be generally applicable for uncovering the cellular pathways triggered by other extracellular stimuli.

Application of Adenosine Triphosphate Affinity Probe and Scheduled Multiple-Reaction Monitoring Analysis for Profiling Global Kinome in Human Cells in Response to Arsenite Treatment

PubMed Central

2015-01-01

Phosphorylation of cellular components catalyzed by kinases plays important roles in cell signaling and proliferation. Quantitative assessment of perturbation in global kinome may provide crucial knowledge for elucidating the mechanisms underlying the cytotoxic effects of environmental toxicants. Here, we utilized an adenosine triphosphate (ATP) affinity probe coupled with stable isotope labeling by amino acids in cell culture (SILAC) to assess quantitatively the arsenite-induced alteration of global kinome in human cells. We constructed a SILAC-compatible kinome library for scheduled multiple-reaction monitoring (MRM) analysis and adopted on-the-fly recalibration of retention time shift, which provided better throughput of the analytical method and enabled the simultaneous quantification of the expression of ∼300 kinases in two LC-MRM runs. With this improved analytical method, we conducted an in-depth quantitative analysis of the perturbation of kinome of GM00637 human skin fibroblast cells induced by arsenite exposure. Several kinases involved in cell cycle progression, including cyclin-dependent kinases (CDK1 and CDK4) and Aurora kinases A, B, and C, were found to be hyperactivated, and the altered expression of CDK1 was further validated by Western analysis. In addition, treatment with a CDK inhibitor, flavopiridol, partially restored the arsenite-induced growth inhibition of human skin fibroblast cells. Thus, sodium arsenite may confer its cytotoxic effect partly through the aberrant activation of CDKs and the resultant perturbation of cell cycle progression. Together, we developed a high-throughput, SILAC-compatible, and MRM-based kinome profiling method and demonstrated that the method is powerful in deciphering the molecular modes of action of a widespread environmental toxicant. The method should be generally applicable for uncovering the cellular pathways triggered by other extracellular stimuli. PMID:25301106

Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*

PubMed Central

Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

2014-01-01

Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

Arsenite induces apoptosis in human mesenchymal stem cells by altering Bcl-2 family proteins and by activating intrinsic pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yadav, Santosh; Shi Yongli; Wang Feng

2010-05-01

Purpose: Environmental exposure to arsenic is an important public health issue. The effects of arsenic on different tissues and organs have been intensively studied. However, the effects of arsenic on bone marrow mesenchymal stem cells (MSCs) have not been reported. This study is designed to investigate the cell death process caused by arsenite and its related underlying mechanisms on MSCs. The rationale is that absorbed arsenic in the blood circulation can reach to the bone marrow and may affect the cell survival of MSCs. Methods: MSCs of passage 1 were purchased from Tulane University, grown till 70% confluency level andmore » plated according to the experimental requirements followed by treatment with arsenite at various concentrations and time points. Arsenite (iAs{sup III}) induced cytotoxic effects were confirmed by cell viability and cell cycle analysis. For the presence of canonic apoptosis markers; DNA damage, exposure of intramembrane phosphotidylserine, protein and m-RNA expression levels were analyzed. Results: iAs{sup III} induced growth inhibition, G2-M arrest and apoptotic cell death in MSCs, the apoptosis induced by iAs{sup III} in the cultured MSCs was, via altering Bcl-2 family proteins and by involving intrinsic pathway. Conclusion: iAs{sup III} can induce apoptosis in bone marrow-derived MSCs via Bcl-2 family proteins, regulating intrinsic apoptotic pathway. Due to the multipotency of MSC, acting as progenitor cells for a variety of connective tissues including bone, adipose, cartilage and muscle, these effects of arsenic may be important in assessing the health risk of the arsenic compounds and understanding the mechanisms of arsenic-induced harmful effects.« less

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

NASA Astrophysics Data System (ADS)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.

PubMed

Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T

2001-06-29

Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

PubMed

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

The Chromosomal Arsenic Resistance Genes of Thiobacillus ferrooxidans Have an Unusual Arrangement and Confer Increased Arsenic and Antimony Resistance to Escherichia coli

PubMed Central

Butcher, Bronwyn G.; Deane, Shelly M.; Rawlings, Douglas E.

2000-01-01

The chromosomal arsenic resistance genes of the acidophilic, chemolithoautotrophic, biomining bacterium Thiobacillus ferrooxidans were cloned and sequenced. Homologues of four arsenic resistance genes, arsB, arsC, arsH, and a putative arsR gene, were identified. The T. ferrooxidans arsB (arsenite export) and arsC (arsenate reductase) gene products were functional when they were cloned in an Escherichia coli ars deletion mutant and conferred increased resistance to arsenite, arsenate, and antimony. Therefore, despite the fact that the ars genes originated from an obligately acidophilic bacterium, they were functional in E. coli. Although T. ferrooxidans is gram negative, its ArsC was more closely related to the ArsC molecules of gram-positive bacteria. Furthermore, a functional trxA (thioredoxin) gene was required for ArsC-mediated arsenate resistance in E. coli; this finding confirmed the gram-positive ArsC-like status of this resistance and indicated that the division of ArsC molecules based on Gram staining results is artificial. Although arsH was expressed in an E. coli-derived in vitro transcription-translation system, ArsH was not required for and did not enhance arsenic resistance in E. coli. The T. ferrooxidans ars genes were arranged in an unusual manner, and the putative arsR and arsC genes and the arsBH genes were translated in opposite directions. This divergent orientation was conserved in the four T. ferrooxidans strains investigated. PMID:10788346

RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.

PubMed

Maldonado-Mendoza, Ignacio E; Harrison, Maria J

Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.

Sodium Meta-Arsenite Ameliorates Hyperglycemia in Obese Diabetic db/db Mice by Inhibition of Hepatic Gluconeogenesis

PubMed Central

Lee, Eun-Kyu; Oh, Hyun-Hee; Choi, Cheol Soo; Kim, Sujong; Jun, Hee-Sook

2014-01-01

Sodium meta-arsenite (SA) is implicated in the regulation of hepatic gluconeogenesis-related genes in vitro; however, the effects in vivo have not been studied. We investigated whether SA has antidiabetic effects in a type 2 diabetic mouse model. Diabetic db/db mice were orally intubated with SA (10 mg kg−1 body weight/day) for 8 weeks. We examined hemoglobin A1c (HbA1c), blood glucose levels, food intake, and body weight. We performed glucose, insulin, and pyruvate tolerance tests and analyzed glucose production and the expression of gluconeogenesis-related genes in hepatocytes. We analyzed energy metabolism using a comprehensive animal metabolic monitoring system. SA-treated diabetic db/db mice had reduced concentrations of HbA1c and blood glucose levels. Exogenous glucose was quickly cleared in glucose tolerance tests. The mRNA expressions of genes for gluconeogenesis-related enzymes, glucose 6-phosphatase (G6Pase), and phosphoenolpyruvate carboxykinase (PEPCK) were significantly reduced in the liver of SA-treated diabetic db/db mice. In primary hepatocytes, SA treatment decreased glucose production and the expression of G6Pase, PEPCK, and hepatocyte nuclear factor 4 alpha (HNF-4α) mRNA. Small heterodimer partner (SHP) mRNA expression was increased in hepatocytes dependent upon the SA concentration. The expression of Sirt1 mRNA and protein was reduced, and acetylated forkhead box protein O1 (FoxO1) was induced by SA treatment in hepatocytes. In addition, SA-treated diabetic db/db mice showed reduced energy expenditure. Oral intubation of SA ameliorates hyperglycemia in db/db mice by reducing hepatic gluconeogenesis through the decrease of Sirt1 expression and increase in acetylated FoxO1. PMID:25610880

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

PubMed

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

Identification of seven polyamine oxidase genes in tomato (Solanum lycopersicum L.) and their expression profiles under physiological and various stress conditions.

PubMed

Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo

2018-05-15

Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.

Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay

PubMed Central

He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry

2011-01-01

Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

PubMed

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

IMBALANCE OF DNA METHYLATION, BOTH HYPERMETHYLATION AND HYPOMETHYLATION, OCCUR AFTER EXPOSURE OF HUMAN CELLS TO NANOMOLAR CONCENTRATIONS OF ARSENITE IN CULTURE.

EPA Science Inventory

Imbalance of DNA methylation, BOTH hypermethylation and hypomethylation, occur after exposure of human cells to nanomolar concentrations of arsenite in culture.

We and others have hypothesized that a mechanism of arsenic carcinogenesis could involve alteration of DNA methy...

The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans

PubMed Central

Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

2014-01-01

Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.

PubMed

Lee, J; Hofhaus, G; Lisowsky, T

2000-07-14

The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.

Thiol reduction of arsenite and selenite: DFT modeling of the pathways to an as-se bond.

PubMed

Harper, Lenora K; Antony, Sonia; Bayse, Craig A

2014-12-15

The reactivity of arsenite and selenite with biological thiols plays an important role in the toxicity of these elements. However, toxic effects are eliminated when the species are coadministered, due to the antagonistic relationship between selenium and arsenic. The reduction of arsenous acid and selenious acid by thiol and the formation of an As-Se species have been modeled using density functional theory (DFT) and solvent-assisted proton exchange (SAPE), a microsolvation technique that uses a network of water molecules to mimic the participation of bulk solvent in proton transfer processes. Activation barriers and relative energies were calculated for the stepwise thiol reduction of arsenite to form As(SR)3 and selenious acid to first form a selenotrisulfide (Se(SR)2) and then H2Se. Several pathways were explored for the formation of an As-Se bond: the nucleophilic attack of selenide or selenopersulfide on As(OH)3, (RS)As(OH)2, and (RS)2AsOH to form (RS)2AsSeH. On the basis of the lower activation barrier and bioavailability of (RS)2AsOH, the reaction of H2Se with (RS)2AsOH is deemed the most favorable, consistent with previous experimental studies.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

PubMed

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants

PubMed Central

Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

1980-01-01

Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

PubMed Central

Lermontova, Inna; Grimm, Bernhard

2000-01-01

The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

PubMed

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

Deficiency of Rac1 Blocks NADPH Oxidase Activation, Inhibits Endoplasmic Reticulum Stress, and Reduces Myocardial Remodeling in a Mouse Model of Type 1 Diabetes

PubMed Central

Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing

2010-01-01

OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592

Arsenite removal from aqueous solutions by γ-Fe2O3-TiO2 magnetic nanoparticles through simultaneous photocatalytic oxidation and adsorption.

PubMed

Yu, Lian; Peng, Xianjia; Ni, Fan; Li, Jin; Wang, Dongsheng; Luan, Zhaokun

2013-02-15

A novel Fe-Ti binary oxide magnetic nanoparticles which combined the photocatalytic oxidation property of TiO(2) and the high adsorption capacity and magnetic property of γ-Fe(2)O(3) have been synthesized using a coprecipitation and simultaneous oxidation method. The as-prepared samples were characterized by powder XRD, TEM, TG-DTA, VSM and BET methods. Photocatalytic oxidation of arsenite, the effect of solution pH values and initial As(III) concentration on arsenite removal were investigated in laboratory experiments. Batch experimental results showed that under UV light, As(III) can be efficiently oxidized to As(V) by dissolved O(2) in γ-Fe(2)O(3)-TiO(2) nanoparticle suspensions at various pH values. At the same time, As(V) was effectively removed by adsorption onto the surface of nanoparticles. The maximum removal capability of the nano-material for arsenite was 33.03 mg/g at pH 7.0. Among all the common coexisting ions investigated, phosphate was the greatest competitor with arsenic for adsorptive sites on the nano-material. Regeneration studies verified that the γ-Fe(2)O(3)-TiO(2) nanoparticles, which underwent five successive adsorption-desorption processes, still retained comparable catalysis and adsorption performance, indicating the excellent stability of the nanoparticles. The excellent photocatalytic oxidation performance and high uptake capability of the magnetic nano-material make it potentially attractive material for the removal of As(III) from water. Copyright © 2012 Elsevier B.V. All rights reserved.

Polymorphisms in the canine monoamine oxidase a (MAOA) gene: identification and variation among five broad dog breed groups.

PubMed

Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael

2017-01-01

In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.

Xenophilus arseniciresistens sp. nov., an arsenite-resistant bacterium isolated from soil.

PubMed

Li, Qin-Fen; Sun, Li-Na; Kwon, Soon-Wo; Chen, Qing; He, Jian; Li, Shun-Peng; Zhang, Jun

2014-06-01

A Gram-reaction-negative, aerobic, motile, rod-shaped, arsenite [As(III)]-resistant bacterium, designated strain YW8(T), was isolated from agricultural soil. 16S rRNA gene sequence analysis showed over 97% sequence similarity to strains of the environmental species Xenophilus azovorans, Xenophilus aerolatus, Simplicispira metamorpha, Variovorax soli, and Xylophilus ampelinus. However, the phylogenetic tree indicated that strain YW8(T) formed a separate clade from Xenophilus azovorans. DNA-DNA hybridization experiments showed that the DNA-DNA relatedness values between strain YW8(T) and its closest phylogenetic neighbours were below 24.2-35.5%, which clearly separated the strain from these closely related species. The major cellular fatty acids of strain YW8(T) were C(16 : 0), C(17 : 0) cyclo, C(18 : 1)ω7c, and summed feature 3(C(16 : 1)ω6c and/or C(16 : 1)ω7c). The genomic DNA G+C content was 69.3 mol%, and the major respiratory quinone was ubiquinone-8. The predominant polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, three unknown phospholipids, an unknown polar lipid and phosphatidylserine. The major polyamines were 2-hydroxyputrescine and putrescine. On the basis of morphological, physiological and biochemical characteristics, phylogenetic position, DNA-DNA hybridization and chemotaxonomic data, strain YW8(T) is considered to represent a novel species of the genus Xenophilus, for which the name Xenophilus arseniciresistens sp. nov. is proposed; the type strain is YW8(T) ( = CCTCC AB2012103(T) = KACC 16853(T)). © 2014 IUMS.

A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

PubMed Central

Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

2013-01-01

Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID

Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.

PubMed Central

Okamura, H; Murooka, Y; Harada, T

1976-01-01

Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974

Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells

PubMed Central

Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.

2017-01-01

Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230

Possible mechanisms for arsenic-induced proliferative diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetterhahn, K.E.; Dudek, E.J.; Shumilla, J.A.

1996-12-31

Possible mechanisms for cardiovascular diseases and cancers which have been observed on chronic exposure to arsenic have been investigated. We tested the hypothesis that nonlethal levels of arsenic are mitogenic, cause oxidative stress, increase nuclear translocation of trans-acting factors, and increase expression of genes involved in proliferation. Cultured porcine vascular (from aorta) endothelial cells were used as a model cell system to study the effects of arsenic on the target cells for cardiovascular diseases. Treatment of postconfluent cell cultures with nonovertly toxic concentrations of arsenite increased DNA synthesis, similar to the mitogenic response observed with hydrogen peroxide. Within 1 hourmore » of adding noncytotoxic concentrations of arsenite, cellular levels of oxidants increased relative to control levels, indicating that arsenite promotes cellular oxidations. Arsenite treatment increased nuclear translocation of NF-{kappa}B, an oxidative stress-responsive transcription factor, in a manner similar to that observed with hydrogen peroxide. Pretreatment of intact cells with the antioxidants N-acetylcysteine and dimethylfumarate prevented the arsenite-induced increases in cellular oxidant formation and NF-KB translocation. Arsenite had little or no effect on binding of NF-KB to its DNA recognition sequence in vitro, indicating that it is unlikely that arsenite directly affects NF-KB. The steady-state mRNA levels of intracellular adhesion molecule and urokinase-like plasminogen activator, genes associated with the active endothelial phenotype in arteriosclerosis and cancer metastasis, were increased by nontoxic concentrations of arsenite. These data suggest that arsenite promotes proliferative diseases like heart disease and cancer by activating oxidant-sensitive endothelial cell signaling and gene expression. It is possible that antioxidant therapy would be useful in preventing arsenic-induced cardiovascular disease and cancer.« less

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

PubMed

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

PubMed

Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

2015-01-01

The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.

BOTH HYPOMETHYLATION AND HYPERMETHYLATION OF DNA ASSOCIATED WITH ARSENITE EXPOSURE IN CULTURES OF HUMAN CELLS IDENTIFIED BY METHYLATION-SENSITIVE ARBITRARILY-PRIMED PCR

EPA Science Inventory

Differentially Methylated DNA Sequences Associated with Exposure to Arsenite in Cultures of Human Cells Identified by Methylation-Sensitive-Primed PCR

Arsenic, a known human carcinogen, is converted to methylated derivatives by a methyltransferase (Mtase) and its biotra...

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

PubMed

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway

PubMed Central

Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James

2001-01-01

We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

PubMed

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.

PubMed

Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J

2015-01-01

Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.

EFFECTS OF ARSENITE IN TELOMERE AND TELOMERASE IN RELATION TO CELL PROLIFERATION AND APOPTOSIS IN HUMAN KERATINOCYTES AND LEUKEMIA CELLS IN VITRO

EPA Science Inventory

Telomeres are critical in maintaining chromosome and genomic stability. Arsenic, a human carcinogen as well as an anticancer agent, is known for its clastogenicity. To better understand molecular mechanisms of arsenic actions, we investigated arsenite effects on telomere and telo...

Inhibition of arsenic induced-rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-{beta}/Smad activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan Xinjuan; Dai Yujie; Li Xing

2011-08-01

Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

2016-01-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

PubMed

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

NADPH oxidases of the brain: distribution, regulation, and function.

PubMed

Infanger, David W; Sharma, Ram V; Davisson, Robin L

2006-01-01

The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.

Gravity Responsive NADH Oxidase of the Plasma Membrane

NASA Technical Reports Server (NTRS)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

PubMed Central

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

PubMed

Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

2001-05-04

The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

Immobilization of Pichia pastoris cells containing alcohol oxidase activity

PubMed Central

Maleknia, S; Ahmadi, H; Norouzian, D

2011-01-01

Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F., E-mail: merrillg@onid.orst.ed

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involvedmore » in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.« less

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase.

PubMed

Long, C M; Rohrmann, G F; Merrill, G F

2009-06-05

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

PubMed Central

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

ARSENATE AND ARSENITE REMOVAL BY ZERO-VALENT IRON: EFFECTS OF PHOSPHATE, SILICATE, CARBONATE, BORATE, SULFATE, CHROMATE, MOLYBDATE, AND NITRATE, RELATIVE TO CHLORIDE

EPA Science Inventory

Batch tests were performed to evaluate the effects of inorganic anion competition on the kinetics of arsenate (As(V)) and arsenite (As(III)) removal by zerovalent iron (Peerless Fe0) in aqueous solution. The oxyanions underwent either sorption-dominated reactions (phosphate, sil...

AN EVALUATION OF THE RELATIVE GENOTOXICITY OF ARSENITE, ARSENATE, AND FOUR METHYLATED METABOLITES IN VITRO USING THE ALKALINE SINGLE CELL GEL ASSAY

EPA Science Inventory