Science.gov

Sample records for arsenite oxidase gene

  1. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  2. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions.

  3. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  4. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  5. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  6. Constitutive arsenite oxidase expression detected in arsenic-hypertolerant Pseudomonas xanthomarina S11.

    PubMed

    Koechler, Sandrine; Arsène-Ploetze, Florence; Brochier-Armanet, Céline; Goulhen-Chollet, Florence; Heinrich-Salmeron, Audrey; Jost, Bernard; Lièvremont, Didier; Philipps, Muriel; Plewniak, Frédéric; Bertin, Philippe N; Lett, Marie-Claire

    2015-04-01

    Pseudomonas xanthomarina S11 is an arsenite-oxidizing bacterium isolated from an arsenic-contaminated former gold mine in Salsigne, France. This bacterium showed high resistance to arsenite and was able to oxidize arsenite to arsenate at concentrations up to 42.72 mM As[III]. The genome of this strain was sequenced and revealed the presence of three ars clusters. One of them is located on a plasmid and is organized as an "arsenic island" harbouring an aio operon and genes involved in phosphorous metabolism, in addition to the ars genes. Neither the aioXRS genes nor a specific sigma-54-dependent promoter located upstream of aioBA genes, both involved in regulation of arsenite oxidase expression in other arsenite-oxidizing bacteria, could be identified in the genome. This observation is in accordance with the fact that no difference was observed in expression of arsenite oxidase in P. xanthomarina S11, whether or not the strain was grown in the presence of As[III].

  7. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  8. Spatio-Temporal Detection of the Thiomonas Population and the Thiomonas Arsenite Oxidase Involved in Natural Arsenite Attenuation Processes in the Carnoulès Acid Mine Drainage

    PubMed Central

    Hovasse, Agnès; Bruneel, Odile; Casiot, Corinne; Desoeuvre, Angélique; Farasin, Julien; Hery, Marina; Van Dorsselaer, Alain; Carapito, Christine; Arsène-Ploetze, Florence

    2016-01-01

    The acid mine drainage (AMD) impacted creek of the Carnoulès mine (Southern France) is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron) attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM)-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with FISH and pyrosequencing-based 16S rRNA gene sequence analysis, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ. PMID:26870729

  9. Genetic identification of arsenate reductase and arsenite oxidase in redox transformations carried out by arsenic metabolising prokaryotes - A comprehensive review.

    PubMed

    Kumari, Nisha; Jagadevan, Sheeja

    2016-11-01

    Arsenic (As) contamination in water is a cause of major concern to human population worldwide, especially in Bangladesh and West Bengal, India. Arsenite (As(III)) and arsenate (As(V)) are the two common forms in which arsenic exists in soil and groundwater, the former being more mobile and toxic. A large number of arsenic metabolising microorganisms play a crucial role in microbial transformation of arsenic between its different states, thus playing a key role in remediation of arsenic contaminated water. This review focuses on advances in biochemical, molecular and genomic developments in the field of arsenic metabolising bacteria - covering recent developments in the understanding of structure of arsenate reductase and arsenite oxidase enzymes, their gene and operon structures and their mechanism of action. The genetic and molecular studies of these microbes and their proteins may lead to evolution of successful strategies for effective implementation of bioremediation programs. PMID:27565307

  10. Genetic identification of arsenate reductase and arsenite oxidase in redox transformations carried out by arsenic metabolising prokaryotes - A comprehensive review.

    PubMed

    Kumari, Nisha; Jagadevan, Sheeja

    2016-11-01

    Arsenic (As) contamination in water is a cause of major concern to human population worldwide, especially in Bangladesh and West Bengal, India. Arsenite (As(III)) and arsenate (As(V)) are the two common forms in which arsenic exists in soil and groundwater, the former being more mobile and toxic. A large number of arsenic metabolising microorganisms play a crucial role in microbial transformation of arsenic between its different states, thus playing a key role in remediation of arsenic contaminated water. This review focuses on advances in biochemical, molecular and genomic developments in the field of arsenic metabolising bacteria - covering recent developments in the understanding of structure of arsenate reductase and arsenite oxidase enzymes, their gene and operon structures and their mechanism of action. The genetic and molecular studies of these microbes and their proteins may lead to evolution of successful strategies for effective implementation of bioremediation programs.

  11. Arsenite oxidase from Ralstonia sp. 22: characterization of the enzyme and its interaction with soluble cytochromes.

    PubMed

    Lieutaud, Aurélie; van Lis, Robert; Duval, Simon; Capowiez, Line; Muller, Daniel; Lebrun, Régine; Lignon, Sabrina; Fardeau, Marie-Laure; Lett, Marie-Claire; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2010-07-01

    We characterized the aro arsenite oxidation system in the novel strain Ralstonia sp. 22, a beta-proteobacterium isolated from soil samples of the Salsigne mine in southern France. The inducible aro system consists of a heterodimeric membrane-associated enzyme reacting with a dedicated soluble cytochrome c(554). Our biochemical results suggest that the weak association of the enzyme to the membrane probably arises from a still unknown interaction partner. Analysis of the phylogeny of the aro gene cluster revealed that it results from a lateral gene transfer from a species closely related to Achromobacter sp. SY8. This constitutes the first clear cut case of such a transfer in the Aro phylogeny. The biochemical study of the enzyme demonstrates that it can accommodate in vitro various cytochromes, two of which, c(552) and c(554,) are from the parent species. Cytochrome c(552) belongs to the sox and not the aro system. Kinetic studies furthermore established that sulfite and sulfide, substrates of the sox system, are both inhibitors of Aro activity. These results reinforce the idea that sulfur and arsenic metabolism are linked.

  12. The Saccharomyces cerevisiae ACR3 gene encodes a putative membrane protein involved in arsenite transport.

    PubMed

    Wysocki, R; Bobrowicz, P; Ułaszewski, S

    1997-11-28

    The cluster of three genes, ACR1, ACR2, and ACR3, previously was shown to confer arsenical resistance in Saccharomyces cerevisiae. The overexpression of ACR3 induced high level arsenite resistance. The presence of ACR3 together with ACR2 on a multicopy plasmid was conducive to increased arsenate resistance. The function of ACR3 gene has now been investigated. Amino acid sequence analysis of Acr3p showed that this hypothetical protein has hydrophobic character with 10 putative transmembrane spans and is probably located in yeast plasma membrane. We constructed the acr3 null mutation. The resulting disruptants were 5-fold more sensitive to arsenate and arsenite than wild-type cells. The acr3 disruptants showed wild-type sensitivity to antimony, tellurite, cadmium, and phenylarsine oxide. The mechanism of arsenical resistance was assayed by transport experiments using radioactive arsenite. We did not observe any significant differences in the accumulation of 76AsO33- in wild-type cells, acr1 and acr3 disruptants. However, the high dosage of ACR3 gene resulted in loss of arsenite uptake. These results suggest that arsenite resistance in yeast is mediated by an arsenite transporter (Acr3p).

  13. X-ray Crystal Structure of Arsenite-Inhibited Xanthine Oxidase:[mu]-Sulfido,[mu]-Oxo Double Bridge between Molybdenum and Arsenic in the Active Site

    SciTech Connect

    Cao, Hongnan; Hall, James; Hille, Russ

    2012-10-23

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp{sup 2}-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a {mu}-sulfido,{mu}-oxo double bridge or a single {mu}-sulfido bridge. However, this is contrary to the crystallographically observed single {mu}-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 {angstrom} resolution, respectively. We observe {mu}-sulfido,{mu}-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  14. Global Analysis of Posttranscriptional Gene Expression in Response to Sodium Arsenite

    PubMed Central

    Qiu, Lian-Qun; Abey, Sarah; Harris, Shawn; Shah, Ruchir; Gerrish, Kevin E.

    2014-01-01

    Background: Inorganic arsenic species are potent environmental toxins and causes of numerous health problems. Most studies have assumed that arsenic-induced changes in mRNA levels result from effects on gene transcription. Objectives: We evaluated the prevalence of changes in mRNA stability in response to sodium arsenite in human fibroblasts. Methods: We used microarray analyses to determine changes in steady-state mRNA levels and mRNA decay rates following 24-hr exposure to noncytotoxic concentrations of sodium arsenite, and we confirmed some of these changes using real-time reverse-transcription polymerase chain reaction (RT-PCR). Results: In arsenite-exposed cells, 186 probe set–identified transcripts were significantly increased and 167 were significantly decreased. When decay rates were analyzed after actinomycin D treatment, only 4,992 (9.1%) of probe set–identified transcripts decayed by > 25% after 4 hr. Of these, 70 were among the 353 whose steady-state levels were altered by arsenite, and of these, only 4 exhibited significantly different decay rates between arsenite and control treatment. Real-time RT-PCR confirmed a major, significant arsenite-induced stabilization of the mRNA encoding δ aminolevulinate synthase 1 (ALAS1), the rate-limiting enzyme in heme biosynthesis. This change presumably accounted for at least part of the 2.7-fold increase in steady-state ALAS1 mRNA levels seen after arsenite treatment. This could reflect decreases in cellular heme caused by the massive induction by arsenite of heme oxygenase mRNA (HMOX1; 68-fold increase), the rate-limiting enzyme in heme catabolism. Conclusions: We conclude that arsenite modification of mRNA stability is relatively uncommon, but in some instances can result in significant changes in gene expression. Citation: Qiu LQ, Abey S, Harris S, Shah R, Gerrish KE, Blackshear PJ. 2015. Global analysis of posttranscriptional gene expression in response to sodium arsenite. Environ Health Perspect 123:324

  15. ALTERNATIVE OXIDASE: From Gene to Function.

    PubMed

    Vanlerberghe, Greg C.; McIntosh, Lee

    1997-06-01

    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  16. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.

    PubMed

    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A

    2003-12-18

    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  17. The study of the mechanism of arsenite toxicity in respiration-deficient cells reveals that NADPH oxidase-derived superoxide promotes the same downstream events mediated by mitochondrial superoxide in respiration-proficient cells.

    PubMed

    Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia; Cerioni, Liana; Balduini, Walter; Cantoni, Orazio

    2016-09-15

    We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O2(.-)) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5μM, arsenite elicited selective formation of O2(.-) in the respiratory chain of RP cells, with hardly any contribution of the above mechanisms. Under these conditions, O2(.-) triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O2(.-) because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O2(.-) mediated by NADPH oxidase. Interestingly, extramitochondrial O2(.-) triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O2(.-) availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. PMID:27450018

  18. Gene expression levels in normal human lymphoblasts with variable sensitivities to arsenite: Identification of GGT1 and NFKBIE expression levels as possible biomarkers of susceptibility

    SciTech Connect

    Komissarova, Elena V.; Li Ping; Uddin, Ahmed N.; Chen, Xuyan; Nadas, Arthur; Rossman, Toby G.

    2008-01-15

    Drinking arsenic-contaminated water is associated with increased risk of neoplasias of the skin, lung, bladder and possibly other sites, as well as other diseases. Earlier, we showed that human lymphoblast lines from different normal unexposed donors showed variable sensitivities to the toxic effects of arsenite. In the present study, we used microarray analysis to compare the basal gene expression profiles between two arsenite-resistant (GM02707, GM00893) and two arsenite-sensitive lymphoblast lines (GM00546, GM00607). A number of genes were differentially expressed in arsenite-sensitive and arsenite-resistant cells. Among these, {gamma}-glutamyltranspeptidase 1 (GGT1) and NF{kappa}B inhibitor-epsilon (NFKBIE) showed higher expression levels in arsenite-resistant cells. RT-PCR analysis with gene-specific primers confirmed these results. Reduction of GGT1 expression level in arsenite-resistant lymphoblasts with GGT1-specific siRNA resulted in increased cell sensitivity to arsenite. In conclusion, we have demonstrated for the first time that expression levels of GGT1 and possibly NFKBIE might be useful as biomarkers of genetic susceptibility to arsenite. Expression microarrays can thus be exploited for identifying additional biomarkers of susceptibility to arsenite and to other toxicants.

  19. Arsenite oxidation by a facultative chemolithoautotrophic Sinorhizobium sp. KGO-5 isolated from arsenic-contaminated soil.

    PubMed

    Dong, Dan; Ohtsuka, Toshihiko; Dong, Dian Tao; Amachi, Seigo

    2014-01-01

    A chemolithoautotrophic arsenite-oxidizing bacterium, designated strain KGO-5, was isolated from arsenic-contaminated industrial soil. Strain KGO-5 was phylogenetically closely related with Sinorhizobium meliloti with 16S rRNA gene similarity of more than 99%, and oxidized 5 mM arsenite under autotrophic condition within 60 h with a doubling time of 3.0 h. Additions of 0.01-0.1% yeast extract enhanced the growth significantly, and the strain still oxidized arsenite efficiently with much lower doubling times of approximately 1.0 h. Arsenite-oxidizing capacities (11.2-54.1 μmol h(-1) mg dry cells(-1)) as well as arsenite oxidase (Aio) activities (1.76-10.0 mU mg protein(-1)) were found in the cells grown with arsenite, but neither could be detected in the cells grown without arsenite. Strain KGO-5 possessed putative aioA gene, which is closely related with AioA of Ensifer adhaerens. These results suggest that strain KGO-5 is a facultative chemolithoautotrophic arsenite oxidizer, and its Aio is induced by arsenic. PMID:25051896

  20. The H-bond network surrounding the pyranopterins modulates redox cooperativity in the molybdenum-bisPGD cofactor in arsenite oxidase.

    PubMed

    Duval, Simon; Santini, Joanne M; Lemaire, David; Chaspoul, Florence; Russell, Michael J; Grimaldi, Stephane; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2016-09-01

    While the molybdenum cofactor in the majority of bisPGD enzymes goes through two consecutive 1-electron redox transitions, previous protein-film voltammetric results indicated the possibility of cooperative (n=2) redox behavior in the bioenergetic enzyme arsenite oxidase (Aio). Combining equilibrium redox titrations, optical and EPR spectroscopies on concentrated samples obtained via heterologous expression, we unambiguously confirm this claim and quantify Aio's redox cooperativity. The stability constant, Ks, of the Mo(V) semi-reduced intermediate is found to be lower than 10(-3). Site-directed mutagenesis of residues in the vicinity of the Mo-cofactor demonstrates that the degree of redox cooperativity is sensitive to H-bonding interactions between the pyranopterin moieties and amino acid residues. Remarkably, in particular replacing the Gln-726 residue by Gly results in stabilization of (low-temperature) EPR-observable Mo(V) with KS=4. As evidenced by comparison of room temperature optical and low temperature EPR titrations, the degree of stabilization is temperature-dependent. This highlights the importance of room-temperature redox characterizations for correctly interpreting catalytic properties in this group of enzymes. Geochemical and phylogenetic data strongly indicate that molybdenum played an essential biocatalytic roles in early life. Molybdenum's redox versatility and in particular the ability to show cooperative (n=2) redox behavior provide a rationale for its paramount catalytic importance throughout the evolutionary history of life. Implications of the H-bonding network modulating Molybdenum's redox properties on details of a putative inorganic metabolism at life's origin are discussed.

  1. Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity.

    PubMed

    Tang, Zhong; Lv, Yanling; Chen, Fei; Zhang, Wenwen; Rosen, Barry P; Zhao, Fang-Jie

    2016-04-01

    Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species. PMID:26998776

  2. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    EPA Science Inventory

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  3. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  4. Inhibition of neurite outgrowth and alteration of cytoskeletal gene expression by sodium arsenite.

    PubMed

    Aung, Kyaw Htet; Kurihara, Ryohei; Nakashima, Shizuka; Maekawa, Fumihiko; Nohara, Keiko; Kobayashi, Tetsuya; Tsukahara, Shinji

    2013-01-01

    Arsenic compounds that are often found in drinking water increase the risk of developmental brain disorders. In this study, we performed live imaging analyses of Neuro-2a cells expressing SCAT3, a caspase-3 cleavage peptide sequence linking two fluorescent proteins; enhanced cyan fluorescence protein (ECFP) and Venus, to determine whether sodium arsenite (NaAsO(2); 0, 1, 5, or 10 μM) affects both neurite outgrowth and/or induces apoptosis with the same doses and in the same cell cultures. We observed that the area ratio of neurite to cell body in SCAT3-expressing cells was significantly reduced by 5 and 10 μM NaAsO(2), but not by 1 μM, although the emission ratio of ECFP to Venus, an endpoint of caspase-3 activity, was not changed. However, cytological assay using apoptotic and necrotic markers resulted in that apoptosis, but not necrosis, was significantly induced in Neuro-2a cells when NaAsO(2) exposure continued after the significant effects of NaAsO(2) on neurite outgrowth were found by live imaging. These results suggested that neurite outgrowth was suppressed by NaAsO(2) prior to NaAsO(2)-induced apoptosis. Next, we examined the effects of NaAsO(2) on cytoskeletal gene expression in Neuro-2a cells. NaAsO(2) increased the mRNA levels of the light and medium subunits of neurofilament and decreased the mRNA levels of tau and tubulin in a dose-dependent manner; no significant effect was found in the mRNA levels of the heavy subunit of neurofilament, microtubule-associated protein 2, or actin. The changes in cytoskeletal gene expression are likely responsible for the inhibitory effects of NaAsO(2) on neurite outgrowth.

  5. Contributions of reactive oxygen species and mitogen-activated protein kinase signaling in arsenite-stimulated hemeoxygenase-1 production

    SciTech Connect

    Cooper, Karen L.; Liu, Ke Jian; Hudson, Laurie G. . E-mail: lhudson@salud.unm.edu

    2007-01-15

    Hemeoxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. HO-1 has cytoprotective activities and arsenite is a potent inducer of HO-1 in many cell types and tissues, including epidermal keratinocytes. We investigated the potential contributions of reactive oxygen species (ROS) generation and mitogen-activated protein kinase (MAPK) activation to arsenite-dependent regulation of HO-1 in HaCaT cells, an immortalized human keratinocyte line. Both epidermal growth factor (EGF) and arsenite stimulated ROS production was detected by dihydroethidium (DHE) staining and fluorescence microscopy. Arsenite induced HO-1 in a time- and concentration-dependent manner, while HO-1 expression in response to EGF was modest and evident at extended time points (48-72 h). Inhibition of EGF receptor, MEK I/II or Src decreased arsenite-stimulated HO-1 expression by 20-30%. In contrast, addition of a superoxide scavenger or inhibition of p38 activity decreased the arsenite-dependent response by 80-90% suggesting that ROS and p38 are required for HO-1 induction. However, ROS generation alone was insufficient for the observed arsenite-dependent response as use of a xanthine/xanthine oxidase system to generate ROS did not produce an equivalent upregulation of HO-1. Cooperation between ERK signaling and ROS generation was demonstrated by synergistic induction of HO-1 in cells co-treated with EGF and xanthine/xanthine oxidase resulting in a response nearly equivalent to that observed with arsenite. These findings suggest that the ERK/MAPK activation is necessary but not sufficient for optimal arsenite-stimulated HO-1 induction. The robust and persistent upregulation of HO-1 may have a role in cellular adaptation to chronic arsenic exposure.

  6. The genetic basis of anoxygenic photosynthetic arsenite oxidation

    USGS Publications Warehouse

    Hernandez-Maldonado, Jamie; Sanchez-Sedillo, Benjamin; Stoneburner, Brendon; Boren, Alison; Miller, Laurence G.; McCann, Shelley; Rosen, Michael R.; Oremland, Ronald S.; Saltikov, Chad W.

    2016-01-01

    “Photoarsenotrophy”, the use of arsenite as an electron donor for anoxygenic photosynthesis, is thought to be an ancient form of phototrophy along with the photosynthetic oxidation of Fe(II), H2S, H2, and NO2-. Photoarsenotrophy was recently identified from Paoha Island's (Mono Lake, CA) arsenic-rich hot springs. The genomes of several photoarsenotrophs revealed a gene cluster, arxB2AB1CD, where arxA is predicted to encode for the sole arsenite oxidase. The role of arxA in photosynthetic arsenite oxidation was confirmed by disrupting the gene in a representative photoarsenotrophic bacterium, resulting in the loss of light-dependent arsenite oxidation. In situ evidence of active photoarsenotrophic microbes was supported by arxA mRNA detection for the first time, in red-pigmented microbial mats within the hot springs of Paoha Island. This work expands on the genetics for photosynthesis coupled to new electron donors and elaborates on known mechanisms for arsenic metabolism, thereby highlighting the complexities of arsenic biogeochemical cycling.

  7. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  8. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  9. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture

    PubMed Central

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination. PMID:26064886

  10. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture.

    PubMed

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination.

  11. Lysyl Oxidase (Lox) Gene Deficiency Affects Osteoblastic Phenotype

    PubMed Central

    Pischon, N.; Mäki, J. M.; Weisshaupt, P.; Heng, N.; Palamakumbura, A. H.; N'Guessan, P.; Ding, A.; Radlanski, R.; Renz, H.; Bronckers, T. A. L. J. J.; Myllyharju, J.; Kielbassa, A.; Kleber, B. M.; Bernimoulin, J.-P.; Trackman, P.C.

    2010-01-01

    Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for structural integrity and function of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox-/-) and wild type (wt) (C57 BL/6) mice. Next to Lox gene depletion, mRNA expression of Lox isoforms, LOXL1-4, was significantly down-regulated in Lox-/- bone tissue. A significant decrease of DNA synthesis of Lox-/- osteoblasts compared to wt was found. Early stages of osteoblastic apoptosis studied by Annexin-V binding as well as later stages of DNA fragmentation were not affected. However, mineral nodule formation and osteoblastic differentiation were markedly decreased, as revealed by significant down-regulation of osteoblastic markers, type I collagen, BSP and Runx2/Cbfa1. PMID:19458888

  12. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  13. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    SciTech Connect

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

    2008-03-15

    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers.

  14. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.

    PubMed

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P

    2009-02-17

    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions.

  15. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. PMID:26057477

  16. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish.

  17. Hypermethylation of the Keap1 gene inactivates its function, promotes Nrf2 nuclear accumulation, and is involved in arsenite-induced human keratinocyte transformation.

    PubMed

    Wang, Dapeng; Ma, Yuan; Yang, Xu; Xu, Xiguo; Zhao, Yingying; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Gao, Fenfang; Tong, Jian; Yamanaka, Kenzo; An, Yan

    2015-12-01

    It is well known that long-term exposure to arsenite leads to human skin cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism; however, emerging data suggest that constitutive activation of Nrf2 is associated with cancer development and chemotherapy resistance. The reasons Nrf2 continuously accumulates in cancer cells remain to be fully understood. By establishing transformed human keratinocyte cells via chronic arsenite treatment, we observed a continuous reduction in reactive oxygen species levels and enhanced levels of Nrf2 and its target antioxidant enzymes in the later stage of arsenite-induced cell transformation. We also revealed that hypermethylation of the Keap1 gene promoter region induced by DNA methyltransferase-3 leading to inactivation of its function was responsible for constitutive activation of Nrf2 and its target enzymes. To validate these observations, the expression of Keap1 protein was restored in arsenite-transformed cells by treatment with a DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5-Aza-dC), and protein levels of Nrf2 and colony formation were then determined after these treatments. Results showed that enhancement of Keap1 expression by 5-Aza-dC significantly reduced Nrf2 and its target antioxidant enzyme levels, and that in turn suppressed cell proliferation and colony formation of the transformed cells. Taken together, the present study strongly suggests that loss of Keap1 function by hypermethylation of its promoter region leading to Nrf2 nuclear accumulation appears to play a role in arsenite-induced human keratinocyte transformation.

  18. The pea gene NA encodes ent-kaurenoic acid oxidase.

    PubMed

    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  19. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  20. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  1. Biotransformation of arsenite and bacterial aox activity in drinking water produced from surface water of floating houses: Arsenic contamination in Cambodia.

    PubMed

    Chang, Jin-Soo

    2015-11-01

    The potential arsenite bioteansformation activity of arsenic was investigated by examining bacterial arsenic arsenite-oxidizing gene such as aoxS, aoxR, aoxA, aoxB, aoxC, and aoxD in high arsenic-contaminated drinking water produced from the surface water of floating houses. There is a biogeochemical cycle of activity involving arsenite oxidase aox system and the ars (arsenic resistance system) gene operon and aoxR leader gene activity in Alcaligenes faecalis SRR-11 and aoxS leader gene activity in Achromobacter xylosoxidans TSL-66. Batch experiments showed that SRR-11 and TSL-66 completely oxidized 1 mM of As (III) to As (V) within 35-40 h. The leaders of aoxS and aoxR are important for gene activity, and their effects in arsenic bioremediation and mobility in natural water has a significant ecological role because it allows arsenite oxidase in bacteria to control the biogeochemical cycle of arsenic-contaminated drinking water produced from surface water of floating houses.

  2. Diversity of arsenite oxidizing bacterial communities in arsenic-rich deltaic aquifers in West Bengal, India

    PubMed Central

    Ghosh, Devanita; Bhadury, Punyasloke; Routh, Joyanto

    2014-01-01

    High arsenic (As) concentration in groundwater has affected human health, particularly in South-East Asia putting millions of people at risk. Biogeochemical cycling of As carried out by different bacterial groups are suggested to control the As fluxes in aquifers. A functional diversity approach in link with As precipitation was adopted to study bacterial community structures and their variation within the As contaminated Bengal Delta Plain (BDP) aquifers of India. Groundwater samples collected from two shallow aquifers in Karimpur II (West Bengal, India), during years 2010 and 2011, were investigated to trace the effects immediately after monsoon period (precipitation) on community structure and diversity of bacterial assemblages with a focus on arsenite oxidizing bacterial phyla for two successive years. The study focused on amplification, clone library generation and sequencing of the arsenite oxidase large sub-unit gene aioA and 16S rRNA marker, with respect to changes in elemental concentrations. New set of primers were designed to amplify the aioA gene as a phylogenetic marker to study taxonomically diverse arsenite oxidizing bacterial groups in these aquifers. The overall narrow distribution of bacterial communities based on aioA and 16S rRNA sequences observed was due to poor nutrient status and anoxic conditions in these As contaminated aquifers. Proteobacteria was the dominant phylum detected, within which Acidovorax, Hydrogenophaga, Albidiferax, Bosea, and Polymorphum were the major arsenite oxidizing bacterial genera based on the number of clones sequenced. The structure of bacterial assemblages including those of arsenite oxidizing bacteria seems to have been affected by increase in major elemental concentrations (e.g., As, Fe, S, and Si) within two sampling sessions, which was supported by statistical analyses. One of the significant findings of this study is detection of novel lineages of 16S rRNA-like bacterial sequences indicating presence of

  3. Overexpression of NADH oxidase gene from Deinococcus geothermalis in Escherichia coli.

    PubMed

    Kazuya, Sase; Tomomi, Iwasaki; Hatsune, Karasaki; Masahide, Ishikawa

    2013-12-01

    When using stable enzyme genes from a thermophile to create a biosensor in Escherichia coli, it is vital that these genes be overexpressed in order to provide a sufficient supply of enzymes. In this study, overexpression of the NADH oxidase (Nox) gene from the thermophile Deinococcus geothermalis was successfully achieved with the aim of creating a stable biosensor active at room temperatures. To do so, modification of 10 nucleotides, GAAATTAACT, upstream of the start codon of the Nox gene was necessary.

  4. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  5. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  6. Family-based association study of the arsenite methyltransferase gene (AS3MT, rs11191454) in Korean children with attention-deficit hyperactivity disorder.

    PubMed

    Park, Subin; Park, Jong-Eun; Yoo, Hee Jeong; Kim, Jae-Won; Cho, Soo-Churl; Shin, Min-Sup; Cheong, Jae Hoon; Han, Doug Hyun; Kim, Bung-Nyun

    2015-02-01

    We examined the association between the selected polymorphisms in two candidate genes, the arsenite methyltransferase gene (AS3MT, rs11191454) and the inter-α-trypsin inhibitors heavy chain-3 gene (ITIH3, rs2535629), and attention-deficit hyperactivity disorder (ADHD) in a Korean population. A total of 238 patients with ADHD, along with both of their biological parents, were recruited. The children were administered intelligence quotient tests, whereas their parents completed the Child Behavior Checklist. In the transmission disequilibrium test on 181 trios, we found overtransmission of the A allele at the AS3MT rs11191454 polymorphism in children with ADHD (χ²=8.81, P=0.003). However, there was no preferential transmission at the ITIH3 rs52535629 polymorphism (χ²=0.14, P=0.707). Our results provide preliminary evidence for the overtransmission of the A allele at the AS3MT rs11191454 polymorphism in ADHD.

  7. Family-based association study of the arsenite methyltransferase gene (AS3MT, rs11191454) in Korean children with attention-deficit hyperactivity disorder.

    PubMed

    Park, Subin; Park, Jong-Eun; Yoo, Hee Jeong; Kim, Jae-Won; Cho, Soo-Churl; Shin, Min-Sup; Cheong, Jae Hoon; Han, Doug Hyun; Kim, Bung-Nyun

    2015-02-01

    We examined the association between the selected polymorphisms in two candidate genes, the arsenite methyltransferase gene (AS3MT, rs11191454) and the inter-α-trypsin inhibitors heavy chain-3 gene (ITIH3, rs2535629), and attention-deficit hyperactivity disorder (ADHD) in a Korean population. A total of 238 patients with ADHD, along with both of their biological parents, were recruited. The children were administered intelligence quotient tests, whereas their parents completed the Child Behavior Checklist. In the transmission disequilibrium test on 181 trios, we found overtransmission of the A allele at the AS3MT rs11191454 polymorphism in children with ADHD (χ²=8.81, P=0.003). However, there was no preferential transmission at the ITIH3 rs52535629 polymorphism (χ²=0.14, P=0.707). Our results provide preliminary evidence for the overtransmission of the A allele at the AS3MT rs11191454 polymorphism in ADHD. PMID:25461954

  8. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  9. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  10. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.

    PubMed

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-06-15

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays.

  11. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-01-01

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  12. Structure and evolution of vertebrate aldehyde oxidases: from gene duplication to gene suppression.

    PubMed

    Kurosaki, Mami; Bolis, Marco; Fratelli, Maddalena; Barzago, Maria Monica; Pattini, Linda; Perretta, Gemma; Terao, Mineko; Garattini, Enrico

    2013-05-01

    Aldehyde oxidases (AOXs) and xanthine dehydrogenases (XDHs) belong to the family of molybdo-flavoenzymes. Although AOXs are not identifiable in fungi, these enzymes are represented in certain protists and the majority of plants and vertebrates. The physiological functions and substrates of AOXs are unknown. Nevertheless, AOXs are major drug metabolizing enzymes, oxidizing a wide range of aromatic aldehydes and heterocyclic compounds of medical/toxicological importance. Using genome sequencing data, we predict the structures of AOX genes and pseudogenes, reconstructing their evolution. Fishes are the most primitive organisms with an AOX gene (AOXα), originating from the duplication of an ancestral XDH. Further evolution of fishes resulted in the duplication of AOXα into AOXβ and successive pseudogenization of AOXα. AOXβ is maintained in amphibians and it is the likely precursors of reptilian, avian, and mammalian AOX1. Amphibian AOXγ is a duplication of AOXβ and the likely ancestor of reptilian and avian AOX2, which, in turn, gave rise to mammalian AOX3L1. Subsequent gene duplications generated the two mammalian genes, AOX3 and AOX4. The evolution of mammalian AOX genes is dominated by pseudogenization and deletion events. Our analysis is relevant from a structural point of view, as it provides information on the residues characterizing the three domains of each mammalian AOX isoenzyme. We cloned the cDNAs encoding the AOX proteins of guinea pig and cynomolgus monkeys, two unique species as to the evolution of this enzyme family. We identify chimeric RNAs from the human AOX3 and AOX3L1 pseudogenes with potential to encode a novel microRNA.

  13. The yeast aquaglyceroporin Fps1p is a bidirectional arsenite channel.

    PubMed

    Maciaszczyk-Dziubinska, Ewa; Migdal, Iwona; Migocka, Magdalena; Bocer, Tomasz; Wysocki, Robert

    2010-02-19

    The stress-activated kinase Hog1p mediates arsenic tolerance by decreasing arsenite influx through the aquaglyceroporin Fps1p in Saccharomyces cerevisiae. Unexpectedly, we found that overexpression of FPS1 increased arsenite tolerance suggesting a physiological role of Fps1p in arsenic detoxification. Consistently, during arsenite treatment transcription of FPS1 gene was strongly upregulated, while Fps1p was not degraded and remained localized to the plasma membrane. Moreover, deletion of FPS1 gene resulted in arsenate sensitivity. Finally, transport experiments revealed that Fps1p in concert with the arsenite transporter Acr3p mediates arsenite efflux.

  14. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  15. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  16. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  17. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  18. Arsenite transport in plants.

    PubMed

    Ali, Waqar; Isayenkov, Stanislav V; Zhao, Fang-Jie; Maathuis, Frans J M

    2009-07-01

    Arsenic is a metalloid which is toxic to living organisms. Natural occurrence of arsenic and human activities have led to widespread contamination in many areas of the world, exposing a large section of the human population to potential arsenic poisoning. Arsenic intake can occur through consumption of contaminated crops and it is therefore important to understand the mechanisms of transport, metabolism and tolerance that plants display in response to arsenic. Plants are mainly exposed to the inorganic forms of arsenic, arsenate and arsenite. Recently, significant progress has been made in the identification and characterisation of proteins responsible for movement of arsenite into and within plants. Aquaporins of the NIP (nodulin26-like intrinsic protein) subfamily were shown to transport arsenite in planta and in heterologous systems. In this review, we will evaluate the implications of these new findings and assess how this may help in developing safer and more tolerant crops.

  19. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.

    PubMed

    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen

    2012-10-01

    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  20. Phylogenetic positions of insectivora in eutheria inferred from mitochondrial cytochrome c oxidase subunit II gene.

    PubMed

    Onuma, M; Kusakabe, T; Kusakabe, S

    1998-02-01

    For the elucidation of the phylogenetic position of insectivora in eutheria, we have sequenced the cytochrome c oxidase subunit II (COII) gene of mitochondria for three insectivoran species [musk screw (Suncus murinus), shrew mole (Urotrichus talpoides), Japanese mole (Mogera wogura)] and analyzed these amino acid sequences with neighbor-joining (NJ) method and maximum likelihood (ML) method. NJ analysis shows polyphyly of Insectivora and Chiroptera. Assuming that each of Primates, Ferungulata, Chiroptera, Insectivora and Rodentia is a monophyletic group, ML analysis suggests that Chiroptera is a sister group of Insectivora and that Ferungulata is the closest outgroup to the (Insectivora and Chiroptera) clade.

  1. Arsenite suppression of BMP signaling in human keratinocytes

    SciTech Connect

    Phillips, Marjorie A.; Qin, Qin; Hu, Qin; Zhao, Bin; Rice, Robert H.

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  2. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.

    PubMed

    Lunt, D H; Zhang, D X; Szymura, J M; Hewitt, G M

    1996-08-01

    Insect mitochondrial cytochrome oxidase I (COI) genes are used as a model to examine the within-gene heterogeneity of evolutionary rate and its implications for evolutionary analyses. The complete sequence (1537 bp) of the meadow grasshopper (Chorthippus parallelus) COI gene has been determined, and compared with eight other insect COI genes at both the DNA and amino acid sequence levels. This reveals that different regions evolve at different rates, and the patterns of sequence variability seems associated with functional constraints on the protein. The COOH-terminal was found to be significantly more variable than internal loops (I), external loops (E), transmembrane helices (M) or the NH2 terminal. The central region of COI (M5-M8) has lower levels of sequence variability, which is related to several important functional domains in this region. Highly conserved primers which amplify regions of different variabilities have been designed to cover the entire insect COI gene. These primers have been shown to amplify COI in a wide range of species, representing all the major insect groups; some even in an arachnid. Implications of the observed evolutionary pattern for phylogenetic analysis are discussed, with particular regard to the choice of regions of suitable variability for specific phylogenetic projects.

  3. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  4. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression.

  5. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression. PMID:24594397

  6. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  7. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.

    PubMed

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-07-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  8. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  9. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  10. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  11. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  12. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.

    PubMed

    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V

    1998-10-01

    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  13. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  14. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  15. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    EPA Science Inventory

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  16. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.

    PubMed

    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P

    1997-04-01

    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis

  17. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  18. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong

    2016-01-01

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  19. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  20. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  1. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans.

  2. Anaerobic arsenite oxidation by an autotrophic arsenite-oxidizing bacterium from an arsenic-contaminated paddy soil.

    PubMed

    Zhang, Jun; Zhou, Wuxian; Liu, Bingbing; He, Jian; Shen, Qirong; Zhao, Fang-Jie

    2015-05-19

    Microbe-mediated arsenic (As) redox reactions play an important role in the biogeochemical cycling of As. Reduction of arsenate [As(V)] generally leads to As mobilization in paddy soils and increased As availability to rice plants, whereas oxidation of arsenite [As(III)] results in As immobilization. A novel chemoautotrophic As(III)-oxidizing bacterium, designated strain SY, was isolated from an As-contaminated paddy soil. The isolate was able to derive energy from the oxidation of As(III) to As(V) under both aerobic and anaerobic conditions using O2 or NO3(-) as the respective electron acceptor. Inoculation of the washed SY cells into a flooded soil greatly enhanced As(III) oxidation to As(V) both in the solution and adsorbed phases of the soil. Strain SY is phylogenetically closely related to Paracoccus niistensis with a 16S rRNA gene similarity of 96.79%. The isolate contains both the denitrification and ribulose 1,5-bisphosphate carboxylase/oxygenase gene clusters, underscoring its ability to denitrify and to fix CO2 while coupled to As(III) oxidation. Deletion of the aioA gene encoding the As(III) oxidase subunit A abolished the As(III) oxidation ability of strain SY and led to increased sensitivity to As(III), suggesting that As(III) oxidation is a detoxification mechanism in this bacterium under aerobic and heterotrophic growth conditions. Analysis of the aioA gene clone library revealed that the majority of the As(III)-oxidizing bacteria in the soil were closely related to the genera Paracoccus of α-Proteobacteria. Our results provide direct evidence for As(III) oxidation by Paracoccus species and suggest that these species may play an important role in As(III) oxidation in paddy soils under both aerobic and denitrifying conditions. PMID:25905768

  3. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )

    1991-11-01

    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  4. Monoamine oxidase A gene DNA hypomethylation - a risk factor for panic disorder?

    PubMed

    Domschke, Katharina; Tidow, Nicola; Kuithan, Henriette; Schwarte, Kathrin; Klauke, Benedikt; Ambrée, Oliver; Reif, Andreas; Schmidt, Hartmut; Arolt, Volker; Kersting, Anette; Zwanzger, Peter; Deckert, Jürgen

    2012-10-01

    The monoamine oxidase A (MAOA) gene has been suggested as a prime candidate in the pathogenesis of panic disorder. In the present study, DNA methylation patterns in the MAOA regulatory and exon 1/intron 1 region were investigated for association with panic disorder with particular attention to possible effects of gender and environmental factors. Sixty-five patients with panic disorder (44 females, 21 males) and 65 healthy controls were analysed for DNA methylation status at 42 MAOA CpG sites via direct sequencing of sodium bisulfate treated DNA extracted from blood cells. The occurrence of recent positive and negative life events was ascertained. Male subjects showed no or only very minor methylation with some evidence for relative hypomethylation at one CpG site in intron 1 in patients compared to controls. Female patients exhibited significantly lower methylation than healthy controls at 10 MAOA CpG sites in the promoter as well as in exon/intron 1, with significance surviving correction for multiple testing at four CpG sites (p≤0.001). Furthermore, in female subjects the occurrence of negative life events was associated with relatively decreased methylation, while positive life events were associated with increased methylation. The present pilot data suggest a potential role of MAOA gene hypomethylation in the pathogenesis of panic disorder particularly in female patients, possibly mediating a detrimental influence of negative life events. Future studies are warranted to replicate the present finding in independent samples, preferably in a longitudinal design.

  5. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    PubMed

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  6. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  7. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  8. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  9. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed Central

    Vanlerberghe, G. C.; McLntosh, L.

    1996-01-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  10. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  11. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  12. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  13. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks.

  14. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  15. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  16. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand.

  17. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  18. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.

    2009-01-01

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  19. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  20. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  1. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  2. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  3. Kinetics of arsenite removal by halobacteria from a highland Andean Chilean Salar

    PubMed Central

    2013-01-01

    Background The purpose of this study was to identify arsenite-oxidizing halobacteria in samples obtained from Salar de Punta Negra, II Region of Chile. Seven bacterial isolates, numbered as isolates I to VII, grown in a culture medium with 100 ppm as NaAsO2 (As (III)) were tested. Bacterial growth kinetics and the percent of arsenite removal (PAR) were performed simultaneously with the detection of an arsenite oxidase enzyme through Dot Blot analysis. Results An arsenite oxidase enzyme was detected in all isolates, expressed constitutively after 10 generations grown in the absence of As (III). Bacterial growth kinetics and corresponding PAR values showed significant fluctuations over time. PARs close to 100% were shown by isolates V, VI, and VII, at different times of the bacterial growth phase; while isolate II showed PAR values around 40%, remaining constant over time. Conclusion Halobacteria from Salar de Punta Negra showed promising properties as arsenite removers under control conditions, incubation time being a critical parameter. PMID:23547876

  4. Identification, cloning and expression of Pseudomonas aeruginosa Ps-x putative urate oxidase gene in Escherichia coli.

    PubMed

    Saeed, Hesham M; Abdel-Fattah, Yasser R; Berekaa, Mahmoud M; Gohar, Yousry M; Elbaz, Mohamed A

    2004-01-01

    In a previous study we reported for the first time the isolation and characterization ofurate oxidase enzyme from Pseudomonas aeruginosa. In this work we isolated and cloned a 1.350 kilobase DNA fragment that encode a putative urate oxidase gene from the genomic library of P. aeruginosa Ps-x. The nucleotide sequence of the cloned DNA insert revealed an open reading frame that encodes a protein of a molecular weight of 54.0 kDa. The cloned DNA fragment showed an uricolytic activity when expressed in E. coli DH5alpha. Surprisingly, the nucleotide sequence of the cloned gene showed more than 99% identity to the gene encoding hypothetical protein of P. aeruginosa PAO1. Moreover, the sequence of the cloned gene was closely similar to the corresponding uricase gene of Cellulomonas flavigena (44% similarity), but showed lower similarity values to that of Bacillus sp. BT-90 (24% similarity), Candida utilis (24% similarity). Interestingly, the isolated uricase gene showed closer similarity to uricase from yeast-like symbiotic fungi Beauveria bassiana (35%), Tolypocladium inflatum (29%), Paecilomyces tenuipes (27%) and Cerataphis fransseni (24%).

  5. The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species -- Calliphora vicina and Calliphora vomitoria.

    PubMed

    Ames, Carole; Turner, Bryan; Daniel, Barbara

    2006-12-20

    Traditionally identification of forensically important insects has been carried out based upon morphological differences between species. However insect evidence found at a crime scene may on occasion be difficult to distinguish by morphological techniques and under these circumstances another method of accurate identification is required. This work utilises a cytochrome oxidase I partial mitochondrial gene region (COI) to distinguish the two of the main UK blowfly species -- Calliphora vicina (Robineau Desvoidy) and Calliphora vomitoria (Linnaeus) (Diptera:Calliphoridae). Seventeen interspecific differences in COI sequence were located. Use of the restriction enzyme SfcI on this gene region provides a simple method for distinguishing between C. vicina and C. vomitoria.

  6. Arsenite and insulin exhibit opposing effects on epidermal growth factor receptor and keratinocyte proliferative potential

    SciTech Connect

    Patterson, Timothy J.; Rice, Robert H. . E-mail: rhrice@ucdavis.edu

    2007-05-15

    Previous work has suggested that arsenic exposure contributes to skin carcinogenesis by preserving the proliferative potential of human epidermal keratinocytes, thereby slowing the exit of putative target stem cells into the differentiation pathway. To find a molecular basis for this action, present work has explored the influence of arsenite on keratinocyte responses to epidermal growth factor (EGF). The ability of cultured keratinocytes to found colonies upon passaging several days after confluence was preserved by arsenite and EGF in an additive fashion, but neither was effective when the receptor tyrosine kinase activity was inhibited. Arsenite prevented the loss of EGF receptor protein and phosphorylation of tyrosine 1173, preserving its capability to signal. The level of nuclear {beta}-catenin was higher in cells treated with arsenite and EGF in parallel to elevated colony forming ability, and expression of a dominant negative {beta}-catenin suppressed the increase in both colony forming ability and yield of putative stem cells induced by arsenite and EGF. As judged by expression of three genes regulated by {beta}-catenin, this transcription factor had substantially higher activity in the arsenite/EGF-treated cells. Trivalent antimony exhibited the same effects as arsenite. A novel finding is that insulin in the medium induced the loss of EGF receptor protein, which was largely prevented by arsenite exposure.

  7. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.

    PubMed

    Kwak, June M; Mori, Izumi C; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L; Bloom, Rachel E; Bodde, Sara; Jones, Jonathan D G; Schroeder, Julian I

    2003-06-01

    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca(2+) increases and ABA- activation of plasma membrane Ca(2+)-permeable channels in guard cells. Exogenous H(2)O(2) rescues both Ca(2+) channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction.

  8. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  9. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R

    1983-01-01

    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  10. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  11. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

    1997-01-01

    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  12. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells.

    PubMed

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-01

    Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1kd cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1kd cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H2O2) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H2O2 among AOX1kd cells confirmed production of H2O2 in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H2O2.

  13. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  14. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  15. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  16. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  17. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion.

  18. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  19. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses.

  20. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  1. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  2. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  3. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  4. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  5. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  6. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  7. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].

    PubMed

    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V

    2008-01-01

    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  8. Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

    PubMed

    Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

    2003-10-01

    Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels. PMID:14561072

  9. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  10. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae.

  11. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. PMID:27421668

  12. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

    2004-01-01

    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  13. The LOXL2 gene encodes a new lysyl oxidase-like protein and is expressed at high levels in reproductive tissues.

    PubMed

    Jourdan-Le Saux, C; Tronecker, H; Bogic, L; Bryant-Greenwood, G D; Boyd, C D; Csiszar, K

    1999-04-30

    We have reported in this paper the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology with the conserved copper-binding and catalytic domains of both lysyl oxidase (LOX) and the lysyl oxidase-like (LOXL) protein. These conserved domains are encoded by five consecutive exons within the LOX, LOXL, and LOXL2 genes that also maintained exon-intron structure conservation. In contrast, six exons encoding the amino-terminal domains diverged both in sequence and structure. Exon 1 of the LOXL2 gene does not encode a signal sequence that is present in LOX and LOXL, suggesting a different processing and intracellular localization for this new protein. Expression of the LOXL2 gene was detected in almost all tissues with the highest steady state mRNA levels in the reproductive tissues, placenta, uterus and prostate. In situ hybridization identified placental syncytial and cytotrophoblasts responsible for the synthesis of LOXL2 mRNA and demonstrated a spatial and temporal expression pattern unique to the LOXL2 gene.

  14. Arsenite modifies structure of soil microbial communities and arsenite oxidization potential.

    PubMed

    Lami, Raphaël; Jones, L Camille; Cottrell, Matthew T; Lafferty, Brandon J; Ginder-Vogel, M; Sparks, Donald L; Kirchman, David L

    2013-05-01

    The influence of arsenite [As(III)] on natural microbial communities and the capacity of exposed communities to oxidize As(III) has not been well explored. In this study, we conducted soil column experiments with a natural microbial community exposed to different carbon conditions and a continuous flow of As(III). We measured the oxidation rates of As(III) to As(V), and the composition of the bacterial community was monitored by 454 pyrosequencing of 16S rRNA genes. The diversity of As(III)-oxidizing bacteria was examined with the aox gene, which encodes the enzyme involved in As(III) oxidation. Arsenite oxidation was high in the live soil regardless of the carbon source and below detection in sterilized soil. In columns amended with 200 μmol kg(-1) of As (III), As(V) concentrations reached 158 μmol kg(-1) in the column effluent, while As(III) decreased to unmeasurable levels. Although the number of bacterial taxa decreased by as much as twofold in treatments amended with As(III), some As(III)-oxidizing bacterial groups increased up to 20-fold. Collectively, the data show the large effect of As(III) on bacterial diversity, and the capacity of natural communities from a soil with low initial As contamination to oxidize large inputs of As(III).

  15. Expression of WWOX and FHIT is downregulated by exposure to arsenite in human uroepithelial cells.

    PubMed

    Huang, Ya-Chun; Hung, Wen-Chun; Chen, Wan-Tzu; Yu, Hsin-Su; Chai, Chee-Yin

    2013-07-01

    Ecological studies in Taiwan, Chile, Argentina, Bangladesh, and Mexico have confirmed significant dose-dependent associations between ingestion of arsenic-contaminated drinking water and the risk of various human malignancies. The FHIT and WWOX genes are active in common fragile sites FRA3B and FRA16D, respectively. Reduced expression of FHIT or WWOX is known to be an early indicator of carcinogen-induced cancers. However, the effect of arsenite on the expressions and molecular mechanisms of these markers is still unclear. The aims of this study were (i) to observe the expression of ATR, WWOX and FHIT proteins in urothelial carcinoma (UC) between endemic and non-endemic areas of blackfoot disease (BFD) by immunohistochemical analyses; (ii) to compare expression of these genes between arsenite-treated SV-HUC-1 human epithelial cells and rat uroepithelial cells; and (iii) to determine the role of DNMT and MEK inhibitors on expressions of WWOX and FHIT in response to arsenite in SV-HUC-1. The experiments revealed that expressions of ATR, WWOX and FHIT in UC significantly differed between BFD areas and non-BFD areas (p=0.003, 0.009 and 0.021, respectively). In fact, the results for the arsenite-treated groups showed that ATR, WWOX and FHIT are downregulated by arsenite in SV-HUC-1. However, the inhibitors suppressed the effects of arsenite on WWOX and FHIT proteins and mRNA expression. In conclusion, arsenite decreased expressions of ATR, WWOX and FHIT via ERK1/2 activation in SV-HUC-1 cells. These findings confirm that dysregulations of these markers may contribute to arsenite-induced carcinogenesis.

  16. Expression of WWOX and FHIT is downregulated by exposure to arsenite in human uroepithelial cells.

    PubMed

    Huang, Ya-Chun; Hung, Wen-Chun; Chen, Wan-Tzu; Yu, Hsin-Su; Chai, Chee-Yin

    2013-07-01

    Ecological studies in Taiwan, Chile, Argentina, Bangladesh, and Mexico have confirmed significant dose-dependent associations between ingestion of arsenic-contaminated drinking water and the risk of various human malignancies. The FHIT and WWOX genes are active in common fragile sites FRA3B and FRA16D, respectively. Reduced expression of FHIT or WWOX is known to be an early indicator of carcinogen-induced cancers. However, the effect of arsenite on the expressions and molecular mechanisms of these markers is still unclear. The aims of this study were (i) to observe the expression of ATR, WWOX and FHIT proteins in urothelial carcinoma (UC) between endemic and non-endemic areas of blackfoot disease (BFD) by immunohistochemical analyses; (ii) to compare expression of these genes between arsenite-treated SV-HUC-1 human epithelial cells and rat uroepithelial cells; and (iii) to determine the role of DNMT and MEK inhibitors on expressions of WWOX and FHIT in response to arsenite in SV-HUC-1. The experiments revealed that expressions of ATR, WWOX and FHIT in UC significantly differed between BFD areas and non-BFD areas (p=0.003, 0.009 and 0.021, respectively). In fact, the results for the arsenite-treated groups showed that ATR, WWOX and FHIT are downregulated by arsenite in SV-HUC-1. However, the inhibitors suppressed the effects of arsenite on WWOX and FHIT proteins and mRNA expression. In conclusion, arsenite decreased expressions of ATR, WWOX and FHIT via ERK1/2 activation in SV-HUC-1 cells. These findings confirm that dysregulations of these markers may contribute to arsenite-induced carcinogenesis. PMID:23618899

  17. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future.

  18. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  19. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  20. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase.

    PubMed

    Andjelković, Ana; Kemppainen, Kia K; Jacobs, Howard T

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  1. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  2. Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

    SciTech Connect

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young; Kim, Dong-Jae; Na, Yi-Rang; Noh, Kyoung-Jin; Park, Sung-Hoon; Lee, Hyun-Kyoung; Lee, Byoung-Hee; Ryu, Doug-Young; Park, Jae-Hak

    2007-12-01

    In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response element (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.

  3. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  4. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  5. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  6. Arsenite-oxidizing bacteria exhibiting plant growth promoting traits isolated from the rhizosphere of Oryza sativa L.: Implications for mitigation of arsenic contamination in paddies.

    PubMed

    Das, Suvendu; Jean, Jiin-Shuh; Chou, Mon-Lin; Rathod, Jagat; Liu, Chia-Chuan

    2016-01-25

    Arsenite-oxidizing bacteria exhibiting plant growth promoting (PGP) traits can have the advantages of reducing As-uptake by rice and promoting plant growth in As-stressed soil. A gram-positive bacterium Bacillus flexus ASO-6 resistant to high levels of As (32 and 280 mM for arsenite and arsenate, respectively) and exhibiting elevated rates of As(III) oxidation (Vmax=1.34 μM min(-1) 10(-7) cell) was isolated from rhizosphere of rice. The presence of aoxB gene and exhibition of As(III)-oxidase enzyme activity of this strain was observed. The ability of the strain to produce siderophore, IAA, ACC-deaminase and to solubilize phosphate was verified. The rice seed treated with the strain exhibited significantly improved seed germination and seedling vigor compared with the un-inoculated seeds. The bacterial inoculation significantly increased root biomass, straw yield, grain yield, chlorophyll and carotenoid in the rice plant. Moreover, As uptake from root to shoot and As accumulation in straw and grain decreased significantly as a result of the bacterial inoculation. Noteworthy, the inoculation effect is more prominent in non-flooded soil than it is in flooded soil. Owing to its wide action spectrum, this As(III)-oxidizing PGPB could serve as a potential bio-inoculant for mitigation of As in paddies and sustainable rice production in As-contaminated areas. PMID:26448489

  7. Arsenite-oxidizing bacteria exhibiting plant growth promoting traits isolated from the rhizosphere of Oryza sativa L.: Implications for mitigation of arsenic contamination in paddies.

    PubMed

    Das, Suvendu; Jean, Jiin-Shuh; Chou, Mon-Lin; Rathod, Jagat; Liu, Chia-Chuan

    2016-01-25

    Arsenite-oxidizing bacteria exhibiting plant growth promoting (PGP) traits can have the advantages of reducing As-uptake by rice and promoting plant growth in As-stressed soil. A gram-positive bacterium Bacillus flexus ASO-6 resistant to high levels of As (32 and 280 mM for arsenite and arsenate, respectively) and exhibiting elevated rates of As(III) oxidation (Vmax=1.34 μM min(-1) 10(-7) cell) was isolated from rhizosphere of rice. The presence of aoxB gene and exhibition of As(III)-oxidase enzyme activity of this strain was observed. The ability of the strain to produce siderophore, IAA, ACC-deaminase and to solubilize phosphate was verified. The rice seed treated with the strain exhibited significantly improved seed germination and seedling vigor compared with the un-inoculated seeds. The bacterial inoculation significantly increased root biomass, straw yield, grain yield, chlorophyll and carotenoid in the rice plant. Moreover, As uptake from root to shoot and As accumulation in straw and grain decreased significantly as a result of the bacterial inoculation. Noteworthy, the inoculation effect is more prominent in non-flooded soil than it is in flooded soil. Owing to its wide action spectrum, this As(III)-oxidizing PGPB could serve as a potential bio-inoculant for mitigation of As in paddies and sustainable rice production in As-contaminated areas.

  8. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.

    PubMed

    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M

    2003-01-01

    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants.

  9. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit.

  10. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  11. Long-term performance of rapid oxidation of arsenite in simulated groundwater using a population of arsenite-oxidizing microorganisms in a bioreactor.

    PubMed

    Li, Hao; Zeng, Xian-Chun; He, Zhong; Chen, Xiaoming; E, Guoji; Han, Yiyang; Wang, Yanxin

    2016-09-15

    A population of arsenite-oxidizing microorganisms enriched from the tailing of the Shimen realgar mine was used to generate biofilms on the surfaces of perlites. This bioreactor is able to completely oxidize 1100 μg/L As(III) dissolved in simulated groundwater into As(V) within 10 min; after 140 days of operation, approximately 20 min were required to completely oxidize the same concentration of As(III). Analysis for the 16S rRNA genes of the microbial community showed that Bacteroidetes and Proteobacteria are dominant in the reactor. Six different bacterial strains were randomly isolated from the reactor. Function and gene analysis indicated that all the isolates possess arsenite-oxidizing activity, and five of them are chemoautotrophic. Further analysis showed that a large diversity of AioAs and two types of RuBisCOs are present in the microbial community. This suggests that many chemoautotrophic arsenite-oxidizing microorganisms were responsible for quick oxidation of arsenite in the reactor. We also found that the reactor is easily regenerated and its number is readily expanded. To the best of our knowledge, the arsenite-oxidizing efficiency, which was expressed as the minimum time for complete oxidization of a certain concentration of As(III) under a single operation, of this bioreactor is the highest among the described bioreactors; it is also the most stable, economic and environment-friendly.

  12. Long-term performance of rapid oxidation of arsenite in simulated groundwater using a population of arsenite-oxidizing microorganisms in a bioreactor.

    PubMed

    Li, Hao; Zeng, Xian-Chun; He, Zhong; Chen, Xiaoming; E, Guoji; Han, Yiyang; Wang, Yanxin

    2016-09-15

    A population of arsenite-oxidizing microorganisms enriched from the tailing of the Shimen realgar mine was used to generate biofilms on the surfaces of perlites. This bioreactor is able to completely oxidize 1100 μg/L As(III) dissolved in simulated groundwater into As(V) within 10 min; after 140 days of operation, approximately 20 min were required to completely oxidize the same concentration of As(III). Analysis for the 16S rRNA genes of the microbial community showed that Bacteroidetes and Proteobacteria are dominant in the reactor. Six different bacterial strains were randomly isolated from the reactor. Function and gene analysis indicated that all the isolates possess arsenite-oxidizing activity, and five of them are chemoautotrophic. Further analysis showed that a large diversity of AioAs and two types of RuBisCOs are present in the microbial community. This suggests that many chemoautotrophic arsenite-oxidizing microorganisms were responsible for quick oxidation of arsenite in the reactor. We also found that the reactor is easily regenerated and its number is readily expanded. To the best of our knowledge, the arsenite-oxidizing efficiency, which was expressed as the minimum time for complete oxidization of a certain concentration of As(III) under a single operation, of this bioreactor is the highest among the described bioreactors; it is also the most stable, economic and environment-friendly. PMID:27288673

  13. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed

    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M

    1998-08-01

    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family.

  14. Arsenite-induced autophagy is associated with proteotoxicity in human lymphoblastoid cells

    SciTech Connect

    Bolt, Alicia M.; Zhao, Fei; Pacheco, Samantha; Klimecki, Walter T.

    2012-10-15

    Epidemiological studies of arsenic-exposed populations have provided evidence that arsenic exposure in humans is associated with immunosuppression. Previously, we have reported that arsenite-induced toxicity is associated with the induction of autophagy in human lymphoblastoid cell lines (LCL). Autophagy is a cellular process that functions in the degradation of damaged cellular components, including protein aggregates formed by misfolded or damaged proteins. Accumulation of misfolded or damaged proteins in the endoplasmic reticulum (ER) lumen causes ER stress and activates the unfolded protein response (UPR). In an effort to investigate the mechanism of autophagy induction by arsenite in the LCL model, we examined the potential contribution of ER stress and activation of the UPR. LCL exposed to sodium arsenite for 8-days induced expression of UPR-activated genes, including CHOP and GRP78, at the RNA and the protein level. Evidence for activation of the three arms of the UPR was observed. The arsenite-induced activation of the UPR was associated with an accumulation of protein aggregates containing p62 and LC3, proteins with established roles in the sequestration and autophagic clearance of protein aggregates. Taken together, these data provide evidence that arsenite-induced autophagy is associated with the generation of ER stress, activation of the UPR, and formation of protein aggregates that may be targeted to the lysosome for degradation. -- Highlights: ► Arsenite induces endoplasmic reticulum stress and the unfolded protein response. ► Arsenite induces the formation of protein aggregates that contain p62 and LC3-II. ► Time-course data suggests that arsenite-induced autophagy precedes ER stress.

  15. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  16. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  17. Arsenite oxidizing Thiomonas strains isolated from different mining sites

    NASA Astrophysics Data System (ADS)

    Battaglia-Brunet, F.; Duquesne, K.; Dictor, M. C.; Garrido, F.; Bonnefoy, V.; Baranger, P.; Morin, D.

    2003-04-01

    Arsenic is commonly found in sulfide rocks and ores. This toxic metalloid is transferred to the water phase through acidophilic bio-oxidation of sulfides in mining galleries and waste dumps. Inorganic arsenic As(III) and As(V) are both soluble anions, however As(III) is more mobile and toxic than As(V). Bacteria can participate to the biogeochemical arsenic cycling through As(III) oxidation or As(V) reduction. Mineral selective media, containing As(III) as sole energy source, were used to isolate As(III)-oxidizing bacteria from two disused mining sites. Cheni site (Haute Vienne) was a gold mine, and Carnoules (Gard) was lead-zinc mine. Both sites are highly contaminated with arsenic. Samples of sediments and water from Cheni (pH 6) and Carnoules (pH 3) were used to inoculate mineral selective media whose pH were adjusted to those of the sampling environments. In both cases, organisms belonging to the genus Thiomonas were selected, then isolated. These bacteria oxidize arsenite during their exponential growth phase. The Both bacteria are able to grow, as a pure strains, in autotrophic conditions. The As(III)-oxidase activity of the Carnoules strain was exclusively found in cells cultivated with arsenite, and was associated to the membrane. If they can use As(III) as energetic substrate, Thiomonas-related organisms may play an important role in the biogeochemical cycling of arsenic within mining ecosystems.

  18. Sorption of Arsenite onto Mackinawite Coated Sand

    NASA Astrophysics Data System (ADS)

    Gallegos, T. J.; Hayes, K. F.; Abriola, L. M.

    2004-05-01

    Arsenic contamination of groundwater is a widespread problem affecting aquifers in the United States as well as abroad. Recent strengthening of the US EPA MCL for arsenic has prompted the need for technology capable of removing both arsenite and arsenate from solution. Arsenite, the more toxic form of arsenic, is more difficult to remove from anoxic zones in the subsurface. Studies by others have demonstrated the affinity of some types of iron sulfides for arsenite, such as troilite, pyrite, amorphous iron sulfide and mackinawite. However, these studies have not provided a comprehensive investigation of the macroscopic behavior of arsenite in the presence of crystalline mackinawite in a form that can be readily applied to real-world treatment technologies. This study examines the behavior of arsenite in the presence of mackinawite coated sand. PH edge results demonstrate that arsenite sorption onto mackinawite coated sand increases with increasing pH, reaching maximum removal at pH 10. Arsenite removal, albeit slight, occurring below pH 5 is independent of pH indicative of a different removal mechanism. Isotherm studies show that at low concentrations, removal is Langmuirian in nature. Arsenite sorption abruptly converts to linear behavior at high concentrations, possibly attributed to the saturation of the monolayer. Ionic strength effects were assessed by comparing pH edge data developed for three different concentrations of NaCl background electrolyte solution. Increases in ionic strength enhance the removal of arsenite from solution, suggesting possible inner-sphere surface complexation removal mechanisms. Information gathered in this study can be used to further develop surface complexation models to describe and predict reactivity of arsenite in the presence of mackinawite coated sands in anoxic regions. Mackinawite coated sands investigated here may provide a feasible reactive medium for implementation in above-ground sorption reactors or subsurface

  19. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  20. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.

    PubMed

    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang

    2015-10-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  1. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.

    PubMed

    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun

    2014-11-01

    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  2. From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.

    PubMed

    Luz, Anthony L; Godebo, Tewodros R; Bhatt, Dhaval P; Ilkayeva, Olga R; Maurer, Laura L; Hirschey, Matthew D; Meyer, Joel N

    2016-08-01

    Millions of people worldwide are chronically exposed to arsenic through contaminated drinking water. Despite decades of research studying the carcinogenic potential of arsenic, the mechanisms by which arsenic causes cancer and other diseases remain poorly understood. Mitochondria appear to be an important target of arsenic toxicity. The trivalent arsenical, arsenite, can induce mitochondrial reactive oxygen species production, inhibit enzymes involved in energy metabolism, and induce aerobic glycolysis in vitro, suggesting that metabolic dysfunction may be important in arsenic-induced disease. Here, using the model organism Caenorhabditis elegans and a novel metabolic inhibition assay, we report an in vivo induction of aerobic glycolysis following arsenite exposure. Furthermore, arsenite exposure induced severe mitochondrial dysfunction, including altered pyruvate metabolism; reduced steady-state ATP levels, ATP-linked respiration and spare respiratory capacity; and increased proton leak. We also found evidence that induction of autophagy is an important protective response to arsenite exposure. Because these results demonstrate that mitochondria are an important in vivo target of arsenite toxicity, we hypothesized that deficiencies in mitochondrial electron transport chain genes, which cause mitochondrial disease in humans, would sensitize nematodes to arsenite. In agreement with this, nematodes deficient in electron transport chain complexes I, II, and III, but not ATP synthase, were sensitive to arsenite exposure, thus identifying a novel class of gene-environment interactions that warrant further investigation in the human populace.

  3. Novel carotenoid-based biosensor for simple visual detection of arsenite: characterization and preliminary evaluation for environmental application.

    PubMed

    Yoshida, Kazuyuki; Inoue, Koichi; Takahashi, Yuko; Ueda, Shunsaku; Isoda, Katsuhiro; Yagi, Kiyohito; Maeda, Isamu

    2008-11-01

    A novel whole-cell arsenite biosensor was developed using the photosynthetic bacterium Rhodopseudomonas palustris no. 7 and characterized. A sensor plasmid containing the operator-promoter region of the ars operon and arsR gene from Escherichia coli and the crtI gene from R. palustris no. 7 was introduced into a blue-green mutant with crtI deleted, R. palustris no. 711. The biosensor changed color in response to arsenite, and the change was obvious to the naked eye after 24 h without further manipulation. Real-time reverse transcription-PCR showed that the crtI mRNA was induced 3-fold at 3 h and 2.5-fold at 6 h after addition of 50 microg/liter arsenite compared with the no-arsenite control, and consistent with this, the relative levels of lycopene and rhodopin also increased compared with the control. Colorimetric analysis of the bacteria showed that the hue angle had clearly shifted from green-yellow toward red in an arsenic dose-dependent manner at 24 h after arsenite addition. This obvious shift occurred irrespective of the culture conditions before arsenite was added, indicating that the color change of the biosensor is stable in water samples containing various concentrations of dissolved oxygen. Finally, assays using samples prepared in various types of mineral water indicated that this biosensor could be used to screen groundwater samples for the presence of arsenite in a variety of locations, even where electricity is not available.

  4. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli.

  5. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.

    2013-01-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  6. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.

    PubMed

    Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet

    2009-10-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

  7. Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae.

    PubMed Central

    Bonnefoy, N; Kermorgant, M; Groudinsky, O; Minet, M; Slonimski, P P; Dujardin, G

    1994-01-01

    The yeast nuclear gene OXA1 is essential for cytochrome oxidase assembly, so that a null mutation in the OXA1 gene leads to complete respiratory deficiency. We have cloned by genetic selection a human OXA1 (OXA1Hs) cDNA that complements the respiratory defect of yeast oxa1 mutants. The deduced sequence of the human protein shares 33% identity with the yeast OXA1 protein. The OXA1Hs cDNA corresponds to a single and relatively highly expressed gene. Oxygen consumption measurements and cytochrome absorption spectra show that replacement of the yeast protein with the human homolog leads to the correct assembly of cytochrome oxidase, suggesting that the proteins play essentially the same role in both organisms. Images PMID:7991568

  8. The NADPH Oxidase Subunit NOX4 Is a New Target Gene of the Hypoxia-inducible Factor-1

    PubMed Central

    Diebold, Isabel; Petry, Andreas; Hess, John

    2010-01-01

    NADPH oxidases are important sources of reactive oxygen species (ROS), possibly contributing to various disorders associated with enhanced proliferation. NOX4 appears to be involved in vascular signaling and may contribute to the response to hypoxia. However, the exact mechanisms controlling NOX4 levels under hypoxia are not resolved. We found that hypoxia rapidly enhanced NOX4 mRNA and protein levels in pulmonary artery smooth-muscle cells (PASMCs) as well as in pulmonary vessels from mice exposed to hypoxia. This response was dependent on the hypoxia-inducible transcription factor HIF-1α because overexpression of HIF-1α increased NOX4 expression, whereas HIF-1α depletion prevented this response. Mutation of a putative hypoxia-responsive element in the NOX4 promoter abolished hypoxic and HIF-1α–induced activation of the NOX4 promoter. Chromatin immunoprecipitation confirmed HIF-1α binding to the NOX4 gene. Induction of NOX4 by HIF-1α contributed to maintain ROS levels after hypoxia and hypoxia-induced proliferation of PASMCs. These findings show that NOX4 is a new target gene of HIF-1α involved in the response to hypoxia. Together with our previous findings that NOX4 mediates HIF-1α induction under normoxia, these data suggest an important role of the signaling axis between NOX4 and HIF-1α in various cardiovascular disorders under hypoxic and also nonhypoxic conditions. PMID:20427574

  9. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

    PubMed

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

    2006-11-01

    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

  10. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  11. Two distinct arsenite-resistant variants of Leishmania amazonensis take different routes to achieve resistance as revealed by comparative transcriptomics.

    PubMed

    Lin, Yi-Chun; Hsu, Ju-Yu; Shu, Jui-Hsu; Chi, Yi; Chiang, Su-Chi; Lee, Sho Tone

    2008-11-01

    Genome-wide search for the genes involved in arsenite resistance in two distinct variants A and A' of Leishmania amazonensis revealed that the two variants used two different mechanisms to achieve resistance, even though these two variants were derived from the same clone and selected against arsenite under the same conditions. In variant A, the variant with DNA amplification, the biochemical pathways for detoxification of oxidative stress, the energy generation system to support the biochemical and physiological needs of the variant for DNA and protein synthesis and the arsenite translocating system to dispose arsenite are among the primary biochemical events that are upregulated under the arsenite stress to gain resistance. In variant A', the variant without DNA amplification, the upregulation of aquaglyceroporin (AQP) gene and the high level of resistance to arsenate point to the direction that the resistance gained by the variant is due to arsenate which is probably oxidized from arsenite in the arsenite solution used for selection and the maintenance of the cell culture. As a result of the AQP upregulation for arsenite disposal, a different set of biochemical pathways for detoxification of oxidative stress, energy generation and cellular signaling are upregulated to sustain the growth of the variant to gain resistance to arsenate. From current evidences, reactive oxygen species (ROS) overproduced by the parasite soon after exposure to arsenite appear to play an instrumental role in both variants to initiate the subsequent biochemical events that allow the same clone of L. amazonensis to take two totally different routes to diverge into two different variants.

  12. Genetic basis of arsenite and cadmium tolerance in Saccharomyces cerevisiae

    PubMed Central

    Thorsen, Michael; Perrone, Gabriel G; Kristiansson, Erik; Traini, Mathew; Ye, Tian; Dawes, Ian W; Nerman, Olle; Tamás, Markus J

    2009-01-01

    Background Arsenic and cadmium are widely distributed in nature and pose serious threats to the environment and human health. Exposure to these nonessential toxic metals may result in a variety of human diseases including cancer. However, arsenic and cadmium toxicity targets and the cellular systems contributing to tolerance acquisition are not fully known. Results To gain insight into metal action and cellular tolerance mechanisms, we carried out genome-wide screening of the Saccharomyces cerevisiae haploid and homozygous diploid deletion mutant collections and scored for reduced growth in the presence of arsenite or cadmium. Processes found to be required for tolerance to both metals included sulphur and glutathione biosynthesis, environmental sensing, mRNA synthesis and transcription, and vacuolar/endosomal transport and sorting. We also identified metal-specific defence processes. Arsenite-specific defence functions were related to cell cycle regulation, lipid and fatty acid metabolism, mitochondrial biogenesis, and the cytoskeleton whereas cadmium-specific defence functions were mainly related to sugar/carbohydrate metabolism, and metal-ion homeostasis and transport. Molecular evidence indicated that the cytoskeleton is targeted by arsenite and that phosphorylation of the Snf1p kinase is required for cadmium tolerance. Conclusion This study has pin-pointed core functions that protect cells from arsenite and cadmium toxicity. It also emphasizes the existence of both common and specific defence systems. Since many of the yeast genes that confer tolerance to these agents have homologues in humans, similar biological processes may act in yeast and humans to prevent metal toxicity and carcinogenesis. PMID:19284616

  13. NAD(P)H oxidase p22phox gene C242T polymorphism, nitric oxide production, salt sensitivity and cardiovascular risk factors in Hispanics.

    PubMed

    Castejon, A M; Bracero, J; Hoffmann, I S; Alfieri, A B; Cubeddu, L X

    2006-10-01

    Mutations in the NAD(P)H oxidase gene may be associated with abnormal superoxide generation, nitric oxide (NO) availability and cardiovascular diseases. We investigated the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism, and its possible association with blood pressure, NO production, salt sensitivity and cardiovascular risk factors in Hispanics. Genotype frequencies were as follows: CC, 52.9%; CT, 40.3%; and TT, 6.8%. There were no significant differences in systolic blood pressure, diastolic blood pressure, age, weight, fasting and post-load glucose levels, LDL and HDL cholesterol, triglyceride and urinary albumin levels in subjects with CC, CT or the TT genotypes. Presence of the T allele was associated with increased salt sensitivity in women, but not in men. NO metabolite excretion was markedly decreased both in women and men with the TT genotype (CC: 868+/-79 micromol/day; CT: 839+/-75 micromol/day; TT: 534+/-78 micromol/day; P<0.05). In conclusion, the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism in Venezuelans was comparable to that of Caucasians, but different from that of Chinese and Japanese. Although the T allele was not associated with cardiovascular risk factors, hyperinsulinaemia or hypertension, in women, it appeared to be a genetic susceptibility factor for salt sensitivity. Both in women and men, the p22phox gene may play a role in the genetic control of NO levels.

  14. NADPH Oxidase-derived Reactive Oxygen Species Increases Expression of Monocyte Chemotactic Factor Genes in Cultured Adipocytes*

    PubMed Central

    Han, Chang Yeop; Umemoto, Tomio; Omer, Mohamed; Den Hartigh, Laura J.; Chiba, Tsuyoshi; LeBoeuf, Renee; Buller, Carolyn L.; Sweet, Ian R.; Pennathur, Subramaniam; Abel, E. Dale; Chait, Alan

    2012-01-01

    Excess glucose and free fatty acids delivered to adipose tissue causes local inflammation, which contributes to insulin resistance. Glucose and palmitate generate reactive oxygen species (ROS) in adipocytes, leading to monocyte chemotactic factor gene expression. Docosahexaenoate (DHA) has the opposite effect. In this study, we evaluated the potential sources of ROS in the presence of excess nutrients. Differentiated 3T3-L1 adipocytes were exposed to palmitate and DHA (250 μm) in either 5 or 25 mm glucose to evaluate the relative roles of mitochondrial electron transport and NADPH oxidases (NOX) as sources of ROS. Excess glucose and palmitate did not increase mitochondrial oxidative phosphorylation. However, glucose exposure increased glycolysis. Of the NOX family members, only NOX4 was expressed in adipocytes. Moreover, its activity was increased by excess glucose and palmitate and decreased by DHA. Silencing NOX4 inhibited palmitate- and glucose-stimulated ROS generation and monocyte chemotactic factor gene expression. NADPH, a substrate for NOX, and pentose phosphate pathway activity increased with glucose but not palmitate and decreased with DHA exposure. Inhibition of the pentose phosphate pathway by glucose-6-phosphate dehydrogenase inhibitors and siRNA suppressed ROS generation and monocyte chemotactic factor gene expression induced by both glucose and palmitate. Finally, both high glucose and palmitate induced NOX4 translocation into lipid rafts, effects that were blocked by DHA. Excess glucose and palmitate generate ROS via NOX4 rather than by mitochondrial oxidation in cultured adipocytes. NOX4 is regulated by both NADPH generated in the PPP and translocation of NOX4 into lipid rafts, leading to expression of monocyte chemotactic factors. PMID:22287546

  15. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.

    PubMed

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-07-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms.

  16. Anaerobic oxidation of arsenite in Mono Lake water and by a facultative, arsenite-oxidizing chemoautotroph, strain MLHE-1

    USGS Publications Warehouse

    Oremland, R.S.; Hoeft, S.E.; Santini, J.M.; Bano, N.; Hollibaugh, R.A.; Hollibaugh, J.T.

    2002-01-01

    Arsenite [As(III)]-enriched anoxic bottom water from Mono Lake, California, produced arsenate [As(V)] during incubation with either nitrate or nitrite. No such oxidation occurred in killed controls or in live samples incubated without added nitrate or nitrite. A small amount of biological As(III) oxidation was observed in samples amended with Fe(III) chelated with nitrolotriacetic acid, although some chemical oxidation was also evident in killed controls. A pure culture, strain MLHE-1, that was capable of growth with As(III) as its electron donor and nitrate as its electron acceptor was isolated in a defined mineral salts medium. Cells were also able to grow in nitrate-mineral salts medium by using H2 or sulfide as their electron donor in lieu of As(III). Arsenite-grown cells demonstrated dark 14CO2 fixation, and PCR was used to indicate the presence of a gene encoding ribulose-1,5-biphosphate carboxylase/oxygenase. Strain MLHE-1 is a facultative chemoautotroph, able to grow with these inorganic electron donors and nitrate as its electron acceptor, but heterotrophic growth on acetate was also observed under both aerobic and anaerobic (nitrate) conditions. Phylogenetic analysis of its 16S ribosomal DNA sequence placed strain MLHE-1 within the haloalkaliphilic Ectothiorhodospira of the ??-Proteobacteria. Arsenite oxidation has never been reported for any members of this subgroup of the Proteobacteria.

  17. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity.

  18. Cellular Response of Sinorhizobium sp. Strain A2 during Arsenite Oxidation

    PubMed Central

    Fukushima, Koh; Huang, He; Hamamura, Natsuko

    2015-01-01

    Arsenic (As) is a widely distributed toxic element in the environment and microorganisms have developed resistance mechanisms in order to tolerate it. The cellular response of the chemoorganotrophic arsenite (As[III])-oxidizing α-Proteobacteria, Sinorhizobium sp. strain A2, to arsenic was examined in the present study. Several proteins associated with arsenite oxidase and As resistance were shown to be accumulated in the presence of As(III). A shift in central carbon metabolism from the tricarboxylic acid pathway to glyoxylate pathway was also observed in response to oxidative stress. Our results revealed the strategy of the As(III)-oxidizing Sinorhizobium strain to mitigate arsenic toxicity and oxidative damage by multiple metabolic adaptations. PMID:26477790

  19. Roles of mitogen activated protein kinases and EGF receptor in arsenite-stimulated matrix metalloproteinase-9 production

    SciTech Connect

    Cooper, Karen L.; Myers, Terrance Alix; Rosenberg, Martina; Chavez, Miquella; Hudson, Laurie G. . E-mail: lghudson@unm.edu

    2004-11-01

    The dermatotoxicity of arsenic is well established and epidemiological studies identify an increased incidence of keratinocytic tumors (basal cell and squamous cell carcinoma) associated with arsenic exposure. Little is known about the underlying mechanisms of arsenic-mediated skin carcinogenesis, but activation of mitogen-activated protein (MAP) kinases and subsequent regulation of downstream target genes may contribute to tumor promotion and progression. In this study, we investigated activation of the extracellular signal regulated kinase (ERK) and the stress-associated kinase p38 by arsenite in HaCat cells, a spontaneously immortalized human keratinocyte cell line. Arsenite concentrations {>=}100 {mu}M stimulate rapid activation of p38 and ERK MAP kinases. However, upon extended exposure (24 h), persistent stimulation of p38 and ERK MAP kinases was detected at low micromolar concentrations of arsenite. Although ERK and p38 were activated with similar time and concentration dependence, the mechanism of activation differed for these two MAP kinases. ERK activation by arsenite was fully dependent on the catalytic activity of the epidermal growth factor (EGF) receptor and partially dependent on Src-family kinase activity. In contrast, p38 activation was independent of EGF receptor or Src-family kinase activity. Arsenite-stimulated MAP kinase signal transduction resulted in increased production of matrix metalloproteinase (MMP)-9, an AP-1 regulated gene product. MMP-9 induction by arsenite was prevented when EGF receptor or MAP kinase signaling was inhibited. These studies indicate that EGF receptor activation is a component of arsenite-mediated signal transduction and gene expression in keratinocytes and that low micromolar concentrations of arsenite stimulate key signaling pathways upon extended exposure. Stimulation of MAP kinase cascades by arsenic and subsequent regulation of genes including c-fos, c-jun, and the matrix degrading proteases may play an important

  20. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.

    PubMed

    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

    2014-08-01

    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures.

  1. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  2. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  3. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  4. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  5. Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

    PubMed Central

    Piedade, Ana Paula; Morais, Paula V.

    2015-01-01

    Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104

  6. The metalloid arsenite induces nuclear export of Id3 possibly via binding to the N-terminal cysteine residues

    SciTech Connect

    Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi

    2013-04-19

    Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite.

  7. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  8. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  9. Regulation of gibberellin 20-oxidase gene expression and gibberellin content in citrus by temperature and citrus exocortis viroid.

    PubMed

    Vidal, Ana M; Ben-Cheikh, Waddi; Talón, Manuel; García-Martínez, José L

    2003-07-01

    A cDNA clone coding for a gibberellin (GA) 20-oxidase ( CcGA20ox1), an enzyme of GA biosynthesis, which when expressed in vitro catalyzed the conversion of GA(12) to GA(9) and of GA(53) to GA(20), was isolated from the citrus hybrid Carrizo citrange (C itrus sinensis x Poncirus trifoliata). Transcripts of CcGA20ox1 were abundant in the apex and leaves and much less abundant in internodes, nodes and roots. Seedlings of Carrizo citrange cultured under a 32 degrees C/27 degrees C (day/night) regime elongated more than seedlings growing under 17 degrees C/12 degrees C conditions. The effect of higher temperature was associated with more CcGA20ox1 transcripts and with higher content of GA(1), the main active GA in citrus, in the shoot. The infection of Etrog citron ( Citrus medica) plants with citrus exocortis viroid (CEVd), which produces a stunted phenotype, reduced the levels of transcripts in the apical shoot hybridizing to the gene CcGA20ox1 of Carrizo citrange and the content of GA(1). Thus GA(1) content correlated with CcGA20ox1 transcript levels. In contrast, results for gibberellic acid (GA(3)) and paclobutrazol applications to Carrizo citrange showed that CcGA20ox1 expression was subject to feed-back regulation. These observations indicate that the feed-back regulation of GA20ox operates mostly when the levels of active GAs have been dramatically altered. The results also show that the growth reduction induced by environmental (temperature) and biotic (CEVd) factors may be partially due to the modulation of the expression of GA20ox genes.

  10. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers.

    PubMed

    Kaneda, Atsushi; Wakazono, Kuniko; Tsukamoto, Tetsuya; Watanabe, Naoko; Yagi, Yukiko; Tatematsu, Masae; Kaminishi, Michio; Sugimura, Takashi; Ushijima, Toshikazu

    2004-09-15

    Lysyl oxidase (LOX) and HRAS-like suppressor (HRASLS) are silenced in human gastric cancers and are reported to have growth-suppressive activities in ras-transformed mouse/rat fibroblasts. Here, we analyzed whether or not LOX and HRASLS are tumor suppressor genes in human gastric cancers. Loss of heterozygosity and promoter methylation of LOX were detected in 33% (9 of 27) and 27% (26 of 96) of gastric cancers, respectively. Biallelic methylation and loss of heterozygosity with promoter methylation were also demonstrated in gastric cancers. Silencing of LOX was also observed in colon, lung, and ovarian cancer cell lines. As for mutations, only one possible somatic mutation was found by analysis of 96 gastric cancer samples and 58 gastric and other cancer cell lines. When LOX was introduced into a gastric cancer cell line, MKN28, in which LOX and HRASLS were silenced, it reduced the number of anchorage-dependent colonies to 57 to 61%, and the number of anchorage-independent colonies to 11 to 23%. Sizes of tumors formed in nude mice were reduced to 19 to 26%. Growth suppression in soft agar assay was also observed in another gastric cancer cell line, KATOIII. On the other hand, neither loss of heterozygosity nor a somatic mutation was detected in HRASLS, and its introduction into MKN28 did not suppress the growth in vitro or in vivo. These data showed that LOX is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in gastric cancers, and possibly also in other cancers. PMID:15374948

  11. Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease

    PubMed Central

    Malech, Harry L.; Maples, Phillip B.; Whiting-Theobald, Narda; Linton, Gilda F.; Sekhsaria, Sudhir; Vowells, Sarah J.; Li, Fei; Miller, Judi A.; DeCarlo, Ellen; Holland, Steven M.; Leitman, Susan F.; Carter, Charles S.; Butz, Robert E.; Read, Elizabeth J.; Fleisher, Thomas A.; Schneiderman, Richard D.; Van Epps, Dennis E.; Spratt, S. Kaye; Maack, Christopher A.; Rokovich, Joseph A.; Cohen, Lawrence K.; Gallin, John I.

    1997-01-01

    Little is known about the potential for engraftment of autologous hematopoietic stem cells in human adults not subjected to myeloablative conditioning regimens. Five adult patients with the p47phox deficiency form of chronic granulomatous disease received intravenous infusions of autologous CD34+ peripheral blood stem cells (PBSCs) that had been transduced ex vivo with a recombinant retrovirus encoding normal p47phox. Although marrow conditioning was not given, functionally corrected granulocytes were detectable in peripheral blood of all five patients. Peak correction occurred 3–6 weeks after infusion and ranged from 0.004 to 0.05% of total peripheral blood granulocytes. Corrected cells were detectable for as long as 6 months after infusion in some individuals. Thus, prolonged engraftment of autologous PBSCs and continued expression of the transduced gene can occur in adults without conditioning. This trial also piloted the use of animal protein-free medium and a blood-bank-compatible closed system of gas-permeable plastic containers for culture and transduction of the PBSCs. These features enhance the safety of PBSCs directed gene therapy. PMID:9342375

  12. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

    PubMed

    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

    2013-10-01

    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

  13. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  14. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  15. Human retina-specific amine oxidase: genomic structure of the gene (AOC2), alternatively spliced variant, and mRNA expression in retina.

    PubMed

    Imamura, Y; Noda, S; Mashima, Y; Kudoh, J; Oguchi, Y; Shimizu, N

    1998-07-15

    Previously, we reported the isolation of cDNA for human retina-specific amine oxidase (RAO) and the expression of RAO exclusively in retina. Bacterial artificial chromosome clones containing the human RAO gene (AOC2) were mapped to human chromosome 17q21 (Imamura et al., 1997, Genomics 40: 277-283). Here, we report the complete genomic structure of the RAO gene, including 5' flanking sequence, and mRNA expression in retina. The human RAO gene spans 6 kb and is composed of four exons corresponding to the amino acid sequence 1-530, 530-598, 598-641, and 642-729 separated by three introns of 3000, 310, and 351 bp. Screening of a human retina cDNA library revealed the existence of an alternatively spliced cDNA variant with an additional 81 bp at the end of exon 2. The sizes of exons and the locations of exon/intron boundaries in the human RAO gene showed remarkable similarity to those of the human kidney diamine oxidase gene (AOC1). In situ hybridization revealed that mRNA coding for RAO is expressed preferentially in the ganglion cell layer of the mouse retina. We designed four sets of PCR primers to amplify four exons, which will be valuable for analyzing mutations in patients with ocular diseases affecting the retinal ganglion cell layer.

  16. Systematic screening of lysyl oxidase-like (LOXL) family genes demonstrates that LOXL2 is a susceptibility gene to intracranial aneurysms.

    PubMed

    Akagawa, Hiroyuki; Narita, Akira; Yamada, Haruhiko; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hori, Tomokatsu; Kubota, Motoo; Saeki, Naokatsu; Hata, Akira; Mizutani, Tohru; Inoue, Ituro

    2007-05-01

    Four lysyl oxidase family genes (LOXL1, LOXL2, LOXL3, and LOXL4), which catalyze cross-linking of collagen and elastin, were considered to be functional candidates for intracranial aneurysms (IA) and were extensively screened for genetic susceptibility in Japanese IA patients. Total RNA was isolated from four paired ruptured IA and superficial temporal artery (STA) tissue and examined by real-time RT-PCR. The expression of LOXL2 in the paired IA and STA tissues was elevated in the IA tissue. A total of 55 single nucleotide polymorphisms (SNPs) of LOXL1-4 were genotyped for an allelic association study in 402 Japanese IA patients and 462 Japanese non-IA controls. Allelic associations were evaluated with the chi-square test and the permutation test especially designed for adjustment of multiple testing. SNPs of LOXL1 and LOXL4 were not significantly associated with IA, while several SNPs of LOXL2 and LOXL3 showed nominally significant associations in IA patients. We detected an empirically significant association with one SNP of LOXL2 in familial IA patients after adjustment for multiple testing [chi(2) = 10.23, empirical P = 0.023, OR (95% CI) = 1.49 (1.17, 1.90)]. Furthermore, multilocus interaction was evaluated by multifactor dimensionality reduction analysis. We found that the SNPs of LOXL2 have an interactive effect with elastin (ELN) and LIM kinase 1 (LIMK1) that have been previously found to be associated with IA. In conclusion, one SNP of LOXL2 showed a significant association with IA individually, and we also detected a gene-gene interaction of LOXL2 with ELN/LIMK1, which may play an important role in susceptibility to IA.

  17. Impact of Arsenite on the Bacterial Community Structure and Diversity in Soil

    PubMed Central

    Dong, Dian-Tao; Yamamura, Shigeki; Amachi, Seigo

    2016-01-01

    The impact of arsenite (As[III]) on the bacterial community structure and diversity in soil was determined by incubating soil slurries with 50, 500, and 5,000 μM As(III). As(III) was oxidized to arsenate (As[V]), and the microbial contribution to As(III) oxidation was 70–100%. PCR-denaturing gradient gel electrophoresis revealed that soil bacterial diversity decreased in the presence of As(III). Bacteria closely related to the family Bacillaceae were predominant in slurry spiked with 5,000 μM As(III). The population size of culturable As(III)-resistant bacteria was 37-fold higher in this slurry than in unspiked slurry (p < 0.01), indicating that high levels of As(III) stimulate the emergence of As(III)-resistant bacteria. As(III)-resistant bacteria isolated from slurry spiked with 5,000 μM As(III) were mainly affiliated with the genus Bacillus; however, no strains showed As(III)-oxidizing capacity. An As(III)-oxidizing bacterial community analysis based on As(III) oxidase gene (aioA) sequences demonstrated that diversity was the lowest in slurry spiked with 5,000 μM As(III). The deduced AioA sequences affiliated with Alphaproteobacteria accounted for 91–93% of all sequences in this slurry, among which those closely related to Bosea spp. were predominant (48–86%). These results suggest that exposure to high levels of As(III) has a significant impact on the composition and diversity of the soil bacterial community, including the As(III)-oxidizing bacterial community. Certain As(III)-oxidizing bacteria with strong As(III) resistance may be enriched under high As(III) levels, while more sensitive As(III) oxidizers are eliminated under these conditions. PMID:26903368

  18. Impact of Arsenite on the Bacterial Community Structure and Diversity in Soil.

    PubMed

    Dong, Dian-Tao; Yamamura, Shigeki; Amachi, Seigo

    2016-01-01

    The impact of arsenite (As[III]) on the bacterial community structure and diversity in soil was determined by incubating soil slurries with 50, 500, and 5,000 μM As(III). As(III) was oxidized to arsenate (As[V]), and the microbial contribution to As(III) oxidation was 70-100%. PCR-denaturing gradient gel electrophoresis revealed that soil bacterial diversity decreased in the presence of As(III). Bacteria closely related to the family Bacillaceae were predominant in slurry spiked with 5,000 μM As(III). The population size of culturable As(III)-resistant bacteria was 37-fold higher in this slurry than in unspiked slurry (p < 0.01), indicating that high levels of As(III) stimulate the emergence of As(III)-resistant bacteria. As(III)-resistant bacteria isolated from slurry spiked with 5,000 μM As(III) were mainly affiliated with the genus Bacillus; however, no strains showed As(III)-oxidizing capacity. An As(III)-oxidizing bacterial community analysis based on As(III) oxidase gene (aioA) sequences demonstrated that diversity was the lowest in slurry spiked with 5,000 μM As(III). The deduced AioA sequences affiliated with Alphaproteobacteria accounted for 91-93% of all sequences in this slurry, among which those closely related to Bosea spp. were predominant (48-86%). These results suggest that exposure to high levels of As(III) has a significant impact on the composition and diversity of the soil bacterial community, including the As(III)-oxidizing bacterial community. Certain As(III)-oxidizing bacteria with strong As(III) resistance may be enriched under high As(III) levels, while more sensitive As(III) oxidizers are eliminated under these conditions.

  19. METHYLATION OF SODIUM ARSENITE BY VARIOUS MAMMALIAN CELLS

    EPA Science Inventory


    Methylation of Sodium Arsenite by various Mammalian Cells

    Methylation of arsenite (As 3-1) is thought to play an important role in the carcinogenicity of arsenic. AIM: I. Characterization of methylation of arsenite in primary rodent and transformed human cell lines. ...

  20. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  1. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  2. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    PubMed

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  3. Induction of heme oxygenase 1 by arsenite inhibits cytokine-induced monocyte adhesion to human endothelial cells

    SciTech Connect

    Sun Xi; Pi Jingbo; Liu Wenlan; Hudson, Laurie G.; Liu Kejian; Feng Changjian

    2009-04-15

    Heme oxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. Arsenite, as an oxidative stressor, is a potent inducer of HO-1 in human and rodent cells. In this study, we investigated the mechanistic role of arsenite-induced HO-1 in modulating tumor necrosis factor {alpha} (TNF-{alpha}) induced monocyte adhesion to human umbilical vein endothelial cells (HUVEC). Arsenite pretreatment, which upregulated HO-1 in a time- and concentration-dependent manner, inhibited TNF-{alpha}-induced monocyte adhesion to HUVEC and intercellular adhesion molecule 1 protein expression by 50% and 40%, respectively. Importantly, knockdown of HO-1 by small interfering RNA abolished the arsenite-induced inhibitory effects. These results indicate that induction of HO-1 by arsenite inhibits the cytokine-induced monocyte adhesion to HUVEC by suppressing adhesion molecule expression. These findings established an important mechanistic link between the functional monocyte adhesion properties of HUVEC and the induction of HO-1 by arsenite.

  4. The lncRNA MALAT1, acting through HIF-1α stabilization, enhances arsenite-induced glycolysis in human hepatic L-02 cells.

    PubMed

    Luo, Fei; Liu, Xinlu; Ling, Min; Lu, Lu; Shi, Le; Lu, Xiaolin; Li, Jun; Zhang, Aihua; Liu, Qizhan

    2016-09-01

    Accelerated glycolysis, a common process in tumor cells called the Warburg effect, is associated with various biological phenomena. However, the role of glycolysis induced by arsenite, a well-established human carcinogen, is unknown. Long non-coding RNAs (lncRNAs) act as regulators in various cancers, but how lncRNAs regulate glucose metabolism remains largely unexplored. We have found that, in human hepatic epithelial (L-02) cells, arsenite increases lactate production; glucose consumption; and expression of glycolysis-related genes, including HK-2, Eno-1, and Glut-4. In L-02 cells exposed to arsenite, the lncRNA, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), and hypoxia inducible factors (HIFs)-α, the transcriptional regulators of cellular response to hypoxia, are over-expressed. In addition, HIF-1α, not HIF-2α, is involved in arsenite-induced glycolysis, and MALAT1 enhances arsenite-induced glycolysis. Although MALAT1 regulates HIF-α and promotes arsenite-induced glycolysis, MALAT1 promotes glycolysis through HIF-1α, not HIF-2α. Moreover, arsenite-increased MALAT1 enhances the disassociation of Von Hippel-Lindau (VHL) tumor suppressor from HIF-1α, alleviating VHL-mediated ubiquitination of HIF-1α, which causes accumulation of HIF-1α. In sum, these findings indicate that MALAT1, acting through HIF-1α stabilization, is a mediator that enhances glycolysis induced by arsenite. These results provide a link between the induction of lncRNAs and the glycolysis in cells exposed to arsenite, and thus establish a previously unknown mechanism for arsenite-induced hepatotoxicity.

  5. The lncRNA MALAT1, acting through HIF-1α stabilization, enhances arsenite-induced glycolysis in human hepatic L-02 cells.

    PubMed

    Luo, Fei; Liu, Xinlu; Ling, Min; Lu, Lu; Shi, Le; Lu, Xiaolin; Li, Jun; Zhang, Aihua; Liu, Qizhan

    2016-09-01

    Accelerated glycolysis, a common process in tumor cells called the Warburg effect, is associated with various biological phenomena. However, the role of glycolysis induced by arsenite, a well-established human carcinogen, is unknown. Long non-coding RNAs (lncRNAs) act as regulators in various cancers, but how lncRNAs regulate glucose metabolism remains largely unexplored. We have found that, in human hepatic epithelial (L-02) cells, arsenite increases lactate production; glucose consumption; and expression of glycolysis-related genes, including HK-2, Eno-1, and Glut-4. In L-02 cells exposed to arsenite, the lncRNA, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), and hypoxia inducible factors (HIFs)-α, the transcriptional regulators of cellular response to hypoxia, are over-expressed. In addition, HIF-1α, not HIF-2α, is involved in arsenite-induced glycolysis, and MALAT1 enhances arsenite-induced glycolysis. Although MALAT1 regulates HIF-α and promotes arsenite-induced glycolysis, MALAT1 promotes glycolysis through HIF-1α, not HIF-2α. Moreover, arsenite-increased MALAT1 enhances the disassociation of Von Hippel-Lindau (VHL) tumor suppressor from HIF-1α, alleviating VHL-mediated ubiquitination of HIF-1α, which causes accumulation of HIF-1α. In sum, these findings indicate that MALAT1, acting through HIF-1α stabilization, is a mediator that enhances glycolysis induced by arsenite. These results provide a link between the induction of lncRNAs and the glycolysis in cells exposed to arsenite, and thus establish a previously unknown mechanism for arsenite-induced hepatotoxicity. PMID:27287256

  6. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit.

  7. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  8. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  9. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  10. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  11. Phylogenetic position of Indian termites (Isoptera: Termitidae) with their respective genera inferred from DNA sequence analysis of the mitochondrial cytochrome oxidase gene subunit I compared to subunit II.

    PubMed

    Sharma, Vijay Lakshmi; Singla, Mandakini; Sobti, Ranbir Chander

    2013-08-20

    The present work was aimed to investigate the phylogenetic analysis of different species of Indian termites belonging to the family termitidae based on mitochondrial genes COI and COII. The sequences so obtained from public database revealed grouping of termites according to their ecological distribution. The sequences of the species under investigation were characterized on the basis of frequencies of nucleotide bases and in most of the species, a significantly high percentage of A+T base composition was observed. Phylogenetic tree revealed positioning of species according to the analysis of their cytochrome oxidase subunits.

  12. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.

    PubMed

    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

    2013-12-01

    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  13. Arsenite toxicity and uptake rate of rice (Oryza sativa L.) in vivo.

    PubMed

    Hoffmann, Holger; Schenk, Manfred K

    2011-10-01

    Toxicity threshold of arsenite on intact rice seedlings was determined and arsenite uptake characteristics were investigated using non-toxic concentrations of arsenite. The arsenite toxicity threshold was 2.4 μM arsenite which reduced growth by 10% (EC(10)). The two highest arsenite levels induced wilting of seedlings and reduced both, transpiration rate and net photosynthetic rate. Arsenic content in plant tissue increased up to 10.7 μM arsenite and then declined with increasing arsenite concentration in the treatment solution. The contents of Si, P, K, and of micronutrients Cu, Fe, Mn and Zn in shoot d.m. were reduced by arsenite levels ≥ 5.3 μM. In the non-toxic range, arsenite uptake rate was linearly related to arsenite concentration. High arsenite levels reduced growth without being taken up which might be due to increasing binding of arsenite to proteins at the outer side of the plasmalemma. PMID:21764194

  14. Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite permeability and tolerance in plants.

    PubMed

    Mosa, Kareem A; Kumar, Kundan; Chhikara, Sudesh; Mcdermott, Joseph; Liu, Zijuan; Musante, Craig; White, Jason C; Dhankher, Om Parkash

    2012-12-01

    Rice accumulates high level of arsenic (As) in its edible parts and thus plays an important role in the transfer of As into the food chain. However, the mechanisms of As uptake and its detoxification in rice are not well understood. Recently, members of the Nodulin 26-like intrinsic protein (NIP) subfamily of plant aquaporins were shown to transport arsenite in rice and Arabidopsis. Here we report that members of the rice plasma membrane intrinsic protein (PIP) subfamily are also involved in As tolerance and transport. Based on the homology search with the mammalian AQP9 and yeast Fps1 arsenite transporters, we identified and cloned five rice PIP gene subfamily members. qRT-PCR analysis of PIPs in rice root and shoot tissues revealed a significant down regulation of transcripts encoding OsPIP1;2, OsPIP1;3, OsPIP2;4, OsPIP2;6, and OsPIP2;7 in response to arsenite treatment. Heterologous expression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Xenopus laevis oocytes significantly increased the uptake of arsenite. Overexpression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Arabidopsis yielded enhanced arsenite tolerance and higher biomass accumulation. Further, these transgenic plants showed no significant accumulation of As in shoot and root tissues in long term uptake assays. Whereas, short duration exposure to arsenite caused both active influx and efflux of As in the roots. The data suggests a bidirectional arsenite permeability of rice PIPs in plants. These rice PIPs genes will be highly useful for engineering important food and biofuel crops for enhanced crop productivity on contaminated soils without increasing the accumulation of toxic As in the biomass or edible tissues. PMID:22350764

  15. Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite permeability and tolerance in plants.

    PubMed

    Mosa, Kareem A; Kumar, Kundan; Chhikara, Sudesh; Mcdermott, Joseph; Liu, Zijuan; Musante, Craig; White, Jason C; Dhankher, Om Parkash

    2012-12-01

    Rice accumulates high level of arsenic (As) in its edible parts and thus plays an important role in the transfer of As into the food chain. However, the mechanisms of As uptake and its detoxification in rice are not well understood. Recently, members of the Nodulin 26-like intrinsic protein (NIP) subfamily of plant aquaporins were shown to transport arsenite in rice and Arabidopsis. Here we report that members of the rice plasma membrane intrinsic protein (PIP) subfamily are also involved in As tolerance and transport. Based on the homology search with the mammalian AQP9 and yeast Fps1 arsenite transporters, we identified and cloned five rice PIP gene subfamily members. qRT-PCR analysis of PIPs in rice root and shoot tissues revealed a significant down regulation of transcripts encoding OsPIP1;2, OsPIP1;3, OsPIP2;4, OsPIP2;6, and OsPIP2;7 in response to arsenite treatment. Heterologous expression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Xenopus laevis oocytes significantly increased the uptake of arsenite. Overexpression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Arabidopsis yielded enhanced arsenite tolerance and higher biomass accumulation. Further, these transgenic plants showed no significant accumulation of As in shoot and root tissues in long term uptake assays. Whereas, short duration exposure to arsenite caused both active influx and efflux of As in the roots. The data suggests a bidirectional arsenite permeability of rice PIPs in plants. These rice PIPs genes will be highly useful for engineering important food and biofuel crops for enhanced crop productivity on contaminated soils without increasing the accumulation of toxic As in the biomass or edible tissues.

  16. Novel Carotenoid-Based Biosensor for Simple Visual Detection of Arsenite: Characterization and Preliminary Evaluation for Environmental Application▿ †

    PubMed Central

    Yoshida, Kazuyuki; Inoue, Koichi; Takahashi, Yuko; Ueda, Shunsaku; Isoda, Katsuhiro; Yagi, Kiyohito; Maeda, Isamu

    2008-01-01

    A novel whole-cell arsenite biosensor was developed using the photosynthetic bacterium Rhodopseudomonas palustris no. 7 and characterized. A sensor plasmid containing the operator-promoter region of the ars operon and arsR gene from Escherichia coli and the crtI gene from R. palustris no. 7 was introduced into a blue-green mutant with crtI deleted, R. palustris no. 711. The biosensor changed color in response to arsenite, and the change was obvious to the naked eye after 24 h without further manipulation. Real-time reverse transcription-PCR showed that the crtI mRNA was induced 3-fold at 3 h and 2.5-fold at 6 h after addition of 50 μg/liter arsenite compared with the no-arsenite control, and consistent with this, the relative levels of lycopene and rhodopin also increased compared with the control. Colorimetric analysis of the bacteria showed that the hue angle had clearly shifted from green-yellow toward red in an arsenic dose-dependent manner at 24 h after arsenite addition. This obvious shift occurred irrespective of the culture conditions before arsenite was added, indicating that the color change of the biosensor is stable in water samples containing various concentrations of dissolved oxygen. Finally, assays using samples prepared in various types of mineral water indicated that this biosensor could be used to screen groundwater samples for the presence of arsenite in a variety of locations, even where electricity is not available. PMID:18776022

  17. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica.

    PubMed

    Nixon, Julie E J; Wang, Amy; Field, Jessica; Morrison, Hilary G; McArthur, Andrew G; Sogin, Mitchell L; Loftus, Brendan J; Samuelson, John

    2002-04-01

    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica.

  18. Regulation of arsenite oxidation by the phosphate two-component system PhoBR in Halomonas sp. HAL1

    PubMed Central

    Chen, Fang; Cao, Yajing; Wei, Sha; Li, Yanzhi; Li, Xiangyang; Wang, Qian; Wang, Gejiao

    2015-01-01

    Previously, the expression of arsenite [As(III)] oxidase genes aioBA was reported to be regulated by a three-component regulatory system, AioXSR, in a number of As(III)-oxidizing bacterial strains. However, the regulation mechanism is still unknown when aioXSR genes are absent in some As(III)-oxidizing bacterial genomes, such as in Halomonas sp. HAL1. In this study, transposon mutagenesis and gene knock-out mutation were performed, and two mutants, HAL1-phoR931 and HAL1-▵phoB, were obtained in strain HAL1. The phoR and phoB constitute a two-component system which is responsible for phosphate (Pi) acquisition and assimilation. Both of the mutants showed negative As(III)-oxidation phenotypes in low Pi condition (0.1 mM) but not under normal Pi condition (1 mM). The phoBR complementation strain HAL1-▵phoB-C reversed the mutants' null phenotypes back to wild type status. Meanwhile, lacZ reporter fusions using pCM-lacZ showed that the expression of phoBR and aioBA were both induced by As(III) but were not induced in HAL1-phoR931 and HAL1-▵phoB. Using 15 consensus Pho box sequences, a putative Pho box was found in the aioBA regulation region. PhoB was able to bind to the putative Pho box in vivo (bacterial one-hybrid detection) and in vitro (electrophoretic mobility gel shift assay), and an 18-bp binding sequence containing nine conserved bases were determined. This study provided the evidence that PhoBR regulates the expression of aioBA in Halomonas sp. HAL1 under low Pi condition. The new regulation model further implies the close metabolic connection between As and Pi. PMID:26441863

  19. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  20. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  1. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  2. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease.

    PubMed

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E; Ortiz, Genaro Gabriel

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  3. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  4. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  5. Defects in NADPH Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel Disease

    PubMed Central

    Hayes, Patti; Dhillon, Sandeep; O'Neill, Kim; Thoeni, Cornelia; Hui, Ken Y.; Elkadri, Abdul; Guo, Conghui H.; Kovacic, Lidija; Aviello, Gabriella; Alvarez, Luis A.; Griffiths, Anne M.; Snapper, Scott B.; Brant, Steven R.; Doroshow, James H.; Silverberg, Mark S.; Peter, Inga; McGovern, Dermot P. B.; Cho, Judy; Brumell, John H.; Uhlig, Holm H.; Bourke, Billy; Muise, Aleixo A.; Knaus, Ulla G.

    2015-01-01

    Background & Aims Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD). Reactive oxygen species (ROS) generated by nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 209 children with very early onset inflammatory bowel disease (VEOIBD), the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn) and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys) in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. PMID:26301257

  6. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  7. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  8. Genomic evidence reveals the extreme diversity and wide distribution of the arsenic-related genes in Burkholderiales.

    PubMed

    Li, Xiangyang; Zhang, Linshuang; Wang, Gejiao

    2014-01-01

    So far, numerous genes have been found to associate with various strategies to resist and transform the toxic metalloid arsenic (here, we denote these genes as "arsenic-related genes"). However, our knowledge of the distribution, redundancies and organization of these genes in bacteria is still limited. In this study, we analyzed the 188 Burkholderiales genomes and found that 95% genomes harbored arsenic-related genes, with an average of 6.6 genes per genome. The results indicated: a) compared to a low frequency of distribution for aio (arsenite oxidase) (12 strains), arr (arsenate respiratory reductase) (1 strain) and arsM (arsenite methytransferase)-like genes (4 strains), the ars (arsenic resistance system)-like genes were identified in 174 strains including 1,051 genes; b) 2/3 ars-like genes were clustered as ars operon and displayed a high diversity of gene organizations (68 forms) which may suggest the rapid movement and evolution for ars-like genes in bacterial genomes; c) the arsenite efflux system was dominant with ACR3 form rather than ArsB in Burkholderiales; d) only a few numbers of arsM and arrAB are found indicating neither As III biomethylation nor AsV respiration is the primary mechanism in Burkholderiales members; (e) the aio-like gene is mostly flanked with ars-like genes and phosphate transport system, implying the close functional relatedness between arsenic and phosphorus metabolisms. On average, the number of arsenic-related genes per genome of strains isolated from arsenic-rich environments is more than four times higher than the strains from other environments. Compared with human, plant and animal pathogens, the environmental strains possess a larger average number of arsenic-related genes, which indicates that habitat is likely a key driver for bacterial arsenic resistance. PMID:24632831

  9. Chemolithoautotrophic arsenite oxidation by a thermophilic Anoxybacillus flavithermus strain TCC9-4 from a hot spring in Tengchong of Yunnan, China

    PubMed Central

    Jiang, Dawei; Li, Ping; Jiang, Zhou; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Guo, Qinghai; Wang, Yanxin

    2015-01-01

    A new facultative chemolithoautotrophic arsenite (AsIII)-oxidizing bacterium TCC9-4 was isolated from a hot spring microbial mat in Tengchong of Yunnan, China. This strain could grow with AsIII as an energy source, CO2–HCO3- as a carbon source and oxygen as the electron acceptor in a minimal salts medium. Under chemolithoautotrophic conditions, more than 90% of 100 mg/L AsIII could be oxidized by the strain TCC9-4 in 36 h. Temperature was an important environmental factor that strongly influenced the AsIII oxidation rate and AsIII oxidase (Aio) activity; the highest Aio activity was found at the temperature of 40∘C. Addition of 0.01% yeast extract enhanced the growth significantly, but delayed the AsIII oxidation. On the basis of 16S rRNA phylogenetic sequence analysis, strain TCC9-4 was identified as Anoxybacillus flavithermus. To our best knowledge, this is the first report of arsenic (As) oxidation by A. flavithermus. The Aio gene in TCC9-4 might be quite novel relative to currently known gene sequences. The results of this study expand our current understanding of microbially mediated As oxidation in hot springs. PMID:25999920

  10. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  11. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid. PMID:27425865

  12. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function.

  13. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  14. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression

    PubMed Central

    Beck, Emily A.; Thompson, Aaron C.; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana

    2015-01-01

    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba—D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear‐encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear‐ and mitochondrial‐encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum‐likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial‐encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  15. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.

    PubMed

    Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce

    2010-05-01

    Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements.

  16. A negative regulating element controlling transcription of the gene encoding acyl-CoA oxidase in Saccharomyces cerevisiae.

    PubMed Central

    Wang, T W; Lewin, A S; Small, G M

    1992-01-01

    Peroxisomes are induced in Saccharomyces cerevisiae when this yeast is grown in the presence of oleate, and are repressed when glucose is supplied as the carbon source. Concomitant with this is an induction/repression of peroxisomal beta-oxidation enzymes. We are investigating the transcriptional control of acyl-CoA oxidase, the first and rate-limiting enzyme in the peroxisomal beta-oxidation cycle. The promoter region of POX1 from S. cerevisiae has been analyzed in POX1/lacZ fusions. Expression of the POX1/lacZ fusion protein underwent glucose repression and oleate induction. By deletion, DNA band shift and DNase I footprinting analyses we have identified a region that is involved in transcriptional repression of POX1. Elimination of this DNA sequence results in constitutive expression of POX1 when S. cerevisiae is grown on a fermentable carbon source or glycerol. Images PMID:1630920

  17. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded.

  18. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  19. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  20. Sensitivity to sodium arsenite in human melanoma cells depends upon susceptibility to arsenite-induced mitotic arrest

    SciTech Connect

    McNeely, Samuel C.; Belshoff, Alex C.; Taylor, B. Frazier; Fan, Teresa W-M.; McCabe, Michael J.; Pinhas, Allan R.

    2008-06-01

    Arsenic induces clinical remission in patients with acute promyelocytic leukemia and has potential for treatment of other cancers. The current study examines factors influencing sensitivity to arsenic using human malignant melanoma cell lines. A375 and SK-Mel-2 cells were sensitive to clinically achievable concentrations of arsenite, whereas SK-Mel-3 and SK-Mel-28 cells required supratherapeutic levels for toxicity. Inhibition of glutathione synthesis, glutathione S-transferase (GST) activity, and multidrug resistance protein (MRP) transporter function attenuated arsenite resistance, consistent with studies suggesting that arsenite is extruded from the cell as a glutathione conjugate by MRP-1. However, MRP-1 was not overexpressed in resistant lines and GST-{pi} was only slightly elevated. ICP-MS analysis indicated that arsenite-resistant SK-Mel-28 cells did not accumulate less arsenic than arsenite-sensitive A375 cells, suggesting that resistance was not attributable to reduced arsenic accumulation but rather to intrinsic properties of resistant cell lines. The mode of arsenite-induced cell death was apoptosis. Arsenite-induced apoptosis is associated with cell cycle alterations. Cell cycle analysis revealed arsenite-sensitive cells arrested in mitosis whereas arsenite-resistant cells did not, suggesting that induction of mitotic arrest occurs at lower intracellular arsenic concentrations. Higher intracellular arsenic levels induced cell cycle arrest in the S-phase and G{sub 2}-phase in SK-Mel-3 and SK-Mel-28 cells, respectively. The lack of arsenite-induced mitotic arrest in resistant cell lines was associated with a weakened spindle checkpoint resulting from reduced expression of spindle checkpoint protein BUBR1. These data suggest that arsenite has potential for treatment of solid tumors but a functional spindle checkpoint is a prerequisite for a positive response to its clinical application.

  1. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide

  2. ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    EPA Science Inventory

    ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    Useful biomarkers of arsenic effects in both experimental animals and humans are needed. Arsenate and arsenite are good inducers of rat hepatic and renal heme oxygenase (HO); monomethylarsonic acid (MMA) and dimethylarsi...

  3. METHYLATION OF ARSENITE BY SOME MAMMALIAN CELL LINES

    EPA Science Inventory

    THIS ABSTRACT WAS SUBMITTED ELECTRONICALLY;. SPACE CONSTRAINTS WERE SEVERE)

    Methylation of Arsenite by Some Mammalian Cell Lines.

    Methylation of arsenite is thought to play an important role in the carcinogenicity of arsenic.
    Aim 1: Determine if there is diffe...

  4. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  5. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  6. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  7. Phylogeography of stable fly (Diptera: Muscidae) estimated by diversity at ribosomal 16S and cytochrome oxidase I mitochondrial genes.

    PubMed

    Marquez, J G; Cummings, M A; Krafsur, E S

    2007-11-01

    The blood-feeding cosmopolitan stable fly, Stomoxys calcitrans L. (Diptera: Muscidae), is thought to disperse rapidly and widely, and earlier studies of allozyme variation were consistent with high vagility in this species. The geographic origins of New World populations are unknown. Diversity at mitochondrial loci r16S and cytochrome oxidase I was examined in 277 stable flies from 11 countries, including five zoogeographical regions. Of 809 nucleotides, 174 were polymorphic and 133 were parsimony informative. Seventy-six haplotypes were found in frequencies consistent with the Wright-Fisher infinite allele model. None were shared among four or more zoogeographical regions. The null hypothesis of mutation neutrality was not rejected, thereby validating the observed distribution. Fifty-nine haplotypes were singular, eight were private and confined to the Old World, and three of 76 haplotypes were shared between the Old and New World. Only 19 haplotypes were found in the New World, 14 of which were singletons. Haplotype and nucleotide diversities were heterogeneous among countries and regions. The most diversity was observed in sub-Saharan Africa. Regional differentiation indices were C(RT) = 0.26 and N(RT) = 0.31, indicating populations were highly structured macrogeographically. Palearctic and New World flies were the least differentiated from each other. There were strong genetic similarities among populations in the Nearctic, Neotropical, and Palearctic regions, and it is most likely that New World populations were derived from the Palearctic after 1492 CE, in the colonial era. PMID:18047198

  8. A role for active oxygen species as second messengers in the induction of alternative oxidase gene expression in Petunia hybrida cells.

    PubMed

    Wagner, A M

    1995-07-17

    Incubation of Petunia hybrida cells with H2O2 leads to an increase in alternative oxidase activity measured after 24 h. This increased activity is accompanied by an increase in alternative oxidase protein. A model is presented for the regulation of alternative oxidase protein synthesis in which active oxygen species and especially H2O2 play a crucial role as second messengers in the signal transducing pathway from the mitochondria to the nucleus. It is proposed that also the induction of the alternative oxidase by salicylic acid is mediated via H2O2.

  9. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

  10. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  11. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.

    PubMed

    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C

    2003-12-01

    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  12. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  13. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy.

    PubMed

    Kartavtsev, Yuri Ph; Sharina, Svetlana N; Goto, Tadasuke; Chichvarkhin, Anton Y; Balanov, Andrey A; Vinnikov, Kirill A; Ivankov, Vyacheslav N; Hanzawa, Naoto

    2008-12-01

    Mitochondrial DNA at the cytochrome oxidase 1 (Co-1) gene region was sequenced for six flatfish species (in total, 11 sequences of at least 539 base pairs) from the Far East of Russia and compared with other sequences of Pleuronectiformes, comprising altogether 26 flatfish sequences and two outgroup sequences (Perciformes). An analysis of the protein-coding Co-1 gene revealed a statistically substantiated bias in (T + C):(A + G) content, supporting earlier findings. Average scores of the p-distances for different scales of the evolutionary history at the Co-1 gene revealed a clear pattern of increased nucleotide diversity at four different levels: (1) intraspecies, (2) intragenus, (3) intrafamily, and (4) intra-order. Scores of average p-distances of the four categories of comparison in flatfishes were (1) 0.17 +/- 0.09%, (2) 10.60 +/- 1.57%, (3) 12.40 +/- 0.27%, and (4) 19.93 +/- 0.05%, respectively (mean +/- standard error). These data jointly with current knowledge support the concept that speciation in the order Pleuronectiformes mostly follows a geographic mode through accumulation of numerous small genetic changes over a long period of time. A phylogenetic tree for 26 sequences of flatfishes and two other fishes belonging to ray-finned fishes (Actinopterigii) was developed using the Co-1 gene and four different analytical approaches: neighbour-joining, Bayesian (BA), maximum parsimony (MP), and maximum likelihood. The analysis revealed a monophyletic origin for the representatives of Pleuronectidae, which is the principal flatfish family investigated (73-100% support level in our MP and BA analyses). According to the current and literary data, the monophyletic origin for the six compared flatfish families was well supported. Species identification on a per-individual basis (barcoding tagging) was high.

  14. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  15. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  16. Facultative anoxygenic photosynthesis in cyanobacteria driven by arsenite and sulfide with evidence for the support of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Wolfe-Simon, F.; Hoeft, S. E.; Baesman, S. M.; Oremland, R. S.

    2010-12-01

    The rise in atmospheric oxygen (O2) over geologic time is attributed to the evolution and widespread proliferation of oxygenic photosynthesis in cyanobacteria. However, cyanobacteria maintain a metabolic flexibility that may not always result in O2 release. In the environment, cyanobacteria may use a variety of alternative electron donors rather than water that are known to be used by other anoxygenic phototrophs (eg. purple sulfur bacteria) including reduced forms of sulfur, iron, nitrogen, and arsenic. Recent evidence suggests cyanobacteria actively take advantage of at least a few of these alternatives. We used a classical Winogradsky approach to enrich for cyanobacteria from the high salinity, elevated pH and arsenic-enriched waters of Mono Lake (CA). Experiments, optimized for cyanobacteria, revealed light-dependent, anaerobic arsenite-oxidation in sub-cultured sediment-free enrichments dominated by a filamentous cyanobacteria. We isolated and identified the dominant member of this enrichment to be a member of the Oscillatoriales by 16S rDNA. Addition of 1 mM arsenite induced facultative anoxygenic photosynthesis under continuous and circadian light. This isolate also oxidized sulfide under the same light-based conditions. Aerobic conditions elicited no arsenite oxidation in the light or dark and the isolate grew as a typical cyanobacterium using oxygenic photosynthesis. Under near-infrared light (700 nm) there was a direct correlation of enhanced growth with an increase in the rate arsenite or sulfide oxidation suggesting the use of photosystem I. Additionally, to test the wide-spread nature of this metabolism in the Oscillatoriales, we followed similar arsenite- and sulfide-driven facultative anoxygenic photosynthesis as well as nitrogen fixation (C2H2 reduction) in the axenic isolate Oscillatoria sp. CCMP 1731. Future characterization includes axenic isolation of the Mono Lake Oscillatoria sp. as well as the arsenite oxidase responsible for electron

  17. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  18. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  19. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  20. Tumor promoter arsenite stimulates histone H3 phosphoacetylation of proto-oncogenes c-fos and c-jun chromatin in human diploid fibroblasts.

    PubMed

    Li, Ji; Gorospe, Myriam; Barnes, Janice; Liu, Yusen

    2003-04-11

    Although epidemiological studies have long established that inorganic arsenic is a potent human carcinogen, the underlying mechanisms are still poorly understood. Recent studies suggest that inorganic arsenic may act as a tumor promoter by perturbing key signaling transduction pathways. We have shown previously that arsenite can potently activate the mitogen-activated protein kinase cascades and induce the expression of proliferation-associated genes, including proto-oncogenes c-jun and c-fos. In order to elucidate further the molecular mechanisms underlying its tumor-promoting properties, we investigated the signaling events involved in arsenite-mediated induction of c-fos and c-jun. We found that induction of both c-fos and c-jun by arsenite can be substantially inhibited by the MEK- selective inhibitor U0126, suggesting that the ERK pathway is critically involved in their up-regulation. Interestingly, arsenite dramatically induced the phosphorylation and acetylation of histone H3 preceding the induction of mRNAs encoding c-fos and c-jun. Finally, chromatin immunoprecipitation assays revealed that arsenite treatment markedly induced the phosphorylation/acetylation of histone H3 associated with the c-fos and c-jun genes through an ERK-dependent pathway. Our results strongly suggest that arsenic-triggered alterations in chromatin structure perturb specific gene transcription, including that of proto-oncogenes c-jun and c-fos, and may thereby contribute to the carcinogenic process.

  1. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

  2. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  3. How sodium arsenite improve amyloid β-induced memory deficit?

    PubMed

    Nassireslami, Ehsan; Nikbin, Parmida; Amini, Elham; Payandemehr, Borna; Shaerzadeh, Fatemeh; Khodagholi, Fariba; Yazdi, Behnoosh Bonakdar; Kebriaeezadeh, Abbas; Taghizadeh, Ghorban; Sharifzadeh, Mohammad

    2016-09-01

    Evidence has shown that arsenic exposure, besides its toxic effects results in impairment of learning and memory, but its molecular mechanisms are not fully understood. In the present study, we examined sodium arsenite (1, 5, 10, 100nM) effects on contextual and tone memory of male rats in Pavlovian fear conditioning paradigm alone and in co-administration with β-amyloid. We detected changes in the level of caspase-3, nuclear factor kappa-B (NF-κB), cAMP response element-binding (CREB), heme oxygenase-1 and NF-E2-related factor-2 (Nrf2) by Western blot. Sodium arsenite in high doses induced significant memory impairment 9 and 16days after infusion. By contrast, low doses of sodium arsenite attenuate memory deficit in Aβ injected rats after 16days. Our data revealed that treatment with high concentration of sodium arsenite increased caspase-3 cleavage and NF-κB level, 9days after injection. Whereas, low doses of sodium arsenite cause Nrf2 and HO-1 activation and increased CREB phosphorylation in the hippocampus. These findings suggest the concentration dependent effects of sodium arsenite on contextual and tone memory. Moreover, it seems that the neuroprotective effects of ultra-low concentrations of sodium arsenite on Aβ-induced memory impairment is mediated via an increase Nrf2, HO-1 and CREB phosphorylation levels and decrease caspase-3 and NF-κB amount. PMID:27129674

  4. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.

    PubMed

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-09-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley.

  5. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.

    PubMed

    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov

    2012-06-01

    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  6. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  7. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  8. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  9. Effects of arsenic on modification of promyelocytic leukemia (PML): PML responds to low levels of arsenite

    SciTech Connect

    Hirano, Seishiro; Watanabe, Takayuki; Kobayashi, Yayoi

    2013-12-15

    Inorganic arsenite (iAs{sup 3+}) is a two-edged sword. iAs{sup 3+} is a well-known human carcinogen; nevertheless, it has been used as a therapeutic drug for acute promyelocytic leukemia (APL), which is caused by a fusion protein comprising retinoic acid receptor-α and promyelocytic leukemia (PML). PML, a nuclear transcription factor, has a RING finger domain with densely positioned cysteine residues. To examine PML-modulated cellular responses to iAs{sup 3+}, CHO-K1 and HEK293 cells were each used to establish cell lines that expressed ectopic human PML. Overexpression of PML increased susceptibility to iAs{sup 3+} in CHO-K1 cells, but not in HEK293 cells. Exposure of PML-transfected cells to iAs{sup 3+} caused PML to change from a soluble form to less soluble forms, and this modification of PML was observable even with just 0.1 μM iAs{sup 3+} (7.5 ppb). Western blot and immunofluorescent microscopic analyses revealed that the biochemical changes of PML were caused at least in part by conjugation with small ubiquitin-like modifier proteins (SUMOylation). A luciferase reporter gene was used to investigate whether modification of PML was caused by oxidative stress or activation of antioxidant response element (ARE) in CHO-K1 cells. Modification of PML protein occurred faster than activation of the ARE in response to iAs{sup 3+}, suggesting that PML was not modified as a consequence of oxidative stress-induced ARE activation. - Highlights: • PML was found in nuclear microspecles in response to arsenite. • Arsenite triggers SUMOylation of PML. • Arsenite modifies PML at as low as 0.1 μM. • Modification of PML is not caused by ARE activation.

  10. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  11. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  12. Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

    PubMed Central

    Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

    2012-01-01

    A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

  13. Immunohistochemical observations on tumor suppressor gene p53 status in mouse fibrosarcoma following in-vivo photodynamic therapy: the role of xanthine oxidase activity

    NASA Astrophysics Data System (ADS)

    Ziolkowski, Piotr P.; Symonowicz, Krzysztof; Milnerowicz, Artur; Osiecka, Beata J.

    1997-12-01

    Tumor suppressor gene p53 expression in a mouse fibrosarcoma following in-vivo photodynamic therapy has been studied using the immunohistochemical method. Photodynamic treatment involved injections of the well known sensitizer -- hematoporphyrin derivative at the doses 1.25 and 2.5 mg/kg of body weight and irradiations at the doses 25 and 50 J/sq cm. Glass slide preparations from PDT-treated tumors were obtained at different time points (15, 60 minutes, 2 and 24 hours) after therapy, subsequently stained for wild type/mutant p53, and assessed for positive reaction. High PDT doses (HpD -- 2.5 mg/kg; light dose -- 50 J/sq cm) correlated with decreased expression of p53 in tumor cells. The other part of the study was directed to measure the xanthine oxidase (XO) activity in the tumor cells. PDT included injections of HpD and light exposure at the same doses as for p53 study. We observed a complete inhibition of the enzyme activity. The slight increase in XO activity was found following treatment with either light or HpD alone.

  14. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  15. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  16. Mutation T318M in the CYP11B2 gene encoding P450c11AS (aldosterone synthase) causes corticosterone methyl oxidase II deficiency

    SciTech Connect

    Zhang, G.; Rodriguez, H.; Miller, W.L.

    1995-11-01

    Corticosterone methyl oxidase (CMO) deficiency refers to disorders of aldosterone synthesis due to mutations in the CYP11B2 gene encoding cytochrome P450c11AS, which is the adrenal aldosterone synthase. Type I CMO deficiency is associated with low concentrations of 18OH-corticosterone and aldosterone, due to severe mutations in P450c11AS, while type III CMO deficiency is associated with high concentrations of 18OH-corticosterone and low concentrations of aldosterone, due to less severe mutations of P450c11AS. A single type of mutation, compound homozygosity for R181W and V386A, has been reported as the cause of CMOII deficiency in an inbred population. We now report a patient with a typical clinical and hormonal picture of CMOII deficiency. Direct sequencing of patient and parent DNAs showed that the mother`s allele contributed R181W and the deletion/frameshift mutation {Delta}C372, while the father`s allele contributed T318M and V386A. These mutants were recreated in cDNA expression vectors singly and in the parental pairs, showing that neither allele contributed any measurable activity. This would suggest the patient should have CMOI deficiency. These studies suggest that other factors besides P450c11AS are involved in the genesis of the distinctive CMOI and CMOII phenotypes. 31 refs., 2 figs., 3 tabs.

  17. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  18. An mtDNA mutation in the initiation codon of the cytochrome C oxidase subunit II gene results in lower levels of the protein and a mitochondrial encephalomyopathy.

    PubMed Central

    Clark, K M; Taylor, R W; Johnson, M A; Chinnery, P F; Chrzanowska-Lightowlers, Z M; Andrews, R M; Nelson, I P; Wood, N W; Lamont, P J; Hanna, M G; Lightowlers, R N; Turnbull, D M

    1999-01-01

    A novel heteroplasmic 7587T-->C mutation in the mitochondrial genome which changes the initiation codon of the gene encoding cytochrome c oxidase subunit II (COX II), was found in a family with mitochondrial disease. This T-->C transition is predicted to change the initiating methionine to threonine. The mutation load was present at 67% in muscle from the index case and at 91% in muscle from the patient's clinically affected son. Muscle biopsy samples revealed isolated COX deficiency and mitochondrial proliferation. Single-muscle-fiber analysis revealed that the 7587C copy was at much higher load in COX-negative fibers than in COX-positive fibers. After microphotometric enzyme analysis, the mutation was shown to cause a decrease in COX activity when the mutant load was >55%-65%. In fibroblasts from one family member, which contained >95% mutated mtDNA, there was no detectable synthesis or any steady-state level of COX II. This new mutation constitutes a new mechanism by which mtDNA mutations can cause disease-defective initiation of translation. PMID:10205264

  19. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.

    PubMed

    Makouloutou, P; Setsuda, A; Yokoyama, M; Tsuji, T; Saita, E; Torii, H; Kaneshiro, Y; Sasaki, M; Maeda, K; Une, Y; Hasegawa, H; Sato, H

    2013-09-01

    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan.

  20. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  1. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  2. Increase in BrAO1 gene expression and aldehyde oxidase activity during clubroot development in Chinese cabbage (Brassica rapa L.).

    PubMed

    Ando, Sugihiro; Tsushima, Seiya; Tagiri, Akemi; Kamachi, Shinichiro; Konagaya, Ken-Ichi; Hagio, Takashi; Tabei, Yutaka

    2006-07-01

    SUMMARY In clubroot disease, gall formation is induced by infection with the obligate biotroph Plasmodiophora brassicae due to increased levels of auxins and cytokinins. Because aldehyde oxidase (AO) may be involved in auxin biosynthesis in plants, we isolated two AO genes (BrAO1 and BrAO2) from Chinese cabbage (Brassica rapa ssp. pekinensis cv. Muso), which are the most similar to AAO1 among Arabidopsis AO genes, and examined their expressions during clubroot development. The expression of BrAO1 was enhanced in inoculated roots from 15 days post-inoculation (dpi) when visible clubroots were still undetectable. Thereafter, BrAO1 expression increased with clubroot development compared with uninoculated roots, although BrAO2 expression was repressed. In situ hybridization revealed that BrAO1 was strongly expressed in tissues that were invaded by immature plasmodia at 35 dpi, suggesting that BrAO1 expression was enhanced by the pathogen in order to establish its pathogenesis. In addition, we detected AO activity, as evidenced by the occurrence of at least six bands (BrAO-a to BrAO-f) in the roots of Chinese cabbage using an active staining method with benzaldehyde and indlole-3-aldehyde as the substrate. Coincidental with BrAO1 expression, the signals of BrAO-a and BrAO-d increased with inoculation by P. brassicae during clubroot development compared with healthy roots, resulting in an increase in total AO activity. By contrast, the band BrAO-b decreased post-inoculation, in parallel with the expression of BrAO2. The other bands of activity were not clearly influenced by the infection. Based on these results, we discuss the involvement of AO in auxin-overproduction during clubroot development in Chinese cabbage.

  3. Deletion of genes encoding cytochrome oxidases and quinol monooxygenase blocks the aerobic-anaerobic shift in Escherichia coli K-12 MG1655.

    PubMed

    Portnoy, Vasiliy A; Scott, David A; Lewis, Nathan E; Tarasova, Yekaterina; Osterman, Andrei L; Palsson, Bernhard Ø

    2010-10-01

    The constitutive activation of the anoxic redox control transcriptional regulator (ArcA) in Escherichia coli during aerobic growth, with the consequent production of a strain that exhibits anaerobic physiology even in the presence of air, is reported in this work. Removal of three terminal cytochrome oxidase genes (cydAB, cyoABCD, and cbdAB) and a quinol monooxygenase gene (ygiN) from the E. coli K-12 MG1655 genome resulted in the activation of ArcA aerobically. These mutations resulted in reduction of the oxygen uptake rate by nearly 98% and production of d-lactate as a sole by-product under oxic and anoxic conditions. The knockout strain exhibited nearly identical physiological behaviors under both conditions, suggesting that the mutations resulted in significant metabolic and regulatory perturbations. In order to fully understand the physiology of this mutant and to identify underlying metabolic and regulatory reasons that prevent the transition from an aerobic to an anaerobic phenotype, we utilized whole-genome transcriptome analysis, (13)C tracing experiments, and physiological characterization. Our analysis showed that the deletions resulted in the activation of anaerobic respiration under oxic conditions and a consequential shift in the content of the quinone pool from ubiquinones to menaquinones. An increase in menaquinone concentration resulted in the activation of ArcA. The activation of the ArcB/ArcA regulatory system led to a major shift in the metabolic flux distribution through the central metabolism of the mutant strain. Flux analysis indicated that the mutant strain had undetectable fluxes around the tricarboxylic acid (TCA) cycle and elevated flux through glycolysis and anaplerotic input to oxaloacetate. Flux and transcriptomics data were highly correlated and showed similar patterns.

  4. Arsenite cocarcinogenesis: an animal model derived from genetic toxicology studies.

    PubMed

    Rossman, Toby G; Uddin, Ahmed N; Burns, Fredric J; Bosland, Maarten C

    2002-10-01

    Although epidemiologic evidence shows an association between inorganic arsenic in drinking water and increased risk of skin, lung, and bladder cancers, no animal model for arsenic carcinogenesis has been successful. This lack has hindered mechanistic studies of arsenic carcinogenesis. Previously, we and others found that low concentrations (< or =5 microm) of arsenite (the likely environmental carcinogen), which are not mutagenic, can enhance the mutagenicity of other agents, including ultraviolet radiation (UVR) and alkylating agents. This enhancing effect appears to result from inhibition of DNA repair by arsenite, but not via inhibition of DNA repair enzymes. Rather, low concentrations of arsenite disrupt p53 function and upregulate cyclin D1. Failure to find an animal model for arsenic carcinogenesis might be because arsenite is not a carcinogen per se but acts as an enhancing agent (cocarcinogen) with a genotoxic partner. We tested this hypothesis with solar UVR in hairless but immunocompetent Skh1 mice. Mice were given 10 mg/L sodium arsenite in drinking water (or not) and irradiated with 1.7 KJ/m(2) solar UVR 3 times weekly. As expected, no tumors appeared in any organs in control mice or in mice given arsenite alone. After 26 weeks irradiated mice given arsenite had a 2.4-fold increase in skin tumor yield compared with mice given UVR alone. The tumors were mostly squamous cell carcinomas, and those occurring in mice given UVR plus arsenite were much larger and more invasive. These results are consistent with the hypothesis that arsenic acts as a cocarcinogen with a second (genotoxic) agent by inhibiting DNA repair and/or enhancing positive growth signaling. Skin cancers in populations drinking water containing arsenic may be caused by the enhancement by arsenic compounds of carcinogenesis induced by UVR (or other environmental agents). It is possible that lung and bladder cancers associated with arsenic in drinking water may also require a carcinogenic

  5. Inorganic arsenite alters macrophage generation from human peripheral blood monocytes.

    PubMed

    Sakurai, Teruaki; Ohta, Takami; Fujiwara, Kitao

    2005-03-01

    Inorganic arsenite has caused severe inflammatory chronic poisoning in humans through the consumption of contaminated well water. In this study, we examined the effects of arsenite at nanomolar concentrations on the in vitro differentiation of human macrophages from peripheral blood monocytes. While arsenite was found to induce cell death in a culture system containing macrophage colony stimulating factor (M-CSF), macrophages induced by granulocyte-macrophage CSF (GM-CSF) survived the treatment, but were morphologically, phenotypically, and functionally altered. In particular, arsenite-induced cells expressed higher levels of a major histocompatibility complex (MHC) class II antigen, HLA-DR, and CD14. They were more effective at inducing allogeneic or autologous T cell responses and responded more strongly to bacterial lipopolysaccharide (LPS) by inflammatory cytokine release as compared to cells induced by GM-CSF alone. On the other hand, arsenite-induced cells expressed lower levels of CD11b and CD54 and phagocytosed latex beads or zymosan particles less efficiently. We also demonstrated that the optimum amount of cellular reactive oxygen species (ROS) induced by nM arsenite might play an important role in this abnormal monocyte differentiation. This work may have implications in chronic arsenic poisoning because the total peripheral blood arsenic concentrations of these patients are at nM levels.

  6. Photoinduced Oxidation of Arsenite to Arsenate on Ferrihydrite

    SciTech Connect

    N Bhandari; R Reeder; D Strongin

    2011-12-31

    The photochemistry of an aqueous suspension of the iron oxyhydroxide, ferrihydrite, in the presence of arsenite has been investigated using attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR), X-ray absorption near edge structure (XANES), and solution phase analysis. Both ATR-FTIR and XANES show that the exposure of ferrihydrite to arsenite in the dark leads to no change in the As oxidation state, but the exposure of this arsenite-bearing surface, which is in contact with pH 5 water, to light leads to the conversion of the majority of the adsorbed arsenite to the As(V) bearing species, arsenate. Analysis of the solution phase shows that ferrous iron is released into solution during the oxidation of arsenite. The photochemical reaction, however, shows the characteristics of a self-terminating reaction in that there is a significant suppression of this redox chemistry before 10% of the total iron making up the ferrihydrite partitions into solution as ferrous iron. The self-terminating behavior exhibited by this photochemical arsenite/ferrihydrite system is likely due to the passivation of the ferrihydrite surface by the strongly bound arsenate product.

  7. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  8. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes.

  9. Glutathione peroxidase and catalase modulate the genotoxicity of arsenite.

    PubMed

    Wang, T S; Shu, Y F; Liu, Y C; Jan, K Y; Huang, H

    1997-09-01

    The X-ray hypersensitive Chinese hamster ovary (CHO) cells, xrs-5, are also more sensitive to sodium arsenite in terms of cell growth and micronucleus induction than CHO-K1 cells. Since reactive oxygen species are suggested to be involved in arsenic toxicity, we have measured antioxidant mechanisms in xrs-5 as well as CHO-K1 cells. There were no apparent differences in the activities of superoxide dismutase, glutathione S-transferase, glutathione reductase, and the levels of glutathione between xrs-5 and CHO-K1 cells. However, the activities of glutathione peroxidase and catalase were 5.4- and 5.8-fold lower, respectively, in xrs-5 cells. The addition of catalase or glutathione peroxidase to cultures reduced the arsenite-induced micronuclei in xrs-5 cells. Whereas, simultaneous treatment with mercaptosuccinate, an inhibitor of glutathione peroxidase, and 3-aminotriazole, an inhibitor of catalase, synergistically increased the arsenite-induced micronuclei. These results suggest that both catalase and glutathione peroxidase are involved in defense against arsenite genotoxicity. The xrs-6 cells, another line of x-ray hypersensitive CHO cells, which had 1.6-fold higher catalase activity and 2.5-fold higher glutathione peroxidase activity than xrs-5 cells, were also more sensitive than CHO-K1 cells but were less sensitive than xrs-5 cells to cell growth inhibition of arsenite. Moreover, a 1.6-fold increase of glutathione peroxidase activity by selenite adaptation effectively removed the arsenite-induced micronuclei in CHO-K1 cells. These results suggest that glutathione peroxidase is more important than catalase in defending against arsenite toxicity. Our results also suggest that increasing the intracellular antioxidant level may have preventive or therapeutic effects in arsenic poisoning.

  10. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gjerde, Bjørn

    2013-10-01

    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  11. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.

    PubMed

    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia

    2002-12-01

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  12. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  13. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  14. Evidence that arsenite acts as a cocarcinogen in skin cancer.

    PubMed

    Rossman, Toby G; Uddin, Ahmed N; Burns, Fredric J

    2004-08-01

    Inorganic arsenic (arsenite and arsenate) in drinking water has been associated with skin cancers in several countries such as Taiwan, Chile, Argentina, Bangladesh, and Mexico. This association has not been established in the United States. In addition, inorganic arsenic alone in drinking water does not cause skin cancers in animals. We recently showed that concentrations as low as 1.25 mg/l sodium arsenite were able to enhance the tumorigenicity of solar UV irradiation in mice. The tumors were almost all squamous cell carcinomas (SCCs). These data suggest that arsenic in drinking water may need a carcinogenic partner, such as sunlight, in the induction of skin cancers. Arsenite may enhance tumorigenicity via effects on DNA repair and DNA damage-induced cell cycle effects, leading to genomic instability. Others have found that dimethlyarsinic acid (DMA), a metabolite of arsenite, can induce bladder cancers at high concentrations in drinking water. In those experiments, skin cancers were not produced. Taken together, these data suggest that arsenite (or possibly an earlier metabolite), and not DMA, is responsible for the skin cancers, but a second genotoxic agent may be a requirement. The differences between the US and the other arsenic-exposed populations with regard to skin cancers might be explained by the lower levels of arsenic in the US, less sun exposure, better nutrition, or perhaps genetic susceptibility differences.

  15. Arsenite exposure compromises early embryonic development in the Golden hamster.

    PubMed

    Unis, Dave; Osborne, Cassandra; Diawara, Moussa M

    2009-11-01

    The toxicity of arsenite to 8-cell stage hamster embryos was evaluated. Females were superovulated and mated; embryos were collected and grown for 72 h in culture medium containing vehicle control, 25, 50, 250, 500, or 750 nM arsenite. Morphological observations were taken at 0 and 24h increments. A TUNEL assay was used for determining DNA damage. Survival was expressed by the ability to undergo zona escape. The control group had 78% survival and no evidence of deformities. Embryos in the 25, 50 and 250 nM groups had survival rates of 63%, 55% and 27%, respectively. Arsenite exposure caused total embryo lethality, major deformities, complete failure to undergo zona lysis, and significantly higher number of cells with fragmented DNA in embryos at the 500 and 750 nM concentrations. The study underscores the sensitivity of preimplantation stage embryos to the presence of even relatively small amounts of arsenic in luminal fluid.

  16. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat.

    PubMed

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  17. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  18. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  19. Endoplasmic reticulum stress is involved in arsenite-induced oxidative injury in rat brain

    SciTech Connect

    Lin, Anya M.Y.; Chao, P.L.; Fang, S.F.; Chi, C.W.; Yang, C.H.

    2007-10-15

    The mechanism underlying sodium arsenite (arsenite)-induced neurotoxicity was investigated in rat brain. Arsenite was locally infused in the substantia nigra (SN) of anesthetized rat. Seven days after infusion, lipid peroxidation in the infused SN was elevated and dopamine level in the ipsilateral striatum was reduced in a concentration-dependent manner (0.3-5 nmol). Furthermore, local infusion of arsenite (5 nmol) decreased GSH content and increased expression of heat shock protein 70 and heme oxygenase-1 in the infused SN. Aggregation of {alpha}-synuclein, a putative pathological protein involved in several CNS neurodegenerative diseases, was elevated in the arsenite-infused SN. From the breakdown pattern of {alpha}-spectrin, both necrosis and apoptosis were involved in the arsenite-induced neurotoxicity. Pyknotic nuclei, cellular shrinkage and cytoplasmic disintegration, indicating necrosis, and TUNEL-positive cells and DNA ladder, indicating apoptosis was observed in the arsenite-infused SN. Arsenite-induced apoptosis was mediated via two different organelle pathways, mitochondria and endoplasmic reticulum (ER). For mitochondrial activation, cytosolic cytochrome c and caspase-3 levels were elevated in the arsenite-infused SN. In ER pathway, arsenite increased activating transcription factor-4, X-box binding protein 1, C/EBP homologues protein (CHOP) and cytosolic immunoglobulin binding protein levels. Moreover, arsenite reduced procaspase 12 levels, an ER-specific enzyme in the infused SN. Taken together, our study suggests that arsenite is capable of inducing oxidative injury in CNS. In addition to mitochondria, ER stress was involved in the arsenite-induced apoptosis. Arsenite-induced neurotoxicity clinically implies a pathophysiological role of arsenite in CNS neurodegeneration.

  20. Coordinated regulation of angiopoietin-1 and vascular endothelial growth factor by arsenite in human brain microvascular pericytes: implications of arsenite-induced vascular dysfunction.

    PubMed

    Park, Jae-Sun; Seo, Jungwon; Kim, Yong-Ou; Lee, Ho-Sa; Jo, Inho

    2009-10-01

    Arsenite is an environmental toxicant that is associated with vascular disease; however, the underlying mechanism of its toxicity has yet to be elucidated. Vascular stability appears to be tightly regulated by several vasoactive proteins produced by two adjacent vascular cells, endothelial cells (EC) and pericytes. The disruption of vascular stability may be involved in arsenite toxicity. The roles of angipoietins (Ang) and vascular endothelial growth factor (VEGF) in this process have been evaluated, but these studies have mostly been limited to EC. In this study, we used human brain microvascular pericytes (HBMP) to evaluate the effects of arsenite on Ang-1 and VEGF regulation. Ang-2 was reported to be not detected in HBMP. Arsenite decreased Ang-1 secretion in a time and dose-dependent manner, while it increased VEGF secretion. Although arsenite did not alter Ang-1 mRNA expression, it increased intracellular Ang-1 protein levels in a dose-dependent manner, suggesting a role for arsenite in the intracellular trapping of Ang-1. Contrary to Ang-1, the expression of VEGF mRNA was dose-dependently up-regulated by arsenite. Treatment with N-actyl-l:-cysteine (NAC) alone decreased the release of Ang-1, but failed to attenuate the arsenite-induced decrease in Ang-1 secretion, while NAC completely blocked the arsenite-stimulated VEGF secretion. These results indicate that reactive oxygen species are involved in the regulation of VEGF, but not of Ang-1, secretion in response to arsenite treatment in pericytes. Furthermore, immunocytochemical analysis using confocal microscopy revealed a colocalization of Ang-1 with actin filaments that occurred independently of tubulin. In conclusion, arsenite decreases Ang-1 secretion and increases VEGF secretion, which may offer new insight into understanding the arsenite toxicity associated with vascular instability and subsequent development of vascular disease.

  1. The role of the rice aquaporin Lsi1 in arsenite efflux from roots.

    PubMed

    Zhao, Fang-Jie; Ago, Yukiko; Mitani, Namiki; Li, Ren-Ying; Su, Yu-Hong; Yamaji, Naoki; McGrath, Steve P; Ma, Jian Feng

    2010-04-01

    *When supplied with arsenate (As(V)), plant roots extrude a substantial amount of arsenite (As(III)) to the external medium through as yet unidentified pathways. The rice (Oryza sativa) silicon transporter Lsi1 (OsNIP2;1, an aquaporin channel) is the major entry route of arsenite into rice roots. Whether Lsi1 also mediates arsenite efflux was investigated. *Expression of Lsi1 in Xenopus laevis oocytes enhanced arsenite efflux, indicating that Lsi1 facilitates arsenite transport bidirectionally. *Arsenite was the predominant arsenic species in arsenate-exposed rice plants. During 24-h exposure to 5 mum arsenate, rice roots extruded arsenite to the external medium rapidly, accounting for 60-90% of the arsenate uptake. A rice mutant defective in Lsi1 (lsi1) extruded significantly less arsenite than the wild-type rice and, as a result, accumulated more arsenite in the roots. By contrast, Lsi2 mutation had little effect on arsenite efflux to the external medium. *We conclude that Lsi1 plays a role in arsenite efflux in rice roots exposed to arsenate. However, this pathway accounts for only 15-20% of the total efflux, suggesting the existence of other efflux transporters.

  2. Prophylactic neuroprotective efficiency of co-administration of Ginkgo biloba and Trifolium pretense against sodium arsenite-induced neurotoxicity and dementia in different regions of brain and spinal cord of rats.

    PubMed

    Abdou, Heba M; Yousef, Mokhtar I; El Mekkawy, Desouki A; Al-Shami, Ahmed S

    2016-08-01

    The present study was carried out to evaluate the potential protective role of co-administration of Ginkgo biloba, Trifolium pretenseagainst sodium arsenite-induced neurotoxicity in different parts of brain (Cerebral cortex, Hippocampus, striatum and Hind brain) and in the spinal cord of rats. Sodium arsenite caused impairment in the acquisition and learning in all the behavioral tasks and caused significant increase in tumor necrosis factor-α,thiobarbituric acid-reactive substances andlipid profile, while caused significant decrease in glutathione, total thiol content, total antioxidant capacity, acetylcholinesterase, monoamine oxidase and ATPases activities. These results were confirmed by histopathological, fluorescence and scanning electron microscopy examination of different regions of brain. From these results sodium arsenite-induced neurodegenerative disorder in different regions of brain and spinal cord and this could be mediated through modifying the intracellular brain ions homeostasis, cholinergic dysfunction and oxidative damage. The presence of Ginkgo biloba and/orTrifolium pretense with sodium arsenite minimized its neurological damages. It was pronounced that using Ginkgo biloba and Trifolium pretense in combination was more effective as protective agents compared to use eachone of them alone. PMID:27234133

  3. Prophylactic neuroprotective efficiency of co-administration of Ginkgo biloba and Trifolium pretense against sodium arsenite-induced neurotoxicity and dementia in different regions of brain and spinal cord of rats.

    PubMed

    Abdou, Heba M; Yousef, Mokhtar I; El Mekkawy, Desouki A; Al-Shami, Ahmed S

    2016-08-01

    The present study was carried out to evaluate the potential protective role of co-administration of Ginkgo biloba, Trifolium pretenseagainst sodium arsenite-induced neurotoxicity in different parts of brain (Cerebral cortex, Hippocampus, striatum and Hind brain) and in the spinal cord of rats. Sodium arsenite caused impairment in the acquisition and learning in all the behavioral tasks and caused significant increase in tumor necrosis factor-α,thiobarbituric acid-reactive substances andlipid profile, while caused significant decrease in glutathione, total thiol content, total antioxidant capacity, acetylcholinesterase, monoamine oxidase and ATPases activities. These results were confirmed by histopathological, fluorescence and scanning electron microscopy examination of different regions of brain. From these results sodium arsenite-induced neurodegenerative disorder in different regions of brain and spinal cord and this could be mediated through modifying the intracellular brain ions homeostasis, cholinergic dysfunction and oxidative damage. The presence of Ginkgo biloba and/orTrifolium pretense with sodium arsenite minimized its neurological damages. It was pronounced that using Ginkgo biloba and Trifolium pretense in combination was more effective as protective agents compared to use eachone of them alone.

  4. Arsenite interferes with protein folding and triggers formation of protein aggregates in yeast.

    PubMed

    Jacobson, Therese; Navarrete, Clara; Sharma, Sandeep K; Sideri, Theodora C; Ibstedt, Sebastian; Priya, Smriti; Grant, Chris M; Christen, Philipp; Goloubinoff, Pierre; Tamás, Markus J

    2012-11-01

    Several metals and metalloids profoundly affect biological systems, but their impact on the proteome and mechanisms of toxicity are not fully understood. Here, we demonstrate that arsenite causes protein aggregation in Saccharomyces cerevisiae. Various molecular chaperones were found to be associated with arsenite-induced aggregates indicating that this metalloid promotes protein misfolding. Using in vivo and in vitro assays, we show that proteins in the process of synthesis/folding are particularly sensitive to arsenite-induced aggregation, that arsenite interferes with protein folding by acting on unfolded polypeptides, and that arsenite directly inhibits chaperone activity. Thus, folding inhibition contributes to arsenite toxicity in two ways: by aggregate formation and by chaperone inhibition. Importantly, arsenite-induced protein aggregates can act as seeds committing other, labile proteins to misfold and aggregate. Our findings describe a novel mechanism of toxicity that may explain the suggested role of this metalloid in the etiology and pathogenesis of protein folding disorders associated with arsenic poisoning.

  5. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  6. Traveling Waves in the Arsenite-Iodate System.

    ERIC Educational Resources Information Center

    Epstein, Irving R.

    1983-01-01

    The reaction between arsenite and iodate in acidic solution offers an excellent pedagogic introduction to such phenomena as traveling waves. Component reactions, traveling waves, and a mathematical model are discussed. Demonstrations described can easily be elaborated into a full laboratory experiment. (Author/JN)

  7. ZERO-VALENT IRON FOR HIGH-LEVEL ARSENITE REMOVAL

    EPA Science Inventory

    This study conducted by flow through column systems was aimed at investigating the feasibility of using zero-valent iron for arsenic remediation in groundwater. A high concentration arsenic solution (50 mg l-1) was prepared by using sodium arsenite (arsenic (III)) to simulate gr...

  8. Inhibition of mitotic-specific histone phophorylation by sodium arsenite

    SciTech Connect

    Cobo, J.M.; Valdez, J.G.; Gurley, L.R.

    1994-10-01

    Synchronized cultures of Chinese hamster cells (line CHO) were used to measure the effects of 10{mu}M sodium arsenite on histone phosphorylation. This treatment caused cell proliferation to be temporarily arrested, after which the cells spontaneously resumed cell proliferation in a radiomimetric manner. Immediately following treatment, it was found that sodium arsenite affected only mitotic-specific HI and H3 phosphorylations. Neither interphase, nor mitotic, H2A and H4 phosphorylations were affected, nor was interphase HI Phosphorylation affected. The phosphorylation of HI was inhibited only in mitosis, reducing HI phosphorylation to 38.1% of control levels, which was the level of interphase HI phosphorylation. The phosphorylation of both H3 variants was inhibited in mitosis, the less hydrophobic H3 to 19% and the more hydrophobic H3 to 24% of control levels. These results suggest that sodium arsenite may inhibite cell proliferation by interfering with the cyclin B/p34{sup cdc2} histone kinase activity which is thought to play a key role in regulating the cell cycle. It has been proposed by our laboratory that HI and H3 phosphorylations play a role in restructuring interphase chromatin into metaphase chromosomes. Interference of this process by sodium arsenite may lead to structurally damaged chromosomes resulting in the increased cancer risks known to be produced by arsenic exposure from the environment.

  9. Decrease of fibrinolytic activity in human endothelial cells by arsenite.

    PubMed

    Jiang, Shinn-Jong; Lin, Tsun-Mei; Wu, Hua-Lin; Han, Huai-Song; Shi, Guey-Yueh

    2002-01-01

    Blackfoot disease (BFD) is an endemic peripheral vascular occlusive disease that occurred in the southwest coast of Taiwan. It is believed that arsenic in the drinking water from artesian wells plays an important role in the development of the disease. We have previously shown that BFD patients had significant lower tissue-type plasminogen activator (t-PA) antigen level and higher plasminogen activator inhibitor, Type 1 (PAI-1) antigen level than normal controls. The purpose of this study was to investigate the effects of arsenite on the fibrinolytic and anticoagulant activities of cultured macrovascular and microvascular endothelial cells. Incubation of human microvascular endothelial cells (HMEC-1), but not human umbilical vein endothelial cells (HUVECs), with arsenite caused a decrease of t-PA mRNA level, a rise of both PAI-1 mRNA level and PAI activity. Arsenite could also inhibit the thrombomodulin (TM) mRNA expression and reduce the TM antigen level in HMEC-1. In conclusion, arsenite had a greater effect on HMEC-1 as compared to HUVECs in lowering the fibrinolytic activity and may be responsible for the reduced capacity of fibrinolysis associated with BFD.

  10. Proteomic Profiling of Bladders from Mice Exposed with Sodium Arsenite

    EPA Science Inventory

    Arsenic, an environmental contaminant, has been linked with cancer of the bladder in humans. To study the mode of action of arsenic, female CH3 mice were exposed to 85 ppm sodium arsenite in their drinking water for 30 days. Following the exposure a comparative proteomic analysis...

  11. Identification and catalytic residues of the arsenite methyltransferase from a sulfate-reducing bacterium, Clostridium sp. BXM.

    PubMed

    Wang, Pei-Pei; Bao, Peng; Sun, Guo-Xin

    2015-01-01

    Arsenic methylation is an important process frequently occurring in anaerobic environments. Anaerobic microorganisms have been implicated as the major contributors for As methylation. However, very little information is available regarding the enzymatic mechanism of As methylation by anaerobes. In this study, one novel sulfate-reducing bacterium isolate, Clostridium sp. BXM, which was isolated from a paddy soil in our laboratory, was demonstrated to have the ability of methylating As. One putative arsenite S-Adenosyl-Methionine methyltransferase (ArsM) gene, CsarsM was cloned from Clostridium sp. BXM. Heterologous expression of CsarsM conferred As resistance and the ability of methylating As to an As-sensitive strain of Escherichia coli. Purified methyltransferase CsArsM catalyzed the formation of methylated products from arsenite, further confirming its function of As methylation. Site-directed mutagenesis studies demonstrated that three conserved cysteine residues at positions 65, 153 and 203 in CsArsM are necessary for arsenite methylation, but only Cysteine 153 and Cysteine 203 are required for the methylation of monomethylarsenic to dimethylarsenic. These results provided the characterization of arsenic methyltransferase from anaerobic sulfate-reducing bacterium. Given that sulfate-reducing bacteria are ubiquitous in various wetlands including paddy soils, enzymatic methylation mediated by these anaerobes is proposed to contribute to the arsenic biogeochemical cycling. PMID:25790486

  12. Arsenic Methylation and Volatilization by Arsenite S-Adenosylmethionine Methyltransferase in Pseudomonas alcaligenes NBRC14159

    PubMed Central

    Zhang, Jun; Cao, Tingting; Tang, Zhu; Shen, Qirong; Rosen, Barry P.

    2015-01-01

    Inorganic arsenic (As) is highly toxic and ubiquitous in the environment. Inorganic As can be transformed by microbial methylation, which constitutes an important part of the As biogeochemical cycle. In this study, we investigated As biotransformation by Pseudomonas alcaligenes NBRC14159. P. alcaligenes was able to methylate arsenite [As(III)] rapidly to dimethylarsenate and small amounts of trimethylarsenic oxide. An arsenite S-adenosylmethionine methyltransferase, PaArsM, was identified and functionally characterized. PaArsM shares low similarities with other reported ArsM enzymes (<55%). When P. alcaligenes arsM gene (PaarsM) was disrupted, the mutant lost As methylation ability and became more sensitive to As(III). PaarsM was expressed in the absence of As(III) and the expression was further enhanced by As(III) exposure. Heterologous expression of PaarsM in an As-hypersensitive strain of Escherichia coli conferred As(III) resistance. Purified PaArsM protein methylated As(III) to dimethylarsenate as the main product in the medium and also produced dimethylarsine and trimethylarsine gases. We propose that PaArsM plays a role in As methylation and detoxification of As(III) and could be exploited in bioremediation of As-contaminated environments. PMID:25681184

  13. Isolation and Characterization of Arsenite-Oxidation Bacteria From Arsenic-contaminated Groundwater in Blackfoot Disease Region in Taiwan

    NASA Astrophysics Data System (ADS)

    Hsu, H.; Hsiao, S.; Liu, C.; Liao, C.; Chang, F.; Liao, V. H.

    2006-12-01

    Arsenic is an environmental carcinogen of toxicological concern. Although arsenic is generally toxic to life, it has been demonstrated that some microorganisms can use arsenic compounds as electron donors, electron acceptors, or possess arsenic detoxification mechanisms. Increasing evidences suggest that the biogeochemical cycle of arsenic is significant dependent on microbial transformations which affect the distribution and the mobility of arsenic species in the environment. However, the roles of the bacteria in the arsenic cycles are yet to be fully elucidated. In this study, we isolate As(V)-As(III) redox bacteria using arsenic-contaminated groundwater in Blackfoot disease region in Taiwan under oxic condition. Two hundred and nineteen arsenic-resistant heterotrophic bacterial strains were isolated. Analysis of the 16S rRNA gene sequence of some bacteria revealed that some of bacteria have been indicated involving in arsenic transformation, while others have not been reported to be associated with arsenic transformation. Of these isolated bacteria, one designated as L7506 was selected for further investigation. Strain L7506 is a Gram- negative, straight to curved rod, and motile bacteria. It belongs to genus Bosea based on 16S rRNA sequence analysis. The optimal growth condition was at pH 6-7, 37'C in LB medium. Moreover, it was able to grow in the presence of 100mM arsenate. L7506 began to significantly oxidize arsenite (2mM) to arsenate after 3-day incubation and complete the oxidation process after 10-day incubation. To further explore the genetic basis for the regulation of arsenite oxidation, transposon Tn5 mutagenesis was used to identify genetic determinants required for arsenite oxidation in L7506 and it is in progress. Results from this study show that diverse bacteria were isolated from arsenic-contaminated groundwater in Blackfoot disease region in Taiwan. The identified As(III)-oxidizing bacteria may be potentially used for bioremediation of arsenic

  14. Gene × environment effects of serotonin transporter, dopamine receptor D4, and monoamine oxidase A genes with contextual and parenting risk factors on symptoms of oppositional defiant disorder, anxiety, and depression in a community sample of 4-year-old children.

    PubMed

    Lavigne, John V; Herzing, Laura B K; Cook, Edwin H; Lebailly, Susan A; Gouze, Karen R; Hopkins, Joyce; Bryant, Fred B

    2013-05-01

    Genetic factors can play a key role in the multiple level of analyses approach to understanding the development of child psychopathology. The present study examined gene-environment correlations and gene × environment interactions for polymorphisms of three target genes, the serotonin transporter gene, the D4 dopamine receptor gene, and the monoamine oxidase A gene in relation to symptoms of anxiety, depression, and oppositional behavior. Saliva samples were collected from 175 non-Hispanic White, 4-year-old children. Psychosocial risk factors included socioeconomic status, life stress, caretaker depression, parental support, hostility, and scaffolding skills. In comparison with the short forms (s/s, s/l) of the serotonin transporter linked polymorphic repeat, the long form (l/l) was associated with greater increases in symptoms of oppositional defiant disorder in interaction with family stress and with greater increases in symptoms of child depression and anxiety in interaction with caretaker depression, family conflict, and socioeconomic status. In boys, low-activity monoamine oxidase A gene was associated with increases in child anxiety and depression in interaction with caretaker depression, hostility, family conflict, and family stress. The results highlight the important of gene-environment interplay in the development of symptoms of child psychopathology in young children.

  15. An arsenate-activated glutaredoxin from the arsenic hyperaccumulator fern Pteris vittata L. regulates intracellular arsenite.

    PubMed

    Sundaram, Sabarinath; Rathinasabapathi, Bala; Ma, Lena Q; Rosen, Barry P

    2008-03-01

    To elucidate the mechanisms of arsenic resistance in the arsenic hyperaccumulator fern Pteris vittata L., a cDNA for a glutaredoxin (Grx) Pv5-6 was isolated from a frond expression cDNA library based on the ability of the cDNA to increase arsenic resistance in Escherichia coli. The deduced amino acid sequence of Pv5-6 showed high homology with an Arabidopsis chloroplastic Grx and contained two CXXS putative catalytic motifs. Purified recombinant Pv5-6 exhibited glutaredoxin activity that was increased 1.6-fold by 10 mm arsenate. Site-specific mutation of Cys(67) to Ala(67) resulted in the loss of both GRX activity and arsenic resistance. PvGrx5 was expressed in E. coli mutants in which the arsenic resistance genes of the ars operon were deleted (strain AW3110), a deletion of the gene for the ArsC arsenate reductase (strain WC3110), and a strain in which the ars operon was deleted and the gene for the GlpF aquaglyceroporin was disrupted (strain OSBR1). Expression of PvGrx5 increased arsenic tolerance in strains AW3110 and WC3110, but not in OSBR1, suggesting that PvGrx5 had a role in cellular arsenic resistance independent of the ars operon genes but dependent on GlpF. AW3110 cells expressing PvGrx5 had significantly lower levels of arsenite when compared with vector controls when cultured in medium containing 2.5 mm arsenate. Our results are consistent with PvGrx5 having a role in regulating intracellular arsenite levels, by either directly or indirectly modulating the aquaglyceroporin. To our knowledge, PvGrx5 is the first plant Grx implicated in arsenic metabolism.

  16. Prenatal sodium arsenite affects early development of serotonergic neurons in the fetal rat brain.

    PubMed

    Senuma, Mika; Mori, Chisato; Ogawa, Tetsuo; Kuwagata, Makiko

    2014-11-01

    Prenatal arsenite exposure has been associated with developmental disorders in children, including reduced IQ and language abnormalities. Animal experiments have also shown that exposure to arsenite during development induced developmental neurotoxicity after birth. However, the evidence is not enough, and the mechanism is poorly understood, especially on the exposure during early brain development. This study assessed effects of sodium (meta) arsenite shortly after exposure on early developing fetal rat brains. Pregnant rats were administered 50 mg/L arsenite in their drinking water or 20 mg/kg arsenite orally using a gastric tube, on gestational days (GD) 9-15. Fetal brains were examined on GD16. Pregnant rats administered 20 mg/kg arsenite showed reductions in maternal body weight gain and food consumption during treatment, but not with 50 mg/L arsenite. Arsenite did not affect fetal development, as determined by body weight, mortality and brain size. Arsenite also did not induce excessive cell death or affect neural cell division in any region of the fetal neuroepithelium. Thyrosine hydroxylase immunohistochemistry revealed no difference in the distribution of catecholaminergic neurons between fetuses of arsenite treated and control rats. However, reductions in the number of serotonin positive cells in the fetal median and dorsal raphe nuclei were observed following maternal treatment with 20mg/kg arsenite. Image analysis showed that the serotonin positive areas decreased in all fetal mid- and hind-brain areas without altering distribution patterns. Maternal stress induced by arsenite toxicity did not alter fetal development. These results suggest that arsenite-induced neurodevelopmental toxicity involves defects in the early development of the serotonin nervous system.

  17. Molecular characterization of Fasciola hepatica and phylogenetic analysis based on mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I and cytochrome oxidase subunit I) genes from the North-East of Iran

    PubMed Central

    Reaghi, Saber; Haghighi, Ali; Harandi, Majid Fasihi; Spotin, Adel; Arzamani, Kourosh; Rouhani, Soheila

    2016-01-01

    Aim: Fascioliasis is one of the most zoonotic diseases with global extension. As the epidemiological distribution of Fasciola may lead to various genetic patterns of the parasite, the aim of this study is to identify Fasciola hepatica based on spermatogenesis, and phylogenetic analysis using mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I [ND1] and cytochrome oxidase subunit I) gene marker. Materials and Methods: In this study, 90 F. hepatica collected from 30 cattle at slaughterhouse located in three different geographical locations in the North-East of Iran were evaluated based on spermatogenetic ability and internal transcribed spacer 1 gene restriction fragment length polymorphism pattern. Genetic diversity and phylogenetic relationship using mtDNA gene marker for the isolates from the North-East of Iran, and other countries were then analyzed. Results: Partial sequences of mtDNA showed eight haplotypes in both genes. The phylogenic analysis using neighbor joining as well as maximum likelihood methods showed similar topologies of trees. Pairwise fixation index between different F. hepatica populations calculated from the nucleotide data set of ND1 gene are statistically significant and show the genetic difference. Conclusion: F. hepatica found in this region of Iran has different genetic structures through the other Fasciola populations in the world. PMID:27733809

  18. Mobilization of arsenite by dissimilatory reduction of adsorbed arsenate

    USGS Publications Warehouse

    Zobrist, J.; Dowdle, P.R.; Davis, J.A.; Oremland, R.S.

    2000-01-01

    Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite, a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was influenced by the method in which arsenate became associated with the mineral phases and may have been strongly coupled with arsenate desorption rates. The extent of release of arsenite into solution was governed by adsorption of arsenite onto the ferrihydrite or alumina phases. The results of these experiments have interpretive significance to the mobilization of arsenic in large alluvial aquifers, such as those of the Ganges in India and Bangladesh, and in the hyporheic zones of contaminated streams.Sulfurospirillum barnesii is capable of anaerobic growth using ferric iron or arsenate as electron acceptors. Cell suspensions of S. barnesii were able to reduce arsenate to arsenite when the former oxyanion was dissolved in solution, or when it was adsorbed onto the surface of ferrihydrite a common soil mineral, by a variety of mechanisms (e.g., coprecipitation, presorption). Reduction of Fe(III) in ferrihydrite to soluble Fe(II) also occurred, but dissolution of ferrihydrite was not required in order for adsorbed arsenate reduction to be achieved. This was illustrated by bacterial reduction of arsenate coprecipitated with aluminum hydroxide, a mineral that does not undergo reductive dissolution. The rate of arsenate reduction was

  19. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders.

  20. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  1. Arsenite-induced apoptosis is prevented by antioxidants in zebrafish liver cell line.

    PubMed

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young; Kim, Dong-Jae; Na, Yi-Rang; Noh, Kyoung-Jin; Park, Sung-Hoon; Lee, Hyun-Kyoung; Lee, Byoung-Hee; Ryu, Doug-Young; Park, Jae-Hak

    2007-08-01

    This study evaluated oxidative stress-induced apoptosis as a possible mechanism of arsenite toxicity in zebrafish liver cell line (ZFL cells). The heat shock protein 70 (HSP70), a chaperone protein, appears to provide protection against oxidative stress and apoptosis. Using the MTT assay, we demonstrated that survival of ZFL cells treated with arsenite for 24h decreased in a dose-dependent manner. The possible mechanisms that promote the cytotoxicity of arsenite were addressed. Cell viability assays revealed that arsenite caused a dose-dependent increase in cell death, and pretreatment of the ZFL cells with antioxidants blunted these effects. Antioxidants such as N-acetyl-cysteine (NAC, 5 mM) and dithiothreitol (DTT, 80 microM) significantly prevented ZFL cells from arsenite-induced death. Nuclear staining was performed using 1 microg/ml Hoechst, and cells were analyzed with a fluorescent microscope. Arsenite (30 microM) induced massive apoptosis that was identified by morphology and condensation and fragmentation of the nuclei of the ZFL cells. Pretreatment with NAC or DTT before arsenite insult effectively protected the cells against oxidative stress-induced apoptosis from the arsenite. Using a transfected human hsp 70 promoter-enhanced green fluorescent protein (EGFP) reporter, pHhsp70-EGFP, the induction of HSP70 against oxidative stress-induced apoptosis by arsenite was observed. The induction of HSP70 by arsenite increased in a dose-dependent manner, and pretreatment of transfected ZFL cells with NAC or DTT before arsenite insult reduced EGFP expression. Taken together, our results provide evidence that stimulation of the heat shock response is a sensitive biomarker of arsenic exposure and that arsenite causes oxidative stress-induced apoptosis in ZFL cells. PMID:17416483

  2. Arsenite decreases CYP3A23 induction in cultured rat hepatocytes by transcriptional and translational mechanisms

    SciTech Connect

    Noreault, Trisha L.; Nichols, Ralph C.; Trask, Heidi W.; Wrighton, Steven A.; Sinclair, Peter R.; Evans, Ronald M.; Sinclair, Jacqueline F. . E-mail: JSINC@dartmouth.edu

    2005-12-01

    Arsenic is a naturally occurring, worldwide contaminant implicated in numerous pathological conditions in humans, including cancer and several forms of liver disease. One of the contributing factors to these disorders may be the alteration of cytochrome P450 (CYP) levels by arsenic. In rat and human hepatocyte cultures, arsenic, in the form of arsenite, decreases the induction of several CYPs. The present study investigated whether arsenite utilizes transcriptional or post-transcriptional mechanisms to decrease CYP3A23 in primary cultures of rat hepatocytes. In these cultures, a 6-h treatment with 5 {mu}M arsenite abolished dexamethasone (DEX)-mediated induction of CYP3A23 protein and activity, but did not inhibit general protein synthesis. However, arsenite treatment only reduced DEX-induced levels of CYP3A23 mRNA by 30%. The effects of arsenite on CYP3A23 transcription were examined using a luciferase reporter construct containing 1.4 kb of the CYP3A23 promoter. Arsenite caused a 30% decrease in DEX-induced luciferase expression of this reporter. Since arsenite abolished induction of CYP3A23 protein, but caused only a small decrease in CYP3A23 mRNA, the effects of arsenite on translation of CYP3A23 mRNA were investigated. Polysomal distribution analysis showed that arsenite decreased translation by decreasing the DEX-mediated increase in CYP3A23 mRNA association with polyribosomes. Arsenite did not decrease intracellular glutathione or increase lipid peroxidation, suggesting that the effect of arsenite on CYP3A23 does not involve oxidative stress. Overall, the results suggest that low-level arsenite decreases both transcription and translation of CYP3A23 in primary rat hepatocyte cultures.

  3. Arsenite-induced apoptosis is prevented by antioxidants in zebrafish liver cell line.

    PubMed

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young; Kim, Dong-Jae; Na, Yi-Rang; Noh, Kyoung-Jin; Park, Sung-Hoon; Lee, Hyun-Kyoung; Lee, Byoung-Hee; Ryu, Doug-Young; Park, Jae-Hak

    2007-08-01

    This study evaluated oxidative stress-induced apoptosis as a possible mechanism of arsenite toxicity in zebrafish liver cell line (ZFL cells). The heat shock protein 70 (HSP70), a chaperone protein, appears to provide protection against oxidative stress and apoptosis. Using the MTT assay, we demonstrated that survival of ZFL cells treated with arsenite for 24h decreased in a dose-dependent manner. The possible mechanisms that promote the cytotoxicity of arsenite were addressed. Cell viability assays revealed that arsenite caused a dose-dependent increase in cell death, and pretreatment of the ZFL cells with antioxidants blunted these effects. Antioxidants such as N-acetyl-cysteine (NAC, 5 mM) and dithiothreitol (DTT, 80 microM) significantly prevented ZFL cells from arsenite-induced death. Nuclear staining was performed using 1 microg/ml Hoechst, and cells were analyzed with a fluorescent microscope. Arsenite (30 microM) induced massive apoptosis that was identified by morphology and condensation and fragmentation of the nuclei of the ZFL cells. Pretreatment with NAC or DTT before arsenite insult effectively protected the cells against oxidative stress-induced apoptosis from the arsenite. Using a transfected human hsp 70 promoter-enhanced green fluorescent protein (EGFP) reporter, pHhsp70-EGFP, the induction of HSP70 against oxidative stress-induced apoptosis by arsenite was observed. The induction of HSP70 by arsenite increased in a dose-dependent manner, and pretreatment of transfected ZFL cells with NAC or DTT before arsenite insult reduced EGFP expression. Taken together, our results provide evidence that stimulation of the heat shock response is a sensitive biomarker of arsenic exposure and that arsenite causes oxidative stress-induced apoptosis in ZFL cells.

  4. Sodium arsenite alters cell cycle and MTHFR, MT1/2, and c-Myc protein levels in MCF-7 cells

    SciTech Connect

    Ruiz-Ramos, Ruben; Lopez-Carrillo, Lizbeth; Albores, Arnulfo; Hernandez-Ramirez, Raul U.; Cebrian, Mariano E.

    2009-12-15

    There is limited available information on the effects of arsenic on enzymes participating in the folate cycle. Therefore, our aim was to evaluate the effects of sodium arsenite on the protein levels of methylenetetrahydrofolate reductase (MTHFR) and dihydrofolate reductase (DHFR) and its further relationship with the expression MT1/2 and c-myc in MCF-7 cells. Arsenite treatment (0-10 muM) for 4 h decreased MTHFR levels in a concentration-dependent fashion without significant effects on DHFR. The effects on MTHFR were observed at arsenite concentrations not significantly affecting cell viability. We also observed an increase in S-phase recruitment at all concentrations probed. Lower concentrations (< 5 muM) induced cell proliferation, showing a high proportion of BrdU-stained cells, indicating a higher DNA synthesis rate. However, higher concentrations (>= 5 muM) or longer treatment periods induced apoptosis. Arsenite also induced dose-dependent increases in MT1/2 and c-Myc protein levels. The levels of MTHFR were inversely correlated to MT1/2 and c-Myc overexpression and increased S-phase recruitment. Our findings indicate that breast epithelial cells are responsive to arsenite and suggest that exposure may pose a risk for breast cancer. The reductions in MTHFR protein levels contribute to understand the mechanisms underlying the induction of genes influencing growth regulation, such as c-myc and MT1/2. However, further research is needed to ascertain if the effects here reported following short-time and high-dose exposure are relevant for human populations chronically exposed to low arsenic concentrations.

  5. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis.

  6. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  7. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression.

  8. Criblamydia sequanensis Harbors a Megaplasmid Encoding Arsenite Resistance.

    PubMed

    Bertelli, Claire; Goesmann, Alexander; Greub, Gilbert

    2014-01-01

    Criblamydia sequanensis is an amoeba-resisting bacterium recently isolated from the Seine River. This Chlamydia-related bacterium harbors a genome of approximately 3 Mbp and a megaplasmid of 89,525 bp. The plasmid encodes several efflux systems and an operon for arsenite resistance. This first genome sequence within the Criblamydiaceae family enlarges our view on the evolution and the ecology of this important bacterial clade largely understudied so far. PMID:25342672

  9. Effects of arsenite in astrocytes on neuronal signaling transduction.

    PubMed

    Wang, Yan; Zhao, Fenghong; Liao, Yingjun; Jin, Yaping; Sun, Guifan

    2013-01-01

    The main purpose of this study was to test the hypothesis that arsenite induces neurotoxicity via effects on astrocytes. Astrocytes were exposed to 0, 5 or 10 μM arsenite in medium for 24 h, and then astrocyte-conditioned medium (ACM) was collected after incubation with fresh medium for 6 h. Primary neuron cultures were divided into four groups due to ACM, which were neurons without ACM exposure (group I) and neurons exposed to ACM from 0, 5 or 10 μM arsenite treated astrocytes (group II-IV). Protein expression of N-methyl-d-aspartate receptors (NR1, NR2A, NR2B), calmodulin-dependent protein kinase II (CaMKII) and adenylate cyclase (AC) in neurons were measured after incubation with ACM for 4, 8 or 12 h. Morphological changes and synaptic formation were observed after a 72 h-incubation with ACM. Compared to group II, synaptic formation and protein expression of NR2A, NR2B, CaMKII and AC in group III and IV were significantly suppressed. Moreover, synaptic formation and protein expression of CaMKII and AC in group II were significantly enhanced when compared with group I. Taken together, findings from this study suggested that arsenic in astrocytes might impair synaptic formation through disturbing astrocytic effects on neuronal signal transduction.

  10. Involvement of HIF-2α-mediated inflammation in arsenite-induced transformation of human bronchial epithelial cells

    SciTech Connect

    Xu, Yuan; Zhao, Yue; Xu, Wenchao; Luo, Fei; Wang, Bairu; Li, Yuan; Pang, Ying; Liu, Qizhan

    2013-10-15

    Arsenic is a well established human carcinogen that causes diseases of the lung. Some studies have suggested a link between inflammation and lung cancer; however, it is unknown if arsenite-induced inflammation causally contributes to arsenite-caused malignant transformation of cells. In this study, we investigated the molecular mechanisms underlying inflammation during neoplastic transformation induced in human bronchial epithelial (HBE) cells by chronic exposure to arsenite. The results showed that, on acute or chronic exposure to arsenite, HBE cells over-expressed the pro-inflammatory cytokines, interleukin-6 (IL-6), interleukin-8 (IL-8), and interleukin-1β (IL-1β). The data also indicated that HIF-2α was involved in arsenite-induced inflammation. Moreover, IL-6 and IL-8 were essential for the malignant progression of arsenite-transformed HBE cells. Thus, these experiments show that HIF-2α mediates arsenite-induced inflammation and that such inflammation is involved in arsenite-induced malignant transformation of HBE cells. The results provide a link between the inflammatory response and the acquisition of a malignant transformed phenotype by cells chronically exposed to arsenite and thus establish a previously unknown mechanism for arsenite-induced carcinogenesis. - Highlights: • Arsenite induces inflammation. • Arsenite-induced the increases of IL-6 and IL-8 via HIF-2α. • Inflammation is involved in arsenite-induced carcinogenesis.

  11. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.

    PubMed

    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon

    2015-06-10

    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade.

  12. Spectroscopic and genetic evidence for two heme-Cu-containing oxidases in Rhodobacter sphaeroides.

    PubMed Central

    Shapleigh, J P; Hill, J J; Alben, J O; Gennis, R B

    1992-01-01

    It has recently become evident that many bacterial respiratory oxidases are members of a superfamily that is related to the eukaryotic cytochrome c oxidase. These oxidases catalyze the reduction of oxygen to water at a heme-copper binuclear center. Fourier transform infrared (FTIR) spectroscopy has been used to examine the heme-copper-containing respiratory oxidases of Rhodobacter sphaeroides Ga. This technique monitors the stretching frequency of CO bound at the oxygen binding site and can be used to characterize the oxidases in situ with membrane preparations. Oxidases that have a heme-copper binuclear center are recognizable by FTIR spectroscopy because the bound CO moves from the heme iron to the nearby copper upon photolysis at low temperature, where it exhibits a diagnostic spectrum. The FTIR spectra indicate that the binuclear center of the R. sphaeroides aa3-type cytochrome c oxidase is remarkably similar to that of the bovine mitochondrial oxidase. Upon deletion of the ctaD gene, encoding subunit I of the aa3-type oxidase, substantial cytochrome c oxidase remains in the membranes of aerobically grown R. sphaeroides. This correlates with a second wild-type R. sphaeroides is grown photosynthetically, the chromatophore membranes lack the aa3-type oxidase but have this second heme-copper oxidase. Subunit I of the heme-copper oxidase superfamily contains the binuclear center. Amino acid sequence alignments show that this subunit is structurally very highly conserved among both eukaryotic and prokaryotic species. The polymerase chain reaction was used to show that the chromosome of R. sphaeroides contains at least one other gene that is a homolog of ctaD, the gene encoding subunit I of the aa3-type cytochrome c oxidase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1313003

  13. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  14. Arsenite-induced mitotic death involves stress response and is independent of tubulin polymerization

    SciTech Connect

    Taylor, B. Frazier; McNeely, Samuel C.; Miller, Heather L.; States, J. Christopher

    2008-07-15

    Arsenite, a known mitotic disruptor, causes cell cycle arrest and cell death at anaphase. The mechanism causing mitotic arrest is highly disputed. We compared arsenite to the spindle poisons nocodazole and paclitaxel. Immunofluorescence analysis of {alpha}-tubulin in interphase cells demonstrated that, while nocodazole and paclitaxel disrupt microtubule polymerization through destabilization and hyperpolymerization, respectively, microtubules in arsenite-treated cells remain comparable to untreated cells even at supra-therapeutic concentrations. Immunofluorescence analysis of {alpha}-tubulin in mitotic cells showed spindle formation in arsenite- and paclitaxel-treated cells but not in nocodazole-treated cells. Spindle formation in arsenite-treated cells appeared irregular and multi-polar. {gamma}-tubulin staining showed that cells treated with nocodazole and therapeutic concentrations of paclitaxel contained two centrosomes. In contrast, most arsenite-treated mitotic cells contained more than two centrosomes, similar to centrosome abnormalities induced by heat shock. Of the three drugs tested, only arsenite treatment increased expression of the inducible isoform of heat shock protein 70 (HSP70i). HSP70 and HSP90 proteins are intimately involved in centrosome regulation and mitotic spindle formation. HSP90 inhibitor 17-DMAG sensitized cells to arsenite treatment and increased arsenite-induced centrosome abnormalities. Combined treatment of 17-DMAG and arsenite resulted in a supra-additive effect on viability, mitotic arrest, and centrosome abnormalities. Thus, arsenite-induced abnormal centrosome amplification and subsequent mitotic arrest is independent of effects on tubulin polymerization and may be due to specific stresses that are protected against by HSP90 and HSP70.

  15. SORPTION OF ARSENITE AND ARSENATE ON A HIGH AFFINITY OXIDE: MACROSCOPIC AND MICROSCOPIC STUDIES

    EPA Science Inventory

    Sorption of arsenate and arsenite was examined on a Ru compound using macroscopic and microscopic techniques. Isotherms were constructed from batch studies at pH 4 through 8. Solution As was measured by ICAP. Samples of the Ru compound were equilibrated with arsenite and arsenate...

  16. DISSOCIATION OF ARSENITE-PEPTIDE COMPLEXES: TRIPHASIC NATURE, RATE CONSTANTS, HALF LIVES AND BIOLOGICAL IMPORTANCE

    EPA Science Inventory

    We determined the number and the dissociation rate constants of different complexes formed from arsenite and two peptides containing either one (RV AVGNDYASGYHYGV for peptide 20) or three cysteines (LE AWQGK VEGTEHLYSMK K for peptide 10) via radioactive 73As labeled arsenite and ...

  17. Complexation of arsenite with phytochelatins reduces arsenite efflux and translocation from roots to shoots in Arabidopsis.

    PubMed

    Liu, Wen-Ju; Wood, B Alan; Raab, Andrea; McGrath, Steve P; Zhao, Fang-Jie; Feldmann, Jörg

    2010-04-01

    Complexation of arsenite [As(III)] with phytochelatins (PCs) is an important mechanism employed by plants to detoxify As; how this complexation affects As mobility was little known. We used high-resolution inductively coupled plasma-mass spectrometry and accurate mass electrospray ionization-mass spectrometry coupled to HPLC to identify and quantify As(III)-thiol complexes and free thiol compounds in Arabidopsis (Arabidopsis thaliana) exposed to arsenate [As(V)]. As(V) was efficiently reduced to As(III) in roots. In wild-type roots, 69% of As was complexed as As(III)-PC4, As(III)-PC3, and As(III)-(PC2)2. Both the glutathione (GSH)-deficient mutant cad2-1 and the PC-deficient mutant cad1-3 were approximately 20 times more sensitive to As(V) than the wild type. In cad1-3 roots, only 8% of As was complexed with GSH as As(III)-(GS)3 and no As(III)-PCs were detected, while in cad2-1 roots, As(III)-PCs accounted for only 25% of the total As. The two mutants had a greater As mobility, with a significantly higher accumulation of As(III) in shoots and 4.5 to 12 times higher shoot-to-root As concentration ratio than the wild type. Roots also effluxed a substantial proportion of the As(V) taken up as As(III) to the external medium, and this efflux was larger in the two mutants. Furthermore, when wild-type plants were exposed to l-buthionine sulfoximine or deprived of sulfur, both As(III) efflux and root-to-shoot translocation were enhanced. The results indicate that complexation of As(III) with PCs in Arabidopsis roots decreases its mobility for both efflux to the external medium and for root-to-shoot translocation. Enhancing PC synthesis in roots may be an effective strategy to reduce As translocation to the edible organs of food crops. PMID:20130102

  18. Complexation of arsenite with phytochelatins reduces arsenite efflux and translocation from roots to shoots in Arabidopsis.

    PubMed

    Liu, Wen-Ju; Wood, B Alan; Raab, Andrea; McGrath, Steve P; Zhao, Fang-Jie; Feldmann, Jörg

    2010-04-01

    Complexation of arsenite [As(III)] with phytochelatins (PCs) is an important mechanism employed by plants to detoxify As; how this complexation affects As mobility was little known. We used high-resolution inductively coupled plasma-mass spectrometry and accurate mass electrospray ionization-mass spectrometry coupled to HPLC to identify and quantify As(III)-thiol complexes and free thiol compounds in Arabidopsis (Arabidopsis thaliana) exposed to arsenate [As(V)]. As(V) was efficiently reduced to As(III) in roots. In wild-type roots, 69% of As was complexed as As(III)-PC4, As(III)-PC3, and As(III)-(PC2)2. Both the glutathione (GSH)-deficient mutant cad2-1 and the PC-deficient mutant cad1-3 were approximately 20 times more sensitive to As(V) than the wild type. In cad1-3 roots, only 8% of As was complexed with GSH as As(III)-(GS)3 and no As(III)-PCs were detected, while in cad2-1 roots, As(III)-PCs accounted for only 25% of the total As. The two mutants had a greater As mobility, with a significantly higher accumulation of As(III) in shoots and 4.5 to 12 times higher shoot-to-root As concentration ratio than the wild type. Roots also effluxed a substantial proportion of the As(V) taken up as As(III) to the external medium, and this efflux was larger in the two mutants. Furthermore, when wild-type plants were exposed to l-buthionine sulfoximine or deprived of sulfur, both As(III) efflux and root-to-shoot translocation were enhanced. The results indicate that complexation of As(III) with PCs in Arabidopsis roots decreases its mobility for both efflux to the external medium and for root-to-shoot translocation. Enhancing PC synthesis in roots may be an effective strategy to reduce As translocation to the edible organs of food crops.

  19. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma.

  20. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  1. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population.

    PubMed

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande

    2016-01-01

    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  2. Improved detection of malaria cases in island settings of Vanuatu and Kenya by PCR that targets the Plasmodium mitochondrial cytochrome c oxidase III (cox3) gene.

    PubMed

    Isozumi, Rie; Fukui, Mayumi; Kaneko, Akira; Chan, Chim W; Kawamoto, Fumihiko; Kimura, Masatsugu

    2015-06-01

    Detection of sub-microscopic parasitemia is crucial for all malaria elimination programs. PCR-based methods have proven to be sensitive, but two rounds of amplification (nested PCR) are often needed to detect the presence of Plasmodium DNA. To simplify the detection process, we designed a nested PCR method whereby only the primary PCR is required for the detection of the four major human Plasmodium species. Primers designed for the detection of the fifth species, Plasmodium knowlesi, were not included in this study due to the absence of appropriate field samples. Compared to the standard 18S rDNA PCR method, our cytochrome c oxidase III (cox3) method detected 10-50% more cases while maintaining high sensitivities (1.00) for all four Plasmodium species in our samples from Vanuatu (n=77) and Kenya (n=76). Improvement in detection efficiency was more substantial for samples with sub-microscopic parasitemia (54%) than those with observable parasitemia (10-16%). Our method will contribute to improved malaria surveillance in low endemicity settings.

  3. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande

    2016-01-01

    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  4. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  5. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.

    PubMed

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  6. Arsenite as the probable active species in the human carcinogenicity of arsenic: mouse micronucleus assays on Na and K arsenite, orpiment, and Fowler's solution.

    PubMed Central

    Tinwell, H; Stephens, S C; Ashby, J

    1991-01-01

    Sodium arsenite, potassium arsenite, and Fowler's solution (arsenic trioxide dissolved in potassium bicarbonate) are equally active in the mouse bone marrow micronucleus assay (approximately 10 mg/kg by IP injection). The natural ore orpiment (principally As2S3) was inactive despite blood levels of arsenic of 300 to 900 ng/mL in treated mice at 24 hr. Sodium arsenite was active in three strains of mice. It is suggested that the human lung cancer observed among arsenic ore smelters and the skin cancer among people exposed therapeutically to Fowler's solution, have, as their common origin, the genotoxic arsenite ion AsO2-. The difficulty experienced when attempting to demonstrate rodent carcinogenicity for derivatives of arsenic suggests that the bone marrow micronucleus assay may act as a useful assay for potentially carcinogenic arsenic derivatives. PMID:1821373

  7. Autecology of an Arsenite Chemolithotroph: Sulfide Constraints on Function and Distribution in a Geothermal Spring▿

    PubMed Central

    D'Imperio, Seth; Lehr, Corinne R.; Breary, Michele; McDermott, Timothy R.

    2007-01-01

    Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H2S exceeds ∼5 μM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H2S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H2S is removed. Cultivation experiments initiated with mat samples taken from along the H2S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H2S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H2S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H2S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H2S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs. PMID:17827309

  8. Arsenite transporters expression in rice (Oryza sativa L.) associated with arbuscular mycorrhizal fungi (AMF) colonization under different levels of arsenite stress.

    PubMed

    Chen, Xunwen; Li, Hui; Chan, Wai Fung; Wu, Chuan; Wu, Fuyong; Wu, Shengchun; Wong, Ming Hung

    2012-11-01

    As a silicon hyperaccumulator, lowland rice takes up higher levels of As than many other plants due to silicic acid and arsenite sharing the same transporters (Lsi1 and Lsi2). Glomus intraradices (AH01) was inoculated to rice under different arsenite concentrations (0, 2 and 8 μM) in order to investigate the interactions between arbuscular mycorrhizal fungus and rice on the accumulation of arsenite. The relative mRNA expressions of Lsi1 and Lsi2 resulted in a down-regulating trend in mycorrhizal plants. Under 2 μM arsenite treatments, Lsi1 and Lsi2 were significantly decreased, by 0.7-fold (P<0.05) and 0.5-fold (P<0.01), respectively, in mycorrhizal plants when compared with non-mycorrhizal plants. This led to the decrease of arsenite uptake per unit of root dry mass. No organic As species were detected in both roots and shoots. The As(III)/As(V) ratios indicated that mycorrhizal plants immobilized most of the arsenite proportion in the roots and prevented its translocation from the roots to the shoots.

  9. Diversity and abundance of arsenic biotransformation genes in paddy soils from southern China.

    PubMed

    Zhang, Si-Yu; Zhao, Fang-Jie; Sun, Guo-Xin; Su, Jian-Qiang; Yang, Xiao-Ru; Li, Hu; Zhu, Yong-Guan

    2015-04-01

    Microbe-mediated arsenic (As) biotransformation in paddy soils determines the fate of As in soils and its availability to rice plants, yet little is known about the microbial communities involved in As biotransformation. Here, we revealed wide distribution, high diversity, and abundance of arsenite (As(III)) oxidase genes (aioA), respiratory arsenate (As(V)) reductase genes (arrA), As(V) reductase genes (arsC), and As(III) S-adenosylmethionine methyltransferase genes (arsM) in 13 paddy soils collected across Southern China. Sequences grouped with As biotransformation genes are mainly from rice rhizosphere bacteria, such as some Proteobacteria, Gemmatimonadales, and Firmicutes. A significant correlation of gene abundance between arsC and arsM suggests that the two genes coexist well in the microbial As resistance system. Redundancy analysis (RDA) indicated that soil pH, EC, total C, N, As, and Fe, C/N ratio, SO4(2-)-S, NO3(-)-N, and NH4(+)-N were the key factors driving diverse microbial community compositions. This study for the first time provides an overall picture of microbial communities involved in As biotransformation in paddy soils, and considering the wide distribution of paddy fields in the world, it also provides insights into the critical role of paddy fields in the As biogeochemical cycle.

  10. Diversity and abundance of arsenic biotransformation genes in paddy soils from southern China.

    PubMed

    Zhang, Si-Yu; Zhao, Fang-Jie; Sun, Guo-Xin; Su, Jian-Qiang; Yang, Xiao-Ru; Li, Hu; Zhu, Yong-Guan

    2015-04-01

    Microbe-mediated arsenic (As) biotransformation in paddy soils determines the fate of As in soils and its availability to rice plants, yet little is known about the microbial communities involved in As biotransformation. Here, we revealed wide distribution, high diversity, and abundance of arsenite (As(III)) oxidase genes (aioA), respiratory arsenate (As(V)) reductase genes (arrA), As(V) reductase genes (arsC), and As(III) S-adenosylmethionine methyltransferase genes (arsM) in 13 paddy soils collected across Southern China. Sequences grouped with As biotransformation genes are mainly from rice rhizosphere bacteria, such as some Proteobacteria, Gemmatimonadales, and Firmicutes. A significant correlation of gene abundance between arsC and arsM suggests that the two genes coexist well in the microbial As resistance system. Redundancy analysis (RDA) indicated that soil pH, EC, total C, N, As, and Fe, C/N ratio, SO4(2-)-S, NO3(-)-N, and NH4(+)-N were the key factors driving diverse microbial community compositions. This study for the first time provides an overall picture of microbial communities involved in As biotransformation in paddy soils, and considering the wide distribution of paddy fields in the world, it also provides insights into the critical role of paddy fields in the As biogeochemical cycle. PMID:25738639

  11. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  12. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  13. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.

    PubMed

    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu

    2014-10-01

    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  14. Responses to heat shock, arsenite and cadmium in soybean

    SciTech Connect

    Edelman, L. ); Key, J.L. )

    1989-04-01

    Heat shock (HS), arsenite (As) and cadmium (Cd) treatments induced the HS response in soybean seedlings but differed in their abilities to induce stress tolerance. Pretreatment of seedlings with sub-lethal HS protected them from subsequent normally lethal HS treatment. However, the protection was much more pronounced in 1 day-old than in 2 day-old plants. Sublethal arsenite pretreatment resulted in only a low level of protection against lethal As or HS treatment and severe damage still occurred in specific tissues. Cadmium did not induce any self- or cross-protection. DNA sequence analyses revealed that HS, As and Cd induced the transcription of similar sequences. However, Northern blot analyses of HS mRNAs, and analyses of in vitro translation products and in vivo-labeled proteins by 1D and 2D SDS-PAGE demonstrated that, compared to HS, the response to the chemical stresses was slower, less intense and not as selective. Apparently any causal relationship between HS proteins and induced stress tolerance must also involve developmental-, tissue-, and/or quantitative-specificities.

  15. Arsenite induces aquaglyceroporin 9 expression in murine livers.

    PubMed

    Torres-Avila, Manuel; Leal-Galicia, Perla; Sánchez-Peña, Luz C; Del Razo, Luz M; Gonsebatt, Maria E

    2010-07-01

    Mice exposed to sodium arsenite show a dose-related accumulation of inorganic arsenic (iAs) and its methylated metabolites in the liver. While the accumulation of iAs forms increased linearly with dose in liver cells, a different pattern was observed in other tissues such as the brain and lung, as well as in the peripheral nerves of the rat. As such, trivalent iAs enters the cells, using aquaglyceroporin transporters to modulate cell arsenic accumulation and cytotoxicity. We investigated here if the dose-related accumulation of arsenic in the liver was related to the expression of aquaglyceroporin 9 (AQP9) in the same organ. CD1 male mice were treated with different concentrations (0, 2.5, 5 or 10mg/kg/day) of sodium arsenite during 1, 3 or 9 days. A significant dose-related, up-regulation of AQP9 mRNA and protein was observed and which was verified by immunohistochemistry in liver sections using specific antibodies. The increased transcription of AQP9 has been observed in fasting and diabetic rats, suggesting that this channel could play a role in the diabetogenic effect of arsenic.

  16. Arsenite maintains germinative state in cultured human epidermal cells

    SciTech Connect

    Patterson, Timothy J.; Reznikova, Tatiana V.; Phillips, Marjorie A.; Rice, Robert H. . E-mail: rhrice@ucdavis.edu

    2005-08-22

    Arsenic is a well-known carcinogen for human skin, but its mechanism of action and proximal macromolecular targets remain to be elucidated. In the present study, low micromolar concentrations of sodium arsenite maintained the proliferative potential of epidermal keratinocytes, decreasing their exit from the germinative compartment under conditions that promote differentiation of untreated cells. This effect was observed in suspension and in post-confluent surface cultures as measured by colony-forming ability and by proportion of rapidly adhering colony-forming cells. Arsenite-treated cultures exhibited elevated levels of {beta}1-integrin and {beta}-catenin, two proteins enriched in cells with high proliferative potential. Levels of phosphorylated (inactive) glycogen synthase kinase 3{beta} were higher in the treated cultures, likely accounting for the increased levels of transcriptionally available {beta}-catenin. These findings suggest that arsenic could have co-carcinogenic and tumor co-promoting activities in the epidermis as a result of increasing the population and persistence of germinative cells targeted by tumor initiators and promoters. These findings also identify a critical signal transduction pathway meriting further exploration in pursuit of this phenomenon.

  17. Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.

    PubMed

    McDonald, Allison E; Vanlerberghe, Greg C

    2005-04-11

    Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans.

  18. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    PubMed

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  19. A complex organization of the gene encoding cytochrome oxidase subunit 1 in the mitochondrial genome of the dinoflagellate, Crypthecodinium cohnii: homologous recombination generates two different cox1 open reading frames.

    PubMed

    Norman, J E; Gray, M W

    2001-01-01

    In the course of investigating mitochondrial genome organization in Crypthecodinium cohnii, a non-photosynthetic dinoflagellate, we identified four EcoRI fragments that hybridize to a probe specific for cox1, the gene that encodes subunit 1 of cytochrome oxidase. Cloning and sequence characterization of the four fragments (5.7, 5.1, 4.1, 3.5 kilobase pairs) revealed that cox1 exists in four distinct but related contexts in C. cohnii mtDNA, with a central repeat unit flanked by one of two possible upstream (flanking domain 1 or 2) and downstream (flanking domain 3 or 4) regions. The majority of the cox1 gene is located within the central repeat; however, the C-terminal portion of the open reading frame extends into flanking domains 3 and 4, thereby creating two distinct cox1 coding sequences. The 3'-terminal region of one of the cox1 reading frames can assume an elaborate secondary structure, which potentially could act to stabilize the mature mRNA against nucleolytic degradation. In addition, a high density of small inverted repeats (15-22 base pairs) has been identified at the 5'-end of cox1, further suggesting that hairpin structures could be important for gene regulation. The organization of cox1 in C. cohnii mtDNA appears to reflect homologous recombination events within the central repeat between different cox1 sequence contexts. Such recombining repeats are a characteristic feature of plant (angiosperm) mtDNA, but they have not previously been described in the mitochondrial genomes of protists.

  20. Induction of apoptotic death and retardation of neuronal differentiation of human neural stem cells by sodium arsenite treatment

    SciTech Connect

    Ivanov, Vladimir N.; Hei, Tom K.

    2013-04-01

    Chronic arsenic toxicity is a global health problem that affects more than 100 million people worldwide. Long-term health effects of inorganic sodium arsenite in drinking water may result in skin, lung and liver cancers and in severe neurological abnormalities. We investigated in the present study whether sodium arsenite affects signaling pathways that control cell survival, proliferation and neuronal differentiation of human neural stem cells (NSC). We demonstrated that the critical signaling pathway, which was suppressed by sodium arsenite in NSC, was the protective PI3K–AKT pathway. Sodium arsenite (2–4 μM) also caused down-regulation of Nanog, one of the key transcription factors that control pluripotency and self-renewal of stem cells. Mitochondrial damage and cytochrome-c release induced by sodium arsenite exposure was followed by initiation of the mitochondrial apoptotic pathway in NSC. Beside caspase-9 and caspase-3 inhibitors, suppression of JNK activity decreased levels of arsenite-induced apoptosis in NSC. Neuronal differentiation of NSC was substantially inhibited by sodium arsenite exposure. Overactivation of JNK1 and ERK1/2 and down-regulation of PI3K–AKT activity induced by sodium arsenite were critical factors that strongly affected neuronal differentiation. In conclusion, sodium arsenite exposure of human NSC induces the mitochondrial apoptotic pathway, which is substantially accelerated due to the simultaneous suppression of PI3K–AKT. Sodium arsenite also negatively affects neuronal differentiation of NSC through overactivation of MEK–ERK and suppression of PI3K–AKT. - Highlights: ► Arsenite induces the mitochondrial apoptotic pathway in human neural stem cells. ► Arsenite-induced apoptosis is strongly upregulated by suppression of PI3K–AKT. ► Arsenite-induced apoptosis is strongly down-regulated by inhibition of JNK–cJun. ► Arsenite negatively affects neuronal differentiation by inhibition of PI3K–AKT.

  1. Mitochondrial hormesis links low-dose arsenite exposure to lifespan extension

    PubMed Central

    Schmeisser, Sebastian; Schmeisser, Kathrin; Weimer, Sandra; Groth, Marco; Priebe, Steffen; Fazius, Eugen; Kuhlow, Doreen; Pick, Denis; Einax, Jürgen W; Guthke, Reinhard; Platzer, Matthias; Zarse, Kim; Ristow, Michael

    2013-01-01

    Arsenite is one of the most toxic chemical substances known and is assumed to exert detrimental effects on viability even at lowest concentrations. By contrast and unlike higher concentrations, we here find that exposure to low-dose arsenite promotes growth of cultured mammalian cells. In the nematode C. elegans, low-dose arsenite promotes resistance against thermal and chemical stressors and extends lifespan of this metazoan, whereas higher concentrations reduce longevity. While arsenite causes a transient increase in reactive oxygen species (ROS) levels in C. elegans, co-exposure to ROS scavengers prevents the lifespan-extending capabilities of arsenite, indicating that transiently increased ROS levels act as transducers of arsenite effects on lifespan, a process known as mitohormesis. This requires two transcription factors, namely DAF-16 and SKN-1, which employ the metallothionein MTL-2 as well as the mitochondrial transporter TIN-9.1 to extend lifespan. Taken together, low-dose arsenite extends lifespan, providing evidence for nonlinear dose-response characteristics of toxin-mediated stress resistance and longevity in a multicellular organism. PMID:23534459

  2. Single strand DNA functionalized single wall carbon nanotubes as sensitive electrochemical labels for arsenite detection.

    PubMed

    Wang, Yonghong; Wang, Ping; Wang, Yiqiang; He, Xiaoxiao; Wang, Kemin

    2015-08-15

    In this work, a simple and sensitive electrochemical strategy for arsenite detection based on the ability of arsenite bound to single-strand DNA (ssDNA) and the signal transduction of single wall carbon nanotubes (SWCNTs) is developed. To realize this purpose, the ssDNA/SWCNTs complexes were formed at first by making ssDNA wrapped around SWCNTs via π-stacking. In the presence of arsenite, the arsenite could strongly bind with the G/T bases of ssDNA and decrease the π-π interaction between ssDNA and SWCNTs, resulting in a certain amount of ssDNA dissociating from the complexes. The separated SWCNTs were selectively assembled on the self-assembled monolayer (SAM) modified Au electrode. Then the SWCNTs onto the SAM-modified Au electrode substantially restored heterogeneous electron transfer that was almost totally blocked by the SAM. The assembled SWCNTs could generate a considerably sensitive and specific tactic for signal transduction, which was related to the concentration of the arsenite. Through detecting the currents mediated by SWCNTs, a linear response to concentration of arsenite ranging from 0.5 to 10ppb and a detection limit of 0.5ppb was readily achieved with desirable specificity and sensitivity. Such a SWCNTs-based biosensor creates a simple, sensitive, nonradioactive route for detection of arsenite. In addition, this demonstration provides a new approach to fabrication of stable biosensors with favorable electrochemical properties believed to be appealing to electroanalytical applications.

  3. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  4. Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean

    PubMed Central

    Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  5. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.

    PubMed

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

    2009-10-01

    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  6. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  7. Exploring the utility of phylogenetic analysis of cytochrome oxidase gene subunit I as a complementary tool to classical taxonomical identification of phlebotomine sand fly species (Diptera, Psychodidae) from southern Europe.

    PubMed

    Maia, Carla; Parreira, Ricardo; Cristóvão, José Manuel; Afonso, Maria Odete; Campino, Lenea

    2015-04-01

    Phlebotomine sand flies (Diptera, Psychodidae) are known to be vectors of several pathogens such as Leishmania and Phlebovirus genera. The identification of phlebotomine sand fly species is currently based on morphological characters, and requires considerable taxonomic expertise and skilfulness, but may be complemented by DNA-based analyses for (i) accurate species identification and (ii) for estimating sand fly diversity. The aim of this study was to evaluate the utility of mitochondrial cytochrome oxidase gene subunit I (cox1) sequence analysis as a complementary tool to classical taxonomical for the identification of the most prevalent phlebotomine sand fly species from southern Europe (i.e. Phlebotomus ariasi, P. perniciosus, P. sergenti and Sergentomyia minuta). Phylogenetic analyses of cox1 sequences allowed conclusive assignment of most of the sand flies into individual species, and revealed the genetic heterogeneity that characterizes some of the identified genetic clusters. Nevertheless, it showed some limitations, as it failed to (i) allocate correctly all of all species of a given subgenus to a single lineage, or (ii) conclusively identify sequences amplified from individuals classified morphologically as P. ariasi. A more extensive analysis of cox1 sequences together with morphometric characterization of specimens from different geographic areas/regions might be useful for the correct assessment of the phylogenetic relationship within the P. ariasi/P. chadlii cluster and/or help to ascertain the usefulness of cox1 for molecular taxonomy of sand flies.

  8. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  9. Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

    PubMed

    Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

    2015-10-01

    Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings. PMID:26024808

  10. Effect of arsenite-oxidizing bacterium B. laterosporus on arsenite toxicity and arsenic translocation in rice seedlings.

    PubMed

    Yang, Gui-Di; Xie, Wan-Ying; Zhu, Xi; Huang, Yi; Yang, Xiao-Jun; Qiu, Zong-Qing; Lv, Zhen-Mao; Wang, Wen-Na; Lin, Wen-Xiong

    2015-10-01

    Arsenite [As (III)] oxidation can be accelerated by bacterial catalysis, but the effects of the accelerated oxidation on arsenic toxicity and translocation in rice plants are poorly understood. Herein we investigated how an arsenite-oxidizing bacterium, namely Brevibacillus laterosporus, influences As (III) toxicity and translocation in rice plants. Rice seedlings of four cultivars, namely Guangyou Ming 118 (GM), Teyou Hang II (TH), Shanyou 63 (SY) and Minghui 63 (MH), inoculated with or without the bacterium were grown hydroponically with As (III) to investigate its effects on arsenic toxicity and translocation in the plants. Percentages of As (III) oxidation in the solutions with the bacterium (100%) were all significantly higher than those without (30-72%). The addition of the bacterium significantly decreased As (III) concentrations in SY root, GM root and shoot, while increased the As (III) concentrations in the shoot of SY, MH and TH and in the root of MH. Furthermore, the As (III) concentrations in the root and shoot of SY were both the lowest among the treatments with the bacterium. On the other hand, its addition significantly alleviated the As (III) toxicity on four rice cultivars. Among the treatments amended with B. laterosporus, the bacterium showed the best remediation on SY seedlings, with respect to the subdued As (III) toxicity and decreased As (III) concentration in its roots. These results indicated that As (III) oxidation accelerated by B. laterosporus could be an effective method to alleviate As (III) toxicity on rice seedlings.

  11. Identification and characterization of the arsenite methyltransferase from a protozoan, Tetrahymena pyriformis.

    PubMed

    Ye, Jun; Chang, Yue; Yan, Yu; Xiong, Jie; Xue, Xi-Mei; Yuan, Dongxia; Sun, Guo-Xin; Zhu, Yong-Guan; Miao, Wei

    2014-04-01

    Arsenic (As) methylation in aquatic microbes plays a major role in the biogeochemistry of As. Protozoa, especially the free-living freshwater species, are important players in aquatic ecological health. In this study, an arsenite (As(III)) methyltransferase, TpyArsM, was identified and characterized in a free-living protozoan, Tetrahymena pyriformis. In order to confirm its function, TpyarsM gene was knocked-out in Tetrahymena and was also heterologously expressed in hypersensitive E. coli; these events resulted in expected decreases in As tolerance and methylation ability, respectively. In-vitro tests revealed that purified TpyArsM protein methylated inorganic As to mono- and di- methylarsenate, and also had the novel property of producing trimethylarsenite (TMA(III)) and dimethylarsine (Me2AsH) gases. This new methyltransferase gene, identified in a species near the base of the food web, has enriched our knowledge of As methyltransferases and has great potential for bioremediation of As-contaminated environments.

  12. Metalloid tolerance based on phytochelatins is not functionally equivalent to the arsenite transporter Acr3p.

    PubMed

    Wysocki, Robert; Clemens, Stephan; Augustyniak, Daria; Golik, Pawel; Maciaszczyk, Ewa; Tamás, Markus J; Dziadkowiec, Dorota

    2003-05-01

    Active transport of metalloids by Acr3p and Ycf1p in Saccharomyces cerevisiae and chelation by phytochelatins in Schizosaccharomyces pombe, nematodes, and plants represent distinct strategies of metalloid detoxification. In this report, we present results of functional comparison of both resistance mechanisms. The S. pombe and wheat phytochelatin synthase (PCS) genes, when expressed in S. cerevisiae, mediate only modest resistance to arsenite and thus cannot functionally compensate for Acr3p. On the other hand, we show for the first time that phytochelatins also contribute to antimony tolerance as PCS fully complement antimonite sensitivity of ycf1Delta mutant. Remarkably, heterologous expression of PCS sensitizes S. cerevisiae to arsenate, while ACR3 confers much higher arsenic resistance in pcsDelta than in wild-type S. pombe. The analysis of PCS and ACR3 homologues distribution in various organisms and our experimental data suggest that separation of ACR3 and PCS genes may lead to the optimal tolerance status of the cell.

  13. A bacterial view of the periodic table: genes and proteins for toxic inorganic ions.

    PubMed

    Silver, Simon; Phung, Le T

    2005-12-01

    Essentially all bacteria have genes for toxic metal ion resistances and these include those for Ag+, AsO2-, AsO4(3-), Cd2+ Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. The largest group of resistance systems functions by energy-dependent efflux of toxic ions. Fewer involve enzymatic transformations (oxidation, reduction, methylation, and demethylation) or metal-binding proteins (for example, metallothionein SmtA, chaperone CopZ and periplasmic silver binding protein SilE). Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. For example, Cd2+-efflux pumps of bacteria are either inner membrane P-type ATPases or three polypeptide RND chemiosmotic complexes consisting of an inner membrane pump, a periplasmic-bridging protein and an outer membrane channel. In addition to the best studied three-polypeptide chemiosmotic system, Czc (Cd2+, Zn2+, and Co2), others are known that efflux Ag+, Cu+, Ni2+, and Zn2+. Resistance to inorganic mercury, Hg2+ (and to organomercurials, such as CH3Hg+ and phenylmercury) involve a series of metal-binding and membrane transport proteins as well as the enzymes mercuric reductase and organomercurial lyase, which overall convert more toxic to less toxic forms. Arsenic resistance and metabolizing systems occur in three patterns, the widely-found ars operon that is present in most bacterial genomes and many plasmids, the more recently recognized arr genes for the periplasmic arsenate reductase that functions in anaerobic respiration as a terminal electron acceptor, and the aso genes for the periplasmic arsenite oxidase that functions as an initial electron donor in aerobic resistance to arsenite.

  14. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  15. [Lead adsorption and arsenite oxidation by cobalt doped birnessite].

    PubMed

    Yin, Hui; Feng, Xiong-Han; Qiu, Guo-Hong; Tan, Wen-Feng; Liu, Fan

    2011-07-01

    In order to study the effects of transition metal ions on the physic-chemical properties of manganese dioxides as environmental friendly materials, three-dimensional nano-microsphere cobalt-doped birnessite was synthesized by reduction of potassium permanganate by mixtures of concentrated hydrochloride and cobalt (II) chloride. Powder X-ray diffraction, chemical analysis, N2 physical adsorption, field emission scanning electron microscopy (FE-SEM) and X-ray photoelectron spectra (XPS) were used to characterize the crystal structure, chemical composition and micro-morphologies of products. In the range of molar ratios from 0.05 to 0.20, birnessite was fabricated exclusively. It was observed that cobalt incorporated into the layers of birnessite and had little effect on the crystal structure and micromorpholgy, but crystallinity decreased after cobalt doping. Both chemical analysis and XPS results showed that manganese average oxidation state decreased after cobalt doping, and the percentage of Mn3+ increased. Co(III) OOH existed mainly in the structure. With the increase of cobalt, hydroxide oxygen percentage in molar increased from 12.79% for undoped birnessite to 13.05%, 17.69% and 17.79% for doped samples respectively. Adsorption capacity for lead and oxidation of arsenite of birnessite were enhanced by cobalt doping. The maximum capacity of Pb2+ adsorption increased in the order HB (2 538 mmol/kg) < CoB5 (2798 mmol/kg) < CoB10 (2932 mmol/kg) < CoB20 (3 146 mmol/kg). Oxidation percentage of arsenite in simulated waste water by undoped birnessite was 76.5%, those of doped ones increased by 2.0%, 12.8% and 18.9% respectively. Partial of Co3+ substitution for Mn4+ results in the increase of negative charge of the layer and the content of hydroxyl group, which could account for the improved adsorption capacity of Pb2+. After substitution of manganese by cobalt, oxidation capacity of arsenite by birnessite increases likely due to the higher standard redox potential of

  16. Arsenite Sorption by Drinking-Water Treatment Residuals: Redox Effects

    NASA Astrophysics Data System (ADS)

    Makris, K. C.; Sarkar, D.; Datta, R.

    2005-05-01

    Arsenic (As) is a major human carcinogen and could pose a serious human health risk at concentrations as low as 50 ppb in drinking water. Elevated As concentrations in soils currently used for residential purposes (located on former agricultural lands amended with arsenical pesticides) have increased the possibility of human contact with soil-As. Studies have shown that As bioavailability in the environment is primarily a function of its chemical speciation, which depends upon the redox potential. Arsenic toxicity and carcinogenicity to living organisms is primarily due to exposure to the reduced species of As - arsenite, i.e., As(III), rather than the oxidized species - arsenate, i.e., As(V); the mobility of As(III) is much higher than As(V). One of the most promising methods to decrease the mobility of arsenite in the soil-water system is promoting its retention onto amorphous Fe/Al hydroxides. Drinking-Water Treatment Residuals (WTRs) are an inexpensive source of such Fe/Al hydroxides, which can be land-applied following the USEPA-regulated biosolids application rules. The WTRs are byproducts of drinking-water purification processes and generally contain sediment, organic carbon, and Al/Fe hydroxides. The hydroxides are typically amorphous and have tremendous affinity for oxyanions (e.g., arsenate). Preliminary work showed that WTRs are characterized by large internal surface area and porosity that partly explains their high affinity for As(V). The current study examines the potential of two WTRs (Fe-based and Al-based) to adsorb arsenite from solution. We hypothesize that As(III) adsorption onto the Fe-based WTR (whose stability is highly redox-sensitive) would be vastly different from the adsorption of As(III) onto the redox-insensitive Al-based WTR. Our main objective is to characterize As(III) sorption by both Fe- and Al-based WTRs by changing critical factors, such as the solid:solution ratio, contact time, and initial As(III) load. Results from this study

  17. ARSENITE BINDING TO SYNTHETIC PEPTIDES: THE EFFECT OF INCREASING LENGTH BETWEEN TWO CYSTEINES

    EPA Science Inventory

    Binding of trivalent arsenicals to peptides and proteins can alter peptide/protein structure and enzyme function and thereby contribute to arsenic toxicity and carcinogenicity. We utilized radioactive 73As- labeled arsenite and vacuum filtration methodology to determine the bindi...

  18. Sodium arsenite potentiates the clastogenicity and mutagenicity of DNA cross linking agents

    SciTech Connect

    Lee, T.C.; Lee, K.C.; Tzeng, Y.J.; Huang, R.Y.; Jan, K.Y.

    1986-01-01

    To see if sodium arsenite enhances the clastogenicity and the mutagenicity of DNA crosslinking agents, Chinese hamster ovary (CHO) cells and human skin fibroblasts were exposed to cis-diamminedichloroplatinum (II) (cis-Pt(II)) or 8-methoxypsoralen (8-MOP) plus long-wave ultraviolet light (UVA) and then to sodium arsenite. The results indicate that the clastogenicity of cis-Pt(II) and 8-MOP pllus UVA are enhanced by the post-treatment with sodium arsenite. Chromatid breaks and exchanges are predominantly increased in doubly treated cells. Furthermore, the mutagenicity of cis-Pt(II) at the hypoxanthine-guanine phosphoribosyl transferase locus is also potentiated by sodium arsenite in CHO cells

  19. RAPID ARSENITE OXIDATION BY THERMUS AQUATICUS AND THERMUS THERMOPHILUS: FIELD AND LABORATORY INVESTIGATIONS. (R826189)

    EPA Science Inventory

    Thermus aquaticus and Thermus thermophilus, common inhabitants of terrestrial hot springs and thermally polluted domestic and industrial waters, have been found to rapidly oxidize arsenite to arsenate. Field investigations at a hot spring in Yellowstone National Park revealed ...

  20. Synergistic effect of radon and sodium arsenite on DNA damage in HBE cells.

    PubMed

    Liu, Xing; Sun, Bin; Wang, Xiaojuan; Nie, Jihua; Chen, Zhihai; An, Yan; Tong, Jian

    2016-01-01

    Human epidemiological studies showed that radon and arsenic exposures are major risk factors for lung cancer in Yunnan tin miners. However, biological evidence for this phenomenon is absent. In this study, HBE cells were exposed to different concentrations of sodium arsenite, different radon exposure times, or a combination of these two factors. The results showed a synergistic effect of radon and sodium arsenite in cell cytotoxicity as determined by cell viability. Elevated intracellular ROS levels and increased DNA damage indexed by comet assay and γ-H2AX were detected. Moreover, DNA HR repair in terms of Rad51 declined when the cells were exposed to both radon and sodium arsenite. The synergistic effect of radon and sodium arsenite in HBE cells may be attributed to the enhanced DSBs and inhibited HR pathway upon co-exposure.

  1. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  2. Silymarin protects plasma membrane and acrosome integrity in sperm treated with sodium arsenite

    PubMed Central

    Eskandari, Farzaneh; Momeni, Hamid Reza

    2016-01-01

    Background: Exposure to arsenic is associated with impairment of male reproductive function by inducing oxidative stress. Silymarin with an antioxidant property scavenges free radicals. Objective: The aim of this study was to investigate if silymarin can prevent the adverse effects of sodium arsenite on ram sperm plasma membrane and acrosome integrity. Materials and Methods: Ram epidydimal spermatozoa were divided into five groups: spermatozoa at 0 hr, spermatozoa at 180 min (control), spermatozoa treated with silymarin (20 μM) + sodium arsenite (10 μM) for 180 min, spermatozoa treated with sodium arsenite (10 μM) for 180 min and spermatozoa treated with silymarin (20 μM) for 180 min. Double staining of Hoechst and propidium iodide was performed to evaluate sperm plasma membrane integrity, whereas comassie brilliant blue staining was used to assess acrosome integrity. Results: Plasma membrane (p< 0.001) and acrosome integrity (p< 0.05) of the spermatozoa were significantly reduced in sodium arsenite group compared to the control. In silymarin + sodium arsenite group, silymarin was able to significantly (p< 0.001) ameliorate the adverse effects of sodium arsenite on these sperm parameters compared to sodium arsenite group. The incubation of sperm for 180 min (control group) showed a significant (p< 0.001) decrease in acrosome integrity compared to the spermatozoa at 0 hour. The application of silymarin alone for 180 min could also significantly (p< 0.05) increase sperm acrosome integrity compared to the control. Conclusion: Silymarin as a potent antioxidant could compensate the adverse effects of sodium arsenite on the ram sperm plasma membrane and acrosome integrity. PMID:27141548

  3. A MALAT1/HIF-2α feedback loop contributes to arsenite carcinogenesis

    PubMed Central

    Xu, Yuan; Liu, Yi; Liu, Xinlu; Lu, Lu; Li, Jun; Wang, Qingling; Wei, Shaofeng; Shi, Le; Lu, Xiaolin; Liu, Qizhan; Zhang, Aihua

    2016-01-01

    Arsenic is well established as a human carcinogen, but the molecular mechanisms leading to arsenic-induced carcinogenesis are complex and elusive. It is also not known if lncRNAs are involved in arsenic-induced liver carcinogenesis. We have found that MALAT1, a non-coding RNA, is over-expressed in the sera of people exposed to arsenite and in hepatocellular carcinomas (HCCs), and MALAT1 has a close relation with the clinicopathological characteristics of HCC. In addition, hypoxia-inducible factor (HIF)-2α is up-regulated in HCCs, and MALAT1 and HIF-2α have a positive correlation in HCC tissues. During the malignant transformation of human hepatic epithelial (L-02) cells induced by a low concentration (2.0 μM) of arsenite, MALAT1 and HIF-2α are increased. In addition, arsenite-induced MALAT1 causes disassociation of the von Hippel-Lindau (VHL) protein from HIF-2α, therefore, alleviating VHL-mediated HIF-2α ubiquitination, which causes HIF-2α accumulation. In turn, HIF-2α transcriptionally regulates MALAT1, thus forming a positive feedback loop to ensure expression of arsenite-induced MALAT1 and HIF-2α, which are involved in malignant transformation. Moreover, MALAT1 and HIF-2α promote the invasive and metastatic capacities of arsenite-induced transformed L-02 cells and in HCC-LM3 cells. The capacities of MALAT1 and HIF-2α to promote tumor growth are validated in mouse xenograft models. In mice, arsenite induces an inflammatory response, and MALAT1 and HIF-2α are over-expressed. Together, these findings suggest that the MALAT1/HIF-2α feedback loop is involved in regulation of arsenite-induced malignant transformation. Our results not only confirm a novel mechanism involving reciprocal regulation between MALAT1 and HIF-2α, but also expand the understanding of the carcinogenic potential of arsenite. PMID:26735578

  4. Arsenite suppression of involucrin transcription through AP1 promoter sites in cultured human keratinocytes

    SciTech Connect

    Sinitsyna, Nadezda N.; Reznikova, Tatiana V.; Qin Qin; Song, Hyukhwan; Phillips, Marjorie A.; Rice, Robert H.

    2010-03-15

    While preserving keratinocyte proliferative ability, arsenite suppresses cellular differentiation markers by preventing utilization of AP1 transcriptional response elements. In present experiments, arsenite had a dramatic effect in electrophoretic mobility supershift analysis of proteins binding to an involucrin promoter AP1 response element. Without arsenite treatment, binding of JunB and Fra1 was readily detected in nuclear extracts from preconfluent cultures and was not detected a week after confluence, while c-Fos was detected only after confluence. By contrast, band shift of nuclear extracts from arsenite treated cultures showed only JunB and Fra1 binding in postconfluent as well as preconfluent cultures. Immunoblotting of cell extracts showed that arsenite treatment prevented the loss of Fra1 and the increase in c-Fos proteins that occurred after confluence in untreated cultures. Chromatin immunoprecipitation assays demonstrated substantial reduction of c-Fos and acetylated histone H3 at the proximal and distal AP1 response elements in the involucrin promoter and of coactivator p300 at the proximal element. Alteration of AP1 transcription factors was also examined in response to treatment with four metal containing compounds (chromate, vanadate, hemin, divalent cadmium) that also suppress involucrin transcription. These agents all influenced transcription at AP1 elements in a transcriptional reporter assay, but exhibited less effect than arsenite on binding activity assessed by mobility shift and chromatin immunoprecipitation and displayed variable effects on AP1 protein levels. These findings help trace a mechanism by which transcriptional effects of arsenite become manifest and help rationalize the unique action of arsenite, compared to the other agents, to preserve proliferative ability.

  5. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  6. Indole-3-ethanol Oxidase

    PubMed Central

    Percival, Frank W.; Purves, William K.; Vickery, Larry E.

    1973-01-01

    We report the further characterization of indole-3-ethanol oxidase from cucumber seedlings. The effects of various inhibitors suggest that the enzyme may be a flavoprotein with a metal ion and sulfhydryl groups required for full activity. Indole-3-acetaldehyde, a product of the reaction, inhibits the enzyme. This inhibition is overcome by O2 but not by indole-3-ethanol, indicating that the kinetic mechanism of the enzyme is a ping-pong Bi-Bi. The enzyme undergoes cooperative interactions with indoleethanol, yielding Hill coefficients as high as 2.96. Gibberellins are without effect on the enzyme, but it is inhibited by several acidic indoles possessing growth-promoting activity and by two synthetic auxins, 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid. Increasing concentrations of indoleacetic acid (IAA) brought about a slight reduction in the indoleethanol concentration producing halfmaximal velocity. Increasing levels of indoleethanol decreased the concentration of IAA required for half-maximal inhibition. At low concentrations of indoleethanol, low levels of IAA activated rather than inhibited. The effect of IAA was not overcome at higher levels of indoleethanol. These results may be interpreted as showing that IAA is a noncompetitive inhibitor which binds to that conformation of the enzyme which also binds indoleethanol. The significance of these interactions for the regulation of IAA biosynthesis is discussed. PMID:16658401

  7. Caenorhabditis elegans bicarbonate transporter ABTS-1 is involved in arsenite toxicity and cholinergic signaling.

    PubMed

    Liao, Vivian Hsiu-Chuan; Liu, Jui-Tung; Li, Wen-Hsuan; Yu, Chan-Wei; Hsieh, Yi-Chen

    2010-05-17

    Arsenic poisoning affects millions of people worldwide. Although there is accumulating evidence to suggest that the nervous system is a target of arsenic, relatively little information is known regarding its effects on the nervous system. The effects of arsenite on the nervous system in Caenorhabditis elegans were investigated in the present study. We found that abts-1, which encodes a Na(+)-dependent Cl(-)/HCO(3)(-) transporter, is required to protect C. elegans from arsenite toxicity. The abts-1::GFP transgene is primarily expressed in neurons and the hypodermis, but stronger expression was also observed in the pharynx and body wall muscle cells after exposure to arsenite. The steady-state level of ABTS-1 mRNA increased in response to arsenite exposure. We showed that worms lacking abts-1 are hypersensitive to the paralytic effects of the cholinesterase inhibitor, aldicarb, and the nicotinic acetylcholine receptor agonist, levamisole. We also showed that arsenite enhanced sensitivity to aldicarb and levamisole in abts-1 mutant worms. Our results indicate neuronal effects of arsenite and the ABTS-1 bicarbonate transporter.

  8. Removal of arsenite by simultaneous electro-oxidation and electro-coagulation process.

    PubMed

    Zhao, Xu; Zhang, Baofeng; Liu, Huijuan; Qu, Jiuhui

    2010-12-15

    An electrochemical reactor was built and used to remove arsenite from water. In this reactor, arsenite can be oxidized into arsenate, which was removed by electro-coagulation process simultaneously. The reactor mainly included dimension stable anode (DSA) and iron plate electrode. Oxidation of arsenite will occur at the DSA electrode in the electrochemical process. Meantime, the iron ions can be generated by the electro-induced process and iron oxides will form. Thus, the arsenic was removed by coagulation process. Influencing factors on the removal of arsenite were investigated. It is found that Ca(2+) and Mg(2+) ions promoted the removal of arsenite. However, Cl(-), CO(3)(2-), SiO(3)(2-), and PO(4)(3-) ions inhibited the arsenic removal. And, it is observed that the inhibition effect was the largest in the presence of PO(4)(3-). Furthermore, it is observed that the removal efficiency of arsenate is the largest in the pH value of 8. Increase or decrease of pH value did not benefit to the arsenite removal. Fourier transform infrared spectra were used to analyze the floc particles, it is suggested that the removal mechanism of As(III) in this system seems to be oxidative of As(III) to As(V) and to be removed by adsorption/complexation with metal hydroxides generated in the process. PMID:20863616

  9. Autophagy is the predominant process induced by arsenite in human lymphoblastoid cell lines

    SciTech Connect

    Bolt, Alicia M.; Byrd, Randi M.; Klimecki, Walter T.

    2010-05-01

    Arsenic is a widespread environmental toxicant with a diverse array of molecular targets and associated diseases, making the identification of the critical mechanisms and pathways of arsenic-induced cytotoxicity a challenge. In a variety of experimental models, over a range of arsenic exposure levels, apoptosis is a commonly identified arsenic-induced cytotoxic pathway. Human lymphoblastoid cell lines (LCL) have been used as a model system in arsenic toxicology for many years, but the exact mechanism of arsenic-induced cytotoxicity in LCL is still unknown. We investigated the cytotoxicity of sodium arsenite in LCL 18564 using a set of complementary markers for cell death pathways. Markers indicative of apoptosis (phosphatidylserine externalization, PARP cleavage, and sensitivity to caspase inhibition) were uniformly negative in arsenite exposed cells. Interestingly, electron microscopy, acidic vesicle fluorescence, and expression of LC3 in LCL 18564 identified autophagy as an arsenite-induced process that was associated with cytotoxicity. Autophagy, a cellular programmed response that is associated with both cellular stress adaptation as well as cell death appears to be the predominant process in LCL cytotoxicity induced by arsenite. It is unclear, however, whether LCL autophagy is an effector mechanism of arsenite cytotoxicity or alternatively a cellular compensatory mechanism. The ability of arsenite to induce autophagy in lymphoblastoid cell lines introduces a potentially novel mechanistic explanation of the well-characterized in vitro and in vivo toxicity of arsenic to lymphoid cells.

  10. Transporters of arsenite in rice and their role in arsenic accumulation in rice grain.

    PubMed

    Ma, Jian Feng; Yamaji, Naoki; Mitani, Namiki; Xu, Xiao-Yan; Su, Yu-Hong; McGrath, Steve P; Zhao, Fang-Jie

    2008-07-22

    Arsenic poisoning affects millions of people worldwide. Human arsenic intake from rice consumption can be substantial because rice is particularly efficient in assimilating arsenic from paddy soils, although the mechanism has not been elucidated. Here we report that two different types of transporters mediate transport of arsenite, the predominant form of arsenic in paddy soil, from the external medium to the xylem. Transporters belonging to the NIP subfamily of aquaporins in rice are permeable to arsenite but not to arsenate. Mutation in OsNIP2;1 (Lsi1, a silicon influx transporter) significantly decreases arsenite uptake. Furthermore, in the rice mutants defective in the silicon efflux transporter Lsi2, arsenite transport to the xylem and accumulation in shoots and grain decreased greatly. Mutation in Lsi2 had a much greater impact on arsenic accumulation in shoots and grain in field-grown rice than Lsi1. Arsenite transport in rice roots therefore shares the same highly efficient pathway as silicon, which explains why rice is efficient in arsenic accumulation. Our results provide insight into the uptake mechanism of arsenite in rice and strategies for reducing arsenic accumulation in grain for enhanced food safety.

  11. Immobilization of arsenite and ferric iron by Acidithiobacillus ferrooxidans and its relevance to acid mine drainage.

    PubMed

    Duquesne, K; Lebrun, S; Casiot, C; Bruneel, O; Personné, J-C; Leblanc, M; Elbaz-Poulichet, F; Morin, G; Bonnefoy, V

    2003-10-01

    Weathering of the As-rich pyrite-rich tailings of the abandoned mining site of Carnoulès (southeastern France) results in the formation of acid waters heavily loaded with arsenic. Dissolved arsenic present in the seepage waters precipitates within a few meters from the bottom of the tailing dam in the presence of microorganisms. An Acidithiobacillus ferrooxidans strain, referred to as CC1, was isolated from the effluents. This strain was able to remove arsenic from a defined synthetic medium only when grown on ferrous iron. This A. ferrooxidans strain did not oxidize arsenite to arsenate directly or indirectly. Strain CC1 precipitated arsenic unexpectedly as arsenite but not arsenate, with ferric iron produced by its energy metabolism. Furthermore, arsenite was almost not found adsorbed on jarosite but associated with a poorly ordered schwertmannite. Arsenate is known to efficiently precipitate with ferric iron and sulfate in the form of more or less ordered schwertmannite, depending on the sulfur-to-arsenic ratio. Our data demonstrate that the coprecipitation of arsenite with schwertmannite also appears as a potential mechanism of arsenite removal in heavily contaminated acid waters. The removal of arsenite by coprecipitation with ferric iron appears to be a common property of the A. ferrooxidans species, as such a feature was observed with one private and three collection strains, one of which was the type strain. PMID:14532077

  12. Inhibitory effects of sodium arsenite and acacia honey on acetylcholinesterase in rats.

    PubMed

    Muhammad, Aliyu; Odunola, Oyeronke A; Gbadegesin, Michael A; Sallau, Abdullahi B; Ndidi, Uche S; Ibrahim, Mohammed A

    2015-01-01

    This study was conducted to investigate the effect of sodium arsenite and Acacia honey on acetylcholinesterase (AChE) activity and electrolytes in the brain and serum of Wistar rats. Male Wistar albino rats in four groups of five rats each were treated with distilled water, sodium arsenite (5 mg/kg body weight), Acacia honey (20% v/v), and sodium arsenite and Acacia honey, daily for one week. The sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the brain with the combined treatment being more potent. Furthermore, sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the serum. Strong correlation was observed between the sodium and calcium ion levels with acetylcholinesterase activity in the brain and serum. The gas chromatography mass spectrometry analysis of Acacia honey revealed the presence of a number of bioactive compounds such as phenolics, sugar derivatives, and fatty acids. These findings suggest that sodium arsenite and/or Acacia honey modulates acetylcholinesterase activities which may be explored in the management of Alzheimer's diseases but this might be counteracted by the hepatotoxicity induced by arsenics. PMID:25821630

  13. Removal of arsenite by simultaneous electro-oxidation and electro-coagulation process.

    PubMed

    Zhao, Xu; Zhang, Baofeng; Liu, Huijuan; Qu, Jiuhui

    2010-12-15

    An electrochemical reactor was built and used to remove arsenite from water. In this reactor, arsenite can be oxidized into arsenate, which was removed by electro-coagulation process simultaneously. The reactor mainly included dimension stable anode (DSA) and iron plate electrode. Oxidation of arsenite will occur at the DSA electrode in the electrochemical process. Meantime, the iron ions can be generated by the electro-induced process and iron oxides will form. Thus, the arsenic was removed by coagulation process. Influencing factors on the removal of arsenite were investigated. It is found that Ca(2+) and Mg(2+) ions promoted the removal of arsenite. However, Cl(-), CO(3)(2-), SiO(3)(2-), and PO(4)(3-) ions inhibited the arsenic removal. And, it is observed that the inhibition effect was the largest in the presence of PO(4)(3-). Furthermore, it is observed that the removal efficiency of arsenate is the largest in the pH value of 8. Increase or decrease of pH value did not benefit to the arsenite removal. Fourier transform infrared spectra were used to analyze the floc particles, it is suggested that the removal mechanism of As(III) in this system seems to be oxidative of As(III) to As(V) and to be removed by adsorption/complexation with metal hydroxides generated in the process.

  14. Inhibitory Effects of Sodium Arsenite and Acacia Honey on Acetylcholinesterase in Rats

    PubMed Central

    Odunola, Oyeronke A.; Gbadegesin, Michael A.; Sallau, Abdullahi B.; Ndidi, Uche S.; Ibrahim, Mohammed A.

    2015-01-01

    This study was conducted to investigate the effect of sodium arsenite and Acacia honey on acetylcholinesterase (AChE) activity and electrolytes in the brain and serum of Wistar rats. Male Wistar albino rats in four groups of five rats each were treated with distilled water, sodium arsenite (5 mg/kg body weight), Acacia honey (20% v/v), and sodium arsenite and Acacia honey, daily for one week. The sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the brain with the combined treatment being more potent. Furthermore, sodium arsenite and Acacia honey significantly (P < 0.05) decreased AChE activity in the serum. Strong correlation was observed between the sodium and calcium ion levels with acetylcholinesterase activity in the brain and serum. The gas chromatography mass spectrometry analysis of Acacia honey revealed the presence of a number of bioactive compounds such as phenolics, sugar derivatives, and fatty acids. These findings suggest that sodium arsenite and/or Acacia honey modulates acetylcholinesterase activities which may be explored in the management of Alzheimer's diseases but this might be counteracted by the hepatotoxicity induced by arsenics. PMID:25821630

  15. Arsenite stress variably stimulates pro-oxidant enzymes, anatomical deformities, photosynthetic pigment reduction, and antioxidants in arsenic-tolerant and sensitive rice seedlings.

    PubMed

    Tripathi, Preeti; Singh, Rana Pratap; Sharma, Yogesh Kumar; Tripathi, Rudra Deo

    2015-07-01

    Contamination of arsenic (As) in rice (Oryza sativa L.) paddies and subsequent uptake by rice plants is a serious concern, because rice is a staple crop for millions of people. Identification of As toxicity and detoxification mechanisms in paddy rice cultivars would help to reduce As-associated risk. Arsenic tolerance and susceptibility mechanisms were investigated in 2 differential As-accumulating rice genotypes, Triguna and IET-4786, selected from initial screening of 52 rice cultivars as an As-tolerant and an As-sensitive cultivar, respectively, on the basis of root and shoot length during various arsenite (AsIII) exposures (0-50 μM). Indicators of oxidative stress, such as pro-oxidant enzymes (reduced nicotinamide adenine dinucleotide phosphate [NADPH] oxidase and ascorbate oxidase) and nitric oxide, were more numerous in the sensitive cultivar than in the tolerant cultivar. Arsenic-induced anatomical deformities were frequent in the sensitive cultivar, showing more distorted and flaccid root cells than the tolerant cultivar. Chlorophyll and carotenoid synthesis were inhibited in both cultivars, although the decline was more prominent in the sensitive cultivar at higher doses of As. Furthermore, the tolerant cultivar tolerated As stress by producing more antioxidants, such as proline, sustaining the ratio of ascorbate, dehydroascorbate, and glutathione peroxidase (GPX) activity as well as As detoxifying enzymes arsenate reductase, whereas these respective metabolic activities declined in sensitive cultivar, resulting in greater susceptibility to As toxicity. PMID:25683332

  16. After-ripening alters the gene expression pattern of oxidases involved in the ethylene and gibberellin pathways during early imbibition of Sisymbrium officinale L. seeds.

    PubMed

    Iglesias-Fernández, Raquel; Matilla, Angel

    2009-01-01

    After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA(4+7), paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA(4+7) indicated ET-GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET-GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the beta-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA(4+7) only increased MAN in seeds which were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process.

  17. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.

    PubMed

    Kang, J-H; Park, J-Y; Choi, T-J

    2012-11-21

    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program.

  18. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population.

  19. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N. kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.

    PubMed

    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning

    2013-04-01

    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N. kuhlii (Müller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N. trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N. kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N. kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides. PMID:23849725

  20. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  1. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.

    PubMed

    Kang, J-H; Park, J-Y; Choi, T-J

    2012-01-01

    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  2. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N. kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.

    PubMed

    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning

    2013-04-01

    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N. kuhlii (Müller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N. trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N. kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N. kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides.

  3. The Escherichia coli CydX protein is a member of the CydAB cytochrome bd oxidase complex and is required for cytochrome bd oxidase activity.

    PubMed

    VanOrsdel, Caitlin E; Bhatt, Shantanu; Allen, Rondine J; Brenner, Evan P; Hobson, Jessica J; Jamil, Aqsa; Haynes, Brittany M; Genson, Allyson M; Hemm, Matthew R

    2013-08-01

    Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ∼30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ΔcydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex.

  4. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).

    PubMed

    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E

    2013-10-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  5. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae) that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    PubMed

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus.

  6. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  7. Expression of AS3MT alters transcriptional profiles in human urothelial cells exposed to arsenite.

    PubMed

    Hester, Sd; Drobná, Z; Andrews, Dmk; Liu, J; Waalkes, Mp; Thomas, Dj; Styblo, M

    2009-01-01

    Inorganic arsenic (iAs) is an environmental toxicant and human carcinogen. The enzymatic methylation of iAs that is catalyzed by arsenic (+3 oxidation state)-methyltransferase (AS3MT) generates reactive methylated intermediates that contribute to the toxic and carcinogenic effects of iAs. We have shown that clonal human urothelial cells (UROtsa/F35) that express rat AS3MT and methylate iAs are more susceptible to acute toxicity of arsenite (iAs(III)) than parental UROtsa cells that do not express AS3MT and do not methylate iAs. The current work examines transcriptional changes associated with AS3MT expression and identifies specific categories of genes expressed in UROtsa and UROtsa/F35 cells in response to a 24-h exposure to 1 or 50 microM iAs(III). Here, the expression of 21,073 genes was assessed using Agilent Human 1A(V2) arrays. Venn analysis showed marked concentration-dependent differences between gene expression patterns in UROtsa and UROTsa/F35 cells exposed to iAs(III). Among 134 genes altered by exposure to subtoxic 1 microM iAs(III), only 14 were shared by both cell lines. Exposure to cytotoxic 50 microM iAs(III) uniquely altered 1389 genes in UROtsa/F35 and 649 genes in UROtsa cells; 5033 altered genes were associated with the chemical alone. In UROtsa, but not UROtsa/F35 cells exposure to 1 microM iAs(III) altered expression of genes associated with cell adhesion. In contrast, expression of genes involved in cell cycle regulation was significantly altered in UROtsa/F35 cells at this exposure level. At 50 microM iAs(III), pathways regulating cell cycle, cell death, transcription, and metabolism were affected in both cell lines. However, only Urotsa/F35 cells showed numerous G-protein and kinase pathway alterations as well as alterations in pathways involved in cell growth and differentiation. These data link the AS3MT-catalyzed methylation of iAs to specific genomic responses in human cells exposed to iAs(III). Further analysis of these responses will

  8. Arsenite-oxidizing Hydrogenobaculum strain isolated from an acid-sulfate-chloride geothermal spring in Yellowstone National Park.

    PubMed

    Donahoe-Christiansen, Jessica; D'Imperio, Seth; Jackson, Colin R; Inskeep, William P; McDermott, Timothy R

    2004-03-01

    An arsenite-oxidizing Hydrogenobaculum strain was isolated from a geothermal spring in Yellowstone National Park, Wyo., that was previously shown to contain microbial populations engaged in arsenite oxidation. The isolate was sensitive to both arsenite and arsenate and behaved as an obligate chemolithoautotroph that used H(2) as its sole energy source and had an optimum temperature of 55 to 60 degrees C and an optimum pH of 3.0. The arsenite oxidation in this organism displayed saturation kinetics and was strongly inhibited by H(2)S.

  9. Arsenite-Oxidizing Hydrogenobaculum Strain Isolated from an Acid-Sulfate-Chloride Geothermal Spring in Yellowstone National Park

    PubMed Central

    Donahoe-Christiansen, Jessica; D'Imperio, Seth; Jackson, Colin R.; Inskeep, William P.; McDermott, Timothy R.

    2004-01-01

    An arsenite-oxidizing Hydrogenobaculum strain was isolated from a geothermal spring in Yellowstone National Park, Wyo., that was previously shown to contain microbial populations engaged in arsenite oxidation. The isolate was sensitive to both arsenite and arsenate and behaved as an obligate chemolithoautotroph that used H2 as its sole energy source and had an optimum temperature of 55 to 60°C and an optimum pH of 3.0. The arsenite oxidation in this organism displayed saturation kinetics and was strongly inhibited by H2S. PMID:15006819

  10. NADPH oxidases in Eukaryotes: red algae provide new hints!

    PubMed

    Hervé, Cécile; Tonon, Thierry; Collén, Jonas; Corre, Erwan; Boyen, Catherine

    2006-03-01

    The red macro-alga Chondrus crispus is known to produce superoxide radicals in response to cell-free extracts of its green algal pathogenic endophyte Acrochaete operculata. So far, no enzymes involved in this metabolism have been isolated from red algae. We report here the isolation of a gene encoding a homologue of the respiratory burst oxidase gp91(phox) in C. crispus, named Ccrboh. This single copy gene encodes a polypeptide of 825 amino acids. Search performed in available genome and EST algal databases identified sequences showing common features of NADPH oxidases in other algae such as the red unicellular Cyanidioschyzon merolae, the economically valuable red macro-alga Porphyra yezoensis and the two diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. Domain organization and phylogenetic relationships with plant, animal, fungal and algal NADPH oxidase homologues were analyzed. Transcription analysis of the C. crispus gene revealed that it was over-transcribed during infection of C. crispus gametophyte by the endophyte A. operculata, and after incubation in presence of atrazine, methyl jasmonate and hydroxyperoxides derived from C20 polyunsaturated fatty acids (PUFAs). These results also illustrate the interest of exploring the red algal lineage for gaining insight into the deep evolution of NADPH oxidases in Eukaryotes.

  11. [Alternative oxidase in industrial fungi].

    PubMed

    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang

    2015-01-01

    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi.

  12. Identification of prokaryotic homologues indicates an endosymbiotic origin for the alternative oxidases of mitochondria (AOX) and chloroplasts (PTOX).

    PubMed

    Atteia, Ariane; van Lis, Robert; van Hellemond, Jaap J; Tielens, Aloysius G M; Martin, William; Henze, Katrin

    2004-04-14

    The alternative oxidase is a ubiquinol oxidase that has been found to date in the mitochondrial respiratory chain of plants, some fungi and protists. Because of its sparse distribution among eukaryotic lineages and because of its diversity in regulatory mechanisms, the origin of AOX has been a mystery, particularly since no prokaryotic homologues have previously been identified. Here we report the identification of a gene encoding a clear homologue of the mitochondrial alternative oxidase in an alpha-proteobacterium, and the identification of three cyanobacterial genes that encode clear homologues of the plastid-specific alternative oxidase of plants and algae. These findings suggest that the eukaryotic nuclear genes for the alternative oxidases of mitochondria and chloroplasts were acquired via endosymbiotic gene transfer from the eubacterial ancestors of these two organelles, respectively.

  13. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  14. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie

    2011-01-01

    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  15. Curcumin Inhibits The Adverse Effects of Sodium Arsenite in Mouse Epididymal Sperm

    PubMed Central

    Momeni, Hamid Reza; Eskandari, Najmeh

    2016-01-01

    Background The aim of this study was to investigate the effects of curcumin on epididy- mal sperm parameters in adult male Navel Medical Research Institute (NMRI) mice ex- posed to sodium arsenite. Materials and Methods In this experimental study, we divided the animals into four groups: control, sodium arsenite (5 mg/kg), curcumin (100 mg/kg) and curcumin+sodium arsenite. Exposures were performed by intraperitoneal injections for a 5-week period. After the exposure period, we recorded the animals’ body and left testes weights. The left caudal epididymis was used to count the sperm number and analyze motility, viability, morphological abnormalities, acrosome reaction, DNA integrity, and histone-protamine replacement in the spermatozoa. One-way analysis of variance (ANOVA) followed by the Tukey’s test was used to assess the statistical significance of the data with SPSS 16.0. P<0.05 was considered significant. Results Mice exposed to sodium arsenite showed a significant decrease in the num- ber, motility, viability, normal sperm morphology and acrosome integrity of spermato- zoa compared to the control group. In the curcumin+sodium arsenite group, curcumin significantly reversed these adverse effects to the point where they approximated the control. In addition, the application of curcumin alone had no significant difference in these parameters compared to the control and curcumin+sodium arsenite groups. However, we observed no significant differences in the body and the testis weight as well as the DNA integrity and histone-protamine replacement in the spermatozoa of the four groups. Conclusion Curcumin compensated for the toxic effects of sodium arsenite on a number of sperm parameters in adult mice. PMID:27441059

  16. Arsenite Oxidation by Anaerobic Bacteria in Mono Lake, California

    NASA Astrophysics Data System (ADS)

    Hoeft, S. E.; Oremland, R. S.

    2001-12-01

    Mono Lake, California is a meromictic soda lake (pH = 9.8; salinity = 70-90 g/L) with exceptionally high arsenic content (200 μ M) derived from hydrothermal sources. Previous work has shown that arsenic speciation changes from arsenate [As(V)] to the more reduced arsenite [As(III)] with vertical transition from the lake's surface oxic waters to its unmixed, anoxic bottom waters and that dissimilatory reduction is responsible for the observed change in arsenic speciation (Oremland et al., 2000). Depth profiles of arsenic speciation indicate that a small amount of As(V) exists in the anoxic bottom waters, suggesting a constant re-supply by microbial oxidation of As(III). Anaerobic microbial oxidation of As(III) to As(V) was first noted in arsenate-enriched anoxic bottom water amended with nitrate, where nitrate addition caused a rapid microbial re-oxidation of arsenite to arsenate (Hoeft et al. 2001). In following, we conducted time course experiments with As(III)-amended bottom waters supplemented with either 5 mM nitrate, Fe(III)-NTA or nitrite. Nitrate-amended waters formed As(V), while killed controls did not form significant amounts and 5 mM nitrate was completely reduced to 5 mM nitrite by the end of the incubation. Live samples amended with 5mM Fe(III)-NTA produced As(V) that exceeded production of As(V) in killed controls, while nitrite-amended waters formed As(V) in excess of killed controls after an initial lag. We isolated a pure culture, strain MLHE-1, that grows in minimal salts media by oxidation of As(III) to As(V) with the reduction of equivalent quantities of nitrate to nitrite. Strain MLHE-1 appears to be a chemoautotroph. These results demonstrate that the cycling of As(V) and As(III) can be sustained in the absence of oxygen. This has implications not only for the recycling of As(V) in Mono Lake's bottom waters, but also for the mobility of arsenic in aquifers as well. Oremland, R.S. et al. 2000. Geochim. Cosmochim. Acta 64: 3073-3084. Hoeft, S

  17. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni

    1990-01-01

    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  18. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  19. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  20. Adaptation of a methanogenic consortium to arsenite inhibition

    PubMed Central

    Rodriguez-Freire, Lucia; Moore, Sarah E.; Sierra-Alvarez, Reyes; Field, James A.

    2016-01-01

    Arsenic (As) is a ubiquitous metalloid known for its adverse effects to human health. Microorganisms are also impacted by As toxicity, including methanogenic archaea, which can affect the performance of process in which biological activity is required (i.e. stabilization of activated sludge in wastewater treatment plants). The novel ability of a mixed methanogenic granular sludge consortium to adapt to the inhibitory effect of arsenic (As) was investigated by exposing the culture to approximately 0.92 mM of AsIII for 160 d in an arsenate (AsV) reducing bioreactor using ethanol as the electron donor. The results of shaken batch bioassays indicated that the original, unexposed sludge was severely inhibited by arsenite (AsIII) as evidenced by the low 50% inhibition concentrations (IC50) determined, i.e., 19 and 90 μM for acetoclastic- and hydrogenotrophic methanogenesis, respectively. The tolerance of the acetoclastic and hydrogenotrophic methanogens in the sludge to AsIII increased 47-fold (IC50 = 910 μM) and 12-fold (IC50= 1100 μM), respectively, upon long-term exposure to As. In conclusion, the methanogenic community in the granular sludge demonstrated a considerable ability to adapt to the severe inhibitory effects of As after a prolonged exposure period. PMID:26823637

  1. Removal of arsenic from groundwater by arsenite-oxidizing bacteria.

    PubMed

    Ike, M; Miyazaki, T; Yamamoto, N; Sei, K; Soda, S

    2008-01-01

    The presence of arsenic in groundwater has been of great public concern because of its high toxicity. For purification of arsenic-contaminated groundwater, bacterial oxidation of arsenite, As(III), with a chemical adsorption process was examined in this study. After As(III) oxidation to arsenate, As(V), arsenic is easily removable from contaminated groundwater because As(V) is more adsorptive to absorbents than As(III). By acclimation to As(III) of high concentrations, a mixed culture of heterotrophic bacteria with high As(III)-oxidizing activity was obtained from a soil sample that was free from contamination. With initial concentration up to 1,500 mg l(-1) As(III), the mixed culture showed high As(III)-oxidizing activity at pH values of 7-10 and at temperatures of 25-35 degrees C. The mixed culture contained several genera of heterotrophic As(III)-oxidizing and arsenic-tolerant bacteria: Haemophilus, Micrococcus, and Bacillus. Activated alumina was added to the basal salt medium containing 75 mg l(-1) As(III) before and after bacterial oxidation. Arsenic removal by activated alumina was greatly enhanced by bacterial oxidation of As(III) to As(V). The isotherms of As(III) and As(V) onto activated alumina verified that bacterial As(III) oxidation is a helpful pretreatment process for the conventional adsorption process for arsenic removal.

  2. An aquaporin PvTIP4;1 from Pteris vittata may mediate arsenite uptake.

    PubMed

    He, Zhenyan; Yan, Huili; Chen, Yanshan; Shen, Hongling; Xu, Wenxiu; Zhang, Haiyan; Shi, Lei; Zhu, Yong-Guan; Ma, Mi

    2016-01-01

    The fern Pteris vittata is an arsenic hyperaccumulator. The genes involved in arsenite (As(III)) transport are not yet clear. Here, we describe the isolation and characterization of a new P. vittata aquaporin gene, PvTIP4;1, which may mediate As(III) uptake. PvTIP4;1 was identified from yeast functional complement cDNA library of P. vittata. Arsenic toxicity and accumulating activities of PvTIP4;1 were analyzed in Saccharomyces cerevisiae and Arabidopsis. Subcellular localization of PvTIP4;1-GFP fusion protein in P. vittata protoplast and callus was conducted. The tissue expression of PvTIP4;1 was investigated by quantitative real-time PCR. Site-directed mutagenesis of the PvTIP4;1 aromatic/arginine (Ar/R) domain was studied. Heterologous expression in yeast demonstrates that PvTIP4;1 was able to facilitate As(III) diffusion. Transgenic Arabidopsis showed that PvTIP4;1 increases arsenic accumulation and induces arsenic sensitivity. Images and FM4-64 staining suggest that PvTIP4;1 localizes to the plasma membrane in P. vittata cells. A tissue location study shows that PvTIP4;1 transcripts are mainly expressed in roots. Site-directed mutation in yeast further proved that the cysteine at the LE1 position of PvTIP4;1 Ar/R domain is a functional site. PvTIP4;1 is a new represented tonoplast intrinsic protein (TIP) aquaporin from P. vittata and the function and location results imply that PvTIP4;1 may be involved in As(III) uptake.

  3. Label-free signal-on aptasensor for sensitive electrochemical detection of arsenite.

    PubMed

    Cui, Lin; Wu, Jie; Ju, Huangxian

    2016-05-15

    A signal-on aptasensor was fabricated for highly sensitive and selective electrochemical detection of arsenite with a label-free Ars-3 aptamer self-assembled on a screen-printed carbon electrode (SPCE) via Au-S bond. The Ars-3 aptamer could adsorb cationic polydiallyldimethylammonium (PDDA) via electrostatic interaction to repel other cationic species. In the presence of arsenite, the change of Ars-3 conformation due to the formation of Ars-3/arsenite complex led to less adsorption of PDDA, and the complex could adsorb more positively charged [Ru(NH3)6](3+) as an electrochemically active indicator on the aptasensor surface, which produced a sensitive "turn-on" response. The target-induced structure switching could be used for sensitive detection of arsenite with a linear range from 0.2 nM to 100 nM and a detection limit down to 0.15 nM. Benefiting from Ars-3 aptamer, the proposed system exhibited excellent specificity against other heavy metal ions. The SPCE-based aptasensor exhibited the advantages of low cost and simple fabrication, providing potential application of arsenite detection in environment.

  4. Label-free signal-on aptasensor for sensitive electrochemical detection of arsenite.

    PubMed

    Cui, Lin; Wu, Jie; Ju, Huangxian

    2016-05-15

    A signal-on aptasensor was fabricated for highly sensitive and selective electrochemical detection of arsenite with a label-free Ars-3 aptamer self-assembled on a screen-printed carbon electrode (SPCE) via Au-S bond. The Ars-3 aptamer could adsorb cationic polydiallyldimethylammonium (PDDA) via electrostatic interaction to repel other cationic species. In the presence of arsenite, the change of Ars-3 conformation due to the formation of Ars-3/arsenite complex led to less adsorption of PDDA, and the complex could adsorb more positively charged [Ru(NH3)6](3+) as an electrochemically active indicator on the aptasensor surface, which produced a sensitive "turn-on" response. The target-induced structure switching could be used for sensitive detection of arsenite with a linear range from 0.2 nM to 100 nM and a detection limit down to 0.15 nM. Benefiting from Ars-3 aptamer, the proposed system exhibited excellent specificity against other heavy metal ions. The SPCE-based aptasensor exhibited the advantages of low cost and simple fabrication, providing potential application of arsenite detection in environment. PMID:26785310

  5. Genotoxic effects of sodium arsenite and sodium arsenate after chronic exposure of Drosophila melanogaster larvae

    SciTech Connect

    Ramos-Morales, P.; Ordaz, M.G.; Munoz, A.

    1995-11-01

    Two arsenic compounds, namely: NaAsO{sub 2} (Sodium Arsenite) and Na{sub 2}HAsO{sub 4} (Sodium Arsenate) were tested for its chronic effect in somatic cells of Drosophila melanogaster. In a previous study in Drosophila we found that both compounds induced SLRL mutations, but failed to induce sex chromosome loss. In the SMART, after acute exposure, only sodium arsenite was positive when cells of the wings were used; however, both were positives in cells of the eyes of Drosophila. The genotoxicity of both compounds localized mainly on somatic cells, in agreement with reports on the carcinogenicity potential of arsenical compounds. The Somatic mutation and recombination test (SMART) was run employing cells of the wing imaginal discs from flr{sup 3}/mwh larvae. First instar larvae (24 {plus_minus} 4 h) were treated during 96 hours with sodium arsenite [0.015-4.0 ppm], and sodium arsenate [0.2-10 ppm], negative control was treated with distilled water. The frequency of spots by wing induced by the two arsenic salts were compared with control according with Frei and Wuergler procedure. Data show that sodium arsenite tested negative at all concentrations, but sodium arsenate tested positive at 0.8, 2 and 10 ppm (P<0.05). This results were consistent with the co-mutagenic role of sodium arsenite, but show that sodium arsenate was mutagenic in Drosophila test system under chronic exposure.

  6. NADPH Oxidase-Dependent Mechanism Explains How Arsenic and Other Oxidants Can Activate Aryl Hydrocarbon Receptor Signaling.

    PubMed

    Mohammadi-Bardbori, Afshin; Vikström Bergander, Linda; Rannug, Ulf; Rannug, Agneta

    2015-12-21

    The mechanisms explaining arsenic toxicity are not well understood, but physiological consequences of stimulated aryl hydrocarbon receptor (AHR) signaling both directly and through cross-talk with other pathways have been indicated. The aim of this study was to establish how arsenic interacts with AHR-mediated transcription. The human hepatoma cell line (HepG2-XRE-Luc) carrying a luciferase reporter under the control of two AHR response elements (AHREs) and immortalized human keratinocytes (HaCaT) were exposed to sodium arsenite (NaAsO2; As(3+)), alone or in combination with the endogenous high affinity AHR ligand 6-formylindolo[3,2-b]carbazole (FICZ). Luciferase activity, cytochrome P4501A1 (CYP1A1) activity, oxidative stress-related responses, metabolic clearance of FICZ, and NADPH oxidase (NOX) activity as well as nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-dependent gene expression were measured. Arsenic inhibited CYP1A1 enzyme activity and reduced the metabolic clearance of FICZ. Arsenic also led to activated CYP1A1 transcription but only in cells grown in medium containing trace amounts of the endogenous ligand FICZ, pointing to an indirect mechanism of activation. Initially, arsenic caused dose-dependent inhibition of FICZ-activated AHR signaling, disturbed intracellular GSH status, and increased expression of oxidative stress-related genes. Silencing of NOX4, addition of N-acetylcystein, or pretreatment with arsenic itself attenuated the initial dose-dependent inhibition of AHR signaling. Arsenic pretreatment led to elevated GSH levels and sensitized the cells to ligand-dependent AHR signaling, while silencing of Nrf2 significantly reduced arsenic-mediated activation of the AHR. In addition, influence of NOX on AHR activation was also observed in cells treated with the SH-reactive metals cadmium, mercury, and nickel. Together, the results suggest that SH-reactive agents via a new and possibly general NOX/H2O2-dependent mechanism can interfere with

  7. Construction of the recombinant broad-host-range plasmids providing their bacterial hosts arsenic resistance and arsenite oxidation ability.

    PubMed

    Drewniak, Lukasz; Ciezkowska, Martyna; Radlinska, Monika; Sklodowska, Aleksandra

    2015-02-20

    The plasmid pSinA of Sinorhizobium sp. M14 was used as a source of functional phenotypic modules, encoding proteins involved in arsenite oxidation and arsenic resistance, to obtain recombinant broad-host-range plasmids providing their bacterial hosts arsenic resistance and arsenite oxidative ability. An arsenite oxidation module was cloned into pBBR1MCS-2 vector yielding plasmid vector pAIO1, while an arsenic resistance module was cloned into pCM62 vector yielding plasmid pARS1. Both plasmid constructs were introduced (separately and together) into the cells of phylogenetically distant (representing Alpha-, Beta-, and Gammaproteobacteria) and physiologically diversified (unable to oxidize arsenite and susceptible/resistant to arsenite and arsenate) bacteria. Functional analysis of the modified strains showed that: (i) the plasmid pARS1 can be used for the construction of strains with an increased resistance to arsenite [up to 20mM of As(III), (ii) the presence of the plasmid pAIO1 in bacteria previously unable to oxidize As(III) to As(V), contributes to the acquisition of arsenite oxidation abilities by these cells, (iii) the highest arsenite utilization rate are observed in the culture of strains harbouring both the plasmids pAIO1 and pARS1, (iv) the strains harbouring the plasmid pAIO1 were able to grow on arsenic-contaminated mine waters (∼ 3.0 mg As L(-1)) without any supplementation.

  8. HypC, the Anthrone Oxidase Involved in Aflatoxin Biosynthesis▿ †

    PubMed Central

    Ehrlich, Kenneth C.; Li, Ping; Scharfenstein, Leslie; Chang, Perng-Kuang

    2010-01-01

    On the basis of gene disruption and enzyme activity, hypC, an open reading frame in the region between the pksA (aflC) and nor-1 (aflD) genes in the aflatoxin biosynthesis gene cluster, encodes a 17-kDa oxidase that converts norsolorinic acid anthrone to norsolorinic acid. PMID:20348292

  9. Rapid arsenite oxidation by Thermus aquaticus and Thermus thermophilus: Field and laboratory investigations

    USGS Publications Warehouse

    Gihring, T.M.; Druschel, G.K.; McCleskey, R.B.; Hamers, R.J.; Banfield, J.F.

    2001-01-01

    Thermus aquaticus and Thermus thermophilus, common inhabitants of terrestrial hot springs and thermally polluted domestic and industrial waters, have been found to rapidly oxidize arsenite to arsenate. Field investigations at a hot spring in Yellowstone National Park revealed conserved total arsenic transport and rapid arsenite oxidation occurring within the drainage channel. This environment was heavily colonized by Thermus aquaticus. In laboratory experiments, arsenite oxidation by cultures of Thermus aquaticus YT1 (previously isolated from Yellowstone National Park) and Thermus thermophilus HB8 was accelerated by a factor of over 100 relative to abiotic controls. Thermus aquaticus and Thermus thermophilus may therefore play a large and previously unrecognized role in determining arsenic speciation and bioavailability in thermal environments.

  10. CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.

    PubMed

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  11. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  12. Effect of rosiglitazone in sodium arsenite-induced experimental vascular endothelial dysfunction.

    PubMed

    Kaur, Tajpreet; Goel, Rajesh Kumar; Balakumar, Pitchai

    2010-04-01

    The present study has been designed to investigate the effect of rosiglitazone, a peroxisome proliferator activated receptor gamma agonist in sodium arsenite-induced vascular endothelial dysfunction (VED) in rats. The rats were administered sodium arsenite (1.5 mg/kg/day, i.p., 2 weeks) to induce VED. The development of VED was assessed by employing isolated aortic ring preparation and estimating serum nitrite/nitrate concentration. Further, the integrity of the aortic endothelium was assessed histologically using haematoxylin-eosin staining. Moreover, the oxidative stress was assessed by estimating serum thiobarbituric acid reactive substances, aortic reactive oxygen species and reduced form of glutathione. The administration of sodium arsenite produced VED by impairing acetylcholine-induced endothelium dependent relaxation, diminishing the integrity of vascular endothelium and decreasing the serum nitrite/nitrate concentration. In addition, sodium arsenite was noted to produce oxidative stress as it increased serum thiobarbituric acid reactive substances and aortic reactive oxygen species and consequently decreased glutathione. Treatment with rosiglitazone (3 mg/kg/day, p.o., 2 weeks and 5 mg/kg/day, p.o., 2 weeks) significantly prevented sodium arsenite-induced VED by enhancing acetylcholine-induced endothelium dependent relaxation, improving the integrity of vascular endothelium, increasing the nitrite/nitrate concentration and decreasing the oxidative stress. However, the vascular protective effect of rosiglitazone was markedly abolished by co-administration of nitric oxide synthase inhibitor, N-Omega-Nitro-L-Arginine Methyl Ester (L-NAME) (25 mg/kg/day, i.p., 2 weeks). Thus, it may be concluded that rosiglitazone reduces oxidative stress, activates eNOS and enhances the generation of nitric oxide to prevent sodium arsenite-induced VED in rats. PMID:20422371

  13. Sodium arsenite impairs insulin secretion and transcription in pancreatic {beta}-cells

    SciTech Connect

    Diaz-Villasenor, Andrea; Sanchez-Soto, M. Carmen; Cebrian, Mariano E.; Ostrosky-Wegman, Patricia; Hiriart, Marcia . E-mail: mhiriart@ifc.unam.mx

    2006-07-01

    Human studies have shown that chronic inorganic arsenic (iAs) exposure is associated with a high prevalence and incidence of type 2 diabetes. However, the mechanism(s) underlying this effect are not well understood, and practically, there is no information available on the effects of arsenic on pancreatic {beta}-cells functions. Thus, since insulin secreted by the pancreas plays a crucial role in maintaining glucose homeostasis, our aim was to determine if sodium arsenite impairs insulin secretion and mRNA expression in single adult rat pancreatic {beta}-cells. Cells were treated with 0.5, 1, 2, 5 and 10 {mu}M sodium arsenite and incubated for 72 and 144 h. The highest dose tested (10 {mu}M) decreased {beta}-cell viability, by 33% and 83%, respectively. Insulin secretion and mRNA expression were evaluated in the presence of 1 and 5 {mu}M sodium arsenite. Basal insulin secretion, in 5.6 mM glucose, was not significantly affected by 1 or 5 {mu}M treatment for 72 h, but basal secretion was reduced when cells were exposed to 5 {mu}M sodium arsenite for 144 h. On the other hand, insulin secretion in response to 15.6 mM glucose decreased with sodium arsenite in a dose-dependent manner in such a way that cells were no longer able to distinguish between different glucose concentrations. We also showed a significant decrease in insulin mRNA expression of cells exposed to 5 {mu}M sodium arsenite during 72 h. Our data suggest that arsenic may contribute to the development of diabetes mellitus by impairing pancreatic {beta}-cell functions, particularly insulin synthesis and secretion.

  14. Arsenite treatment induces oxidative stress, upregulates antioxidant system, and causes phytochelatin synthesis in rice seedlings.

    PubMed

    Mishra, Shruti; Jha, A B; Dubey, R S

    2011-07-01

    The effects of arsenite treatment on generation of reactive oxygen species, induction of oxidative stress, response of antioxidative system, and synthesis of phytochelatins were investigated in two indica rice (Oryza sativa L.) cvs. Malviya-36 and Pant-12 grown in sand cultures for a period of 5-20 days. Arsenite (As(2)O(3); 25 and 50 μM) treatment resulted in increased formation of superoxide anion (O (2) (.-) ), elevated levels of H(2)O(2) and thiobarbituric acid reactive substances, showing enhanced lipid peroxidation. An enhanced level of ascorbate (AA) and glutathione (GSH) was observed irrespective of the variation in the level of dehydroascorbate (DHA) and oxidized glutathione (GSSG) which in turn influenced redox ratios AA/DHA and GSH/GSSG. With progressive arsenite treatment, synthesis of total acid soluble thiols and phytochelatins (PC) increased in the seedlings. Among antioxidative enzymes, the activities of superoxide dismutase (EC 1.15.1.1), catalase (EC 1.11.1.6), total ascorbate peroxidase (APX, EC 1.11.1.11), chloroplastic ascorbate peroxidase, guaiacol peroxidase (EC 1.11.1.7), monodehydroascorbate reductase (EC 1.6.5.4), and glutathione reductase (EC 1.6.4.2) increased in arsenite treated seedlings, while dehyroascorbate reductase (EC 1.8.5.1) activity declined initially during 5-10 days and increased thereafter. Results suggest that arsenite treatment causes oxidative stress in rice seedlings, increases the levels of many enzymatic and non-enzymatic antioxidants, and induces synthesis of thiols and PCs, which may serve as important components in mitigating arsenite-induced oxidative damage.

  15. [Effectiveness of arsenite adsorption by ferric and alum water treatment residuals with different grain sizes].

    PubMed

    Lin, Lu; Xu, Jia-Rui; Wu, Hao; Wang, Chang-Hui; Pei, Yuan-Sheng

    2013-07-01

    Effectiveness of arsenite adsorption by ferric and alum water treatment residuals (FARs) with different grain sizes was studied. The results indicated that the content of active Fe and Al, the specific surface area and pore volume in FARs with different grain sizes were in the range of 523.72-1 861.72 mmol x kg(-1), 28.15-265.59 m2 x g(-1) and 0.03-0.09 cm3 x g(-1), respectively. The contents of organic matter, fulvic acid, humic acid and humin were in the range of 46.97-91.58 mg x kg(-1), 0.02-32.27 mg x kg(-1), 22.27-34.09 mg x kg(-1) and 10.76-34.22 mg x kg(-1), respectively. Results of SEM and XRD analysis further demonstrated that FARs with different grain sizes were amorphousness. Batch experiments suggested that both the pseudo-first-order and pseudo-second-order equations could well describe the kinetics adsorption processes of arsenite by FARs. Moreover, the contents of arsenite absorbed by FARs increased with the increase of arsenite concentrations. The theoretical saturated adsorption capacities calculated from Langmuir isotherm model were in the range of 6.72-21.79 mg x g(-1). Interestingly, pH showed little effect on the arsenite adsorption capability of FARs. The capability of FARs had a close relationship with their physicochemical properties. Correlation analysis showed that the active Fe and Al contents and pore volume had major effects on the arsenite adsorption capability of FARs.

  16. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions.

  17. In vitro effect of sodium arsenite on Echinococcus granulosus protoscoleces.

    PubMed

    Xing, Guoqiang; Wang, Bo; Lei, Ying; Liu, Chunli; Wang, Zhuo; Shi, Hongjuan; Yang, Rentan; Qin, Wenjuan; Jiang, Yufeng; Lv, Hailong

    2016-06-01

    Cystic echinococcosis (CE) caused by the metacestodes of Echinococcus granulosus is an important cosmopolitan zoonosis. Surgery is the main treatment option for CE. Meanwhile, chemotherapy is used as an significant adjunct to surgery. However, the benzimidazole carbamate group and the existing scolicidal agents may not be as effective as hoped. In this study, we aimed to explore the in vitro effect of sodium arsenite (NaAsO2) on Echinococcus granulosus protoscoleces, the causative agents of CE. Protoscoleces of E. granulosus were incubated in vitro with 4, 8, 12, 16, and 20μM NaAsO2. Viability and changes in morphology were investigated by 0.1% eosin staining. The ultrastructural alterations were observed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Additionally, caspase-3 activity was measured by colorimetric assay. Obvious protoscolicidal effect was seen with NaAsO2 at concentrations of 16μM and 20μM. Protoscolex mortality was 83.24% (16μM) and 100% (20μM) after 6 days post-incubation. SEM showed that the primary site of drug damage was the tegument of the protoscoleces. TEM analysis demonstrated that the internal tissues were severely affected and revealed an increase in the number of lipid droplets and vacuoles after treatment with 16μM NaAsO2. Meanwhile, the caspase-3 activity significantly increased in protoscoleces after 24h of NaAsO2 incubation compared to the untreated controls. Our study demonstrated the clear in vitro scolicidal effect of NaAsO2 against E. granulosus protoscoleces. However, the in vivo efficacy, specific mechanism, and any possible side effects of NaAsO2 remain to be investigated. PMID:27234209

  18. In vitro effect of sodium arsenite on Echinococcus granulosus protoscoleces.

    PubMed

    Xing, Guoqiang; Wang, Bo; Lei, Ying; Liu, Chunli; Wang, Zhuo; Shi, Hongjuan; Yang, Rentan; Qin, Wenjuan; Jiang, Yufeng; Lv, Hailong

    2016-06-01

    Cystic echinococcosis (CE) caused by the metacestodes of Echinococcus granulosus is an important cosmopolitan zoonosis. Surgery is the main treatment option for CE. Meanwhile, chemotherapy is used as an significant adjunct to surgery. However, the benzimidazole carbamate group and the existing scolicidal agents may not be as effective as hoped. In this study, we aimed to explore the in vitro effect of sodium arsenite (NaAsO2) on Echinococcus granulosus protoscoleces, the causative agents of CE. Protoscoleces of E. granulosus were incubated in vitro with 4, 8, 12, 16, and 20μM NaAsO2. Viability and changes in morphology were investigated by 0.1% eosin staining. The ultrastructural alterations were observed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Additionally, caspase-3 activity was measured by colorimetric assay. Obvious protoscolicidal effect was seen with NaAsO2 at concentrations of 16μM and 20μM. Protoscolex mortality was 83.24% (16μM) and 100% (20μM) after 6 days post-incubation. SEM showed that the primary site of drug damage was the tegument of the protoscoleces. TEM analysis demonstrated that the internal tissues were severely affected and revealed an increase in the number of lipid droplets and vacuoles after treatment with 16μM NaAsO2. Meanwhile, the caspase-3 activity significantly increased in protoscoleces after 24h of NaAsO2 incubation compared to the untreated controls. Our study demonstrated the clear in vitro scolicidal effect of NaAsO2 against E. granulosus protoscoleces. However, the in vivo efficacy, specific mechanism, and any possible side effects of NaAsO2 remain to be investigated.

  19. Enhanced arsenite removal through surface-catalyzed oxidative coagulation treatment.

    PubMed

    Li, Yue; Bland, Garret D; Yan, Weile

    2016-05-01

    Arsenic being a naturally-occurring groundwater contaminant is subject to stringent water quality regulations. Coagulation and adsorption are widely used methods to treat arsenic-contaminated water, however, these treatments have been reported to be less efficient for the removal of arsenite (As(III)) than arsenate (As(V)). In this study, the feasibility of in situ oxidation of As(III) during coagulation was investigated in two systems: Fe(II) or H2O2-assisted oxidative coagulation treatment using ferric chloride as the coagulant. This setup exploits the catalytic property of the fresh formed Fe(III) hydroxide colloids in coagulation suspension to mediate the production of reactive oxidants capable of As(III) oxidation. Fe(II)-assisted coagulation brought about small improvements in As(III) removal compared to treatment with Fe(III) coagulant alone, however, its arsenic removal efficiency is strongly dependent on pH (observed optimal pH = 7-9). Addition of H2O2 together with ferric chloride led to a significant enhancement in arsenic retention at pH 6-8, with final arsenic concentrations well below the U.S.EPA regulatory limit (10 μg/L). H2O2-assisted oxidative coagulation can attain reliable As(III) removal over a broad pH range of 4-9. Radical quenching experiments reveal the participation of superoxide radical in As(III) removal in the oxidative coagulation systems. Phosphate (at > 0.1 mM) strongly suppresses As(III) removal efficiency, whereas carbonate and humic acid pose a minor impact. Overall, the results suggest that a low dose addition of H2O2 along with ferric coagulant is a feasible method for the existing water treatment facilities to achieve improved As(III) removal efficiency. PMID:26897520

  20. Functional characterization of gibberellin oxidases from cucumber, Cucumis sativus L.

    PubMed

    Pimenta Lange, Maria João; Liebrandt, Anja; Arnold, Linda; Chmielewska, Sara-Miriam; Felsberger, André; Freier, Eduard; Heuer, Monika; Zur, Doreen; Lange, Theo

    2013-06-01

    Cucurbits have been used widely to elucidate gibberellin (GA) biosynthesis. With the recent availability of the genome sequence for the economically important cucurbit Cucumis sativus, sequence data became available for all genes potentially involved in GA biosynthesis for this species. Sixteen cDNAs were cloned from root and shoot of 3-d to 7-d old seedlings and from mature seeds of C. sativus. Two cDNAs code for GA 7-oxidases (CsGA7ox1, and -2), five for GA 20-oxidases (CsGA20ox1, -2, -3, -4, and -5), four for GA 3-oxidases (CsGA3ox1, -2, -3, and -4), and another five for GA 2-oxidases (CsGA2ox1, -2, -3, -4, and -5). Their enzymatic activities were investigated by heterologous expression of the cDNAs in Escherichia coli and incubation of the cell lysates with (14)C-labelled, D2-labelled, or unlabelled GA-substrates. The two GA 7-oxidases converted GA12-aldehyde to GA12 efficiently. CsGA7ox1 converted GA12 to GA14, to 15α-hydroxyGA12, and further to 15α-hydroxyGA14. CsGA7ox2 converted GA12 to its 12α-hydroxylated analogue GA111. All five GA 20-oxidases converted GA12 to GA9 as a major product, and to GA25 as a minor product. The four GA 3-oxidases oxidized the C19-GA GA9 to GA4 as the only product. In addition, three of them (CsGA3ox2, -3, and -4) converted the C20-GA GA12 to GA14. The GA 2-oxidases CsGA2ox1, -2, -3, and -4 oxidized the C19-GAs GA9 and GA4 to GA34 and GA51, respectively. CsGA2ox2, -3, and -4 converted GA51 and GA34 further to respective GA-catabolites. In addition to C19-GAs, CsGA2ox4 also converted the C20-GA GA12 to GA110. In contrast, CsGA2ox5 oxidized only the C20 GA12 to GA110 as the sole product. As shown for CsGA20ox1 and CsGA3ox1, similar reactions were catalysed with 13-hydroxlyated GAs as substrates. It is likely that these enzymes are also responsible for the biosynthesis of 13-hydroxylated GAs in vivo that occur at low levels in cucumber.

  1. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.

    PubMed

    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki

    2013-01-01

    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  2. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.

    PubMed

    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki

    2013-01-01

    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments.

  3. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )

    1989-04-01

    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  4. Arsenite tolerance is related to proportional thiolic metabolite synthesis in rice (Oryza sativa L.).

    PubMed

    Dave, Richa; Singh, Pradyumna Kumar; Tripathi, Preeti; Shri, Manju; Dixit, Garima; Dwivedi, Sanjay; Chakrabarty, Debasis; Trivedi, Prabodh Kumar; Sharma, Yogesh Kumar; Dhankher, Om Prakash; Corpas, Francisco Javier; Barroso, Juan B; Tripathi, Rudra Deo

    2013-02-01

    Thiol metabolism is the primary detoxification strategy by which rice plants tolerate arsenic (As) stress. In light of this, it is important to understand the importance of harmonised thiol metabolism with As accumulation and tolerance in rice plant. For this aim, tolerant (T) and sensitive (S) genotypes were screened from 303 rice (Oryza sativa) genotypes on exposure to 10 and 25 μM arsenite (As(III)) in hydroponic culture. On further As accumulation estimation, contrasting (13-fold difference) T (IC-340072) and S (IC-115730) genotypes were selected. This difference was further evaluated using biochemical and molecular approaches to understand involvement of thiolic metabolism vis-a-vis As accumulation in these two genotypes. Various phytochelatin (PC) species (PC(2), PC(3) and PC(4)) were detected in both the genotypes with a dominance of PC(3). However, PC concentrations were greater in the S genotype, and it was noticed that the total PC (PC(2) + PC(3 )+ PC(4))-to-As(III) molar ratio (PC-SH:As(III)) was greater in T (2.35 and 1.36 in shoots and roots, respectively) than in the S genotype (0.90 and 0.15 in shoots and roots, respectively). Expression analysis of several metal(loid) stress-related genes showed significant upregulation of glutaredoxin, sulphate transporter, and ascorbate peroxidase in the S genotype. Furthermore, enzyme activity of phytochelatin synthase and cysteine synthase was greater on As accumulation in the S compared with the T genotype. It was concluded that the T genotype synthesizes adequate thiols to detoxify metalloid load, whereas the S genotype synthesizes greater but inadequate levels of thiols to tolerate an exceedingly greater load of metalloids, as evidenced by thiol-to-metalloid molar ratios, and therefore shows a phytotoxicity response.

  5. Xenophilus arseniciresistens sp. nov., an arsenite-resistant bacterium isolated from soil.

    PubMed

    Li, Qin-Fen; Sun, Li-Na; Kwon, Soon-Wo; Chen, Qing; He, Jian; Li, Shun-Peng; Zhang, Jun

    2014-06-01

    A Gram-reaction-negative, aerobic, motile, rod-shaped, arsenite [As(III)]-resistant bacterium, designated strain YW8(T), was isolated from agricultural soil. 16S rRNA gene sequence analysis showed over 97% sequence similarity to strains of the environmental species Xenophilus azovorans, Xenophilus aerolatus, Simplicispira metamorpha, Variovorax soli, and Xylophilus ampelinus. However, the phylogenetic tree indicated that strain YW8(T) formed a separate clade from Xenophilus azovorans. DNA-DNA hybridization experiments showed that the DNA-DNA relatedness values between strain YW8(T) and its closest phylogenetic neighbours were below 24.2-35.5%, which clearly separated the strain from these closely related species. The major cellular fatty acids of strain YW8(T) were C(16 : 0), C(17 : 0) cyclo, C(18 : 1)ω7c, and summed feature 3(C(16 : 1)ω6c and/or C(16 : 1)ω7c). The genomic DNA G+C content was 69.3 mol%, and the major respiratory quinone was ubiquinone-8. The predominant polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, three unknown phospholipids, an unknown polar lipid and phosphatidylserine. The major polyamines were 2-hydroxyputrescine and putrescine. On the basis of morphological, physiological and biochemical characteristics, phylogenetic position, DNA-DNA hybridization and chemotaxonomic data, strain YW8(T) is considered to represent a novel species of the genus Xenophilus, for which the name Xenophilus arseniciresistens sp. nov. is proposed; the type strain is YW8(T) ( = CCTCC AB2012103(T) = KACC 16853(T)).

  6. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.

    PubMed

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-12-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  7. Essential role of lysyl oxidases in notochord development

    PubMed Central

    Gansner, John M.; Mendelsohn, Bryce A.; Hultman, Keith A.; Johnson, Stephen L.; Gitlin, Jonathan D.

    2007-01-01

    Recent studies reveal a critical role for copper in the development of the zebrafish notochord, suggesting that specific cuproenzymes are required for the structural integrity of the notochord sheath. We now demonstrate that β-aminopropionitrile, a known inhibitor of the copper-dependent lysyl oxidases, causes notochord distortion in the zebrafish embryo identical to that seen in copper deficiency. Characterization of the zebrafish lysyl oxidase genes reveals eight unique sequences, several of which are expressed in the developing notochord. Specific gene knockdown demonstrates that loss of loxl1 results in notochord distortion, and that loxl1 and loxl5b have overlapping roles in notochord formation. Interestingly, while notochord abnormalities are not observed following partial knockdown of loxl1 or loxl5b alone, in each case this markedly sensitizes developing embryos to notochord distortion if copper availability is diminished. Likewise, partial knockdown of the lysyl oxidase substrate col2a1 results in notochord distortion when combined with reduced copper availability or partial knockdown of loxl1 or loxl5b. These data reveal a complex interplay of gene expression and nutrient availability critical to notochord development. They also provide insight into specific genetic and nutritional factors that may play a role in the pathogenesis of structural birth defects of the axial skeleton. PMID:17543297

  8. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity

    PubMed Central

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-01-01

    Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

  9. Lysyl oxidase modulates the osteoblast differentiation of primary mouse calvaria cells.

    PubMed

    Sharma-Bhandari, Anjali; Park, Sun-Hyang; Kim, Ju-Young; Oh, Jaemin; Kim, Youngho

    2015-12-01

    Lysyl oxidase (LOX) is an extracellular amine oxidase that mediates the formation of collagen fibers. Thus far, five LOX family genes [LOX, lysyl oxidase-like (LOXL)1, LOXL2, LOXL3 and LOXL4] have been identified in humans, each encoding the characteristic C-terminal domains that are required for amine oxidase activity. During osteoblastogenesis, collagen fibers function as a three-dimensional scaffold for organizing mineral deposition. In this study, to assess the functional roles of the LOX family members in osteoblastogenesis, we investigated the temporal expression of these genes as a function of phenotypic development during the osteoblast differentiation of primary cultured mouse calvaria cells. Of the LOX family members, only LOX was prominently expressed during osteoblast differentiation. LOX expression was highest on day 9 of differentiation, as shown by RT-PCR and western blot analysis. The expression pattern of collagen, type I, alpha 2 (COL1A2), which encodes the α2-chain of mouse collagen type I, was similar to that of LOX. The total amine oxidase activity of the differentiating calvaria cells exhibited a temporal pattern that paralleled LOX expression, reaching the highest level on day 9 of differentiation. We also noted that the inhibition of the amine oxidase activity of LOX significantly suppressed both mineral nodule formation and the expression of osteoblast marker genes during the differentiation of primary calvaria cells. Taken together, these findings suggest that the LOX-mediated organization of collagen fibers in the extracellular matrix is an important regulator of osteoblastogenesis.

  10. Effect of proteasome inhibition on toxicity and CYP3A23 induction in cultured rat hepatocytes: Comparison with arsenite

    SciTech Connect

    Noreault-Conti, Trisha L.; Jacobs, Judith M.; Trask, Heidi W.; Wrighton, Steven A.; Sinclair, Jacqueline F.; Nichols, Ralph C. . E-mail: ralph.c.nichols@dartmouth.edu

    2006-12-15

    Previous work in our laboratory has shown that acute exposure of primary rat hepatocyte cultures to non-toxic concentrations of arsenite causes major decreases in the DEX-mediated induction of CYP3A23 protein, with minor decreases in CYP3A23 mRNA. To elucidate the mechanism for these effects of arsenite, the effects of arsenite and proteasome inhibition, separately and in combination, on induction of CYP3A23 protein were compared. The proteasome inhibitor, MG132, inhibited proteasome activity, but also decreased CYP3A23 mRNA and protein. Lactacystin, another proteasome inhibitor, decreased CYP3A23 protein without affecting CYP3A23 mRNA at a concentration that effectively inhibited proteasome activity. This result, suggesting that the action of lactacystin is similar to arsenite and was post-transcriptional, was confirmed by the finding that lactacystin decreased association of DEX-induced CYP3A23 mRNA with polyribosomes. Both MG132 and lactacystin inhibited total protein synthesis, but did not affect MTT reduction. Arsenite had no effect on ubiquitination of proteins, nor did arsenite significantly affect proteasomal activity. These results suggest that arsenite and lactacystin act by similar mechanisms to inhibit translation of CYP3A23.

  11. Aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) protect against sodium arsenite-induced hepatotoxicity in Wistar rats.

    PubMed

    Gbadegesin, M A; Odunola, O A

    2010-11-25

    We evaluated the effects of aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) on sodium arsenite-induced hepatotoxicity in Wistar rats. We observed that treatment of the animals with the extracts before or just after sodium arsenite administration significantly (p < 0.05) reduced mean liver and serum γ-Glutamyl transferase (γGT), and serum alkaline phosphatase (ALP) activities when compared with the group administered the toxin alone. In addition, treatments of the animals with aqueous or ethanolic extract of O. basilicum before the administration of sodium arsenite resulted in the attenuation of the sodium arsenite-induced aspartate and alanine aminotransferase activities: ALT (from 282.6% to 167.7% and 157.8%), AST (from 325.1% to 173.5% and 164.2%) for the group administered sodium arsenite alone, the aqueous extracts plus sodium arsenite, and ethanolic extracts plus sodium arsenite respectively, expressed as percentage of the negative control. These findings support the presence of hepatoprotective activity in the O.basilicum extracts.

  12. Effects of Iodonium-Class Flavin Dehydrogenase Inhibitors on Growth, Reactive Oxygen Production, Cell Cycle Progression, NADPH Oxidase 1 Levels, and Gene Expression in Human Colon Cancer Cells and Xenografts

    PubMed Central

    Doroshow, James H.; Gaur, Shikha; Markel, Susan; Lu, Jiamo; van Balgooy, Josephus; Synold, Timothy W.; Xi, Bixin; Wu, Xiwei; Juhasz, Agnes

    2013-01-01

    Iodonium-class flavoprotein dehydrogenase inhibitors have been demonstrated to possess antiproliferative potential and to inhibit reactive oxygen production in human tumor cells, although the mechanism(s) that explain the relationship between altered cell growth and the generation of reactive oxygen species (ROS) remain an area of active investigation. Because of the ability of these compounds to inhibit the activity of flavoprotein-containing epithelial NADPH oxidases, we chose to examine the effects of several iodonium-class flavoprotein inhibitors on human colon cancer cell lines that express high, functional levels of a single such oxidase (NADPH oxidase 1 [Nox1]). We found that diphenylene iodonium (DPI), di-2-thienyliodonium (DTI), and iodoniumdiphenyl inhibited the growth of Caco2, HT-29, and LS-174T colon cancer cells at concentrations (10–250 nM for DPI, 0.5–2.5 μM for DTI, and 155 nM to 10 μM for iodoniumdiphenyl) substantially lower than for DU145 human prostate cancer cells that do not possess functional NADPH oxidase activity. Drug treatment was associated with decreased H2O2 production and diminished intracellular ROS levels, lasting up to 24 hr, following short-term (1-hr) exposure to the iodonium analogs. Decreased tumor cell proliferation was caused, in part, by a profound block in cell cycle progression at the G1/S interface in both LS-174T and HT-29 cells exposed to either DPI or DTI; and the G1 block was produced, for LS-174T cells, by upregulation of p27 and a drug concentration-related decrease in the expression of cyclins D1, A, and E that was partially prevented by exogenous H2O2. Not only did DPI and DTI decrease intracellular ROS, they both also significantly decreased the mRNA expression levels of Nox1, potentially contributing to the prolonged reduction in tumor cell reactive oxygen levels. We also found that DPI and DTI significantly decreased the growth of both HT-29 and LS-174T human tumor xenografts, at dose levels that

  13. Arsenite medicinal use, metabolism, pharmacokinetics and monitoring in human hair.

    PubMed

    Nicolis, I; Curis, E; Deschamps, P; Bénazeth, S

    2009-10-01

    Acute promyelocytic leukaemia (APL) is a distinctive subtype of acute myeloid leukaemias. Even through this human disease can be treated by the intravenous administration of all-trans retinoic acid (ATRA), 25% of patients typically relapse after the first treatment. In this context, the intravenous administration of APL patients with an aqueous solution of arsenic trioxide has also been demonstrated to be successful despite the established mammalian toxicity of this arsenic compound. Accordingly, the administration of a therapeutic dose of arsenic trioxide has resulted in an improved patient survival in both relapsing as well newly diagnosed APL patients. We present here a mini-r