Science.gov

Sample records for arsenite oxidase gene

  1. Detection, diversity and expression of aerobic bacterial arsenite oxidase genes.

    PubMed

    Inskeep, William P; Macur, Richard E; Hamamura, Natsuko; Warelow, Thomas P; Ward, Seamus A; Santini, Joanne M

    2007-04-01

    The arsenic (As) drinking water crisis in south and south-east Asia has stimulated intense study of the microbial processes controlling the redox cycling of As in soil-water systems. Microbial oxidation of arsenite is a critical link in the global As cycle, and phylogenetically diverse arsenite-oxidizing microorganisms have been isolated from various aquatic and soil environments. However, despite progress characterizing the metabolism of As in various pure cultures, no functional gene approaches have been developed to determine the importance and distribution of arsenite-oxidizing genes in soil-water-sediment systems. Here we report for the first time the successful amplification of arsenite oxidase-like genes (aroA/asoA/aoxB) from a variety of soil-sediment and geothermal environments where arsenite is known to be oxidized. Prior to the current work, only 16 aroA/asoA/aoxB-like gene sequences were available in GenBank, most of these being putative assignments from homology searches of whole genomes. Although aroA/asoA/aoxB gene sequences are not highly conserved across disparate phyla, degenerate primers were used successfully to characterize over 160 diverse aroA-like sequences from 10 geographically isolated, arsenic-contaminated sites and from 13 arsenite-oxidizing organisms. The primer sets were also useful for confirming the expression of aroA-like genes in an arsenite-oxidizing organism and in geothermal environments where arsenite is oxidized to arsenate. The phylogenetic and ecological diversity of aroA-like sequences obtained from this study suggests that genes for aerobic arsenite oxidation are widely distributed in the bacterial domain, are widespread in soil-water systems containing As, and play a critical role in the biogeochemical cycling of As.

  2. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  3. Microbial oxidation of arsenite in a subarctic environment: Diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    USGS Publications Warehouse

    Osborne, Thomas H.; Jamieson, Heather E.; Hudson-Edwards, Karen A.; Nordstrom, D. Kirk; Walker, Stephen R.; Ward, Seamus A.; Santini, Joanne M.

    2010-01-01

    BackgroundArsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C).ResultsOur study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range.ConclusionsThe diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  4. Kinetics of arsenite oxidation by Variovorax sp. MM-1 isolated from a soil and identification of arsenite oxidase gene.

    PubMed

    Bahar, Md Mezbaul; Megharaj, Mallavarapu; Naidu, Ravi

    2013-11-15

    A Gram-negative, arsenite-oxidizing bacterial strain, MM-1 tolerant to 20mM arsenite and 200 mM arsenate was isolated from a heavy metal contaminated soil which contained only 8.8 mg kg(-1) of arsenic. Based on 16S rRNA analysis, the strain was closely related to the genus Variovorax. This strain completely oxidized 500 μM of arsenite to arsenate within 3h of incubation in minimal salts medium. Kinetic studies of arsenite oxidation by the cells showed one of the lowest Km (17 μM) and highest Vmax (1.23 × 10(-7) μM min(-1) cell(-1)) values reported to date for whole cell suspension. PCR analysis using degenerate primers confirmed the presence of arsenite oxidase gene and its amino acid sequence was 70-91% identical to the large subunit of most reported arsenite oxidases. The significant arsenite oxidation capacity shown by the strain opens the way to its potential application in arsenic remediation process. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Identification of a Novel Arsenite Oxidase Gene, arxA, in the Haloalkaliphilic, Arsenite-Oxidizing Bacterium Alkalilimnicola ehrlichii Strain MLHE-1 ▿

    PubMed Central

    Zargar, Kamrun; Hoeft, Shelley; Oremland, Ronald; Saltikov, Chad W.

    2010-01-01

    Although arsenic is highly toxic to most organisms, certain prokaryotes are known to grow on and respire toxic metalloids of arsenic (i.e., arsenate and arsenite). Two enzymes are known to be required for this arsenic-based metabolism: (i) the arsenate respiratory reductase (ArrA) and (ii) arsenite oxidase (AoxB). Both catalytic enzymes contain molybdopterin cofactors and form distinct phylogenetic clades (ArrA and AoxB) within the dimethyl sulfoxide (DMSO) reductase family of enzymes. Here we report on the genetic identification of a “new” type of arsenite oxidase that fills a phylogenetic gap between the ArrA and AoxB clades of arsenic metabolic enzymes. This “new” arsenite oxidase is referred to as ArxA and was identified in the genome sequence of the Mono Lake isolate Alkalilimnicola ehrlichii MLHE-1, a chemolithoautotroph that can couple arsenite oxidation to nitrate reduction. A genetic system was developed for MLHE-1 and used to show that arxA (gene locus ID mlg_0216) was required for chemoautotrophic arsenite oxidation. Transcription analysis also showed that mlg_0216 was only expressed under anaerobic conditions in the presence of arsenite. The mlg_0216 gene is referred to as arxA because of its greater homology to arrA relative to aoxB and previous reports that implicated Mlg_0216 (ArxA) of MLHE-1 in reversible arsenite oxidation and arsenate reduction in vitro. Our results and past observations support the position that ArxA is a distinct clade within the DMSO reductase family of proteins. These results raise further questions about the evolutionary relationships between arsenite oxidases (AoxB) and arsenate respiratory reductases (ArrA). PMID:20453090

  6. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  7. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  8. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  9. Arsenite Oxidase from Ralstonia sp. 22

    PubMed Central

    Lieutaud, Aurélie; van Lis, Robert; Duval, Simon; Capowiez, Line; Muller, Daniel; Lebrun, Régine; Lignon, Sabrina; Fardeau, Marie-Laure; Lett, Marie-Claire; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2010-01-01

    We characterized the aro arsenite oxidation system in the novel strain Ralstonia sp. 22, a β-proteobacterium isolated from soil samples of the Salsigne mine in southern France. The inducible aro system consists of a heterodimeric membrane-associated enzyme reacting with a dedicated soluble cytochrome c554. Our biochemical results suggest that the weak association of the enzyme to the membrane probably arises from a still unknown interaction partner. Analysis of the phylogeny of the aro gene cluster revealed that it results from a lateral gene transfer from a species closely related to Achromobacter sp. SY8. This constitutes the first clear cut case of such a transfer in the Aro phylogeny. The biochemical study of the enzyme demonstrates that it can accommodate in vitro various cytochromes, two of which, c552 and c554, are from the parent species. Cytochrome c552 belongs to the sox and not the aro system. Kinetic studies furthermore established that sulfite and sulfide, substrates of the sox system, are both inhibitors of Aro activity. These results reinforce the idea that sulfur and arsenic metabolism are linked. PMID:20421652

  10. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  11. Cloning and In Situ Expression Studies of the Hydrogenobaculum Arsenite Oxidase Genes▿

    PubMed Central

    Clingenpeel, Scott R.; D'Imperio, Seth; Oduro, Harry; Druschel, Greg K.; McDermott, Timothy R.

    2009-01-01

    Novel arsenite [As(III)] oxidase structural genes (aoxAB) were cloned from Hydrogenobaculum bacteria isolated from an acidic geothermal spring. Reverse transcriptase PCR demonstrated expression throughout the outflow channel, and the aoxB cDNA clones exhibited distribution patterns relative to the physicochemical gradients in the spring. Microelectrode analyses provided evidence of quantitative As(III) transformation within the microbial mat. PMID:19304831

  12. The purification and characterization of arsenite oxidase from Alcaligenes faecalis, a molybdenum-containing hydroxylase.

    PubMed

    Anderson, G L; Williams, J; Hille, R

    1992-11-25

    The purification and initial characterization of arsenite oxidase from Alcaligenes faecalis are described. The enzyme consists of a monomer of 85 kDa containing one molybdenum, five or six irons, and inorganic sulfide. In the presence of denaturants arsenite oxidase releases a fluorescent material with spectral properties identical to the pterin cofactor released by the hydroxylase class of molybdenum-containing enzymes. Azurin and a c-type cytochrome, both isolated from A. faecalis, each serves as an electron acceptor to arsenite oxidase and may form a periplasmic electron transfer pathway for arsenite detoxification. Full reduction of arsenite oxidase requires 3-4 reducing equivalents, using either arsenite or dithionite as the electron source. Below 20 K, oxidized arsenite oxidase exhibits an EPR signal with g values of 2.03, 2.01, and 2.00, which integrates to approximately 0.4 spins/protein. Since enrichment in 57Fe results in broadening of this EPR signal, the center giving rise to this signal must contain iron. The most plausible candidates are a [4Fe-4S] high potential iron protein center or a [3Fe-4S] center. The EPR signal observed in oxidized arsenite oxidase disappears upon reduction of the protein with either arsenite or dithionite. Concomitantly, a rhombic EPR signal (g = 2.03, 1.89, 1.76) appears which is similar to that of Rieske-type [2Fe-2S] clusters and spin quantifies to one spin/protein.

  13. Organization and regulation of the arsenite oxidase operon of the moderately acidophilic and facultative chemoautotrophic Thiomonas arsenitoxydans.

    PubMed

    Slyemi, Djamila; Moinier, Danielle; Talla, Emmanuel; Bonnefoy, Violaine

    2013-11-01

    Thiomonas arsenitoxydans is an acidophilic and facultatively autotrophic bacterium that can grow by oxidizing arsenite to arsenate. A comparative genomic analysis showed that the T. arsenitoxydans aioBA cluster encoding the two subunits of arsenite oxidase is distinct from the other clusters, with two specific genes encoding a cytochrome c and a metalloregulator belonging to the ArsR/SmtB family. These genes are cotranscribed with aioBA, suggesting that these cytochromes c are involved in arsenite oxidation and that this operon is controlled by the metalloregulator. The growth of T. arsenitoxydans in the presence of thiosulfate and arsenite, or arsenate, is biphasic. Real-time PCR experiments showed that the operon is transcribed during the second growth phase in the presence of arsenite or arsenate, whereas antimonite had no effect. These results suggest that the expression of the aioBA operon of T. arsenitoxydans is regulated by the electron donor present in the medium, i.e., is induced in the presence of arsenic but is repressed by more energetic substrates. Our data indicate that the genetic organization and regulation of the aioBA operon of T. arsenitoxydans differ from those of the other arsenite oxidizers.

  14. Spatio-Temporal Detection of the Thiomonas Population and the Thiomonas Arsenite Oxidase Involved in Natural Arsenite Attenuation Processes in the Carnoulès Acid Mine Drainage

    PubMed Central

    Hovasse, Agnès; Bruneel, Odile; Casiot, Corinne; Desoeuvre, Angélique; Farasin, Julien; Hery, Marina; Van Dorsselaer, Alain; Carapito, Christine; Arsène-Ploetze, Florence

    2016-01-01

    The acid mine drainage (AMD) impacted creek of the Carnoulès mine (Southern France) is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron) attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM)-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with FISH and pyrosequencing-based 16S rRNA gene sequence analysis, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ. PMID:26870729

  15. Spatio-Temporal Detection of the Thiomonas Population and the Thiomonas Arsenite Oxidase Involved in Natural Arsenite Attenuation Processes in the Carnoulès Acid Mine Drainage.

    PubMed

    Hovasse, Agnès; Bruneel, Odile; Casiot, Corinne; Desoeuvre, Angélique; Farasin, Julien; Hery, Marina; Van Dorsselaer, Alain; Carapito, Christine; Arsène-Ploetze, Florence

    2016-01-01

    The acid mine drainage (AMD) impacted creek of the Carnoulès mine (Southern France) is characterized by acid waters with a high heavy metal content. The microbial community inhabiting this AMD was extensively studied using isolation, metagenomic and metaproteomic methods, and the results showed that a natural arsenic (and iron) attenuation process involving the arsenite oxidase activity of several Thiomonas strains occurs at this site. A sensitive quantitative Selected Reaction Monitoring (SRM)-based proteomic approach was developed for detecting and quantifying the two subunits of the arsenite oxidase and RpoA of two different Thiomonas groups. Using this approach combined with FISH and pyrosequencing-based 16S rRNA gene sequence analysis, it was established here for the first time that these Thiomonas strains are ubiquitously present in minor proportions in this AMD and that they express the key enzymes involved in natural remediation processes at various locations and time points. In addition to these findings, this study also confirms that targeted proteomics applied at the community level can be used to detect weakly abundant proteins in situ.

  16. Genetic identification of arsenate reductase and arsenite oxidase in redox transformations carried out by arsenic metabolising prokaryotes - A comprehensive review.

    PubMed

    Kumari, Nisha; Jagadevan, Sheeja

    2016-11-01

    Arsenic (As) contamination in water is a cause of major concern to human population worldwide, especially in Bangladesh and West Bengal, India. Arsenite (As(III)) and arsenate (As(V)) are the two common forms in which arsenic exists in soil and groundwater, the former being more mobile and toxic. A large number of arsenic metabolising microorganisms play a crucial role in microbial transformation of arsenic between its different states, thus playing a key role in remediation of arsenic contaminated water. This review focuses on advances in biochemical, molecular and genomic developments in the field of arsenic metabolising bacteria - covering recent developments in the understanding of structure of arsenate reductase and arsenite oxidase enzymes, their gene and operon structures and their mechanism of action. The genetic and molecular studies of these microbes and their proteins may lead to evolution of successful strategies for effective implementation of bioremediation programs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Electron transfer through arsenite oxidase: Insights into Rieske interaction with cytochrome c.

    PubMed

    Watson, Cameron; Niks, Dimitri; Hille, Russ; Vieira, Marta; Schoepp-Cothenet, Barbara; Marques, Alexandra T; Romão, Maria João; Santos-Silva, Teresa; Santini, Joanne M

    2017-10-01

    Arsenic is a widely distributed environmental toxin whose presence in drinking water poses a threat to >140 million people worldwide. The respiratory enzyme arsenite oxidase from various bacteria catalyses the oxidation of arsenite to arsenate and is being developed as a biosensor for arsenite. The arsenite oxidase from Rhizobium sp. str. NT-26 (a member of the Alphaproteobacteria) is a heterotetramer consisting of a large catalytic subunit (AioA), which contains a molybdenum centre and a 3Fe-4S cluster, and a small subunit (AioB) containing a Rieske 2Fe-2S cluster. Stopped-flow spectroscopy and isothermal titration calorimetry (ITC) have been used to better understand electron transfer through the redox-active centres of the enzyme, which is essential for biosensor development. Results show that oxidation of arsenite at the active site is extremely fast with a rate of >4000s(-1) and reduction of the electron acceptor is rate-limiting. An AioB-F108A mutation results in increased activity with the artificial electron acceptor DCPIP and decreased activity with cytochrome c, which in the latter as demonstrated by ITC is not due to an effect on the protein-protein interaction but instead to an effect on electron transfer. These results provide further support that the AioB F108 is important in electron transfer between the Rieske subunit and cytochrome c and its absence in the arsenite oxidases from the Betaproteobacteria may explain the inability of these enzymes to use this electron acceptor. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  18. Functions and Unique Diversity of Genes and Microorganisms Involved in Arsenite Oxidation from the Tailings of a Realgar Mine.

    PubMed

    Zeng, Xian-Chun; E, Guoji; Wang, Jianing; Wang, Nian; Chen, Xiaoming; Mu, Yao; Li, Hao; Yang, Ye; Liu, Yichen; Wang, Yanxin

    2016-12-15

    The tailings of the Shimen realgar mine have unique geochemical features. Arsenite oxidation is one of the major biogeochemical processes that occurs in the tailings. However, little is known about the functional and molecular aspects of the microbial community involved in arsenite oxidation. Here, we fully explored the functional and molecular features of the microbial communities from the tailings of the Shimen realgar mine. We collected six samples of tailings from sites A, B, C, D, E, and F. Microcosm assays indicated that all of the six sites contain both chemoautotrophic and heterotrophic arsenite-oxidizing microorganisms; their activities differed considerably from each other. The microbial arsenite-oxidizing activities show a positive correlation with soluble arsenic concentrations. The microbial communities of the six sites contain 40 phyla of bacteria and 2 phyla of archaea that show extremely high diversity. Soluble arsenic, sulfate, pH, and total organic carbon (TOC) are the key environmental factors that shape the microbial communities. We further identified 114 unique arsenite oxidase genes from the samples; all of them code for new or new-type arsenite oxidases. We also isolated 10 novel arsenite oxidizers from the samples, of which 4 are chemoautotrophic and 6 are heterotrophic. These data highlight the unique diversities of the arsenite-oxidizing microorganisms and their oxidase genes from the tailings of the Shimen realgar mine. To the best of our knowledge, this is the first report describing the functional and molecular features of microbial communities from the tailings of a realgar mine. This study focused on the functional and molecular characterizations of microbial communities from the tailings of the Shimen realgar mine. We fully explored, for the first time, the arsenite-oxidizing activities and the functional gene diversities of microorganisms from the tailings, as well as the correlation of the microbial activities/diversities with

  19. Functions and Unique Diversity of Genes and Microorganisms Involved in Arsenite Oxidation from the Tailings of a Realgar Mine

    PubMed Central

    E, Guoji; Wang, Jianing; Wang, Nian; Chen, Xiaoming; Mu, Yao; Li, Hao; Yang, Ye; Liu, Yichen; Wang, Yanxin

    2016-01-01

    ABSTRACT The tailings of the Shimen realgar mine have unique geochemical features. Arsenite oxidation is one of the major biogeochemical processes that occurs in the tailings. However, little is known about the functional and molecular aspects of the microbial community involved in arsenite oxidation. Here, we fully explored the functional and molecular features of the microbial communities from the tailings of the Shimen realgar mine. We collected six samples of tailings from sites A, B, C, D, E, and F. Microcosm assays indicated that all of the six sites contain both chemoautotrophic and heterotrophic arsenite-oxidizing microorganisms; their activities differed considerably from each other. The microbial arsenite-oxidizing activities show a positive correlation with soluble arsenic concentrations. The microbial communities of the six sites contain 40 phyla of bacteria and 2 phyla of archaea that show extremely high diversity. Soluble arsenic, sulfate, pH, and total organic carbon (TOC) are the key environmental factors that shape the microbial communities. We further identified 114 unique arsenite oxidase genes from the samples; all of them code for new or new-type arsenite oxidases. We also isolated 10 novel arsenite oxidizers from the samples, of which 4 are chemoautotrophic and 6 are heterotrophic. These data highlight the unique diversities of the arsenite-oxidizing microorganisms and their oxidase genes from the tailings of the Shimen realgar mine. To the best of our knowledge, this is the first report describing the functional and molecular features of microbial communities from the tailings of a realgar mine. IMPORTANCE This study focused on the functional and molecular characterizations of microbial communities from the tailings of the Shimen realgar mine. We fully explored, for the first time, the arsenite-oxidizing activities and the functional gene diversities of microorganisms from the tailings, as well as the correlation of the microbial activities

  20. Functional genes and thermophilic microorganisms responsible for arsenite oxidation from the shallow sediment of an untraversed hot spring outlet.

    PubMed

    Yang, Ye; Mu, Yao; Zeng, Xian-Chun; Wu, Weiwei; Yuan, Jie; Liu, Yichen; Guoji, E; Luo, Feng; Chen, Xiaoming; Li, Hao; Wang, Jianing

    2017-03-01

    Hot Springs have unique geochemical features. Microorganisms-mediated arsenite oxidation is one of the major biogeochemical processes occurred in some hot springs. This study aimed to understand the diversities of genes and microorganisms involved in arsenite oxidation from the outlet of an untraversed hot spring located at an altitude of 4226 m. Microcosm assay indicated that the microbial community from the hot spring was able to efficiently oxidize As(III) using glucose, lactic acid, yeast extract or sodium bicarbonate as the sole carbon source. The microbial community contained 7 phyla of microorganisms, of which Proteobacteria and Firmicutes are largely dominant; this composition is unique and differs significantly from those of other described hot springs. Twenty one novel arsenite oxidase genes were identified from the samples, which are affiliated with the arsenite oxidase families of α-Proteobacteria, β-Proteobacteria or Archaea; this highlights the high diversity of the arsenite-oxidizing microorganisms from the hot spring. A cultivable arsenite-oxidizer Chelatococcu sp. GHS311 was also isolated from the sample using enrichment technique. It can completely convert 75.0 mg/L As(III) into As(V) in 18 days at 45 °C. The arsenite oxidase of GHS311 shares the maximal sequence identity (84.7%) to that of Hydrogenophaga sp. CL3, a non-thermotolerant bacterium. At the temperature lower than 30 °C or higher than 65 °C, the growth of this strain was completely inhibited. These data help us to better understand the diversity and functional features of the thermophilic arsenite-oxidizing microorganisms from hot springs.

  1. Arsenite oxidase from Ralstonia sp. 22: characterization of the enzyme and its interaction with soluble cytochromes.

    PubMed

    Lieutaud, Aurélie; van Lis, Robert; Duval, Simon; Capowiez, Line; Muller, Daniel; Lebrun, Régine; Lignon, Sabrina; Fardeau, Marie-Laure; Lett, Marie-Claire; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

    2010-07-02

    We characterized the aro arsenite oxidation system in the novel strain Ralstonia sp. 22, a beta-proteobacterium isolated from soil samples of the Salsigne mine in southern France. The inducible aro system consists of a heterodimeric membrane-associated enzyme reacting with a dedicated soluble cytochrome c(554). Our biochemical results suggest that the weak association of the enzyme to the membrane probably arises from a still unknown interaction partner. Analysis of the phylogeny of the aro gene cluster revealed that it results from a lateral gene transfer from a species closely related to Achromobacter sp. SY8. This constitutes the first clear cut case of such a transfer in the Aro phylogeny. The biochemical study of the enzyme demonstrates that it can accommodate in vitro various cytochromes, two of which, c(552) and c(554,) are from the parent species. Cytochrome c(552) belongs to the sox and not the aro system. Kinetic studies furthermore established that sulfite and sulfide, substrates of the sox system, are both inhibitors of Aro activity. These results reinforce the idea that sulfur and arsenic metabolism are linked.

  2. An ArsR/SmtB Family Member Is Involved in the Regulation by Arsenic of the Arsenite Oxidase Operon in Thiomonas arsenitoxydans

    PubMed Central

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel

    2014-01-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. PMID:25107975

  3. An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

    PubMed

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

    2014-10-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed.

  4. Unsuspected Diversity of Arsenite-Oxidizing Bacteria as Revealed by Widespread Distribution of the aoxB Gene in Prokaryotes ▿ †

    PubMed Central

    Heinrich-Salmeron, Audrey; Cordi, Audrey; Brochier-Armanet, Céline; Halter, David; Pagnout, Christophe; Abbaszadeh-fard, Elham; Montaut, Didier; Seby, Fabienne; Bertin, Philippe N.; Bauda, Pascale; Arsène-Ploetze, Florence

    2011-01-01

    In this study, new strains were isolated from an environment with elevated arsenic levels, Sainte-Marie-aux-Mines (France), and the diversity of aoxB genes encoding the arsenite oxidase large subunit was investigated. The distribution of bacterial aoxB genes is wider than what was previously thought. AoxB subfamilies characterized by specific signatures were identified. An exhaustive analysis of AoxB sequences from this study and from public databases shows that horizontal gene transfer has likely played a role in the spreading of aoxB in prokaryotic communities. PMID:21571879

  5. X-ray Crystal Structure of Arsenite-Inhibited Xanthine Oxidase:[mu]-Sulfido,[mu]-Oxo Double Bridge between Molybdenum and Arsenic in the Active Site

    SciTech Connect

    Cao, Hongnan; Hall, James; Hille, Russ

    2012-10-23

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp{sup 2}-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a {mu}-sulfido,{mu}-oxo double bridge or a single {mu}-sulfido bridge. However, this is contrary to the crystallographically observed single {mu}-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 {angstrom} resolution, respectively. We observe {mu}-sulfido,{mu}-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  6. X-ray crystal structure of arsenite-inhibited xanthine oxidase: μ-sulfido,μ-oxo double bridge between molybdenum and arsenic in the active site.

    PubMed

    Cao, Hongnan; Hall, James; Hille, Russ

    2011-08-17

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp(2)-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a μ-sulfido,μ-oxo double bridge or a single μ-sulfido bridge. However, this is contrary to the crystallographically observed single μ-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 Å resolution, respectively. We observe μ-sulfido,μ-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  7. Global Analysis of Posttranscriptional Gene Expression in Response to Sodium Arsenite

    PubMed Central

    Qiu, Lian-Qun; Abey, Sarah; Harris, Shawn; Shah, Ruchir; Gerrish, Kevin E.

    2014-01-01

    Background: Inorganic arsenic species are potent environmental toxins and causes of numerous health problems. Most studies have assumed that arsenic-induced changes in mRNA levels result from effects on gene transcription. Objectives: We evaluated the prevalence of changes in mRNA stability in response to sodium arsenite in human fibroblasts. Methods: We used microarray analyses to determine changes in steady-state mRNA levels and mRNA decay rates following 24-hr exposure to noncytotoxic concentrations of sodium arsenite, and we confirmed some of these changes using real-time reverse-transcription polymerase chain reaction (RT-PCR). Results: In arsenite-exposed cells, 186 probe set–identified transcripts were significantly increased and 167 were significantly decreased. When decay rates were analyzed after actinomycin D treatment, only 4,992 (9.1%) of probe set–identified transcripts decayed by > 25% after 4 hr. Of these, 70 were among the 353 whose steady-state levels were altered by arsenite, and of these, only 4 exhibited significantly different decay rates between arsenite and control treatment. Real-time RT-PCR confirmed a major, significant arsenite-induced stabilization of the mRNA encoding δ aminolevulinate synthase 1 (ALAS1), the rate-limiting enzyme in heme biosynthesis. This change presumably accounted for at least part of the 2.7-fold increase in steady-state ALAS1 mRNA levels seen after arsenite treatment. This could reflect decreases in cellular heme caused by the massive induction by arsenite of heme oxygenase mRNA (HMOX1; 68-fold increase), the rate-limiting enzyme in heme catabolism. Conclusions: We conclude that arsenite modification of mRNA stability is relatively uncommon, but in some instances can result in significant changes in gene expression. Citation: Qiu LQ, Abey S, Harris S, Shah R, Gerrish KE, Blackshear PJ. 2015. Global analysis of posttranscriptional gene expression in response to sodium arsenite. Environ Health Perspect 123:324

  8. Low-level arsenite activates the transcription of genes involved in adipose differentiation.

    PubMed

    Salazard, B; Bellon, L; Jean, S; Maraninchi, M; El-Yazidi, C; Orsière, T; Margotat, A; Botta, A; Bergé-Lefranc, J-L

    2004-11-01

    In this study we analyzed gene expression in 3T3-F442A pre-adipocyte cells that differentiate in the presence of micro-molar arsenate concentration. Two concentrations of arsenite (As2O3, 0.25 micromol/L and 0.5 micromol/L) were applied for three days with and without insulin (170 nmol/L) and gene expressions were evaluated by quantitative RT-PCR. The genes included genes of oxidative-stress responses: heme-oxygenase-1 (HO1) and the hypoxia inducible factor 1a (HIF1alpha), genes of cell-cycle: c-jun and Kruppel like factor 5 (KLF5), and genes that play important roles in adipose determination: a peroxisome proliferator-activated receptor (PPARgamma) and a CCAAT/ enhancer binding protein (C/EBPalpha). Arsenite induced the expression of HO1, HIF1alpha, KLF5, PPARgamma and C/EBPalpha. These results suggest that under condition of oxidative stress arsenite induces genes that are required for adipose differentiation.

  9. Gene expression levels in normal human lymphoblasts with variable sensitivities to arsenite: Identification of GGT1 and NFKBIE expression levels as possible biomarkers of susceptibility

    SciTech Connect

    Komissarova, Elena V.; Li Ping; Uddin, Ahmed N.; Chen, Xuyan; Nadas, Arthur; Rossman, Toby G.

    2008-01-15

    Drinking arsenic-contaminated water is associated with increased risk of neoplasias of the skin, lung, bladder and possibly other sites, as well as other diseases. Earlier, we showed that human lymphoblast lines from different normal unexposed donors showed variable sensitivities to the toxic effects of arsenite. In the present study, we used microarray analysis to compare the basal gene expression profiles between two arsenite-resistant (GM02707, GM00893) and two arsenite-sensitive lymphoblast lines (GM00546, GM00607). A number of genes were differentially expressed in arsenite-sensitive and arsenite-resistant cells. Among these, {gamma}-glutamyltranspeptidase 1 (GGT1) and NF{kappa}B inhibitor-epsilon (NFKBIE) showed higher expression levels in arsenite-resistant cells. RT-PCR analysis with gene-specific primers confirmed these results. Reduction of GGT1 expression level in arsenite-resistant lymphoblasts with GGT1-specific siRNA resulted in increased cell sensitivity to arsenite. In conclusion, we have demonstrated for the first time that expression levels of GGT1 and possibly NFKBIE might be useful as biomarkers of genetic susceptibility to arsenite. Expression microarrays can thus be exploited for identifying additional biomarkers of susceptibility to arsenite and to other toxicants.

  10. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.

    PubMed

    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A

    2003-12-18

    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  11. The study of the mechanism of arsenite toxicity in respiration-deficient cells reveals that NADPH oxidase-derived superoxide promotes the same downstream events mediated by mitochondrial superoxide in respiration-proficient cells.

    PubMed

    Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia; Cerioni, Liana; Balduini, Walter; Cantoni, Orazio

    2016-09-15

    We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O2(.-)) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5μM, arsenite elicited selective formation of O2(.-) in the respiratory chain of RP cells, with hardly any contribution of the above mechanisms. Under these conditions, O2(.-) triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O2(.-) because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O2(.-) mediated by NADPH oxidase. Interestingly, extramitochondrial O2(.-) triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O2(.-) availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Construction of a genetically engineered microorganism with high tolerance to arsenite and strong arsenite oxidative ability.

    PubMed

    Yang, Chunyan; Xu, Lin; Yan, Limin; Xu, Yanhua

    2010-01-01

    Genetically engineered microorganisms (GEMs) have shown great potential for use in environmental bioremediation. In this study, the TTHB128 and TTHB127 genes, which encode the small and large subunits of arsentie oxidase in Thermus thermophilus HB8, respectively, were cloned into the broad-host-range vector pBBR1MCS-5 to produce the recombinant plasmid, TTHB127-pBBR1MCS-5-TTHB128. This resulted in successful construction of a GEM with high tolerance to arsenite and strong arsenite oxidative ability. Culture of the GEM in media containing arsenite for 28 h resulted in 87.6% of the arsenite being oxidized. Overall, the oxidative ability of the GEM was much stronger than that of the wild type host strain. Gentamicin was necessary to maintain the stability of the recombinant plasmid, TTHB127-pBBR1MCS-5-TTHB128, in the GEM. The oxidative ability of the GEM remained unchanged when it was grown in medium containing gentamicin (60 mg/L) for 30 growth cycles, after which its activity gradually decreased.

  13. Diversity of Arsenate Respiratory Reductase Genes Along Gradients of Arsenate and Arsenite Within Hypersaline, Alkaline Sediments

    NASA Astrophysics Data System (ADS)

    Saltikov, C. W.; Nilsen, J.; Oremland, R. S.; Kulp, T. R.; Hoeft, S. E.; Miller, L. G.; Switzer Blum, J.; Baesman, S.; Han, S.; Lanoil, B.

    2005-12-01

    There are several soda lakes in western United States that contain high arsenic concentrations (up to 4 mM total As). Interestingly, these lakes have high rates of anaerobic arsenate reduction, which is catalyzed by arsenate respiring prokaryotes. Several cultured arsenate respiring prokaryotes have been shown to respire and reduce arsenate via a membrane-associated enzyme, ArrA. This enzyme is present in many diverse arsenate respiring prokaryotes. To investigate arsenate respiring microbial communities within these extreme environments, we used functional gene analysis to detect the presence, abundance, and diversity of the arrA gene in core samples collected from two arsenic enriched, hypersaline, alkaline lakes, Mono Lake and Searles Lake. Each sample exhibited concentration gradients for dissolved arsenic species and oxygen. Porewater arsenite concentration increased with depth and was correlated with oxygen depletion. To investigate the depth dependency of the arrA gene in these core samples we utilized the Malasarn et al. (2004) polymerase chain reaction (PCR) primers to detect a partial arrA gene fragment in nucleic acids extracted from sediment samples. The arrA gene fragment was detected only in the top 1-2 cm of the Mono Lake core and no detection was observed in the Searles Lake homogenized core. After the primers were redesigned to include the nucleotide codon bias for haloalkaliphilic archaea ( Halobacterium), the arrA gene fragments could be detected at each depth interval throughout the Mono Lake core and in the homogenized core of Searles Lake. Work is currently focused on characterizing the diversity and abundance of the arrA gene fragments obtained in each core sample and at different depths. Although no haloalkaliphilic arsenate respiring archaea have been isolated to date, these results suggest that the arrA gene fragments detected in these soda lakes may be of archaeal origins.

  14. Arsenite exposure in human lymphoblastoid cell lines induces autophagy and coordinated induction of lysosomal genes.

    PubMed

    Bolt, Alicia M; Douglas, Randi M; Klimecki, Walter T

    2010-11-30

    Chronic exposure to inorganic arsenic is associated with diverse, complex diseases, making the identification of the mechanism underlying arsenic-induced toxicity a challenge. An increasing body of literature from epidemiological and in vitro studies has demonstrated that arsenic is an immunotoxicant, but the mechanism driving arsenic-induced immunotoxicity is not well established. We have previously demonstrated that in human lymphoblastoid cell lines (LCLs), arsenic-induced cell death is strongly associated with the induction of autophagy. In this study we utilized genome-wide gene expression analysis and functional assays to characterize arsenic-induced effects in seven LCLs that were exposed to an environmentally relevant, minimally cytotoxic, concentration of arsenite (0.75 μM) over an eight-day time course. Arsenic exposure resulted in inhibition of cellular growth and induction of autophagy (measured by expansion of acidic vesicles) over the eight-day exposure duration. Gene expression analysis revealed that arsenic exposure increased global lysosomal gene expression, which was associated with increased functional activity of the lysosome protease, cathepsin D. The arsenic-induced expansion of the lysosomal compartment in LCL represents a novel target that may offer insight into the immunotoxic effects of arsenic.

  15. Identification of anaerobic arsenite-oxidizing and arsenate-reducing bacteria associated with an alkaline saline lake in Khovsgol, Mongolia.

    PubMed

    Hamamura, Natsuko; Itai, Takaaki; Liu, Yitai; Reysenbach, Anna-Louise; Damdinsuren, Narantuya; Inskeep, William P

    2014-10-01

    Microbial arsenic transformation pathways associated with a saline lake located in northern Mongolia were examined using molecular biological and culturing approaches. Bacterial 16S rRNA gene sequences recovered from saline lake sediments and soils were affiliated with haloalkaliphiles, including Bacillus and Halomonas spp. Diverse sequences of arsenate respiratory reductase (arrA) and a new group of arsenite oxidase (arxA) genes were also identified. Pure cultures of arsenate-reducing Nitrincola strain and anaerobic arsenite-oxidizing Halomonas strain were isolated. The chemoorganotrophic Halomonas strain contains arxA gene similar to that of a chemoautotrophic arsenite-oxidizing Alkalilimnicola ehrlichii strain MLHE-1. These results revealed the diversity of arsenic transformation pathways associated with a geographically distinct saline system and the potential contribution of arx-dependent arsenite oxidation by heterotrophic bacteria.

  16. Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity

    PubMed Central

    Tang, Zhong; Lv, Yanling; Chen, Fei; Zhang, Wenwen; Rosen, Barry P.; Zhao, Fang-Jie

    2016-01-01

    Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species. PMID:26998776

  17. Metabolic energy from arsenite oxidation in Alcaligenes faecalis

    NASA Astrophysics Data System (ADS)

    Anderson, G. L.; Love, M.; Zeider, B. K.

    2003-05-01

    The aerobic soil bacterium, Alcaligenes faecalis, survives in cultures containing greater than 10 g/L of aqueous arsenic. Toleration of arsenite occurs by the enzymatic oxidation of arsenite (As^III), to the less toxic arsenate (As^V). In defined media, the bacterium grows faster in the presence of arsenite than in its absence. This suggests that the bacterium uses the redox potential of arsenite oxidation as metabolic energy. The oxidation occurs via periplasmic arsenite oxidase, azurin, and cytochrome c [11] which presumably pass electron equivalents through an electron transport chain involving cytochrome c oxidase aud oxygen as the terminal electron acceptor. The associated proton translocation would allow synthesis of ATP and provide a useful means of harnessing the redox potential of arsenite oxidation. Arsenite and arsenate assays of the media during bacterial growth indicate that arsenite is depleted during the exponential growth phase and occurs concomitantly with the expression of arsenite oxidase. These results suggest that arsenite is detoxified to arsenate during bacterial growth and are inconsistent with previous reported interpretations of growth data. Alcaligenes faecalis is dependent on organic carbon sources and is therefore not chemolithoautotrophic. The relationship between succinate and arsenite utilisation provides evidence for the use of arsenite as a supplemental energy source. Because Alcaligenes faecalis not only tolerates, but thrives, in very high concentrations of arsenic has important implications in bioremediation of environments contaminated by aqueous arsenic.

  18. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    EPA Science Inventory

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  19. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    EPA Science Inventory

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  20. Remodulation of central carbon metabolic pathway in response to arsenite exposure in Rhodococcus sp. strain NAU‐1

    PubMed Central

    Jain, Raina; Adhikary, Hemanta; Jha, Sanjay; Jha, Anamika; Kumar, G. Naresh

    2012-01-01

    Summary Arsenite‐tolerant bacteria were isolated from an organic farm of Navsari Agricultural University (NAU), Gujarat, India (Latitude: 20°55′39.04″N; Longitude: 72°54′6.34″E). One of the isolates, NAU‐1 (aerobic, Gram‐positive, non‐motile, coccobacilli), was hyper‐tolerant to arsenite (AsIII, 23 mM) and arsenate (AsV, 180 mM). 16S rRNA gene of NAU‐1 was 99% similar to the 16S rRNA genes of Rhodococcus (Accession No. HQ659188). Assays confirmed the presence of membrane bound arsenite oxidase and cytoplasmic arsenate reductase in NAU‐1. Genes for arsenite transporters (arsB and ACR3(1)) and arsenite oxidase gene (aoxB) were confirmed by PCR. Arsenite oxidation and arsenite efflux genes help the bacteria to tolerate arsenite. Specific activities of antioxidant enzymes (catalase, ascorbate peroxidase, superoxide dismutase and glutathione S‐transferase) increased in dose‐dependent manner with arsenite, whereas glutathione reductase activity decreased with increase in AsIII concentration. Metabolic studies revealed that Rhodococcus NAU‐1 produces excess of gluconic and succinic acids, and also activities of glucose dehydrogenase, phosphoenol pyruvate carboxylase and isocitrate lyase were increased, to cope with the inhibited activities of glucose‐6‐phosphate dehydrogenase, pyruvate dehydrogenase and α‐ketoglutarate dehydrogenase enzymes respectively, in the presence of AsIII. Enzyme assays revealed the increase in direct oxidative and glyoxylate pathway in Rhodococcus NAU‐1 in the presence of AsIII. PMID:23062201

  1. Contributions of reactive oxygen species and mitogen-activated protein kinase signaling in arsenite-stimulated hemeoxygenase-1 production

    SciTech Connect

    Cooper, Karen L.; Liu, Ke Jian; Hudson, Laurie G. . E-mail: lhudson@salud.unm.edu

    2007-01-15

    Hemeoxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. HO-1 has cytoprotective activities and arsenite is a potent inducer of HO-1 in many cell types and tissues, including epidermal keratinocytes. We investigated the potential contributions of reactive oxygen species (ROS) generation and mitogen-activated protein kinase (MAPK) activation to arsenite-dependent regulation of HO-1 in HaCaT cells, an immortalized human keratinocyte line. Both epidermal growth factor (EGF) and arsenite stimulated ROS production was detected by dihydroethidium (DHE) staining and fluorescence microscopy. Arsenite induced HO-1 in a time- and concentration-dependent manner, while HO-1 expression in response to EGF was modest and evident at extended time points (48-72 h). Inhibition of EGF receptor, MEK I/II or Src decreased arsenite-stimulated HO-1 expression by 20-30%. In contrast, addition of a superoxide scavenger or inhibition of p38 activity decreased the arsenite-dependent response by 80-90% suggesting that ROS and p38 are required for HO-1 induction. However, ROS generation alone was insufficient for the observed arsenite-dependent response as use of a xanthine/xanthine oxidase system to generate ROS did not produce an equivalent upregulation of HO-1. Cooperation between ERK signaling and ROS generation was demonstrated by synergistic induction of HO-1 in cells co-treated with EGF and xanthine/xanthine oxidase resulting in a response nearly equivalent to that observed with arsenite. These findings suggest that the ERK/MAPK activation is necessary but not sufficient for optimal arsenite-stimulated HO-1 induction. The robust and persistent upregulation of HO-1 may have a role in cellular adaptation to chronic arsenic exposure.

  2. The genetic basis of anoxygenic photosynthetic arsenite oxidation.

    PubMed

    Hernandez-Maldonado, Jaime; Sanchez-Sedillo, Benjamin; Stoneburner, Brendon; Boren, Alison; Miller, Laurence; McCann, Shelley; Rosen, Michael; Oremland, Ronald S; Saltikov, Chad W

    2017-01-01

    'Photoarsenotrophy', the use of arsenite as an electron donor for anoxygenic photosynthesis, is thought to be an ancient form of phototrophy along with the photosynthetic oxidation of Fe(II), H2 S, H2 and NO2-. Photoarsenotrophy was recently identified from Paoha Island's (Mono Lake, CA) arsenic-rich hot springs. The genomes of several photoarsenotrophs revealed a gene cluster, arxB2AB1CD, where arxA is predicted to encode for the sole arsenite oxidase. The role of arxA in photosynthetic arsenite oxidation was confirmed by disrupting the gene in a representative photoarsenotrophic bacterium, resulting in the loss of light-dependent arsenite oxidation. In situ evidence of active photoarsenotrophic microbes was supported by arxA mRNA detection for the first time, in red-pigmented microbial mats within the hot springs of Paoha Island. This work expands on the genetics for photosynthesis coupled to new electron donors and elaborates on known mechanisms for arsenic metabolism, thereby highlighting the complexities of arsenic biogeochemical cycling. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. The genetic basis of anoxygenic photosynthetic arsenite oxidation

    USGS Publications Warehouse

    Hernandez-Maldonado, Jamie; Sanchez-Sedillo, Benjamin; Stoneburner, Brendon; Boren, Alison; Miller, Laurence G.; McCann, Shelley; Rosen, Michael R.; Oremland, Ronald S.; Saltikov, Chad W.

    2017-01-01

    “Photoarsenotrophy”, the use of arsenite as an electron donor for anoxygenic photosynthesis, is thought to be an ancient form of phototrophy along with the photosynthetic oxidation of Fe(II), H2S, H2, and NO2-. Photoarsenotrophy was recently identified from Paoha Island's (Mono Lake, CA) arsenic-rich hot springs. The genomes of several photoarsenotrophs revealed a gene cluster, arxB2AB1CD, where arxA is predicted to encode for the sole arsenite oxidase. The role of arxA in photosynthetic arsenite oxidation was confirmed by disrupting the gene in a representative photoarsenotrophic bacterium, resulting in the loss of light-dependent arsenite oxidation. In situ evidence of active photoarsenotrophic microbes was supported by arxA mRNA detection for the first time, in red-pigmented microbial mats within the hot springs of Paoha Island. This work expands on the genetics for photosynthesis coupled to new electron donors and elaborates on known mechanisms for arsenic metabolism, thereby highlighting the complexities of arsenic biogeochemical cycling.

  4. Sodium arsenite-induced stress-related gene expression in normal human epidermal, HaCaT, and HEL30 keratinocytes.

    PubMed Central

    Trouba, Kevin J; Geisenhoffer, Kristen M; Germolec, Dori R

    2002-01-01

    Arsenic is a carcinogen that poses a significant health risk in humans. Based on evidence that arsenic has differential effects on human, rodent, normal, and transformed cells, these studies addressed the relative merits of using normal human epidermal keratinocytes (NHEK) and immortalized human (HaCaT) and mouse (HEL30) keratinocytes when examining stress-induced gene expression that may contribute to carcinogenesis. We hypothesize that redox-related gene expression is differentially modulated by arsenic in normal versus immortalized keratinocytes. To test the hypothesis, we exposed keratinocytes to sodium arsenite for 4 or 24 hr, at which time serine threonine kinase-25 (stk25) and nicotine adenine dinucleotide phosphate [nad(p)h] quinone oxidoreductase gene expression were measured. The effect of glutathione reduction on arsenite-induced cytotoxicity and gene expression in NHEK also was evaluated by addition of l-buthionine-[S,R]-sulfoximine (BSO) to culture media. Results indicate the term LC(50) for arsenite is approximately 10-15 microM in NHEK and HEL30 keratinocytes and 30 microM in HaCaT keratinocytes. Compared with HaCaT and HEL30 keratinocytes, a nontoxic concentration of arsenite (2.5 microM) increases stk25 and nad(p)h quinone oxidoreductase gene expression in NHEK, an effect partially attenuated by BSO. These data indicate that NHEK and HaCaT/HEL30 keratinocytes have similar sensitivities toward arsenite-induced cytotoxicity but unique gene expression responses. They also suggest that arsenite modulates gene expression in NHEK involved in cellular signaling and other aspects of intermediary metabolism that may contribute to the carcinogenic process. PMID:12426128

  5. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture

    PubMed Central

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination. PMID:26064886

  6. Effects of Arsenite Resistance on the Growth and Functional Gene Expression of Leptospirillum ferriphilum and Acidithiobacillus thiooxidans in Pure Culture and Coculture.

    PubMed

    Jiang, Huidan; Liang, Yili; Yin, Huaqun; Xiao, Yunhua; Guo, Xue; Xu, Ying; Hu, Qi; Liu, Hongwei; Liu, Xueduan

    2015-01-01

    The response of iron-oxidizing Leptospirillum ferriphilum YSK and sulfur-oxidizing Acidithiobacillus thiooxidans A01 to arsenite under pure culture and coculture was investigated based on biochemical characterization (concentration of iron ion and pH value) and related gene expression. L. ferriphilum YSK and At. thiooxidans A01 in pure culture could adapt up to 400 mM and 800 mM As(III) after domestication, respectively, although arsenite showed a negative effect on both strains. The coculture showed a stronger sulfur and ferrous ion oxidation activity when exposed to arsenite. In coculture, the pH value showed no significant difference when under 500 mM arsenite stress, and the cell number of At. thiooxidans was higher than that in pure culture benefiting from the interaction with L. ferriphilum. The expression profile showed that the arsenic efflux system in the coculture was more active than that in pure culture, indicating that there is a synergetic interaction between At. thiooxidans A01 and L. ferriphilum YSK. In addition, a model was proposed to illustrate the interaction between arsenite and the ars operon in L. ferriphilum YSK and At. thiooxidans A01. This study will facilitate the effective application of coculture in the bioleaching process by taking advantage of strain-strain communication and coordination.

  7. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  8. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  9. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    SciTech Connect

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

    2008-03-15

    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers.

  10. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. Published by Elsevier Ltd.

  11. Molecular evolution of the polyamine oxidase gene family in Metazoa.

    PubMed

    Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

    2012-06-20

    Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

  12. Molecular evolution of the polyamine oxidase gene family in Metazoa

    PubMed Central

    2012-01-01

    Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

  13. Arsenic detoxification potential of aox genes in arsenite-oxidizing bacteria isolated from natural and constructed wetlands in the Republic of Korea.

    PubMed

    Chang, Jin-Soo; Yoon, In-Ho; Lee, Ji-Hoon; Kim, Ki-Rak; An, Jeongyi; Kim, Kyoung-Woong

    2010-04-01

    Arsenic is subject to microbial interactions, which support a wide range of biogeochemical transformations of elements in natural environments such as wetlands. The arsenic detoxification potential of the bacterial strains was investigated with the arsenite oxidation gene, aox genotype, which were isolated from the natural and constructed wetlands. The isolates were able to grow in the presence of 10 mM of sodium arsenite (As(III) as NaAsO(2)) and 1 mM of D: +glucose. Phylogenetic analysis based on 16S rRNA gene sequencing indicated that these isolated strains resembled members of the genus that have arsenic-resistant systems (Acinetobacter sp., Aeromonas sp., Agrobacterium sp., Comamonas sp., Enterobacter sp., Pantoea sp., and Pseudomonas sp.) with sequence similarities of 81-98%. One bacterial isolate identified as Pseudomonas stutzeri strain GIST-BDan2 (EF429003) showed the activity of arsenite oxidation and existence of aoxB and aoxR gene, which could play an important role in arsenite oxidation to arsenate. This reaction may be considered as arsenic detoxification process. The results of a batch test showed that P. stutzeri GIST-BDan2 (EF429003) completely oxidized in 1 mM of As(III) to As(V) within 25-30 h. In this study, microbial activity was evaluated to provide a better understanding of arsenic biogeochemical cycle in both natural and constructed wetlands, where ecological niches for microorganisms could be different, with a specific focus on arsenic oxidation/reduction and detoxification.

  14. Biotransformation of arsenite and bacterial aox activity in drinking water produced from surface water of floating houses: Arsenic contamination in Cambodia.

    PubMed

    Chang, Jin-Soo

    2015-11-01

    The potential arsenite bioteansformation activity of arsenic was investigated by examining bacterial arsenic arsenite-oxidizing gene such as aoxS, aoxR, aoxA, aoxB, aoxC, and aoxD in high arsenic-contaminated drinking water produced from the surface water of floating houses. There is a biogeochemical cycle of activity involving arsenite oxidase aox system and the ars (arsenic resistance system) gene operon and aoxR leader gene activity in Alcaligenes faecalis SRR-11 and aoxS leader gene activity in Achromobacter xylosoxidans TSL-66. Batch experiments showed that SRR-11 and TSL-66 completely oxidized 1 mM of As (III) to As (V) within 35-40 h. The leaders of aoxS and aoxR are important for gene activity, and their effects in arsenic bioremediation and mobility in natural water has a significant ecological role because it allows arsenite oxidase in bacteria to control the biogeochemical cycle of arsenic-contaminated drinking water produced from surface water of floating houses.

  15. Distinct gene expression profiles in immortalized human urothelial cells exposed to inorganic arsenite and its methylated trivalent metabolites.

    PubMed

    Su, Pei-Fen; Hu, Yu-Jie; Ho, I-Ching; Cheng, Yang-Ming; Lee, Te-Chang

    2006-03-01

    Inorganic arsenic is an environmental carcinogen. The generation of toxic trivalent methylated metabolites complicates the study of arsenic-mediated carcinogenesis. This study systematically evaluated the effect of chronic treatment with sodium arsenite (iAs(III)), monomethylarsonous acid (MMA(III)), and dimethylarsinous acid (DMA(III)) on immortalized human uroepithelial cells (SV-HUC-1 cells) using cDNA microarray. After exposure for 25 passages to iAs(III) (0.5 microM), MMA(III) (0.05, 0.1, or 0.2 microM), or DMA(III) (0.2 or 0.5 microM), significant compound-specific morphologic changes were observed. A set of 114 genes (5.7% of the examined genes) was differentially expressed in one or more sets of arsenical-treated cells compared with untreated controls. Expression analysis showed that exposure of cells to DMA(III) resulted in a gene profile different from that in cells exposed to iAs(III) or MMA(III), and that the iAs(III)-induced gene profile was closest to that in the tumorigenic HUC-1-derived 3-methylcholanthrene-induced tumorigenic cell line MC-SV-HUC T2, which was derived from SV-HUC-1 cells by methylcholanthrene treatment. Of the genes affected by all three arsenicals, only one, that coding for interleukin-1 receptor, type II, showed enhanced expression, a finding confirmed by the reduced increase in NF-kappaB (nuclear factor kappa B) activity seen in response to interleukin-1beta in iAs(III)-exposed cells. The expression of 11 genes was suppressed by all three arsenicals. 5-Aza-deoxycytidine partially restored the transcription of several suppressed genes, showing that epigenetic DNA methylation was probably involved in arsenical-induced gene repression. Our data demonstrate that chronic exposure to iAs(III), MMA(III), or DMA(III) has different epigenetic effects on urothelial cells and represses NF-kappaB activity.

  16. Differential cytotoxic effects of sodium meta-arsenite on human cancer cells, dental papilla stem cells and somatic cells correlate with telomeric properties and gene expression.

    PubMed

    Jeon, Byeong-Gyun; Kumar, B Mohana; Kang, Eun-Ju; Maeng, Geun-Ho; Lee, Yeon-Mi; Hah, Young-Sool; Ock, Sun-A; Kwack, Dae-Oh; Park, Bong-Wook; Rho, Gyu-Jin

    2011-12-01

    We investigated the effects of sodium meta-arsenite (NaAsO(2)) on human cancer cells (MDA-MB-231, MCF-7 and U-87 MG), dental papilla tissue stem cells (DPSCs) and somatic cells [MRC-5 fetal fibroblasts and adult muscle cells (MCs)] by examining telomeric properties, endogenous reverse transcriptase (RT) activity and the expression of tumorigenesis-linked genes. Half maximal inhibitory concentration (IC(50)) values were higher in DPSCs and MCs, possessing longer telomere lengths when compared to cancer cells. Levels of telomerase and RT activity, and the expression of protein 53 (p53), B-cell lymphoma 2 (BCL2), nuclear factor kappa-light-chain-enhancer of activated B-cells (NFκB), transforming growth factor beta (TGFβ) and vascular endothelial growth factor (VEGF) were significantly lower in cancer cells following sodium meta-arsenite treatment, whereas the effect was absent or marginally detected in DPSCs and somatic cells. Collectively, sodium meta-arsenite effectively induced cellular cytotoxicity by inhibiting telomerase and RT activity, and down-regulating transcript levels in cancer cells with shorter telomere lengths, whereas more tolerance was evident in DPSCs and somatic cells possessing longer telomere lengths.

  17. Arsenic and phosphate rock impacted the abundance and diversity of bacterial arsenic oxidase and reductase genes in rhizosphere of As-hyperaccumulator Pteris vittata.

    PubMed

    Han, Yong-He; Fu, Jing-Wei; Xiang, Ping; Cao, Yue; Rathinasabapathi, Bala; Chen, Yanshan; Ma, Lena Q

    2017-01-05

    Microbially-mediated arsenic (As) transformation in soils affects As speciation and plant uptake. However, little is known about the impacts of As on bacterial communities and their functional genes in the rhizosphere of As-hyperaccumulator Pteris vittata. In this study, arsenite (AsIII) oxidase genes (aroA-like) and arsenate (AsV) reductase genes (arsC) were amplified from three soils, which were amended with 50mgkg(-1) As and/or 1.5% phosphate rock (PR) and grew P. vittata for 90 d. The aroA-like genes in the rhizosphere were 50 times more abundant than arsC genes, consistent with the dominance of AsV in soils. According to functional gene alignment, most bacteria belonged to α-, β- and γ-Proteobacteria. Moreover, aroA-like genes showed a higher biodiversity than arsC genes based on clone library analysis and could be grouped into nine clusters based on terminal restriction fragment length polymorphism (T-RFLP) analysis. Besides, AsV amendment elevated aroA-like gene diversity, but decreased arsC gene diversity. Redundancy analysis indicated that soil pH, available Ca and P, and AsV concentration were key factors driving diverse compositions in aroA-like gene community. This work identified new opportunities to screen for As-oxidizing and/or -reducing bacteria to aid phytoremediation of As-contaminated soils.

  18. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

    2008-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  19. Thyrotoxicity of arsenate and arsenite on juvenile mice at organism, subcellular, and gene levels under low exposure.

    PubMed

    Sun, Hong-Jie; Li, Shi-Wei; Li, Chao; Wang, Wen-Qian; Li, Hong-Bo; Ma, Lena Q

    2017-11-01

    Arsenic contamination in drinking water is a worldwide issue, posing threat to human health. Arsenic is an endocrine system disruptor, however, limited information is available regarding its long-term effects on thyroid endocrine system at low exposure. In this study, we assessed the thyroid toxicity of arsenate (AsV) and arsenite (AsIII) at 10-100 μg L(-1) in juvenile mice after 8-week of exposure via drinking water. After 1-2 week, AsV and AsIII had little influence on thyroxine (T4) level (56.3-64.7 μg L(-1)) in mouse blood compared to control mice at 57.3-60.7 μg L(-1). However, after 4-8 weeks, 10 μg L(-1) AsIII or AsV increased T4 levels to 83.8-88.8 μg L(-1) compared to control treatment at 77.2-80.0 μg L(-1), while 100 μg L(-1) AsV or AsIII decreased T4 levels except for 100 μg L(-1) AsIII for 8 weeks. Based on transmission electron microscopy, exposure to 100 μg L(-1) AsIII or AsV for 8 weeks caused thyroid gland damage. In addition, exposure to AsV or AsIII at 10 or 100 μg L(-1) impacted gene transcription of hypothalamic-pituitary-thyroid axis including thyroid stimulating hormone and iodothyronine deiodinases. Our data demonstrated that exposing to low levels of AsIII or AsV disrupted T4 homeostasis, influenced the related gene transcription and damaged the thyroid glands in juvenile mice. Published by Elsevier Ltd.

  20. Human monoamine oxidase A gene determines levels of enzyme activity.

    PubMed Central

    Hotamisligil, G S; Breakefield, X O

    1991-01-01

    Monoamine oxidase (MAO) is a critical enzyme in the degradative deamination of biogenic amines throughout the body. Two biochemically distinct forms of the enzyme, A and B, are encoded in separate genes on the human X chromosome. In these studies we investigated the role of the structural gene for MAO-A in determining levels of activity in humans, as measured in cultured skin fibroblasts. The coding sequence of the mRNA for MAO-A was determined by first-strand cDNA synthesis, PCR amplification, and direct dideoxy sequencing. Two single-basepair substitutions were observed in cDNAs from cells with a 30-fold difference in activity levels. These two substitutions were in the third base of a triplet codon and hence did not affect the deduced amino acid sequence but did affect the presence or absence of restriction-enzyme sites for EcoRV and Fnu4HI, which could be elucidated on PCR fragments derived from genomic DNA or cDNAs. A third polymorphism for MspI in the noncoding region of the MAOA gene was also evaluated by Southern blot analysis using genomic DNA. Statistically significant associations were observed between the alleles for MAOA and levels of MAO activity in human male fibroblast lines. This association indicates that the MAOA gene itself is a major determinant of activity levels, apparently, in part, through noncoding, regulatory elements. Images Figure 3 Figure 4 Figure 5 PMID:1678250

  1. The Pea Gene LH Encodes ent-Kaurene Oxidase1

    PubMed Central

    Davidson, Sandra E.; Smith, Jennifer J.; Helliwell, Chris A.; Poole, Andrew T.; Reid, James B.

    2004-01-01

    The pea (Pisum sativum) homolog, PsKO1, of the Arabidopsis GA3 gene was isolated. It codes for a cytochrome P450 from the CYP701A subfamily and has ent-kaurene oxidase (KO) activity, catalyzing the three step oxidation of ent-kaurene to ent-kaurenoic acid in the gibberellin (GA) biosynthetic pathway when expressed in yeast (Saccharomyces cerevisiae). PsKO1 is encoded by the LH gene because in three independent mutant alleles, lh-1, lh-2, and lh-3, PsKO1 has altered sequence, and the lh-1 allele, when expressed in yeast, failed to metabolize ent-kaurene. The lh mutants of pea are GA deficient and have reduced internode elongation and root growth. One mutant (lh-2) also causes a large increase in seed abortion. PsKO1 (LH) is expressed in all tissues examined, including stems, roots, and seeds, and appears to be a single-copy gene. Differences in sensitivity to the GA synthesis inhibitor, paclobutrazol, between the mutants appear to result from the distinct nature of the genetic lesions. These differences may also explain the tissue-specific differences between the mutants. PMID:14988475

  2. The pea gene LH encodes ent-kaurene oxidase.

    PubMed

    Davidson, Sandra E; Smith, Jennifer J; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2004-03-01

    The pea (Pisum sativum) homolog, PsKO1, of the Arabidopsis GA3 gene was isolated. It codes for a cytochrome P450 from the CYP701A subfamily and has ent-kaurene oxidase (KO) activity, catalyzing the three step oxidation of ent-kaurene to ent-kaurenoic acid in the gibberellin (GA) biosynthetic pathway when expressed in yeast (Saccharomyces cerevisiae). PsKO1 is encoded by the LH gene because in three independent mutant alleles, lh-1, lh-2, and lh-3, PsKO1 has altered sequence, and the lh-1 allele, when expressed in yeast, failed to metabolize ent-kaurene. The lh mutants of pea are GA deficient and have reduced internode elongation and root growth. One mutant (lh-2) also causes a large increase in seed abortion. PsKO1 (LH) is expressed in all tissues examined, including stems, roots, and seeds, and appears to be a single-copy gene. Differences in sensitivity to the GA synthesis inhibitor, paclobutrazol, between the mutants appear to result from the distinct nature of the genetic lesions. These differences may also explain the tissue-specific differences between the mutants.

  3. Diversity of arsenite oxidizing bacterial communities in arsenic-rich deltaic aquifers in West Bengal, India

    PubMed Central

    Ghosh, Devanita; Bhadury, Punyasloke; Routh, Joyanto

    2014-01-01

    High arsenic (As) concentration in groundwater has affected human health, particularly in South-East Asia putting millions of people at risk. Biogeochemical cycling of As carried out by different bacterial groups are suggested to control the As fluxes in aquifers. A functional diversity approach in link with As precipitation was adopted to study bacterial community structures and their variation within the As contaminated Bengal Delta Plain (BDP) aquifers of India. Groundwater samples collected from two shallow aquifers in Karimpur II (West Bengal, India), during years 2010 and 2011, were investigated to trace the effects immediately after monsoon period (precipitation) on community structure and diversity of bacterial assemblages with a focus on arsenite oxidizing bacterial phyla for two successive years. The study focused on amplification, clone library generation and sequencing of the arsenite oxidase large sub-unit gene aioA and 16S rRNA marker, with respect to changes in elemental concentrations. New set of primers were designed to amplify the aioA gene as a phylogenetic marker to study taxonomically diverse arsenite oxidizing bacterial groups in these aquifers. The overall narrow distribution of bacterial communities based on aioA and 16S rRNA sequences observed was due to poor nutrient status and anoxic conditions in these As contaminated aquifers. Proteobacteria was the dominant phylum detected, within which Acidovorax, Hydrogenophaga, Albidiferax, Bosea, and Polymorphum were the major arsenite oxidizing bacterial genera based on the number of clones sequenced. The structure of bacterial assemblages including those of arsenite oxidizing bacteria seems to have been affected by increase in major elemental concentrations (e.g., As, Fe, S, and Si) within two sampling sessions, which was supported by statistical analyses. One of the significant findings of this study is detection of novel lineages of 16S rRNA-like bacterial sequences indicating presence of

  4. Isolation of a gene encoding a glycosylated cytokinin oxidase from maize.

    PubMed

    Morris, R O; Bilyeu, K D; Laskey, J G; Cheikh, N N

    1999-02-16

    The major cytokinin oxidase in immature maize kernels was purified to homogeneity. Selected tryptic peptides were used to design degenerate oligonucleotide primers for PCR isolation of a fragment of the oxidase gene. Hybridization of the PCR fragment to a maize genomic library allowed isolation of a full-length cytokinin oxidase gene (ckx1). The gene encodes a protein of approximately 57 kDa that possesses a signal peptide, eight consensus N-glycosylation sequences and a consensus FAD binding sequence. Expression of ckx1 in Pichia caused secretion of active glycosylated cytokinin oxidase that contains a substrate-reducible FAD. The gene displays sequence homology with a putative oxidoreductase from Arabidopsis thaliana and with the fas5 gene from Rhodococcus fascians.

  5. Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe melon fruits.

    PubMed

    Ayub, R; Guis, M; Ben Amor, M; Gillot, L; Roustan, J P; Latché, A; Bouzayen, M; Pech, J C

    1996-07-01

    The plant hormone ethylene plays a major role in the ripening of climacteric fruit. We have generated transgenic cantaloupe Charentais melons expressing an antisense ACC oxidase gene; ACC oxidase catalyzes the last step of ethylene biosynthesis. Ethylene production of transgenic fruit was < 1% of control untransformed fruit, and the ripening process was blocked both on and off the vine. The antisense phenotype could be reversed by exogenous ethylene treatment. Analysis of antisense ACC oxidase melons indicated that the ripening process includes ethylene-dependent and ethylene-independent pathways. Because the transgenic line we generated displays extended storage life and improved quality, it has a promising potential for commercial development.

  6. Arsenic-resistant proteobacterium from the phyllosphere of arsenic-hyperaccumulating fern (Pteris vittata L.) reduces arsenate to arsenite.

    PubMed

    Rathinasabapathi, Bala; Raman, Suresh Babu; Kertulis, Gina; Ma, Lena

    2006-07-01

    An arsenic-resistant bacterium, AsRB1, was isolated from the fronds of Pteris vittata grown in a site contaminated with copper chromium arsenate. The bacterium exhibited resistance to arsenate, arsenite, and antimony in the culture medium. AsRB1, like Pseudomonas putida, grew on MacConkey and xylose-lactose-desoxycholate agars and utilized citrate but, unlike P. putida, was positive for indole test and negative for oxidase test. A phylogenetic analysis of the 16S rRNA gene showed that AsRB1 is a proteobacterium of the beta subclass, related to Pseudomonas saccharophila and Variovorax paradoxus. Following an exogenous supply of arsenate, most arsenic occurred as arsenite in the medium and the cell extracts, suggesting reduction and extrusion of arsenic as the mechanism for arsenic resistance in AsRB1.

  7. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Treesearch

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  8. SPARC Gene Expression is Repressed in Human Urothelial Cells (UROtsa) Exposed to or Malignantly Transformed by Cadmium or Arsenite

    PubMed Central

    Larson, Jennifer; Yasmin, Tahmina; Sens, Donald A.; Zhou, Xu Dong; Sens, Mary Ann; Garrett, Scott H.; Dunlevy, Jane R.; Cao, Ling; Somji, Seema

    2010-01-01

    SPARC belongs to a class of extracellular matrix-associated proteins that have counteradhesive properties. The ability of SPARC to modulate cell-cell and cell-matrix interactions provides a strong rationale for studies designed to determine its expression in cancer. The objective of this study was to determine if SPARC expression was altered in cadmium (Cd+2) and arsenite (As+3) induced bladder cancer and if these alterations were present in archival specimens of human bladder cancer. The expression of SPARC was determined in human parental UROtsa cells, their Cd+2 and As+3 transformed counterparts and derived tumors, and in archival specimens of human bladder cancer using a combination of real time reverse transcriptase polymerase chain reaction, western blotting, immunofluoresence localization and immunohistochemical staining. It was demonstrated that SPARC expression was down-regulated in Cd+2 and As+3 transformed UROtsa cells. In addition, the malignant epithelial component of tumors derived from these cell lines were also down-regulated for SPARC expression, but the stromal cells recruited to these tumors was highly reactive for SPARC. This finding was shown to translate to specimens of human bladder cancer where tumor cells were SPARC negative, but stromal cells were positive. Acute exposure of UROtsa cells to both cadmium and arsenite reduced the expression of SPARC through a mechanism that did not involve changes in DNA methylation or histone acetylation. These studies suggest that environmental exposure to As+3 or Cd+2 can alter cell-cell and cell-matrix interactions in normal urothelial cells through a reduction in the expression of SPARC. The SPARC associated loss of cell-cell and cell-matrix contacts may participate in the multi-step process of bladder carcinogenesis. PMID:20837119

  9. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  10. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  11. Characterization of AOC2 gene encoding a copper-binding amine oxidase expressed specifically in retina.

    PubMed

    Zhang, Qiang; Mashima, Yukihiko; Noda, Setsuko; Imamura, Yutaka; Kudoh, Jun; Shimizu, Nobuyoshi; Nishiyama, Takatsune; Umeda, Shinsuke; Oguchi, Yoshihisa; Tanaka, Yasuhiko; Iwata, Takeshi

    2003-10-30

    We have previously cloned a human, retina-specific, amine oxidase gene (RAO, gene symbol: AOC2), a member of the copper-binding amine oxidase super family. AOC2 shares sequence identity with the human kidney amine oxidase gene (KAO, gene symbol: AOC1) and the vascular adhesion protein-1 gene (VAP-1, gene symbol: AOC3). For further analysis of AOC2, the sequences surrounding the human AOC2 and the complete mouse and partial rat homologue of AOC2 were cloned for characterization. Real-time quantitative PCR, in situ hybridization, and immunohistochemistry were performed to determine the specific expression of AOC2 in the mouse retina and especially in the retinal ganglion cells. Our results demonstrated that the copper-binding motif and the enzyme active site of AOC1 and AOC3 were both conserved in mouse AOC2. The human and mouse AOC2 was flanked by two genes, the Psme3 gene for PA-28 gamma subunit and, surprisingly, the AOC3 gene. Rat AOC2 contained a stop codon that terminated the peptide length to 127 amino acids. The presence of human and rat AOC pseudogene in this region, in addition to the tandemly positioned two AOC genes, indicates the possibility of successful AOC3 replication to retina-specific AOC2 for human and mouse but unsuccessful for rat.

  12. Anaerobic oxidation of arsenite linked to chlorate reduction.

    PubMed

    Sun, Wenjie; Sierra-Alvarez, Reyes; Milner, Lily; Field, Jim A

    2010-10-01

    Microorganisms play a significant role in the speciation and mobility of arsenic in the environment. In this study, the oxidation of arsenite [As(III)] to arsenate [As(V)] linked to chlorate (ClO₃⁻) reduction was shown to be catalyzed by sludge samples, enrichment cultures (ECs), and pure cultures incubated under anaerobic conditions. No activity was observed in treatments lacking inoculum or with heat-killed sludge, or in controls lacking ClO₃⁻. The As(III) oxidation was linked to the complete reduction of ClO₃⁻ to Cl⁻, and the molar ratio of As(V) formed to ClO₃⁻ consumed approached the theoretical value of 3:1 assuming the e⁻ equivalents from As(III) were used to completely reduce ClO₃⁻. In keeping with O₂ as a putative intermediate of ClO₃⁻ reduction, the ECs could also oxidize As(III) to As(V) with O₂ at low concentrations. Low levels of organic carbon were essential in heterotrophic ECs but not in autotrophic ECs. 16S rRNA gene clone libraries indicated that the ECs were dominated by clones of Rhodocyclaceae (including Dechloromonas, Azospira, and Azonexus phylotypes) and Stenotrophomonas under autotrophic conditions. Additional phylotypes (Alicycliphilus, Agrobacterium, and Pseudoxanthomonas) were identified in heterotrophic ECs. Two isolated autotrophic pure cultures, Dechloromonas sp. strain ECC1-pb1 and Azospira sp. strain ECC1-pb2, were able to grow by linking the oxidation of As(III) to As(V) with the reduction of ClO₃⁻. The presence of the arsenite oxidase subunit A (aroA) gene was demonstrated with PCR in the ECs and pure cultures. This study demonstrates that ClO₃⁻ is an alternative electron acceptor to support the microbial oxidation of As(III).

  13. Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

    PubMed Central

    Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

    1996-01-01

    Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

  14. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  15. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  16. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  17. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    USDA-ARS?s Scientific Manuscript database

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  18. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  19. Sequence analysis of the oxidase/reductase genes upstream of the Rhodococcus erythropolis aldehyde dehydrogenase gene thcA reveals a gene organisation different from Mycobacterium tuberculosis.

    PubMed

    Nagy, I; De Mot, R

    1999-01-01

    The sequence of the DNA region upstream of the thiocarbamate-inducible aldehyde dehydrogenase gene thcA of Rhodococcus erythropolis NI86/21 was determined. Most of the predicted ORFs are related to various oxidases/reductases, including short-chain oxidases/reductases, GMC oxidoreductases, alpha-hydroxy acid oxidases (subfamily 1 flavin oxidases/dehydrogenases), and subfamily 2 flavin oxidases/dehydrogenases. One ORF is related to enzymes involved in biosynthesis of PQQ or molybdopterin cofactors. In addition, a putative member of the TetR family of regulatory proteins was identified. The substantial sequence divergence from functionally characterized enzymes precludes a reliable prediction about the probable function of these proteins at this stage. In Mycobacterium tuberculosis H37Rv, most of these ORFs have homologs that are also clustered in the genome, but some striking differences in gene organization were observed between Rhodococcus and Mycobacterium.

  20. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.

    PubMed

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-06-15

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays.

  1. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-01-01

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  2. Effects upon metabolic pathways and energy production by Sb(III) and As(III)/Sb(III)-oxidase gene aioA in Agrobacterium tumefaciens GW4

    PubMed Central

    Li, Jingxin; Yang, Birong; Shi, Manman; Yuan, Kai; Guo, Wei; Li, Mingshun

    2017-01-01

    Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III)]/antimonite [Sb(III)]-oxidizing strain. The As(III) oxidase AioAB is responsible for As(III) oxidation in the periplasm and it is also involved in Sb(III) oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III) oxidase AnoA and cellular H2O2 are also responsible for Sb(III) oxidation in strain GW4. However, the deletion of aioA increased the Sb(III) oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III), ATP and NADH contents and heat release were also increased by Sb(III) and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III) oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III) and were more significantly induced in the aioA mutant. The results suggested that Sb(III) oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III) would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III) oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III) stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat. PMID:28241045

  3. Effects upon metabolic pathways and energy production by Sb(III) and As(III)/Sb(III)-oxidase gene aioA in Agrobacterium tumefaciens GW4.

    PubMed

    Li, Jingxin; Yang, Birong; Shi, Manman; Yuan, Kai; Guo, Wei; Li, Mingshun; Wang, Gejiao

    2017-01-01

    Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III)]/antimonite [Sb(III)]-oxidizing strain. The As(III) oxidase AioAB is responsible for As(III) oxidation in the periplasm and it is also involved in Sb(III) oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III) oxidase AnoA and cellular H2O2 are also responsible for Sb(III) oxidation in strain GW4. However, the deletion of aioA increased the Sb(III) oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III), ATP and NADH contents and heat release were also increased by Sb(III) and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III) oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III) and were more significantly induced in the aioA mutant. The results suggested that Sb(III) oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III) would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III) oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III) stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

  4. Mitochondrial electron transport regulation of nuclear gene expression. Studies with the alternative oxidase gene of tobacco.

    PubMed Central

    Vanlerberghe, G C; McIntosh, L

    1994-01-01

    We have isolated a cDNA representing the tobacco (Nicotiana tabacum L. cv Bright Yellow) nuclear gene Aox1, which encodes the alternative oxidase of plant mitochondria. The clone contains the complete coding region (1059 base pairs) of a precursor protein of 353 amino acids with a calculated molecular mass of 39.8 kD. A putative transit peptide contains common signals believed to be important for import and processing of mitochondrially localized proteins. We have studied changes in Aox1 gene expression in tobacco in response to changes in cytochrome pathway activity. Inhibition of the cytochrome pathway by antimycin A resulted in a rapid and dramatic accumulation of Aox1 mRNA, whereas the level of mRNAs encoding two proteins of the cytochrome pathway did not change appreciably. This was accompanied by a dramatic increase in alternative pathway capacity and engagement in whole cells. Respiration under these conditions was unaffected by the uncoupler p-trifluoromethoxycarbonylcyanide (FCCP). When inhibition of the cytochrome pathway was relieved, levels of Aox1 mRNA returned to control levels, alternative pathway capacity and engagement declined, and respiration could once again be stimulated by FCCP. The results show that a mechanism involving changes in Aox1 gene expression exists whereby the capacity of the alternative pathway can be adjusted in response to changes in the activity of the cytochrome pathway. PMID:8058837

  5. Arsenite suppression of BMP signaling in human keratinocytes

    SciTech Connect

    Phillips, Marjorie A.; Qin, Qin; Hu, Qin; Zhao, Bin; Rice, Robert H.

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  6. The multicopper oxidase gene family in the brown planthopper, Nilaparvata lugens.

    PubMed

    Ye, Yu-Xuan; Pan, Peng-Lu; Kang, Dong; Lu, Jia-Bao; Zhang, Chuan-Xi

    2015-08-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, ascorbate oxidases, bilirubin oxidases and a subgroup of metal oxidases. On the basis of a bioinformatics investigation, we identified 7 genes encoding putative multicopper oxidase proteins in the genome of the brown planthopper (BPH), Nilaparvata lugens (Hemiptera: Delphacidae). MCO1 and MCO2 are conserved, while others diverse in insects. Analysis of developmental and tissue-specific expression patterns revealed the following: NlMCO2 was mainly expressed in the integument, and its expression peaked periodically during molting; NlMCO3 was an ovary-specific MCO gene with a high expression level only at the adult stage; NlMCO4 was a salivary gland-specific MCO gene that was expressed at all developmental stages; NlMCO5 only had short-term expression in the middle of the fourth instar stage and was expressed mainly in the gut; NlMCO6 had a developmental expression pattern similar to that of NlMCO2 and was expressed in most N. lugens tissues; and NlMCO1 was expressed in most N. lugens tissues except for the testis, whereas NlMCO7 was mainly expressed in the gut and the Malpighian tube. BPHs injected with double-stranded RNA (dsRNA) targeting NlMCO2 failed to pigment and sclerotize, were colorless and soft-bodied and subsequently died in a short time. Lethal phenotypes were also observed in insects challenged by dsRNA targeting NlMCO6. However, no observable morphological or internal structural abnormality was obtained in the insects treated with dsRNA for NlMCO1, NlMCO3, NlMCO4, NlMCO5 or NlMCO7.

  7. Thioarsenate Formation Coupled with Anaerobic Arsenite Oxidation by a Sulfate-Reducing Bacterium Isolated from a Hot Spring

    PubMed Central

    Wu, Geng; Huang, Liuqin; Jiang, Hongchen; Peng, Yue’e; Guo, Wei; Chen, Ziyu; She, Weiyu; Guo, Qinghai; Dong, Hailiang

    2017-01-01

    Thioarsenates are common arsenic species in sulfidic geothermal waters, yet little is known about their biogeochemical traits. In the present study, a novel sulfate-reducing bacterial strain Desulfotomaculum TC-1 was isolated from a sulfidic hot spring in Tengchong geothermal area, Yunnan Province, China. The arxA gene, encoding anaerobic arsenite oxidase, was successfully amplified from the genome of strain TC-1, indicating it has a potential ability to oxidize arsenite under anaerobic condition. In anaerobic arsenite oxidation experiments inoculated with strain TC-1, a small amount of arsenate was detected in the beginning but became undetectable over longer time. Thioarsenates (AsO4-xSx2- with x = 1–4) formed with mono-, di- and tri-thioarsenates being dominant forms. Tetrathioarsenate was only detectable at the end of the experiment. These results suggest that thermophilic microbes might be involved in the formation of thioarsenates and provide a possible explanation for the widespread distribution of thioarsenates in terrestrial geothermal environments. PMID:28769902

  8. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  9. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  10. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis.

  11. Cloning and expression of an alternative oxidase gene from Lycopersicon esculentum.

    PubMed

    Song, Cong-Feng; Borth, Wayne; Wang, Jin-Sheng; Hu, John-Sheng

    2004-10-01

    A full-length cDNA gene (LeAox1au) was isolated from a cDNA library made from ripening fruit of tomato "UC-82B" (Lycopersicon esculentum), after probing with alternative oxidase (AOX) gene fragments, obtained by degenerate primer PCR. Sequence analysis showed that LeAox1au was 1418 bp long and contained a 1077-bp open reading frame encoding a about 40 kD precursor protein which is processed to a mature protein of 32 kD. Southern blot analysis suggested LeAox1au is present as a single copy in the genome of tomato. RT-PCR analysis indicated LeAox1au was expressed in roots, stems, leaves and cotyledons of tomato plants. A recombinant construct containing the open reading frame sequence of the LeAox1au was transformed into Escherichia coli to express the alternative oxidase precursor protein.

  12. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    PubMed

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  13. Cloning, sequencing and heterologous expression of the monoamine oxidase gene from Aspergillus niger.

    PubMed

    Schilling, B; Lerch, K

    1995-05-20

    The gene encoding the flavin-containing monoamine oxidase (MAO-N) of the filamentous fungus Aspergillus niger was cloned. MAO-N is the first nonvertebrate monoamine oxidase described to date. Three partial cDNA clones, isolated from an expression library, were used to identify and clone the structural gene (maoN) from an A. niger genomic DNA library. The maoN gene was sequenced, and analysis revealed an open reading frame that codes for a protein of 495 amino acids with a calculated molecular mass of 55.6 kDa. Sequencing of an internal proteolytic fragment of the purified enzyme confirmed the derived amino acid sequence. Analysis of the deduced amino acid sequence indicates that MAO-N is structurally related to the human monoamine oxidases MAO-A and MAO-B. In particular, the regions known to be involved in the binding of the FAD cofactor show a high degree of homology; however, the conserved cysteine residue to which the flavin cofactor is covalently bound in the mammalian forms is absent in the fungal enzyme. MAO-N has the C-terminal tripeptide Ala-Arg-Leu, which corresponds to the consensus targeting sequence found in many peroxisomal enzymes. The full-length cDNA for MAO-N was expressed in Escherichia coli from the T7 promoter of the expression vector pET3a, yielding a soluble and fully active enzyme form.

  14. Identification and analysis of the Shewanella oneidensis major oxygen-independent coproporphyrinogen III oxidase gene.

    PubMed

    Al-Sheboul, Suhaila; Saffarini, Daad

    2011-12-01

    Shewanella oneidenesis MR-1 is a facultative anaerobe that can use a large number of electron acceptors including metal oxides. During anaerobic respiration, S. oneidensis MR-1 synthesizes a large number of c cytochromes that give the organism its characteristic orange color. Using a modified mariner transposon, a number of S. oneidensis mutants deficient in anaerobic respiration were generated. One mutant, BG163, exhibited reduced pigmentation and was deficient in c cytochromes normally synthesized under anaerobic condition. The deficiencies in BG163 were due to insertional inactivation of hemN1, which exhibits a high degree of similarity to genes encoding anaerobic coproporphyrinogen III oxidases that are involved in heme biosynthesis. The ability of BG163 to synthesize c cytochromes under anaerobic conditions, and to grow anaerobically with different electron acceptors was restored by the introduction of hemN1 on a plasmid. Complementation of the mutant was also achieved by the addition of hemin to the growth medium. The genome sequence of S. oneidensis contains three putative anaerobic coproporphyrinogen III oxidase genes. The protein encoded by hemN1 appears to be the major enzyme that is involved in anaerobic heme synthesis of S. oneidensis. The other two putative anaerobic coproporphyrinogen III oxidase genes may play a minor role in this process.

  15. Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

    PubMed

    Allam, Mai A; Saker, Mahmoud M

    2017-01-01

    The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

  16. Characterization of Two Brassinosteroid C-6 Oxidase Genes in Pea1[W][OA

    PubMed Central

    Jager, Corinne E.; Symons, Gregory M.; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J.; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L.; Yokota, Takao; Reid, James B.

    2007-01-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  17. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  18. [Mutation of mitochondria cytochrome oxidase gene in patients with myelodysplastic syndrome].

    PubMed

    Hou, Li; Liu, Ting; Meng, Wen-Tong

    2008-08-01

    The relationship between mitochondria gene mutation and hematological malignancies has been focusing on as a key point in recent studies. This study was aimed to investigate whether in patients with myelodysplastic syndrome (MDS) exists mitochoudria cytochrome oxidase COI and COII gene mutations different from normal tissues and to analyze whether these mutations are "hot spot" mutations. Eighteen MDS patients aged from 20 to 70 years old were brought into this study, including 2 of RA, 3 of RCMD, 7 of RAEB, 5 of AML (transformation from MDS), and 1 of MDS/MPD. The total DNA was extracted both from bone marrow cells and buccal cells of the same patients. A pair of primers was designed to amplify a fragment with 528 base pair (7181 - 7709) by PCR technique, which contained high frequency mutation area of cytochrome oxidase COI and COII gene based on the literature reports. The PCR products were purified and sequenced as bidirection to confirm if there is any mutation. The results of sequence of COI and COII gene from MDS patient bone marrow cells were compared with both the standard sequence from GenBank and the sequence from MDS patient buccal cells. The results showed that 3 single nucleotide changes in 528 bp cytochrome oxidase gene fragment from 18 MDS patients were confirmed. They were 7674 T-->C, 7353 A-->G, and an insert mutation of G at 7702. The former two mutations caused isoleucine-->methionine, and methionine-->viline. The 7702G ins was only confirmed with marrow cells in a patient, and caused a frame shift, which suggested that the mutation might be related to MDS cells. It is concluded that some of "hot spots" of mtDNA mutation in cytochrome oxidase (COI, COII) gene from our MDS patients are failed to be confirmed, but 3 new mutations on this gene are found, which suggested that mitochondria DNA mutations in MDS patients still have much complexity and heterogeneity, mtDNA mutation may be a prophase or an accompany phenomenon of this disease.

  19. Modulation of gene-expression profiles associated with sodium arsenite-induced cardiotoxicity by p-coumaric acid, a common dietary polyphenol.

    PubMed

    Prasanna, Nagalakshmi; Rasool, Mahaboobkhan

    2014-04-01

    In the present study, the purpose was to investigate the effect of p-coumaric acid on the mRNA-expression levels of inflammatory cytokines, transcription factor, MAP kinases, and apoptotic proteins by real time reverse transcription polymerase chain reaction in the cardiac tissue of sodium arsenite exposed rats. Sodium arsenite administration (5 mg/kg/b.wt, once daily for 30 days) upregulated the mRNA-expression levels of inflammatory cytokines (interleukin-1 beta, interleukin-6, tumor necrosis factor-alpha, and tumor growth factor-beta), transcription factor (NF-Kb-Rel A), protein kinases (Janus kinase and p38), caspase 3, and proapoptotic protein Bax in the cardiac tissue of rats, but the antiapoptotic protein Bcl-2 mRNA expression was found be downregulated. However, p-coumaric acid (75, 100 mg/kg/b. wt. oral) pretreatment daily before the sodium arsenite exposure protected the changes in the above mRNA-expression profiles observed in the cardiac tissues. In conclusion, this study confirmed that p-coumaric acid could be a promising dietary agent for protecting against the sodium arsenite-induced cardiotoxicity.

  20. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  1. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    EPA Science Inventory

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  2. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    EPA Science Inventory

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  3. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

    PubMed

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  4. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  5. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production.

  6. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.

    PubMed

    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen

    2012-10-01

    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  7. Functional characterization of copA gene encoding multicopper oxidase in Xanthomonas campestris pv. campestris.

    PubMed

    Hsiao, Yi-Min; Liu, Yu-Fan; Lee, Pei-Yu; Hsu, Pei-Chi; Tseng, Szu-Yu; Pan, Yu-Chien

    2011-09-14

    The gram-negative plant pathogenic Xanthomonas campestris pv. campestris (Xcc) is the causative agent of black rot in crucifers, a disease causing tremendous loss in agriculture. Copper-containing bactericides have been widely used to control this disease for many years, possibly leading to the development of copper resistance in Xcc. Homologues of copper resistance genes copLAB are present in the Xcc genome, but none has been characterized. In this study, mutations in copL, copA, and copB decreased Xcc copper tolerance. Among them, the copA mutant displayed the most significant reduction. The copA mutant also resulted in a reduction in virulence on the host cabbage. Sequence and mutational analysis demonstrated that copA encodes a multicopper oxidase and that CopA is able to catalyze the oxidation of 2,6-dimethoxyphenol. Alanine substitutions in each of the putative copper binding residues (H538, H583, C584, and H585) of CopA caused a loss of function including copper tolerance and oxidase activity. Furthermore, reporter assays showed that copA transcription is inducible in the presence of copper, subject to catabolite repression, and repressed under conditions of high osmolarity, nitrogen starvation, or oxygen limitation. This is the first time that multicopper oxidase has been characterized in the crucifer pathogen Xcc.

  8. Monoamine oxidase A gene promoter polymorphism affects novelty seeking and reward dependence in healthy study participants.

    PubMed

    Shiraishi, Hiroaki; Suzuki, Akihito; Fukasawa, Takashi; Aoshima, Toshiaki; Ujiie, Yukihiro; Ishii, Genki; Otani, Koichi

    2006-04-01

    It has been suggested that monoamine oxidase A plays an important role in the characterization of personality. Previous studies on the association between the polymorphism of variable number tandem repeat in the promoter region of the monoamine oxidase A gene and personality traits have, however, been unproductive. In the present study, the association between the monoamine oxidase A variable number tandem repeat polymorphism and personality traits assessed by the Temperament and Character Inventory was examined in 324 Japanese volunteers without psychiatric disorders. The low activity allele with three repeats (allele 3) and high activity allele with four repeats (allele 4) were determined by a polymerase chain reaction method. The carriers of allele 3 in males and the homozygotes of allele 3 in females were classified as the low activity group, the heterozygotes of alleles 3 and 4 in females as the medium activity group, and the carriers of allele 4 in males and the homozygotes of allele 4 in females as the high activity group. One-way analysis of variance showed that the scores of novelty seeking (P=0.006) and reward dependence (P=0.013) were significantly higher in the high activity group than in the low activity group. Multiple regression analysis demonstrated that the excess in the high activity allele was significantly associated with higher scores of novelty seeking (P=0.004) and reward dependence (P=0.003). The present study thus suggests that the monoamine oxidase A variable number tandem repeat polymorphism affects novelty seeking and reward dependence in healthy study participants.

  9. Arsenite oxidizing multiple metal resistant bacteria isolated from industrial effluent: their potential use in wastewater treatment.

    PubMed

    Naureen, Ayesha; Rehman, Abdul

    2016-08-01

    Arsenite oxidizing bacteria, isolated from industrial wastewater, showed high resistance against arsenite (40 mM) and other heavy metals (10 mM Pb; 8 mM Cd; 6 mM Cr; 10 mM Cu and 26.6 mM As(5+)). Bacterial isolates were characterized, on the basis of morphological, biochemical and 16S rRNA ribotyping, as Bacillus cereus (1.1S) and Acinetobacter junii (1.3S). The optimum temperature and pH for the growth of both strains were found to be 37 °C and 7. Both the strains showed maximum growth after 24 h of incubation. The predominant form of arsenite oxidase was extracellular in B. cereus while in A. junii both types of activities, intracellular and extracellular, were found. The extracellular aresenite oxidase activity was found to be 730 and 750 µM/m for B. cereus and A. junii, respectively. The arsenite oxidase from both bacterial strains showed maximum activity at 37 °C, pH 7 and enhanced in the presence of Zn(2+). The presence of two protein bands with molecular weight of approximately 70 and 14 kDa in the presence of arsenic points out a possible role in arsenite oxidation. Arsenite oxidation potential of B. cereus and A. junii was determined up to 92 and 88 % in industrial wastewater after 6 days of incubation. The bacterial treated wastewater improved the growth of Vigna radiata as compared to the untreated wastewater. It indicates that these bacterial strains may find some potential applications in wastewater treatment systems to transform toxic arsenite into less toxic form, arsenate.

  10. Cloning, identification and expression analysis of ACC oxidase gene involved in ethylene production pathway.

    PubMed

    Jafari, Zohreh; Haddad, Raheem; Hosseini, Ramin; Garoosi, Ghasemali

    2013-02-01

    1-aminocyclopropane-1-carboxylic acid oxidase (ACO) enzyme is a member of the Fe II-dependent family of oxidases/oxygenases which require Fe(2+) as a cofactor, ascorbate as a cosubstrate and CO(2) as an activator. This enzyme catalyses the terminal step in the plant signaling of ethylene biosynthetic pathway. A 948 bp fragment of the ACO1 gene cDNA sequence was cloned from tomato (Lycopersicon esculentum) fruit tissues by using reverse transcriptase-polymerase chain reaction (RT-PCR) with two PCR primers designed according to the sequence of a tomato cDNA clone (X58273). The BLAST search showed a high level of similarity (77-98 %) between ACO1 and ACO genes of other plants. The calculated molecular mass and predicted isoelectric point of LeACO1 were 35.8 kDa and 5.13, respectively. The three-dimensional structure studies illustrated that the LeACO1 protein folds into a compact jelly-roll motif comprised of 8 α-helices, 12 β-strands and several long loops. The cosubstrate was located in a cofactor-binding pocket referred to as a 2-His-1-carboxylate facial triad. Semi-quantitative RT-PCR analysis of gene expression revealed that the LeACO1 was expressed in fruit tissues at different ripening stages.

  11. Cloning and expression of the 1-aminocyclopropane-1-carboxylic oxidase gene from Agrostis stolonifera.

    PubMed

    Xiao, G Z; Li, L J; Teng, K; Chao, Y H; Han, L B

    2016-11-03

    A gene encoding 1-aminocyclopropane-1-carboxylic oxidase (ACO), which catalyzes the terminal step in ethylene biosynthesis, was isolated from Agrostis stolonifera. The AsACO gene is composed of 975 bp, encoding 324 amino acids. Three exons interspersed by two introns form AsACO gDNA. A BLAST search of the nucleotide sequence revealed a high level of similarity (79-91%) between AsACO and ACO genes of other plants. A phylogenetic tree was constructed via BLAST in the NCBI, and revealed the highest homology with wheat TaACO. The calculated molecular mass and predicted isoelectric point of AsACO were 36.25 and 4.89 kDa, respectively. Analysis of subcellular localization revealed that AsACO is located in the nucleus and cytoplasm. The Fe(II)-binding cofactors and cosubstrate were identified, pertaining to the ACO family. The expression patterns of AsACO were determined by quantitative real time PCR. AsACO expression was highest in the stem, and was strongly up-regulated in response to ethephon, methyl jasmonate, salicylic acid, and cold temperature, but down-regulated in response to drought and NaCl treatment. The protein encoded by AsACO exhibited ACC oxidase activity in vitro. Taken together, these findings suggest that AsACO contains domains common to the ACO family, and is induced in response to exogenous hormones. Conversely, some abiotic stress conditions can inhibit AsACO expression.

  12. Polymorphisms in NADPH oxidase CYBA gene modify the risk of ESRD in patients with chronic glomerulonephritis.

    PubMed

    Zhou, Hui; Chen, Min; Zhu, Ying; Wang, Bing; Liu, Xiao-ning; Zuo, Zhi; Tang, Feng-Ying

    2016-01-01

    End-stage renal disease (ESRD) was defined as start of renal replacement therapy or death due to kidney disease. However, death due to acute kidney injury was not included. It typically occurs when chronic renal failure progresses to a point where the kidneys are permanently functioning at less than 10% of their capacity. Oxidative stress (OS) plays a crucial role in ESRD. Nicotinamide adenine dinucleotide phosphate (NADPH) is one of the most important enzymes during oxidative stress. Cytochrome b light chain (CYBA), encoded by a polymorphic gene, which is a critical component of the nicotinamide adenine dinucleotide (NADH)/NADPH oxidase system and plays an important role in electron transport and superoxide anion production, is located on chromosome band 16q24 and has six exons spanning almost 7.76 kb of genomic DNA. CYBA gene polymorphisms can influence the activity of NADPH oxidase. To evaluate the association between CYBA gene polymorphisms and ESRD, we genotyped five CYBA polymorphisms using TaqMan allelic discrimination assay on DNA samples from 306 healthy controls and 332 patients with ESRD. Our results suggested that rs1049255 polymorphism of CYBA modified the risk of ESRD (p  =  0.019; OR  =  0.625; 95%CI  =  0.424-0.921). GG genotype and G allele might be a protective factor against the risk of ESRD, especially in patients with chronic glomerulonephritis.

  13. Anaerobic arsenite oxidation by an autotrophic arsenite-oxidizing bacterium from an arsenic-contaminated paddy soil.

    PubMed

    Zhang, Jun; Zhou, Wuxian; Liu, Bingbing; He, Jian; Shen, Qirong; Zhao, Fang-Jie

    2015-05-19

    Microbe-mediated arsenic (As) redox reactions play an important role in the biogeochemical cycling of As. Reduction of arsenate [As(V)] generally leads to As mobilization in paddy soils and increased As availability to rice plants, whereas oxidation of arsenite [As(III)] results in As immobilization. A novel chemoautotrophic As(III)-oxidizing bacterium, designated strain SY, was isolated from an As-contaminated paddy soil. The isolate was able to derive energy from the oxidation of As(III) to As(V) under both aerobic and anaerobic conditions using O2 or NO3(-) as the respective electron acceptor. Inoculation of the washed SY cells into a flooded soil greatly enhanced As(III) oxidation to As(V) both in the solution and adsorbed phases of the soil. Strain SY is phylogenetically closely related to Paracoccus niistensis with a 16S rRNA gene similarity of 96.79%. The isolate contains both the denitrification and ribulose 1,5-bisphosphate carboxylase/oxygenase gene clusters, underscoring its ability to denitrify and to fix CO2 while coupled to As(III) oxidation. Deletion of the aioA gene encoding the As(III) oxidase subunit A abolished the As(III) oxidation ability of strain SY and led to increased sensitivity to As(III), suggesting that As(III) oxidation is a detoxification mechanism in this bacterium under aerobic and heterotrophic growth conditions. Analysis of the aioA gene clone library revealed that the majority of the As(III)-oxidizing bacteria in the soil were closely related to the genera Paracoccus of α-Proteobacteria. Our results provide direct evidence for As(III) oxidation by Paracoccus species and suggest that these species may play an important role in As(III) oxidation in paddy soils under both aerobic and denitrifying conditions.

  14. Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

    PubMed

    Pöggeler, Stefanie

    2011-04-01

    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

  15. Evolution of Multicopper Oxidase Genes in Coprophilous and Non-Coprophilous Members of the Order Sordariales

    PubMed Central

    Pöggeler, Stefanie

    2011-01-01

    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events. PMID:21966247

  16. Genetic variation in the monoamine oxidase A and serotonin transporter genes in sudden infant death syndrome.

    PubMed

    Opdal, Siri H; Vege, Åshild; Rognum, Torleiv O

    2014-04-01

    The purpose of this study was to investigate common polymorphisms in the genes encoding monoamine oxidase A (MAOA) and serotonin transporter (5-HTT) in Norwegian cases of sudden infant death syndrome (SIDS). This was done to further elucidate the role of genetic variation in these genes and SIDS. A variable number of tandem repeat area in the promoter of the MAOA gene and rs25531 in the promoter region of the gene encoding 5-HTT were investigated in 193 SIDS cases and 335 controls. The methods used were polymerase chain reaction, restriction fragment analysis and gel electrophoresis. There were no differences between SIDS cases and controls for any of the investigated polymorphisms. This was also true when male and female SIDS cases were analysed separately. This article indicates that neither the VNTR in the promoter of the MAOA gene, nor rs25531 in the gene encoding 5-HTT, is involved in SIDS. However, as medullary serotonergic abnormalities most likely contribute to the death in at least some SIDS cases, it is important to investigate these genes, as well as other genes involved in the serotonergic network, in more detail. ©2013 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  17. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells.

    PubMed

    Lee, Yuan-Cho; Yang, Vivian C; Wang, Tsu-Shing

    2007-09-24

    Inorganic arsenic is a known human carcinogen, yet its mechanism of action remains unclear. Our previous study showed that arsenite significantly induces oxidative DNA adducts and DNA-protein cross-links in several mammalian cell lines. In the present study, we used the random amplified polymorphic DNA (RAPD) assay to evaluate the possible target in the genomic DNA of human lymphoblastoid cells that were exposed to sodium arsenite. Treatment with both 10 and 80 microM arsenite for 4h induced significant changes in RAPD profiles compared with the control pattern. Two 10-mer RAPD primers (D11 and F1) produced the most distinguishable banding profiles between arsenite-treated and control genomic DNA. The sequencing of four arsenite-sensitive RAPD bands showed that the RB1CC1 and PACE4 genes might be the DNA targets of sodium arsenite treatment. We propose that arsenite may induce sequence- or gene-specific damage and then change the RAPD profile in human lymphoblastoid cells. The results of our study also show that RAPD combined with other techniques is a good tool for detecting alterations in genomic DNA and for the direct screening of new molecular markers related to arsenite-induced carcinogenesis.

  18. Selenate-dependent anaerobic arsenite oxidation by a bacterium from Mono Lake, California.

    PubMed

    Fisher, Jenny C; Hollibaugh, James T

    2008-05-01

    Arsenate was produced when anoxic Mono Lake water samples were amended with arsenite and either selenate or nitrate. Arsenite oxidation did not occur in killed control samples or live samples with no added terminal electron acceptor. Potential rates of anaerobic arsenite oxidation with selenate were comparable to those with nitrate ( approximately 12 to 15 mumol.liter(-1) h(-1)). A pure culture capable of selenate-dependent anaerobic arsenite oxidation (strain ML-SRAO) was isolated from Mono Lake water into a defined salts medium with selenate, arsenite, and yeast extract. This strain does not grow chemoautotrophically, but it catalyzes the oxidation of arsenite during growth on an organic carbon source with selenate. No arsenate was produced in pure cultures amended with arsenite and nitrate or oxygen, indicating that the process is selenate dependent. Experiments with washed cells in mineral medium demonstrated that the oxidation of arsenite is tightly coupled to the reduction of selenate. Strain ML-SRAO grows optimally on lactate with selenate or arsenate as the electron acceptor. The amino acid sequences deduced from the respiratory arsenate reductase gene (arrA) from strain ML-SRAO are highly similar (89 to 94%) to those from two previously isolated Mono Lake arsenate reducers. The 16S rRNA gene sequence of strain ML-SRAO places it within the Bacillus RNA group 6 of gram-positive bacteria having low G+C content.

  19. Functional characterization of the two alcohol oxidase genes from the yeast Pichia pastoris.

    PubMed Central

    Cregg, J M; Madden, K R; Barringer, K J; Thill, G P; Stillman, C A

    1989-01-01

    In Pichia pastoris, alcohol oxidase (AOX) is the first enzyme in the methanol utilization pathway and is encoded by two genes, AOX1 and AOX2. The DNA and predicted amino acid sequences of the protein-coding portions of the genes are closely homologous, whereas flanking sequences share no homology. The functional roles of AOX1 and AOX2 in the metabolism of methanol were examined. Studies of strains with disrupted AOX genes revealed that AOX1 was the major source of methanol-oxidizing activity in methanol-grown P. pastoris. The results of two types of experiments each suggested that the difference in AOX activity contributed by the two genes was a consequence of sequences located 5' of the protein-coding portions of the genes. First, the coding portion of AOX2 was able to functionally substitute for that of AOX1 when placed under the control of AOX1 regulatory sequences. Second, when labeled oligonucleotide probes specific for the 5' nontranslated region of each gene were used, it was apparent that the steady-state level of AOX1 mRNA was much higher than that of AOX2. Except for the difference in the amount of mRNA present, the two genes appeared to be regulated in the same manner. A physiological reason for the existence of AOX2 was sought but was not apparent. Images PMID:2657390

  20. Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

    PubMed Central

    Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

    2009-01-01

    Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

  1. Cloning of the Arabidopsis ent-kaurene oxidase gene GA3.

    PubMed

    Helliwell, C A; Sheldon, C C; Olive, M R; Walker, A R; Zeevaart, J A; Peacock, W J; Dennis, E S

    1998-07-21

    The ga3 mutant of Arabidopsis is a gibberellin-responsive dwarf. We present data showing that the ga3-1 mutant is deficient in ent-kaurene oxidase activity, the first cytochrome P450-mediated step in the gibberellin biosynthetic pathway. By using a combination of conventional map-based cloning and random sequencing we identified a putative cytochrome P450 gene mapping to the same location as GA3. Relative to the progenitor line, two ga3 mutant alleles contained single base changes generating in-frame stop codons in the predicted amino acid sequence of the P450. A genomic clone spanning the P450 locus complemented the ga3-2 mutant. The deduced GA3 protein defines an additional class of cytochrome P450 enzymes. The GA3 gene was expressed in all tissues examined, RNA abundance being highest in inflorescence tissue.

  2. Association analysis of the functional monoamine oxidase A gene promotor polymorphism in migraine.

    PubMed

    Marziniak, M; Mössner, R; Benninghoff, J; Syagailo, Y V; Lesch, K-P; Sommer, C

    2004-05-01

    Migraine affects about 15% of the adult population. Serotonergic and dopaminergic systems are believed to be involved in its pathophysiology. One of the key enzymes in the degradation of serotonin and to a lesser extent of dopamine is monoamine oxidase A (MAO-A). In this study we investigated a functionally relevant gene-linked polymorphic repetitive sequence (LPR) located approximately 1.2 kb upstream of the ATG codon in the MAO-A-promotor gene. 119 patients with migraine and 229 controls were tested. The allelic distribution of the controls and the migraine patients did not show significant differences with respect to the low- and high-activity alleles. Moreover, effectiveness of the potent serotonergic antimigraine agents, triptans, which are metabolized by MAO-A, was clinically not affected by the MAO-A-LPR in our patients. These findings thus indicate that there is no association between the functional MAO-A-LPR and susceptibility to migraine.

  3. Kinetics of arsenite removal by halobacteria from a highland Andean Chilean Salar

    PubMed Central

    2013-01-01

    Background The purpose of this study was to identify arsenite-oxidizing halobacteria in samples obtained from Salar de Punta Negra, II Region of Chile. Seven bacterial isolates, numbered as isolates I to VII, grown in a culture medium with 100 ppm as NaAsO2 (As (III)) were tested. Bacterial growth kinetics and the percent of arsenite removal (PAR) were performed simultaneously with the detection of an arsenite oxidase enzyme through Dot Blot analysis. Results An arsenite oxidase enzyme was detected in all isolates, expressed constitutively after 10 generations grown in the absence of As (III). Bacterial growth kinetics and corresponding PAR values showed significant fluctuations over time. PARs close to 100% were shown by isolates V, VI, and VII, at different times of the bacterial growth phase; while isolate II showed PAR values around 40%, remaining constant over time. Conclusion Halobacteria from Salar de Punta Negra showed promising properties as arsenite removers under control conditions, incubation time being a critical parameter. PMID:23547876

  4. Arsenite and insulin exhibit opposing effects on epidermal growth factor receptor and keratinocyte proliferative potential

    SciTech Connect

    Patterson, Timothy J.; Rice, Robert H. . E-mail: rhrice@ucdavis.edu

    2007-05-15

    Previous work has suggested that arsenic exposure contributes to skin carcinogenesis by preserving the proliferative potential of human epidermal keratinocytes, thereby slowing the exit of putative target stem cells into the differentiation pathway. To find a molecular basis for this action, present work has explored the influence of arsenite on keratinocyte responses to epidermal growth factor (EGF). The ability of cultured keratinocytes to found colonies upon passaging several days after confluence was preserved by arsenite and EGF in an additive fashion, but neither was effective when the receptor tyrosine kinase activity was inhibited. Arsenite prevented the loss of EGF receptor protein and phosphorylation of tyrosine 1173, preserving its capability to signal. The level of nuclear {beta}-catenin was higher in cells treated with arsenite and EGF in parallel to elevated colony forming ability, and expression of a dominant negative {beta}-catenin suppressed the increase in both colony forming ability and yield of putative stem cells induced by arsenite and EGF. As judged by expression of three genes regulated by {beta}-catenin, this transcription factor had substantially higher activity in the arsenite/EGF-treated cells. Trivalent antimony exhibited the same effects as arsenite. A novel finding is that insulin in the medium induced the loss of EGF receptor protein, which was largely prevented by arsenite exposure.

  5. Suppressed expression of the apoplastic ascorbate oxidase gene increases salt tolerance in tobacco and Arabidopsis plants.

    PubMed

    Yamamoto, Atsuko; Bhuiyan, Md Nazmul H; Waditee, Rungaroon; Tanaka, Yoshito; Esaka, Muneharu; Oba, Kazuko; Jagendorf, André T; Takabe, Teruhiro

    2005-07-01

    Transgenic tobacco plants expressing the ascorbate oxidase (AAO) gene in sense and antisense orientations, and an Arabidopsis mutant in which the T-DNA was inserted into a putative AAO gene, were used to examine the potential roles of AAO for salt-stress tolerance in plants. AAO activities in the transgenic tobacco plants expressing the gene in sense and antisense orientations were, respectively, about 16-fold and 0.2-fold of those in the wild type. Under normal growth conditions, no significant differences in phenotypes were observed, except for a delay in flowering time in the antisense plants. However, at high salinity, the percentage germination, photosynthetic activity, and seed yields were higher in antisense plants, with progressively lower levels in the wild type and the sense plants. The redox state of apoplastic ascorbate in sense plants was very low even under normal growth conditions. Upon salt stress, the redox state of symplastic and apoplastic ascorbate decreased among the three types of plants, but was lowest in the sense plants. The hydrogen peroxide contents in the symplastic and apoplastic spaces were higher in sense plants, progressively lower in the wild type, followed by the antisense plants. The Arabidopsis T-DNA inserted mutant exhibited very low ascorbate oxidase activity, and its phenotype was similar to that of antisense tobacco plants. These results suggest that the suppressed expression of apoplastic AAO under salt-stress conditions leads to a relatively low level of hydrogen peroxide accumulation and a high redox state of symplastic and apoplastic ascorbate which, in turn, permits a higher seed yield.

  6. Mutations affecting the expression of the MOX gene encoding peroxisomal methanol oxidase in Hansenula polymorpha.

    PubMed

    Vallini, V; Berardi, E; Strabbioli, R

    2000-11-01

    In this study, aimed at identifying genetic factors acting positively upon the MOX gene, we report the isolation and characterisation of several methanol utilisation-defective (Mut-) mutants of Hansenula polymorpha. These fall into 12 complementation groups, eight of which show significant reductions in alcohol (methanol) oxidase activity in methanol. Three of these groups, identifying the MUT3, MUT5 and MUT10 loci, exhibit extremely low levels of MOX promoter activity, not only in methanol medium, but also during growth in glycerol or methylamine. We suggest that these loci play a significant role in the derepression of the MOX gene expression. One of these genes (MUT10) also seems to be involved in the utilisation of carbon sources other than methanol, and it is apparent that the same gene plays some role in the biogenesis or in the enlargement of the peroxisome. Three other genes (MUT7, MUT8 and MUT9) appear to be involved in peroxisome biogenesis, whereas most other mutants harbour lesions that leave the peroxisome biogenesis and proliferation unaffected.

  7. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression.

  8. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  9. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  10. Bd oxidase homologue of photosynthetic purple sulfur bacterium Allochromatium vinosum is co-transcribed with a nitrogen fixation related gene.

    PubMed

    Dincturk, H Benan; Demir, Volkan; Aykanat, Tutku

    2011-02-01

    Purple sulfur bacteria, which are known to be the most ancient among anoxygenic phototrophs, play an important role in the global sulfur cycle. Allochromatium vinosum oxidizes reduced sulfur compounds such as hydrogen sulfide, elemental sulfur and thiosulfide. At low oxygen concentrations, A. vinosum can grow chemotrophically using oxygen as the terminal electron acceptor. Being also a nitrogen fixer, A. vinosum is faced with the paradox of co-existence of aerobic metabolism and nitrogen fixation. Due to growth difficulties, only a few studies have dealt with the aerobic metabolism of the organism and, until now, there has been no information about the genes involved in the respiratory metabolism of purple sulfur bacteria. In this article we show the first terminal oxidase gene for A. vinosum. The presence of a Bd type of quinol oxidase is necessary to protect nitrogenases against the inhibitory effects of oxygen. In this case, a nitrogen fixation related gene is part of the cyd operon and this gene is co-transcribed with cydAB genes. Bd oxidase of A. vinosum may be the earliest form of oxidase where the function of the enzyme is to scavenge the contaminant oxygen during nitrogen fixation. This may be an important clue about the early evolution of oxygenic photosynthesis, perhaps as a protective mechanism for nitrogen fixation.

  11. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  12. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

  13. Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

    PubMed Central

    Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

    2017-01-01

    Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

  14. Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents.

    PubMed

    Zhang, Yun; Ming, Qing-Sen; Yi, Jin-Yao; Wang, Xiang; Chai, Qiao-Lian; Yao, Shu-Qiao

    2017-01-01

    Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR "SS" genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions.

  15. The terminal quinol oxidase of the hyperthermophilic archaeon Acidianus ambivalens exhibits a novel subunit structure and gene organization.

    PubMed Central

    Purschke, W G; Schmidt, C L; Petersen, A; Schäfer, G

    1997-01-01

    A terminal quinol oxidase has been isolated from the plasma membrane of the crenarchaeon Acidianus ambivalens (DSM 3772) (formerly Desulfurolobus ambivalens), cloned, and sequenced. The detergent-solubilized complex oxidizes caldariella quinol at high rates and is completely inhibited by cyanide and by quinolone analogs, potent inhibitors of quinol oxidases. It is composed of at least five different subunits of 64.9, 38, 20.4, 18.8, and 7.2 kDa; their genes are located in two different operons. doxB, the gene for subunit I, is located together with doxC and two additional small open reading frames (doxE and doxF) in an operon with a complex transcription pattern. Two other genes of the oxidase complex (doxD and doxA) are located in a different operon and are cotranscribed into a common 1.2-kb mRNA. Both operons exist in duplicate on the genome of A. ambivalens. Only subunit I exhibits clear homology to other members of the superfamily of respiratory heme-copper oxidases; however, it reveals 14 transmembrane helices. In contrast, the composition of the accessory proteins is highly unusual; none is homologous to any known accessory protein of cytochrome oxidases, nor do homologs exist in the databases. DoxA is classified as a subunit II equivalent only by analogy of molecular size and hydrophobicity pattern to corresponding polypeptides of other oxidases. Multiple alignments and phylogenetic analysis of the heme-bearing subunit I (DoxB) locate this oxidase at the bottom of the phylogenetic tree, in the branch of heme-copper oxidases recently suggested to be incapable of superstoichiometric proton pumping. This finding is corroborated by lack of the essential amino acid residues delineating the putative H+-pumping channel. It is therefore concluded that A. ambivalens copes with its strongly acidic environment simply by an extreme turnover of its terminal oxidase, generating a proton gradient only by chemical charge separation. PMID:9023221

  16. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  17. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-03-08

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx.

  18. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.

    PubMed

    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V

    1998-10-01

    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  19. Differential Expression of Alternative Oxidase Genes in Soybean Cotyledons during Postgerminative Development1

    PubMed Central

    McCabe, Tulene C.; Finnegan, Patrick M.; Harvey Millar, A.; Day, David A.; Whelan, James

    1998-01-01

    The expression of the alternative oxidase (AOX) was investigated during cotyledon development in soybean (Glycine max [L.] Merr.) seedlings. The total amount of AOX protein increased throughout development, not just in earlier stages as previously thought, and was correlated with the increase in capacity of the alternative pathway. Each AOX isoform (AOX1, AOX2, and AOX3) showed a different developmental trend in mRNA abundance, such that the increase in AOX protein and capacity appears to involve a shift in gene expression from AOX2 to AOX3. As the cotyledons aged, the size of the mitochondrial ubiquinone pool decreased. We discuss how this and other factors may affect the alternative pathway activity that results from the developmental regulation of AOX expression. PMID:9765553

  20. Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

    PubMed

    Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

    2017-01-23

    The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

  1. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  2. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    USDA-ARS?s Scientific Manuscript database

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  3. Characterization of Aldehyde Oxidase (AO) Genes Involved in the Accumulation of Carotenoid Pigments in Wheat Grain

    PubMed Central

    Colasuonno, Pasqualina; Marcotuli, Ilaria; Lozito, Maria L.; Simeone, Rosanna; Blanco, Antonio; Gadaleta, Agata

    2017-01-01

    Aldehyde Oxidase (AO) enzyme (EC 1.2.3.1) catalyzes the final steps of carotenoid catabolism and it is a key enzyme in the abscisic acid (ABA) biosynthesis. AO isoforms are located in the cytosolic compartment of tissues in many plants, where induce the oxidation of aldehydes into carboxylic acid, and in addition, catalyze the hydroxylation of some heterocycles. The goal of the present study was to characterize the AO genes involved in the accumulation of carotenoid pigments in wheat grain, an important quantitative trait controlled by multiple genes. The cDNAs corresponding to the four AO isoforms from Arabidopsis thaliana and five AO isoforms from Brachypodium distachyon were used as query in 454 sequence assemblies data for Triticum aestivum cv. Chinese Spring (https://urgi.versailles.inra.fr/blast/blast.php) to obtain the partial or whole orthologous wheat AO sequences. Three wheat isoforms, designated AO1, AO2, and AO3 were located on the chromosome groups 2, 5, and 7, respectively, and mapped on two consensus wheat maps by SNP markers located within the AO gene sequences. To validate the possible relationships between AO3 genes and carotenoid accumulation in wheat, the expression levels of AO-A3 and AO-B3 gene were determined during the kernel maturation stage of two durum wheat cultivars, Ciccio and Svevo, characterized by a low and high carotenoid content, respectively. Different AO-A3 gene expression values were observed between the two cultivars indicating that the AO-A3 allele present in Ciccio was more active in carotenoid degradation. A gene marker was developed and can be used for marker-assisted selection in wheat breeding programs. PMID:28596779

  4. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  5. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana.

    PubMed

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-09-26

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were 'catalytic activity' (1327, 56.4%), 'heme binding' (65, 2.76%), 'tetrapyrrole binding' (66, 2.81%), and 'oxidoreductase activity' (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis.

  6. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong

    2016-01-01

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  7. Immunologic evidence that the gene for L-gulono-gamma-lactone oxidase is not expressed in animals subject to scurvy.

    PubMed Central

    Nishikimi, M; Udenfriend, S

    1976-01-01

    L-Gulono-gamma-lactone oxidase (L-gulono-gamma-lactone:oxygen 2-oxidoreductase, EC 1.1.3.8) is the enzyme that catalyzes the terminal step of L-ascorbic acid biosynthesis in mammalian liver. The absence of the oxidase activity in primates and guinea pigs is the reason why these animals are subject to scurvy, which must be considered an inborn error of metabolism. Attempts were made to determine if a protein immunologically crossreactive with L-gulono-gamma-lactone oxidase is present in these animals. Detergent-solubilized microsomal preparations from guinea pig and African green monkey liver did not precipitate the antisera directed to either rat or goat enzyme, nor did any of the other cell fractions obtained from guinea pig liver react with either antiserum. No crossreactive protein was detectable in guinea pig microsomes even with the sensitive procedure or micro-complement fixation. On the other hand, extracts of all 10 other mammalian (4 orders) liver microsomes tested were shown to contain L-gulono-gamma-lactone oxidase activity that did crossreact with antibodies to the rat and goat enzymes. One explanation of these findings is that, in the guinea pig, and perhaps in primates too, the structural gene for L-gulono-gamma-lactone oxidase is not expressed. Images PMID:819930

  8. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Treesearch

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  9. The ETS Family Transcription Factor ELK-1 Regulates Induction of the Cell Cycle-regulatory Gene p21Waf1/Cip1 and the BAX Gene in Sodium Arsenite-exposed Human Keratinocyte HaCaT Cells*

    PubMed Central

    Shin, Soon Young; Kim, Chang Gun; Lim, Yoongho; Lee, Young Han

    2011-01-01

    Cyclin-dependent kinase inhibitor (CDKN1A), often referred to as p21Waf1/Cip1 (p21), is induced by a variety of environmental stresses. Transcription factor ELK-1 is a member of the ETS oncogene superfamily. Here, we show that ELK-1 directly trans-activates the p21 gene, independently of p53 and EGR-1, in sodium arsenite (NaASO2)-exposed HaCaT cells. Promoter deletion analysis and site-directed mutagenesis identified the presence of an ELK-1-binding core motif between −190 and −170 bp of the p21 promoter that confers inducibility by NaASO2. Chromatin immunoprecipitation and electrophoretic mobility shift analyses confirmed the specific binding of ELK-1 to its putative binding sequence within the p21 promoter. In addition, NaASO2-induced p21 promoter activity was enhanced by exogenous expression of ELK-1 and reduced by expression of siRNA targeted to ELK-1 mRNA. The importance of ELK-1 in response to NaASO2 was further confirmed by the observation that stable expression of ELK-1 siRNA in HaCaT cells resulted in the attenuation of NaASO2-induced p21 expression. Although ELK-1 was activated by ERK, JNK, and p38 MAPK in response to NaASO2, ELK-1-mediated activation of the p21 promoter was largely dependent on ERK. In addition, EGR-1 induced by ELK-1 seemed to be involved in NaASO2-induced expression of BAX. This supports the view that the ERK/ELK-1 cascade is involved in p53-independent induction of p21 and BAX gene expression. PMID:21642427

  10. The ETS family transcription factor ELK-1 regulates induction of the cell cycle-regulatory gene p21(Waf1/Cip1) and the BAX gene in sodium arsenite-exposed human keratinocyte HaCaT cells.

    PubMed

    Shin, Soon Young; Kim, Chang Gun; Lim, Yoongho; Lee, Young Han

    2011-07-29

    Cyclin-dependent kinase inhibitor (CDKN1A), often referred to as p21(Waf1/Cip1) (p21), is induced by a variety of environmental stresses. Transcription factor ELK-1 is a member of the ETS oncogene superfamily. Here, we show that ELK-1 directly trans-activates the p21 gene, independently of p53 and EGR-1, in sodium arsenite (NaASO(2))-exposed HaCaT cells. Promoter deletion analysis and site-directed mutagenesis identified the presence of an ELK-1-binding core motif between -190 and -170 bp of the p21 promoter that confers inducibility by NaASO(2). Chromatin immunoprecipitation and electrophoretic mobility shift analyses confirmed the specific binding of ELK-1 to its putative binding sequence within the p21 promoter. In addition, NaASO(2)-induced p21 promoter activity was enhanced by exogenous expression of ELK-1 and reduced by expression of siRNA targeted to ELK-1 mRNA. The importance of ELK-1 in response to NaASO(2) was further confirmed by the observation that stable expression of ELK-1 siRNA in HaCaT cells resulted in the attenuation of NaASO(2)-induced p21 expression. Although ELK-1 was activated by ERK, JNK, and p38 MAPK in response to NaASO(2), ELK-1-mediated activation of the p21 promoter was largely dependent on ERK. In addition, EGR-1 induced by ELK-1 seemed to be involved in NaASO(2)-induced expression of BAX. This supports the view that the ERK/ELK-1 cascade is involved in p53-independent induction of p21 and BAX gene expression.

  11. A bioluminescent arsenite biosensor designed for inline water analyzer.

    PubMed

    Prévéral, Sandra; Brutesco, Catherine; Descamps, Elodie C T; Escoffier, Camille; Pignol, David; Ginet, Nicolas; Garcia, Daniel

    2017-01-01

    Whole-cell biosensors based on the reporter gene system can offer rapid detection of trace levels of organic or metallic compounds in water. They are well characterized in laboratory conditions, but their transfer into technological devices for the surveillance of water networks remains at a conceptual level. The development of a semi-autonomous inline water analyzer stumbles across the conservation of the bacterial biosensors over a period of time compatible with the autonomy requested by the end-user while maintaining a satisfactory sensitivity, specificity, and time response. We focused here on assessing the effect of lyophilization on two biosensors based on the reporter gene system and hosted in Escherichia coli. The reporter gene used here is the entire bacterial luciferase lux operon (luxCDABE) for an autonomous bioluminescence emission without the need to add any substrate. In the cell-survival biosensor that is used to determine the overall fitness of the bacteria when mixed with the water sample, lux expression is driven by a constitutive E. coli promoter PrpoD. In the arsenite biosensor, the arsenite-inducible promoter P ars involved in arsenite resistance in E. coli controls lux expression. Evaluation of the shelf life of these lyophilized biosensors kept at 4 °C over a year evidenced that about 40 % of the lyophilized cells can be revived in such storage conditions. The performances of the lyophilized biosensor after 7 months in storage are maintained, with a detection limit of 0.2 μM arsenite for a response in about an hour with good reproducibility. These results pave the way to the use in tandem of both biosensors (one for general toxicity and one for arsenite contamination) as consumables of an autonomous analyzer in the field.

  12. Monoamine oxidase A gene DNA hypomethylation - a risk factor for panic disorder?

    PubMed

    Domschke, Katharina; Tidow, Nicola; Kuithan, Henriette; Schwarte, Kathrin; Klauke, Benedikt; Ambrée, Oliver; Reif, Andreas; Schmidt, Hartmut; Arolt, Volker; Kersting, Anette; Zwanzger, Peter; Deckert, Jürgen

    2012-10-01

    The monoamine oxidase A (MAOA) gene has been suggested as a prime candidate in the pathogenesis of panic disorder. In the present study, DNA methylation patterns in the MAOA regulatory and exon 1/intron 1 region were investigated for association with panic disorder with particular attention to possible effects of gender and environmental factors. Sixty-five patients with panic disorder (44 females, 21 males) and 65 healthy controls were analysed for DNA methylation status at 42 MAOA CpG sites via direct sequencing of sodium bisulfate treated DNA extracted from blood cells. The occurrence of recent positive and negative life events was ascertained. Male subjects showed no or only very minor methylation with some evidence for relative hypomethylation at one CpG site in intron 1 in patients compared to controls. Female patients exhibited significantly lower methylation than healthy controls at 10 MAOA CpG sites in the promoter as well as in exon/intron 1, with significance surviving correction for multiple testing at four CpG sites (p≤0.001). Furthermore, in female subjects the occurrence of negative life events was associated with relatively decreased methylation, while positive life events were associated with increased methylation. The present pilot data suggest a potential role of MAOA gene hypomethylation in the pathogenesis of panic disorder particularly in female patients, possibly mediating a detrimental influence of negative life events. Future studies are warranted to replicate the present finding in independent samples, preferably in a longitudinal design.

  13. Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.

    PubMed

    Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

    2014-01-01

    The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree.

  14. Molecular cloning and expression analysis of duplicated polyphenol oxidase genes reveal their functional differentiations in sorghum.

    PubMed

    Yan, Song; Li, Sujuan; Zhai, Guowei; Lu, Ping; Deng, Hui; Zhu, Shan; Huang, Renliang; Shao, Jianfeng; Tao, Yuezhi; Zou, Guihua

    2017-10-01

    Polyphenol oxidase (PPO) is believed to play a role in plant growth, reproduction, and resistance to pathogens and pests. PPO causes browning of grains in cereals. In this study, genetic mapping of sorghum grain for phenol color reaction (PHR) was performed using a recombinant inbred line population. Only one locus was detected between SSR markers SM06072 and Xtxp176 on chromosome 6. Two linked orthologous genes (Sb06PPO1 and Sb06PPO2) within the mapped region were discovered and cloned. Transformation experiments using Nipponbare (a PHR negative rice cultivar) showed that Sb06PPO1 from LTR108 and two Sb06PPO2 alleles from both varieties could complement Nipponbare, whereas Sb06PPO1 from 654 could not. Subsequent quantitative real-time PCR (qPCR) experiments showed that Sb06PPO1 and Sb06PPO2 functioned diversely, Sb06PPO1 was mainly expressed in young panicles before flowering. Sb06PPO2 was strongly expressed in flowering panicles, especially in hulls and branches at filling stage. Moreover, the expression of Sb06PPO1 was found to be significantly up-regulated by exogenous ABA and salt, whereas Sb06PPO2 was not changed significantly, further demonstrating functional differentiation between the two genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    PubMed

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  16. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  17. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  18. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  19. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  20. The ADMA/DDAH/NO pathway in human vein endothelial cells exposed to arsenite.

    PubMed

    Osorio-Yáñez, Citlalli; Chin-Chan, Miguel; Sánchez-Peña, Luz C; Atzatzi-Aguilar, Octavio G; Olivares-Reyes, Jesus A; Segovia, José; Del Razo, Luz M

    2017-08-01

    Inorganic arsenic (iAs) exposure is related to cardiovascular disease, which is characterized by endothelial dysfunction and nitric oxide (NO) depletion. The mechanisms underlying NO depletion as related to iAs exposure are not fully understood. The endogenous inhibitor of nitric oxide synthase, asymmetric dimethylarginine (ADMA), might be a molecular target of iAs. ADMA concentrations are regulated by proteins involved in its synthesis (arginine methyl transferase 1 [PRMT-1]) and degradation (dimethylarginine dimethylaminohydrolase [DDAH]). Both, ADMA and NO are susceptible to oxidative stress. We aimed to determine the ADMA/DDAH/NO pathway in human vein endothelial cells (HUVEC-CS) exposed to arsenite. We exposed HUVEC-CS cells to 1, 2.5 and 5μM of arsenite for 24h. We proved that arsenite at 5μM was able to decrease NO levels with an associated increase in ADMA and depletion of l-arginine in HUVEC-CS cells. We also found a decrease in DDAH-1 protein expression with 5μM of arsenite compared to the control group. However, we did not observe significant differences in PRMT-1 protein expression at any of the concentrations of arsenite employed. Finally, arsenite (2.5 and 5μM) increased NADPH oxidase 4 protein levels compared with the control group. We conclude that ADMA, l-arginine and DDAH are involved in NO depletion produced by arsenite, and that the mechanism is related to oxidative stress. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  2. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  4. A Novel Association between Lysyl Oxidase Gene Polymorphism and Intracranial Aneurysm in Koreans.

    PubMed

    Hong, Eun Pyo; Jeon, Jin Pyeong; Kim, Sung Eun; Yang, Jin Seo; Choi, Hyuk Jai; Kang, Suk Hyung; Cho, Yong Jun

    2017-09-01

    Lysyl oxidase (LOX) controls the cross-linking and maturation of elastin and collagen fibers. In this study, we investigated the association between LOX gene polymorphisms and intracranial aneurysm (IA) formation in a homogeneous Korean population. This cross-sectional study involved 80 age-sex matched patients with IA and controls. Fisher's exact test was performed to analyze allelic associations between ten single nucleotide polymorphisms (SNPs) and IA, including 41 ruptured and 39 unruptured cases. Haplotype-specific associations were analyzed using the omnibus test estimating asymptotic chi-square statistics. Of ten SNPs, three SNPs (rs2303656, rs3900446, and rs763497) were significantly associated with IA (p<0.01). The C allele of rs3900446 was significantly related to increased IA risk with a significant threshold [odds ratio (OR)=20.15, p=4.8×10⁻⁵]. Meanwhile, the A allele of rs2303656 showed a preventive effect against IA formation (p=8.2×10⁻⁴). Seventeen of 247 haplotype structures showed a suggestive association with IA (asymptotic p<0.001). Of ten SNP haplotype combinations, the CG combination of rs3900446 and rs763497 reached Bonferroni-adjusted significant threshold in IA patients (minor haplotype frequency=0.113, asymptotic p=1.3×10⁻⁵). However, there was no association between aneurysm rupture and the LOX gene. This preliminary study indicated that LOX gene polymorphisms, such as rs2303656, rs3900446, and rs763497, may play crucial roles in IA formation in the Korean population. Our novel findings need to be validated in a large-scale independent population.

  5. The gene encoding cytochrome-c oxidase subunit I from Synechocystis PCC6803.

    PubMed

    Alge, D; Schmetterer, G; Peschek, G A

    1994-01-28

    The gene (coxI or CoxA) encoding subunit I (COI) of cytochrome-c oxidase (cytochrome aa3) of Synechocystis PCC6803, Synechococcus PCC7942 (Anacystis nidulans R2) and Nostoc PCC8002 (Nostoc Mac), was identified by heterologous hybridization of chromosomal digests with a 17-bp oligodeoxyribonucleotide (probe C) derived from the coxI of Paracoccus denitrificans. A single genomic fragment was found to bind to probe C in all chromosomal digests. Due to its favorable signal-to-noise ratio, the genome of Synechocystis was chosen for the isolation and sequencing of this gene. A genomic DNA library in pUC18 was screened with probe C. The two probe C-positive plasmids, pDAUV1 and pDAUV2, contained a 1-kb overlapping region, with the conserved 17-bp sequence encoding the CuB-binding region of the COI polypeptide. These plasmids were subcloned into competent Escherichia coli DH5 alpha cells, and the nucleotide sequences were determined. The deduced amino acid (aa) sequences of Synechocystis COI and homologous proteins from a variety of prokaryotic and eukaryotic organisms showed an overall similarity of between 38.6 and 45.8%. Hydropathy plots revealed 12 potential transmembrane helices. All of the six histidines needed for the binding of heme a and the heme a3/CuB bimetallic center are present in the expected positions of the Synechocystis COI protein (533 aa, M(r) 59,390). A monospecific antibody raised against P. denitrificans COI gave an unequivocal immunological cross-reaction on Western blots of membrane preparations from Synechocystis, Anacystis and Nostoc, showing that the product of gene coxI is indeed synthesized and incorporated into cyanobacterial membranes.

  6. The ccoNOQP gene cluster codes for a cb-type cytochrome oxidase that functions in aerobic respiration of Rhodobacter capsulatus.

    PubMed

    Thöny-Meyer, L; Beck, C; Preisig, O; Hennecke, H

    1994-11-01

    The genes for a new type of a haem-copper cytochrome oxidase were cloned from Rhodobacter capsulatus strain 37b4, using the Bradyrhizobium japonicum fixNOQP gene region as a hybridizing probe. Four genes, probably organized in an operon (ccoNOQP), were identified; their products share extensive amino acid sequence similarity with the FixN, O, Q and P proteins that have recently been shown to be the subunits of a cb-type oxidase. CcoN is a b-type cytochrome, CcoO and CcoP are membrane-bound mono- and dihaem c-type cytochromes and CcoQ is a small membrane protein of unknown function. Genes for a similar oxidase are also present in other non-rhizobial bacterial species such as Azotobacter vinelandii, Agrobacterium tumefaciens and Pseudomonas aeruginosa, as revealed by polymerase chain reaction analysis. A ccoN mutant was constructed whose phenotype, in combination with the structural information on the gene products, provides evidence that the CcoNOQP oxidase is a cytochrome c oxidase of the cb type, which supports aerobic respiration in R. capsulatus and which is probably identical to the cbb3-type oxidase that was recently purified from a different strain of the same species. Mutant analysis also showed that this oxidase has no influence on photosynthetic growth and nitrogen-fixation activity.

  7. Arsenite exposure accelerates aging process regulated by the transcription factor DAF-16/FOXO in Caenorhabditis elegans.

    PubMed

    Yu, Chan-Wei; How, Chun Ming; Liao, Vivian Hsiu-Chuan

    2016-05-01

    Arsenic is a known human carcinogen and high levels of arsenic contamination in food, soils, water, and air are of toxicology concerns. Nowadays, arsenic is still a contaminant of emerging interest, yet the effects of arsenic on aging process have received little attention. In this study, we investigated the effects and the underlying mechanisms of chronic arsenite exposure on the aging process in Caenorhabditis elegans. The results showed that prolonged arsenite exposure caused significantly decreased lifespan compared to non-exposed ones. In addition, arsenite exposure (100 μM) caused significant changes of age-dependent biomarkers, including a decrease of defecation frequency, accumulations of intestinal lipofuscin and lipid peroxidation in an age-dependent manner in C. elegans. Further evidence revealed that intracellular reactive oxygen species (ROS) level was significantly increased in an age-dependent manner upon 100 μM arsenite exposure. Moreover, the mRNA levels of transcriptional makers of aging (hsp-16.1, hsp-16.49, and hsp-70) were increased in aged worms under arsenite exposure (100 μM). Finally, we showed that daf-16 mutant worms were more sensitive to arsenite exposure (100 μM) on lifespan and failed to induce the expression of its target gene sod-3 in aged daf-16 mutant under arsenite exposure (100 μM). Our study demonstrated that chronic arsenite exposure resulted in accelerated aging process in C. elegans. The overproduction of intracellular ROS and the transcription factor DAF-16/FOXO play roles in mediating the accelerated aging process by arsenite exposure in C. elegans. This study implicates a potential ecotoxicological and health risk of arsenic in the environment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Mutations in the Arabidopsis gene IMMUTANS cause a variegated phenotype by inactivating a chloroplast terminal oxidase associated with phytoene desaturation.

    PubMed Central

    Carol, P; Stevenson, D; Bisanz, C; Breitenbach, J; Sandmann, G; Mache, R; Coupland, G; Kuntz, M

    1999-01-01

    The immutans (im) mutant of Arabidopsis shows a variegated phenotype comprising albino and green somatic sectors. We have cloned the IM gene by transposon tagging and show that even stable null alleles give rise to a variegated phenotype. The gene product has amino acid similarity to the mitochondrial alternative oxidase. We show that the IM protein is synthesized as a precursor polypeptide that is imported into chloroplasts and inserted into the thylakoid membrane. The albino sectors of im plants contain reduced levels of carotenoids and increased levels of the carotenoid precursor phytoene. The data presented here are consistent with a role for the IM protein as a cofactor for carotenoid desaturation. The suggested terminal oxidase function of IM appears to be essential to prevent photooxidative damage during early steps of chloroplast formation. We propose a model in which IM function is linked to phytoene desaturation and, possibly, to the respiratory activity of the chloroplast. PMID:9878632

  9. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date.

  10. Gene expression and distribution of antibacterial L-amino acid oxidase in the rockfish Sebastes schlegeli.

    PubMed

    Kitani, Yoichiro; Mori, Tsukasa; Nagai, Hiroshi; Toyooka, Keiko; Ishizaki, Shoichiro; Shimakura, Kuniyoshi; Shiomi, Kazuo; Nagashima, Yuji

    2007-12-01

    Antibacterial factors in the epidermal mucus of fish have a potential importance in the first line of the host defense response to bacterial pathogens. We previously isolated a novel antibacterial protein termed SSAP (Sebastes schlegeli antibacterial protein) from the skin mucus of the rockfish S. schlegeli and identified it as a new member of the L-amino acid oxidase (LAO) family. In the present study, the localization of SSAP in S. schlegeli was investigated by reverse transcription (RT)-PCR, quantitative real time RT-PCR, Western blotting and measurements of LAO and antibacterial activities. SSAP mRNA was expressed dominantly in skin and gill and weakly in ovary or kidney as shown by RT-PCR and real time RT-PCR. The quantity of SSAP mRNA in skin varied among the individuals, ranging from 1.1 to 13.9 ng microg(-1) total RNA, although no relationship was found between the size of fish and gene expression. SSAP was exclusively detected in skin and gill by Western blotting using a specific anti-SSAP antiserum. In addition, the extracts of both tissues apparently showed LAO activity and antibacterial activity against Photobacterium damselae subsp. piscicida. This study demonstrates that SSAP is predominantly synthesized in skin and gill and probably functions as an antibacterial LAO in both tissues.

  11. Eggplant (Solanum melongena L.) polyphenol oxidase multi-gene family: a phylogenetic evaluation.

    PubMed

    Jukanti, Aravind Kumar; Bhatt, Ramakrishna

    2015-02-01

    Polyphenol oxidases (PPOs) in different Solanum species including eggplant have been studied. PPOs have been implicated in undesirable enzymatic browning of eggplant fruit and also in plant defense. The main objective of this study was to identify and accelerate the further functional characterization of additional eggplant PPOs that are involved in food biochemistry and defense-related functions. Eggplant PPOs identified earlier were used in "Basic local alignment search tool (BLAST)" search against expressed sequence tag and nucleotide databases. We have identified seven additional sequences which were almost complete in length. The sequences of the PPOs were aligned and their phylogenetic and evolutionary relationships established. The sequences are quite diverse, broadly falling into two major clusters; three PPOs form a separate branch/minor cluster. The thirteen sequences had conserved copper A binding sites but copper B binding sites differed considerably in two new PPO sequences (AFJ79642 and ACR61398). A third conserved 'Histidine-rich' region has been identified at the 'C' terminus of the eggplant PPOs. In addition, all the seven new PPOs exhibited at least one glycosylated sequon in the mature PPO sequence. Identification of additional PPO genes will further help in functional and biological characterization of these PPOs.

  12. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand.

  13. Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

    PubMed

    Makarevitch, Irina; Thompson, Addie; Muehlbauer, Gary J; Springer, Nathan M

    2012-01-01

    The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system.

  14. [Cloning and bioinformatics analysis of ent-kaurene oxidase synthase gene in Salvia miltiorrhiza].

    PubMed

    Hu, Ya-ting; Gao, Wei; Liu, Yu-jia; Cheng, Qi-qing; Su, Ping; Liu, Yu-zhong; Chen, Min

    2014-11-01

    Based on the transcriptome database of Salvia miltiorrhiza, specific primers were designed to clone a full-length cDNA of ent-kaurene oxidase synthase (SmKOL) using the RACE strategy. ORF Finder was used to find the open reading frame of SmKOL cDNA, and ClustalW has been performed to analysis the multiple amino acid sequence alignment. Phylogenetic tree has been constructed using MEGA 5.1. The transcription level of SmKOL from the hairy roots induced by elicitor methyl jasmonate (MeJA) was qualifiedby real-time quantitative PCR. The full length of SmKOL cDNA was of 1 884 bp nucleotides encoding 519 amino acids. The molecular weight of the SmKOL protein was about 58.88 kDa with isoelectric point (pI) of 7.62. Results of real-time quantitative PCR analyses indicated that the level of SmKOL mRNA expression in hairy roots was increased by elicitor oMeJA, and reached maximum in 36 h. The full-length cDNA of SmKOL was cloned from S. miltiorrhiza hairy root, which provides a target gene for further studies of its function, gibberellin biosynthesis and regulation of secondary metabolites.

  15. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  16. The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes

    PubMed Central

    2011-01-01

    Background Many filamentous fungal genomes contain complex groups of multicopper oxidase (MCO) coding genes that makes them a good source for new laccases with potential biotechnological interest. A bioinformatics analysis of the Aspergillus niger ATCC 1015 genome resulted in the identification of thirteen MCO genes. Ten of them were cloned and homologously overexpressed. Results A bioinformatic analysis of the A. niger ATCC 1015 genome revealed the presence of 13 MCO genes belonging to three different subfamilies on the basis of their phylogenetic relationships: ascomycete laccases, fungal pigment MCOs and fungal ferroxidases. According to in silico amino acid sequence analysis, the putative genes encoding for functional extracellular laccases (mcoA, mcoB, mcoC, mcoD, mcoE, mcoF, mcoG, mcoI, mcoJ and mcoM) were placed under the control of the glaA promoter and overexpressed in A. niger N593. Enzyme activity plate assays with several common laccase substrates showed that all genes are actually expressed and code for active MCOs. Interestingly, expressed enzymes show different substrate specificities. In addition, optimization of fungal pigment MCOs extracellular production was investigated. The performance of the widely used glucoamylase signal sequence (ssGlaA) in McoA secretion was studied. Results obtained suggest that ssGlaA do not yield higher levels of secreted McoA when compared to its native secretion signal. Also, McoB synthesis was investigated using different nitrogen sources in minimal medium liquid cultures. Higher yields of extracellular McoB were achieved with (NH4)2 tartrate. Conclusions Aspergillus niger is a good source of new laccases. The different substrate specificity observed in plate assays makes them interesting to be purified and biochemically compared. The homologous signal sequence of McoA has been shown to be a good choice for its extracellular overexpression. From the nitrogen sources tested (NH4)2 tartrate has been found to be the

  17. Molecular evolution at the cytochrome oxidase subunit 2 gene among divergent populations of the intertidal copepod, Tigriopus californicus.

    PubMed

    Rawson, Paul D; Burton, Ronald S

    2006-06-01

    The cytochrome c oxidase subunit 2 gene (COII) encodes a highly conserved protein that is directly responsible for the initial transfer of electrons from cytochrome c to cytochrome c oxidase (COX) crucial to the production of ATP during cellular respiration. Despite its integral role in electron transport, we have observed extensive intraspecific nucleotide and amino acid variation among 26 full-length COII sequences sampled from seven populations of the marine copepod, Tigriopus californicus. Although intrapopulation divergence was virtually nonexistent, interpopulation divergence at the COII locus was nearly 20% at the nucleotide level, including 38 nonsynonymous substitutions. Given the high degree of interaction between the cytochrome c oxidase subunit 2 protein (COX2) and the nuclear-encoded subunits of COX and cytochrome c (CYC), we hypothesized that some codons in the COII gene are likely to be under positive selection in order to compensate for amino acid substitutions in other subunits. Estimates of the ratio of nonsynonymous to synonymous substitution (omega), obtained using a series of maximum likelihood models of codon substitution, indicated that the majority of codons in T. californicus COII are under strong purifying selection (omega < 1), while approximately 4% of the sites in this gene appear to evolve under relaxed selective constraint (omega = 1). A branch-site maximum likelihood model identified three sites that may have experienced positive selection within the central California sequence clade in our COII phylogeny; these results are consistent with previous studies showing functional and fitness consequences among interpopulation hybrids between central and northern California populations.

  18. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  19. Cytochrome o (cyoABCDE) and d (cydAB) oxidase gene expression in Escherichia coli is regulated by oxygen, pH, and the fnr gene product

    SciTech Connect

    Cotter, P.A.; Gunsalus, R.P. ); Chepuri, V.; Gennis, R.B. )

    1990-11-01

    The aerobic respiratory chain of Escherichia coli contains two terminal oxidases that catalyze the oxidation of ubiquinol-8 and the reduction of oxygen to water. They are the cytochrome o oxidase complex encoded by cyoABCDE and the cytochrome d oxidase complex encoded by cydAB. To determine how these genes are regulated in response to a variety of environmental stimuli, including oxygen, we examined their expression by using lacZ protein fusions in wild-type and fnr mutant strains of E. coli. Based on the pattern of anaerobic cydAB expression observed, we propose the existence of a second, as yet unidentified, regulatory element that must function either to activate cydAB expression as oxygen becomes limiting or to repress cydAB expression aerobically. Whereas cytochrome o oxidase encoded by cyoABCDE appears to be produced only under oxygen-rich growth conditions, in keeping with its biochemical properties, cytochrome d oxidase is expressed moderately aerobically and is elevated yet further when oxygen becomes limiting so that the organism can cope better under oxygen starvation conditions. We also examined cyoABCDE and cydAB expression in response to growth on alternative carbon compounds and to changes in the culture medium pH and osmolarity.

  20. Altered Hepatic Transport by Fetal Arsenite Exposure in Diet-Induced Fatty Liver Disease.

    PubMed

    Ditzel, Eric J; Li, Hui; Foy, Caroline E; Perrera, Alec B; Parker, Patricia; Renquist, Benjamin J; Cherrington, Nathan J; Camenisch, Todd D

    2016-07-01

    Non-alcoholic fatty liver disease can result in changes to drug metabolism and disposition potentiating adverse drug reactions. Furthermore, arsenite exposure during development compounds the severity of diet-induced fatty liver disease. This study examines the effects of arsenite potentiated diet-induced fatty liver disease on hepatic transport in male mice. Changes were detected for Mrp2/3/4 hepatic transporter gene expression as well as for Oatp1a4/2b1/1b2. Plasma concentrations of Mrp and Oatp substrates were increased in arsenic exposure groups compared with diet-only controls. In addition, murine embryonic hepatocytes and adult primary hepatocytes show significantly altered transporter expression after exposure to arsenite alone: a previously unreported phenomenon. These data indicate that developmental exposure to arsenite leads to changes in hepatic transport which could increase the risk for ADRs during fatty liver disease.

  1. Expression of the Aspergillus niger glucose oxidase gene in Saccharomyces cerevisiae and its potential applications in wine production.

    PubMed

    Malherbe, D F; du Toit, M; Cordero Otero, R R; van Rensburg, P; Pretorius, I S

    2003-06-01

    There is a growing consumer demand for wines containing lower levels of alcohol and chemical preservatives. The objectives of this study were to express the Aspergillus niger gene encoding a glucose oxidase (GOX; beta- d-glucose:oxygen oxidoreductase, EC 1.1.3.4) in Saccharomyces cerevisiae and to evaluate the transformants for lower alcohol production and inhibition of wine spoilage organisms, such as acetic acid bacteria and lactic acid bacteria, during fermentation. The A. niger structural glucose oxidase (gox) gene was cloned into an integration vector (YIp5) containing the yeast mating pheromone alpha-factor secretion signal (MFalpha1(S)) and the phosphoglycerate-kinase-1 gene promoter (PGK1(P)) and terminator (PGK1(T)). The PGK1(P)- MFalpha1(S)- gox- PGK1(T) cassette (designated GOX1) was introduced into a laboratory strain (Sigma1278) of S. cerevisiae. Yeast transformants were analysed for the production of biologically active glucose oxidase on selective agar plates and in liquid assays. The results indicated that the recombinant glucose oxidase was active and was produced beginning early in the exponential growth phase, leading to a stable level in the stationary phase. The yeast transformants also displayed antimicrobial activity in a plate assay against lactic acid bacteria and acetic acid bacteria. This might be explained by the fact that a final product of the GOX enzymatic reaction is hydrogen peroxide, a known antimicrobial agent. Microvinification with the laboratory yeast transformants resulted in wines containing 1.8-2.0% less alcohol. This was probably due to the production of d-glucono-delta-lactone and gluconic acid from glucose by GOX. These results pave the way for the development of wine yeast starter culture strains for the production of wine with reduced levels of chemical preservatives and alcohol.

  2. Evidence for the possible existence of a remnant L-gulono-gamma-lactone oxidase (GULO) gene in a teleost genome.

    PubMed

    Ocalewicz, Konrad; Dabrowski, Konrad; Mambrini, Muriel

    2010-01-01

    DNA fragments related to the cloudy catshark Scyliorhinus torazame L-gulono-gamma-lactone oxidase (GULO) cDNA were detected in a distant fish species. Although the Southern hybridization pattern was more distinct in species with active GULO, DNA fragments related to the GULO gene were also discovered in the common carp Cyprinus carpio. Additionally, in the common carp, inter-individual variation of the hybridization pattern was observed. Regular screening of available teleost fish gene libraries did not reveal GULO related DNA sequences.

  3. Quantitative GFP fluorescence as an indicator of arsenite developmental toxicity in mosaic heat shock protein 70 transgenic zebrafish

    SciTech Connect

    Seok, Seung-Hyeok; Baek, Min-Won; Lee, Hui-Young; Kim, Dong-Jae; Na, Yi-Rang; Noh, Kyoung-Jin; Park, Sung-Hoon; Lee, Hyun-Kyoung; Lee, Byoung-Hee; Ryu, Doug-Young; Park, Jae-Hak

    2007-12-01

    In transgenic zebrafish (Danio rerio), green fluorescent protein (GFP) is a promising marker for environmental pollutants. In using GFP, one of the obstacles which we faced was how to compare toxicity among different toxicants or among a specific toxicant in different model species with the intensity of GFP expression. Using a fluorescence detection method, we first validated our method for estimating the amount of GFP fluorescence present in transgenic fish, which we used as an indicator of developmental toxicity caused by the well-known toxicant, arsenite. To this end, we developed mosaic transgenic zebrafish with the human heat shock response element (HSE) fused to the enhanced GFP (EGFP) reporter gene to indicate exposure to arsenite. We confirmed that EGFP expression sites correlate with gross morphological disruption caused by arsenite exposure. Arsenite (300.0 {mu}M) caused stronger EGFP fluorescence intensity and quantity than 50.0 {mu}M and 10.0 {mu}M arsenite in our transgenic zebrafish. Furthermore, arsenite-induced apoptosis was demonstrated by TUNEL assay. Apoptosis was inhibited by the antioxidant, N-acetyl-cystein (NAC) in this transgenic zebrafish. The distribution of TUNEL-positive cells in embryonic tissues was correlated with the sites of arsenite toxicity and EGFP expression. The EGFP values quantified using the standard curve equation from the known GFP quantity were consistent with the arsenite-induced EGFP expression pattern and arsenite concentration, indicating that this technique can be a reliable and applicable measurement. In conclusion, we propose that fluorescence-based EGFP quantification in transgenic fish containing the hsp70 promoter-EGFP reporter-gene construct is a useful indicator of development toxicity caused by arsenite.

  4. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  5. Sorption of Arsenite onto Mackinawite Coated Sand

    NASA Astrophysics Data System (ADS)

    Gallegos, T. J.; Hayes, K. F.; Abriola, L. M.

    2004-05-01

    Arsenic contamination of groundwater is a widespread problem affecting aquifers in the United States as well as abroad. Recent strengthening of the US EPA MCL for arsenic has prompted the need for technology capable of removing both arsenite and arsenate from solution. Arsenite, the more toxic form of arsenic, is more difficult to remove from anoxic zones in the subsurface. Studies by others have demonstrated the affinity of some types of iron sulfides for arsenite, such as troilite, pyrite, amorphous iron sulfide and mackinawite. However, these studies have not provided a comprehensive investigation of the macroscopic behavior of arsenite in the presence of crystalline mackinawite in a form that can be readily applied to real-world treatment technologies. This study examines the behavior of arsenite in the presence of mackinawite coated sand. PH edge results demonstrate that arsenite sorption onto mackinawite coated sand increases with increasing pH, reaching maximum removal at pH 10. Arsenite removal, albeit slight, occurring below pH 5 is independent of pH indicative of a different removal mechanism. Isotherm studies show that at low concentrations, removal is Langmuirian in nature. Arsenite sorption abruptly converts to linear behavior at high concentrations, possibly attributed to the saturation of the monolayer. Ionic strength effects were assessed by comparing pH edge data developed for three different concentrations of NaCl background electrolyte solution. Increases in ionic strength enhance the removal of arsenite from solution, suggesting possible inner-sphere surface complexation removal mechanisms. Information gathered in this study can be used to further develop surface complexation models to describe and predict reactivity of arsenite in the presence of mackinawite coated sands in anoxic regions. Mackinawite coated sands investigated here may provide a feasible reactive medium for implementation in above-ground sorption reactors or subsurface

  6. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy.

    PubMed

    Bongers, Kale S; Fox, Daniel K; Kunkel, Steven D; Stebounova, Larissa V; Murry, Daryl J; Pufall, Miles A; Ebert, Scott M; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

    2015-01-15

    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy.

  7. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

    PubMed Central

    Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

    2014-01-01

    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

  8. Arsenite-induced autophagy is associated with proteotoxicity in human lymphoblastoid cells

    SciTech Connect

    Bolt, Alicia M.; Zhao, Fei; Pacheco, Samantha; Klimecki, Walter T.

    2012-10-15

    Epidemiological studies of arsenic-exposed populations have provided evidence that arsenic exposure in humans is associated with immunosuppression. Previously, we have reported that arsenite-induced toxicity is associated with the induction of autophagy in human lymphoblastoid cell lines (LCL). Autophagy is a cellular process that functions in the degradation of damaged cellular components, including protein aggregates formed by misfolded or damaged proteins. Accumulation of misfolded or damaged proteins in the endoplasmic reticulum (ER) lumen causes ER stress and activates the unfolded protein response (UPR). In an effort to investigate the mechanism of autophagy induction by arsenite in the LCL model, we examined the potential contribution of ER stress and activation of the UPR. LCL exposed to sodium arsenite for 8-days induced expression of UPR-activated genes, including CHOP and GRP78, at the RNA and the protein level. Evidence for activation of the three arms of the UPR was observed. The arsenite-induced activation of the UPR was associated with an accumulation of protein aggregates containing p62 and LC3, proteins with established roles in the sequestration and autophagic clearance of protein aggregates. Taken together, these data provide evidence that arsenite-induced autophagy is associated with the generation of ER stress, activation of the UPR, and formation of protein aggregates that may be targeted to the lysosome for degradation. -- Highlights: ► Arsenite induces endoplasmic reticulum stress and the unfolded protein response. ► Arsenite induces the formation of protein aggregates that contain p62 and LC3-II. ► Time-course data suggests that arsenite-induced autophagy precedes ER stress.

  9. Microbial arsenite oxidation with oxygen, nitrate, or an electrode as the sole electron acceptor.

    PubMed

    Nguyen, Van Khanh; Tran, Huong T; Park, Younghyun; Yu, Jaecheul; Lee, Taeho

    2017-02-09

    The purpose of this study was to identify bacteria that can perform As(III) oxidation for environmental bioremediation. Two bacterial strains, named JHS3 and JHW3, which can autotrophically oxidize As(III)-As(V) with oxygen as an electron acceptor, were isolated from soil and water samples collected in the vicinity of an arsenic-contaminated site. According to 16S ribosomal RNA sequence analysis, both strains belong to the ɤ-Proteobacteria class and share 99% sequence identity with previously described strains. JHS3 appears to be a new strain of the Acinetobacter genus, whereas JHW3 is likely to be a novel strain of the Klebsiella genus. Both strains possess the aioA gene encoding an arsenite oxidase and are capable of chemolithoautotrophic growth in the presence of As(III) up to 10 mM as a primary electron donor. Cell growth and As(III) oxidation rate of both strains were significantly enhanced during cultivation under heterotrophic conditions. Under anaerobic conditions, only strain JHW3 oxidized As(III) using nitrate or a solid-state electrode of a bioelectrochemical system as a terminal electron acceptor. Kinetic studies of As(III) oxidation under aerobic condition demonstrated a higher V max and K m from strain JHW3 than strain JHS3. This study indicated the potential application of strain JHW3 for remediation of subsurface environments contaminated with arsenic.

  10. Alternative splicing and differential expression of two transcripts of nicotine adenine dinucleotide phosphate oxidase B gene from Zea mays.

    PubMed

    Lin, Fan; Zhang, Yun; Jiang, Ming-Yi

    2009-03-01

    With the exception of rice, little is known about the existence of respiratory burst oxidase homolog (rboh) gene in cereals. The present study reports the cloning and analysis of a novel rboh gene, termed ZmrbohB, from maize (Zea mays L.). The full-length cDNA of ZmrbohB encodes a 942 amino acid protein containing all of the respiratory burst oxidase homolog catalytically critical motifs. Alternative splicing of ZmrbohB has generated two transcript isoforms, ZmrbohB-alpha and -beta. Spliced transcript ZmrbohB-beta retains an unspliced intron 11 that carries a premature termination codon and probably leads to nonsense-mediated mRNA decay. Expression analysis showed that two splice isoforms were differentially expressed in various tissues and at different developmental stages, and the major product was ZmrbohB-alpha. The transcripts of ZmrbohB-alpha accumulated markedly when the maize seedlings were subjected to various abiotic stimuli, such as wounding, cold (4 degrees C), heat (40 degrees C), UV and salinity stress. In addition, several abiotic stimuli also affected the alternative splicing pattern of ZmrbohB except wounding. These results provide new insight into roles in the expression regulation of plant rboh genes and suggest that ZmrbohB gene may play a role in response to environmental stresses.

  11. Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory

    PubMed Central

    Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A.; Lewis, John; Wang, Jing; Ross, Daniel L.; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J. David

    2015-01-01

    A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage. PMID:26644996

  12. Arsenite-oxidizing bacteria exhibiting plant growth promoting traits isolated from the rhizosphere of Oryza sativa L.: Implications for mitigation of arsenic contamination in paddies.

    PubMed

    Das, Suvendu; Jean, Jiin-Shuh; Chou, Mon-Lin; Rathod, Jagat; Liu, Chia-Chuan

    2016-01-25

    Arsenite-oxidizing bacteria exhibiting plant growth promoting (PGP) traits can have the advantages of reducing As-uptake by rice and promoting plant growth in As-stressed soil. A gram-positive bacterium Bacillus flexus ASO-6 resistant to high levels of As (32 and 280 mM for arsenite and arsenate, respectively) and exhibiting elevated rates of As(III) oxidation (Vmax=1.34 μM min(-1) 10(-7) cell) was isolated from rhizosphere of rice. The presence of aoxB gene and exhibition of As(III)-oxidase enzyme activity of this strain was observed. The ability of the strain to produce siderophore, IAA, ACC-deaminase and to solubilize phosphate was verified. The rice seed treated with the strain exhibited significantly improved seed germination and seedling vigor compared with the un-inoculated seeds. The bacterial inoculation significantly increased root biomass, straw yield, grain yield, chlorophyll and carotenoid in the rice plant. Moreover, As uptake from root to shoot and As accumulation in straw and grain decreased significantly as a result of the bacterial inoculation. Noteworthy, the inoculation effect is more prominent in non-flooded soil than it is in flooded soil. Owing to its wide action spectrum, this As(III)-oxidizing PGPB could serve as a potential bio-inoculant for mitigation of As in paddies and sustainable rice production in As-contaminated areas. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Isolation of an 1-aminocyclopropane-1-carboxylate oxidase gene from mulberry (Morus alba L.) and analysis of the function of this gene in plant development and stresses response.

    PubMed

    Pan, Gang; Lou, Chengfu

    2008-07-31

    Mulberry (Morus alba) is an important crop tree involved in sericulture and pharmaceuticals. To further understand the development and the environmental adaptability mechanism of mulberry, a cDNA of the gene MaACO1 encoding 1-aminocyclopropane-1-carboxylate oxidase was isolated from mulberry. This was used to investigate stress-responsive expression in mulberry. Developmental expression of ACC oxidase in mulberry leaves and spatial expression in mulberry flowers were also investigated. Damage and low-temperature treatment promoted the expression of MaACO1 in mulberry. In leaves, expression of the MaACO1 gene increased in cotyledons and the lowest leaves with leaf development, but showed reduced levels in emerging leaves. In flowers, the pollinated stigma showed the highest expression level, followed by the unpollinated stigma, ovary, and immature flowers. These results suggest that high MaACO1 expression may be predominantly associated with tissue aging or senescence in mulberry.

  14. Posttreatment with sodium arsenite alters the mutational spectrum induced by ultraviolet light irradiation in Chinese hamster ovary cells

    SciTech Connect

    Yang, Jia-Ling; Chen, Mei-Fang; Wu, Cheng-Wen; Lee, Te-Chang )

    1992-01-01

    Arsenic, a potent carcinogen, fails to induce gene mutations in mammalian cells. However, posttreatment of ultraviolet light (UV)-irradiated cells with sodium arsenite synergstically enhances the mutation frequency on the hypoxanthine (Guanine) phosphoribosyltransferase locus. To investigate the molecular mechanism of the comutagenic effects of sodium arsenite, the authors characterized the alternations of nucleotide sequences in 30 UV-induced and 39 sodium arsenite enhanced hprt mutants from CHinese hamster ovary K1 cells by direct sequencing of mRNA-PCR amplified cDNA. The majority of sequence alterations derived from UV irradiation (80%) and from sodium arsenite posttreatment (70%) were single base substitutions. UV irradiation induced all types of base substitutions. Among them, 57% were transversions. The frequency of transversion increased to 70% in sodium arsenite enhanced mutants. While base substitutions observed in UV-induced mutants were evenly distributed along with the whole coding region, exons 3 and 8 were most frequently mutated in sodium arsenite enhanced mutants. Sodium arsenite posttreatment did not alter the strand bias for mutation induction, i.e., 73% and 78%, of the mutations were located on the non-transcribed strand in UV-induced and sodium arsenite enhanced mutants, respectively. In contrast to UV-induced mutations, bases at the 5' position of TT and the 3' position of CT sequences were the most frequent mutation sites observed in sodium arsenite enhanced mutants. The authors hypothesize that sodium arsenite may interfere with the process of mutation fixation of TT and CT dimers during DNA replication. 50 refs., 2 figs., 6 tabs.

  15. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  16. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    USDA-ARS?s Scientific Manuscript database

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  17. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    USDA-ARS?s Scientific Manuscript database

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  18. Cytochrome oxidase subunit 2 gene allows simultaneous detection and typing of Trypanosoma rangeli and Trypanosoma cruzi.

    PubMed

    de Sá, Amanda Regina Nichi; Steindel, Mário; Demeu, Lara Maria Kalempa; Lückemeyer, Débora Denardin; Grisard, Edmundo Carlos; Neto, Quirino Alves de Lima; de Araújo, Silvana Marques; Toledo, Max Jean de Ornelas; Gomes, Mônica Lúcia

    2013-12-23

    The parasites Trypanosoma rangeli and Trypanosoma cruzi share vectors and hosts over a wide geographical area in Latin America. In this study, we propose a single molecular approach for simultaneous detection and typing of T. rangeli and T. cruzi. A restriction fragment length polymorphism analysis of the mitochondrial cytochrome oxidase II gene (COII-RFLP) using enzyme AluI and different amounts of DNA from the major genetic groups of T. rangeli and T. cruzi (KP1+/KP1- and DTU-I/DTU-II) was carried out. The same marker was tested on the other T. cruzi DTUs (DTU-III to DTU-VI) and on DNA extracted from gut contents of experimentally infected triatomines. The COII PCR generates a ~400 bp fragment, which after digestion with AluI (COII-RFLP) can be used to distinguish T. rangeli from T. cruzi and simultaneously differentiate the major genetic groups of T. rangeli (KP1+ and KP1-) and T. cruzi (DTU-I and DTU-II). The COII-RFLP generated bands of ~120 bp and ~280 bp for KP1+, whereas for KP1- no amplicon cleavage was observed. For T. cruzi, digestion of COII revealed a ~300 bp band for DTU-I and a ~250 bp band for DTU-II. For DTU-III to DTU-VI, COII-RFLP generated bands ranging from ~310 to ~330 bp, but the differentiation of these DTUs was not as clear as the separation between DTU-I and DTU-II. After AluI digestion, a species-specific fragment of ~80 bp was observed for all DTUs of T. cruzi. No cross-amplification was observed for Leishmania spp., T. vivax or T. evansi. The COII-RFLP allowed simultaneous detection and typing of T. rangeli and T. cruzi strains according to their major genetic groups (KP1+/KP1- and DTU-I/DTU-II) in vitro and in vivo, providing a reliable and sensitive tool for epidemiological studies in areas where T. rangeli and T. cruzi coexist.

  19. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  20. Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

    PubMed

    Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

    2007-06-01

    Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

  1. Structural analysis of tissues affected by cytochrome C oxidase deficiency due to mutations in the SCO2 gene.

    PubMed

    Vesela, Katerina; Hulkova, Helena; Hansikova, Hana; Zeman, Jiri; Elleder, Milan

    2008-01-01

    Structural and histochemical studies carried out in a series of seven cases (from five families) with isolated cytochrome c oxidase (COX) deficiency caused by mutations in the SCO2 gene (1, 2) disclosed changes concentrated in the nervous system, skeletal muscle and myocardium. In five patients homozygous for the E140K mutation, the phenotype was predominantly neuromuscular and the average life span ranged between 9 and 15 months. In two cases, the course was more rapid (death at 7 and 11 weeks of life) and featured marked cardiac hypertrophy (3- and 4-fold increase in heart weight). This predominantly cardiomyopathic phenotype was associated with compound heterozygosity (E140K with another nonsense mutation) in the SCO2 gene. Polioencephalopathy with neurodegeneration and neuronal drop out was present in all cases with evidence that retinal neurons might be seriously affected too. Involvement of spinal motoneurons together with cytochrome c oxidase deficiency in muscle represents a "double hit" for the skeletal muscle. The mitochondrial population was not found to be significantly increased or structurally altered, with the exception of two compound heterozygotes in which the cardiac mitochondria were increased in number and size. Our report extends knowledge of the pathology of COX deficiency caused by mutations in the SCO2 gene.

  2. Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes.

    PubMed

    Martin, Frank N; Tooley, Paul W

    2003-01-01

    The phylogenetic relationships of 51 isolates representing 27 species of Phytophthora were assessed by sequence alignment of 568 bp of the mitochondrially encoded cytochrome oxidase II gene. A total of 1299 bp of the cytochrome oxidase I gene also were examined for a subset of 13 species. The cox II gene trees constructed by a heuristic search, based on maximum parsimony for a bootstrap 50% majority-rule consensus tree, revealed 18 species grouping into seven clades and nine species unaffiliated with a specific clade. The phylogenetic relationships among species observed on cox II gene trees did not exhibit consistent similarities in groupings for morphology, pathogenicity, host range or temperature optima. The topology of cox I gene trees, constructed by a heuristic search based on maximum parsimony for a bootstrap 50% majority-rule consensus tree for 13 species of Phytophthora, revealed 10 species grouping into three clades and three species unaffiliated with a specific clade. The groupings in general agreed with what was observed in the cox II tree. Species relationships observed for the cox II gene tree were in agreement with those based on ITS regions, with several notable exceptions. Some of these differences were noted in species in which the same isolates were used for both ITS and cox II analysis, suggesting either a differential rate of evolutionary divergence for these two regions or incorrect assumptions about alignment of ITS sequences. Analysis of combined data sets of ITS and cox II sequences generated a tree that did not differ substantially from analysis of ITS data alone, however, the results of a partition homogeneity test suggest that combining data sets may not be valid.

  3. Genetic basis of arsenite and cadmium tolerance in Saccharomyces cerevisiae

    PubMed Central

    Thorsen, Michael; Perrone, Gabriel G; Kristiansson, Erik; Traini, Mathew; Ye, Tian; Dawes, Ian W; Nerman, Olle; Tamás, Markus J

    2009-01-01

    Background Arsenic and cadmium are widely distributed in nature and pose serious threats to the environment and human health. Exposure to these nonessential toxic metals may result in a variety of human diseases including cancer. However, arsenic and cadmium toxicity targets and the cellular systems contributing to tolerance acquisition are not fully known. Results To gain insight into metal action and cellular tolerance mechanisms, we carried out genome-wide screening of the Saccharomyces cerevisiae haploid and homozygous diploid deletion mutant collections and scored for reduced growth in the presence of arsenite or cadmium. Processes found to be required for tolerance to both metals included sulphur and glutathione biosynthesis, environmental sensing, mRNA synthesis and transcription, and vacuolar/endosomal transport and sorting. We also identified metal-specific defence processes. Arsenite-specific defence functions were related to cell cycle regulation, lipid and fatty acid metabolism, mitochondrial biogenesis, and the cytoskeleton whereas cadmium-specific defence functions were mainly related to sugar/carbohydrate metabolism, and metal-ion homeostasis and transport. Molecular evidence indicated that the cytoskeleton is targeted by arsenite and that phosphorylation of the Snf1p kinase is required for cadmium tolerance. Conclusion This study has pin-pointed core functions that protect cells from arsenite and cadmium toxicity. It also emphasizes the existence of both common and specific defence systems. Since many of the yeast genes that confer tolerance to these agents have homologues in humans, similar biological processes may act in yeast and humans to prevent metal toxicity and carcinogenesis. PMID:19284616

  4. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Beneficial effect of the antioxidant riboflavin on gene expression of extracellular matrix elements, antioxidants and oxidases in keratoconic stromal cells.

    PubMed

    Cheung, Isabella M Y; McGhee, Charles N J; Sherwin, Trevor

    2014-07-01

    Keratoconus manifests as a conical protrusion of the cornea and is characterised by stromal thinning. This causes debilitating visual impairment which may necessitate corneal transplantation. Therapeutic targets related to disease mechanisms are currently lacking, as the pathobiology remains unclear. Many pathological features may be manifestations of defects in wound healing and reactive oxygen species (ROS)-associated functions. In a wide range of tissue and cell types, antioxidant exposure has beneficial effects on both of these pathways. This study investigated the effect of treatment with the antioxidant riboflavin on wound healing and ROS-associated functions in keratoconus. Stromal cells were isolated from human central keratoconic (n = 3) and normal (n = 3) corneas. Total RNA was extracted and reverse-transcribed into complementary DNA. The gene expression of 22 genes involved in repair (eight normal and four repair-type extracellular matrix constituents) and ROS-associated processes (eight antioxidants and two ROS-synthesising oxidases) was quantified using quantitative polymerase chain reaction. This was also performed on keratoconic stromal cells treated in vitro with riboflavin (n = 3). In stromal cells from untreated keratoconic corneas (compared with untreated normal corneas), there was an up-regulation of 7/12 extracellular matrix elements. Four of eight antioxidants and two of two oxidases were also increased. In treated keratoconic corneas (compared with untreated keratoconic corneas), six out of eight normal extracellular matrix constituents were up-regulated and two of four repair-type molecules were reduced. An increase was also observed in seven out of eight antioxidants and there was a diminution in two out of two oxidases. Riboflavin encourages the synthesis of a normal extracellular matrix and reduces reactive oxygen species levels in keratoconus. This supports the occurrence of wound healing and ROS-associated abnormalities in keratoconus

  6. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  7. Anaerobic oxidation of arsenite in Mono Lake water and by a facultative, arsenite-oxidizing chemoautotroph, strain MLHE-1.

    PubMed

    Oremland, Ronald S; Hoeft, Shelley E; Santini, Joanne M; Bano, Nasreen; Hollibaugh, Ryan A; Hollibaugh, James T

    2002-10-01

    Arsenite [As(III)]-enriched anoxic bottom water from Mono Lake, California, produced arsenate [As(V)] during incubation with either nitrate or nitrite. No such oxidation occurred in killed controls or in live samples incubated without added nitrate or nitrite. A small amount of biological As(III) oxidation was observed in samples amended with Fe(III) chelated with nitrolotriacetic acid, although some chemical oxidation was also evident in killed controls. A pure culture, strain MLHE-1, that was capable of growth with As(III) as its electron donor and nitrate as its electron acceptor was isolated in a defined mineral salts medium. Cells were also able to grow in nitrate-mineral salts medium by using H(2) or sulfide as their electron donor in lieu of As(III). Arsenite-grown cells demonstrated dark (14)CO(2) fixation, and PCR was used to indicate the presence of a gene encoding ribulose-1,5-biphosphate carboxylase/oxygenase. Strain MLHE-1 is a facultative chemoautotroph, able to grow with these inorganic electron donors and nitrate as its electron acceptor, but heterotrophic growth on acetate was also observed under both aerobic and anaerobic (nitrate) conditions. Phylogenetic analysis of its 16S ribosomal DNA sequence placed strain MLHE-1 within the haloalkaliphilic Ectothiorhodospira of the gamma-PROTEOBACTERIA: Arsenite oxidation has never been reported for any members of this subgroup of the PROTEOBACTERIA:

  8. Anaerobic oxidation of arsenite in Mono Lake water and by a facultative, arsenite-oxidizing chemoautotroph, strain MLHE-1

    USGS Publications Warehouse

    Oremland, R.S.; Hoeft, S.E.; Santini, J.M.; Bano, N.; Hollibaugh, R.A.; Hollibaugh, J.T.

    2002-01-01

    Arsenite [As(III)]-enriched anoxic bottom water from Mono Lake, California, produced arsenate [As(V)] during incubation with either nitrate or nitrite. No such oxidation occurred in killed controls or in live samples incubated without added nitrate or nitrite. A small amount of biological As(III) oxidation was observed in samples amended with Fe(III) chelated with nitrolotriacetic acid, although some chemical oxidation was also evident in killed controls. A pure culture, strain MLHE-1, that was capable of growth with As(III) as its electron donor and nitrate as its electron acceptor was isolated in a defined mineral salts medium. Cells were also able to grow in nitrate-mineral salts medium by using H2 or sulfide as their electron donor in lieu of As(III). Arsenite-grown cells demonstrated dark 14CO2 fixation, and PCR was used to indicate the presence of a gene encoding ribulose-1,5-biphosphate carboxylase/oxygenase. Strain MLHE-1 is a facultative chemoautotroph, able to grow with these inorganic electron donors and nitrate as its electron acceptor, but heterotrophic growth on acetate was also observed under both aerobic and anaerobic (nitrate) conditions. Phylogenetic analysis of its 16S ribosomal DNA sequence placed strain MLHE-1 within the haloalkaliphilic Ectothiorhodospira of the ??-Proteobacteria. Arsenite oxidation has never been reported for any members of this subgroup of the Proteobacteria.

  9. Elimination of manganese(II,III) oxidation in Pseudomonas putida GB-1 by a double knockout of two putative multicopper oxidase genes.

    PubMed

    Geszvain, Kati; McCarthy, James K; Tebo, Bradley M

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes.

  10. Cloning and functional identification of C-4 methyl sterol oxidase genes from the penicillin-producing fungus Penicillium chrysogenum.

    PubMed

    Wang, Fu-Qiang; Zhao, Ying; Dai, Meng; Liu, Jing; Zheng, Gui-Zhen; Ren, Zhi-Hong; He, Jian-Gong

    2008-10-01

    Two C-4 methyl sterol oxidase genes (Pcerg25A and Pcerg25B) that are involved in ergosterol biosynthesis have been cloned from the penicillin-producing fungus Penicillium chrysogenum. cDNAs of both Pcerg25A and Pcerg25B have an ORF 885 bp in length, encoding a peptide of 295 residues. The deduced amino acid sequences of PcErg25A and PcErg25B show 86% identity, and have high identities to the characterized C-4 methyl sterol oxidases from Candida albicans and Saccharomyces cerevisiae. The function of Pcerg25A and Pcerg25B was identified by complementation of a yeast erg25-deficient strain. Pcerg25A is located in the DNA region containing the penicillin gene cluster, and thus its copy number is dependent on the patterns of the cluster region. Up to eight copies of Pcerg25A were found in the high-productivity strain NCPC 10086. By contrast, Pcerg25B was present in just a single copy in all tested P. chrysogenum genomes. Differences in the transcript level of either Pcerg25A or Pcerg25B were observed in different P. chrysogenum strains by real-time quantitative reverse transcriptase PCR analysis.

  11. The polyphenol oxidase gene family in poplar: phylogeny, differential expression and identification of a novel, vacuolar isoform.

    PubMed

    Tran, Lan T; Constabel, C Peter

    2011-10-01

    Polyphenol oxidases (PPOs) are oxidative enzymes that convert monophenols and o-diphenols to o-quinones using molecular oxygen. The quinone products are highly reactive following tissue damage and can interact with cellular constituents and cause oxidative browning and cross-linking. The induction of PPO in some plants as a result of wounding, herbivore attack, or pathogen infection has implicated them in defense. However, PPO-like enzymes that act as specific hydroxylases, for example in lignan and pigment biosynthesis, have also been discovered. Here, we present the first genome-enabled analysis of a PPO gene family. The Populus trichocarpa genome was found to contain a minimum of nine complete PPO genes, and seven of these were characterized further. The PPO gene family includes both recently duplicated and divergent sequences that are 36-98% identical at the amino acid level. Gene expression profiling in poplar tissues and organs revealed that the PPO genes are all differentially expressed during normal development, but that only a small subset of PPO genes are significantly upregulated by wounding, methyl jasmonate or pathogen infection. Our studies also identified PtrPPO13, a novel PPO gene that is predicted to encode an N-terminal signal peptide. Transient expression of green fluorescent protein fusions demonstrated its localization to the vacuolar lumen. Together, our findings show that the poplar PPO family is diverse and is likely linked to diverse physiological functions.

  12. maoB, a gene that encodes a positive regulator of the monoamine oxidase gene (maoA) in Escherichia coli.

    PubMed Central

    Yamashita, M; Azakami, H; Yokoro, N; Roh, J H; Suzuki, H; Kumagai, H; Murooka, Y

    1996-01-01

    The structural gene for copper- and topa quinone-containing monoamine oxidase (maoA) and an unknown amine oxidase gene have been located at 30.9 min on the Escherichia coli chromosome. Deletion analysis showed that the unknown gene was located within a 1.1-kb cloned fragment adjacent to the maoA gene. The nucleotide sequence of this fragment was determined, and a single open reading frame (maoB) consisting of 903 bp was found. The gene encoded a polypeptide with a predicted molecular mass of 34,619 Da which was correlated with the migration on a sodium dodecyl sulfate-polyacrylamide gel. The predicted amino acid sequence of the MaoB protein was identical to the NH2-terminal amino acid sequence derived by Edman degradation of the protein synthesized under the self-promoter. No homology of the nucleotide sequence of maoB to the sequences of any reported genes was found. However, the amino acid sequence of MaoB showed a high level of homology with respect to the helix-turn-helix motif of the AraC family in its C terminus. The homology search and disruption of maoA on the chromosome led to the conclusion that MaoB is a transcriptional activator of maoA but not an amine oxidase. The consensus sequence of the cyclic AMP-cyclic AMP receptor protein complex binding domain was adjacent to the putative promoter for the maoB gene. By use of lac gene fusions with the maoA and maoB genes, we showed that the maoA gene is regulated by tyramine and MaoB and that the expression of the maoB gene is subject to catabolite repression. Thus, it seems likely that tyramine and the MaoB protein activate the transcription of maoA by binding to the regulatory region of the maoA gene. PMID:8631685

  13. Nrf2-dependent protection against acute sodium arsenite toxicity in zebrafish.

    PubMed

    Fuse, Yuji; Nguyen, Vu Thanh; Kobayashi, Makoto

    2016-08-15

    Transcription factor Nrf2 induces a number of detoxifying enzymes and antioxidant proteins to confer protection against the toxic effects of a diverse range of chemicals including inorganic arsenicals. Although a number of studies using cultured cells have demonstrated that Nrf2 has a cell-protective function against acute and high-dose arsenic toxicity, there is no clear in vivo evidence of this effect. In the present study, we genetically investigated the protective role of Nrf2 against acute sodium arsenite toxicity using the zebrafish Nrf2 mutant, nrf2a(fh318). After treatment with 1mM sodium arsenite, the survival of nrf2a(fh318) larvae was significantly shorter than that of wild-type siblings, suggesting that Nrf2 protected the zebrafish larvae against high-dose arsenite exposure. To understand the molecular basis of the Nrf2-dependent protection, we analyzed the gene expression profiles after arsenite exposure, and found that the genes involved in the antioxidative function (prdx1 and gclc), arsenic metabolism (gstp1) and xenobiotic elimination (abcc2) were induced in an Nrf2-dependent manner. Furthermore, pre-treatment with sulforaphane, a well-known Nrf2 activator improved the survival of zebrafish larvae after arsenic exposure. Based on these results, we concluded that Nrf2 plays a fundamental and conserved role in protection against acute sodium arsenite toxicity.

  14. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

    PubMed

    Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

    2012-03-01

    The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

  15. Roles of mitogen activated protein kinases and EGF receptor in arsenite-stimulated matrix metalloproteinase-9 production

    SciTech Connect

    Cooper, Karen L.; Myers, Terrance Alix; Rosenberg, Martina; Chavez, Miquella; Hudson, Laurie G. . E-mail: lghudson@unm.edu

    2004-11-01

    The dermatotoxicity of arsenic is well established and epidemiological studies identify an increased incidence of keratinocytic tumors (basal cell and squamous cell carcinoma) associated with arsenic exposure. Little is known about the underlying mechanisms of arsenic-mediated skin carcinogenesis, but activation of mitogen-activated protein (MAP) kinases and subsequent regulation of downstream target genes may contribute to tumor promotion and progression. In this study, we investigated activation of the extracellular signal regulated kinase (ERK) and the stress-associated kinase p38 by arsenite in HaCat cells, a spontaneously immortalized human keratinocyte cell line. Arsenite concentrations {>=}100 {mu}M stimulate rapid activation of p38 and ERK MAP kinases. However, upon extended exposure (24 h), persistent stimulation of p38 and ERK MAP kinases was detected at low micromolar concentrations of arsenite. Although ERK and p38 were activated with similar time and concentration dependence, the mechanism of activation differed for these two MAP kinases. ERK activation by arsenite was fully dependent on the catalytic activity of the epidermal growth factor (EGF) receptor and partially dependent on Src-family kinase activity. In contrast, p38 activation was independent of EGF receptor or Src-family kinase activity. Arsenite-stimulated MAP kinase signal transduction resulted in increased production of matrix metalloproteinase (MMP)-9, an AP-1 regulated gene product. MMP-9 induction by arsenite was prevented when EGF receptor or MAP kinase signaling was inhibited. These studies indicate that EGF receptor activation is a component of arsenite-mediated signal transduction and gene expression in keratinocytes and that low micromolar concentrations of arsenite stimulate key signaling pathways upon extended exposure. Stimulation of MAP kinase cascades by arsenic and subsequent regulation of genes including c-fos, c-jun, and the matrix degrading proteases may play an important

  16. Isolation and characterization of two putative cytokinin oxidase genes related to grain number per spike phenotype in wheat.

    PubMed

    Zhang, Jinpeng; Liu, Weihua; Yang, Xinming; Gao, Ainong; Li, Xiuquan; Wu, Xiaoyang; Li, Lihui

    2011-04-01

    Cytokinin oxidases are involved in the regulation of plant cytokinin levels, which are important in regulating plant growth and development, and may affect the yield of cereals. Here, we report the isolation and characterization of two putative cytokinin oxidase genes, TaCKX2.1 and TaCKX2.2, from wheat. Both TaCKX2.1 and TaCKX2.2 are mapped to the 0.24-0.55 region of the short arm of wheat chromosome 3D and their coding proteins are most closely related to OsCKX2. Phylogenetic tree analysis reveals that TaCKX2.1 and TaCKX2.2 belong to the clustered clade I of monocot plants. Tissue expression pattern show that both TaCKX2.1 and TaCKX2.2 genes are highly expressed in young spikes and culms of wheat. The detailed spatial expression pattern of TaCKX2.1 were further conducted by in situ hybridization and promoter-fused GUS expression in Arabidopsis experiments. A collection of 12 typical common wheat varieties exhibiting grain number per spike ranging from 31 to 139 were used for the transcription abundance detection of two TaCKX2 genes. A significantly positive correlation between expression level of two TaCKX2 genes and grain number per spike suggests that TaCKX2.1 and TaCKX2.2 on wheat chromosome 3DS may play an important role in wheat spike morphogenesis.

  17. Cellular Response of Sinorhizobium sp. Strain A2 during Arsenite Oxidation

    PubMed Central

    Fukushima, Koh; Huang, He; Hamamura, Natsuko

    2015-01-01

    Arsenic (As) is a widely distributed toxic element in the environment and microorganisms have developed resistance mechanisms in order to tolerate it. The cellular response of the chemoorganotrophic arsenite (As[III])-oxidizing α-Proteobacteria, Sinorhizobium sp. strain A2, to arsenic was examined in the present study. Several proteins associated with arsenite oxidase and As resistance were shown to be accumulated in the presence of As(III). A shift in central carbon metabolism from the tricarboxylic acid pathway to glyoxylate pathway was also observed in response to oxidative stress. Our results revealed the strategy of the As(III)-oxidizing Sinorhizobium strain to mitigate arsenic toxicity and oxidative damage by multiple metabolic adaptations. PMID:26477790

  18. A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

    PubMed

    Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

    2007-09-05

    Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

  19. Realgar and realgar-containing Liu-Shen-Wan are less acutely toxic than arsenite and arsenate.

    PubMed

    Liu, Jie; Liang, Shi-Xia; Lu, Yuan-Fu; Miao, Jia-Wei; Wu, Qin; Shi, Jing-Shan

    2011-03-08

    Liu-Shen-Wan (LSW) is a widely-used traditional Chinese medicine containing realgar (As(4)S(4)). Realgar has been included in many traditional medicines, and is often taken as arsenite for risk assessment in realgar-containing traditional remedies. Is realgar toxicologically similar to arsenite? Mice were orally given LSW (60 and 200mg/kg; 200mg LSW contains 27 mg realgar), realgar (30 mg/kg, equivalent to 21 mg As/kg), and the equivalent As dose as sodium arsenite (NaAsO(2)), or as arsenate (Na(2)HAsO(4)). Acute toxicity and tissue As accumulation were determined 8h later. Arsenite and arsenate increased serum alanine aminotransferase (ALT) levels, indicative of liver injury; blood urea nitrogen (BUN) was also increased by arsenite and arsenate, indicative of nephrotoxicity. No elevations of ALT and BUN were observed in LSW and realgar groups. Histopathology showed more damage in arsenite- and arsenate-treated liver and kidneys, while in realgar- and LSW- treated animals, only mild alterations were seen. Hepatic and renal As contents were dramatically increased to 6200 and 3350ng/g, respectively, after arsenite, but only increased to 260 and 180 ng/g after LSW. The expressions of arsenic-sensitive stress genes, namely metallothionein-1 and heme oxygenase-1, were increased after arsenite or arsenate by 3-10-folds, but were unaltered after LWS and realgar. Realgar and LSW are much less toxic than arsenite and arenate. The use of total As content to evaluate the safety of realgar-containing traditional medicines is not scientifically sound. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  20. The metalloid arsenite induces nuclear export of Id3 possibly via binding to the N-terminal cysteine residues

    SciTech Connect

    Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi

    2013-04-19

    Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite.

  1. Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.

    PubMed

    Kellner, Harald; Luis, Patricia; Buscot, François

    2007-07-01

    Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol.

  2. Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps

    PubMed Central

    Piedade, Ana Paula; Morais, Paula V.

    2015-01-01

    Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification. PMID:26132104

  3. Hyper Accumulation of Arsenic in Mutants of Ochrobactrum tritici Silenced for Arsenite Efflux Pumps.

    PubMed

    Sousa, Tânia; Branco, Rita; Piedade, Ana Paula; Morais, Paula V

    2015-01-01

    Ochrobactrum tritici SCII24T is a highly As-resistant bacterium, with two previously described arsenic resistance operons, ars1 and ars2. Among a large number of genes, these operons contain the arsB and Acr3 genes that encode the arsenite efflux pumps responsible for arsenic resistance. Exploring the genome of O. tritici SCII24T, an additional putative operon (ars3) was identified and revealed the presence of the Acr3_2 gene that encodes for an arsenite efflux protein but which came to prove to not be required for full As resistance. The genes encoding for arsenite efflux pumps, identified in this strain, were inactivated to develop microbial accumulators of arsenic as new tools for bioremediation. Six different mutants were produced, studied and three were more useful as biotools. O. tritici wild type and the Acr3-mutants showed the highest resistance to As(III), being able to grow up to 50 mM of arsenite. On the other hand, arsB-mutants were not able to grow at concentrations higher than 1 mM As(III), and were the most As(III) sensitive mutants. In the presence of 1 mM As(III), the strain with arsB and Acr3_1 mutated showed the highest intracellular arsenic concentration (up to 17 ng(As)/mg protein), while in assays with 5 mM As(III), the single arsB-mutant was able to accumulate the highest concentration of arsenic (up to 10 ng(As)/mg protein). Therefore, arsB is the main gene responsible for arsenite resistance in O. tritici. However, both genes arsB and Acr3_1 play a crucial role in the resistance mechanism, depending on the arsenite concentration in the medium. In conclusion, at moderate arsenite concentrations, the double arsB- and Acr3_1-mutant exhibited a great ability to accumulate arsenite and can be seen as a promising bioremediation tool for environmental arsenic detoxification.

  4. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  5. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  6. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  7. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

    2004-01-01

    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  8. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-05

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae.

  9. Monoamine Oxidase A gene polymorphisms and self reported aggressive behaviour in a Pakistani ethnic group.

    PubMed

    Shah, Syed Shoaib; Mohyuddin, Aisha; Colonna, Vincenza; Mehdi, Syed Qasim; Ayub, Qasim

    2015-08-01

    To investigate the association of monoamine oxidase Agene polymorphisms with aggression. The study was conducted in an ethnic community in Lahore, Pakistan, from August 2008 to December 2009 on the basis of data that was collected through a questionnaire between August 2004 and September 2005. It analysed 10 single nucleotide polymorphisms of monoamine oxidase A in unrelated males from the same ethnic background who were administered a Punjabi translation of the Buss and Perry aggression questionnaire. SPSS 13 was used for statistical analysis. Of the total 133 haplotypes studied, 52(39%) were Haplotype A, 58(43.6%) B, 8(6%) C, 3(2.3%) D, 9(6.8%) E and 3(2.3%) F. The six haplotypes were analysed for association with scores of the four subscales of the aggression questionnaire and multivariate analysis of variance showed no significant differences (p>0.05 each) in the error variances of the total scores and scores for three of the sub-scales across the haplotypes. The variance was significantly different only for the anger sub-scale (p<0.05). The association of an extended haplotype with low levels of self-reported aggression in this study should assist in characterisation of functional variants responsible for non-aggressive behaviour in male subjects.

  10. Arsenite-induced autophagy is associated with proteotoxicity in human lymphoblastoid cells.

    PubMed

    Bolt, Alicia M; Zhao, Fei; Pacheco, Samantha; Klimecki, Walter T

    2012-10-15

    Epidemiological studies of arsenic-exposed populations have provided evidence that arsenic exposure in humans is associated with immunosuppression. Previously, we have reported that arsenite-induced toxicity is associated with the induction of autophagy in human lymphoblastoid cell lines (LCL). Autophagy is a cellular process that functions in the degradation of damaged cellular components, including protein aggregates formed by misfolded or damaged proteins. Accumulation of misfolded or damaged proteins in the endoplasmic reticulum (ER) lumen causes ER stress and activates the unfolded protein response (UPR). In an effort to investigate the mechanism of autophagy induction by arsenite in the LCL model, we examined the potential contribution of ER stress and activation of the UPR. LCL exposed to sodium arsenite for 8-days induced expression of UPR-activated genes, including CHOP and GRP78, at the RNA and the protein level. Evidence for activation of the three arms of the UPR was observed. The arsenite-induced activation of the UPR was associated with an accumulation of protein aggregates containing p62 and LC3, proteins with established roles in the sequestration and autophagic clearance of protein aggregates. Taken together, these data provide evidence that arsenite-induced autophagy is associated with the generation of ER stress, activation of the UPR, and formation of protein aggregates that may be targeted to the lysosome for degradation.

  11. Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

    PubMed Central

    Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

    2017-01-01

    Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

  12. Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants.

    PubMed

    Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

    2017-01-01

    Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants.

  13. An Oxidoreductase AioE is Responsible for Bacterial Arsenite Oxidation and Resistance

    PubMed Central

    Wang, Qian; Han, Yushan; Shi, Kaixiang; Fan, Xia; Wang, Lu; Li, Mingshun; Wang, Gejiao

    2017-01-01

    Previously, we found that arsenite (AsIII) oxidation could improve the generation of ATP/NADH to support the growth of Agrobacterium tumefaciens GW4. In this study, we found that aioE is induced by AsIII and located in the arsenic island near the AsIII oxidase genes aioBA and co-transcripted with the arsenic resistant genes arsR1-arsC1-arsC2-acr3-1. AioE belongs to TrkA family corresponding the electron transport function with the generation of NADH and H+. An aioE in-frame deletion strain showed a null AsIII oxidation and a reduced AsIII resistance, while a cytC mutant only reduced AsIII oxidation efficiency. With AsIII, aioE was directly related to the increase of NADH, while cytC was essential for ATP generation. In addition, cyclic voltammetry analysis showed that the redox potential (ORP) of AioBA and AioE were +0.297 mV vs. NHE and +0.255 mV vs. NHE, respectively. The ORP gradient is AioBA > AioE > CytC (+0.217 ~ +0.251 mV vs. NHE), which infers that electron may transfer from AioBA to CytC via AioE. The results indicate that AioE may act as a novel AsIII oxidation electron transporter associated with NADH generation. Since AsIII oxidation contributes AsIII detoxification, the essential of AioE for AsIII resistance is also reasonable. PMID:28128323

  14. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  15. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  16. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future.

  17. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  18. Mitogen-Activated Protein Kinase Hog1 Mediates Adaptation to G1 Checkpoint Arrest during Arsenite and Hyperosmotic Stress▿

    PubMed Central

    Migdal, Iwona; Ilina, Yulia; Tamás, Markus J.; Wysocki, Robert

    2008-01-01

    Cells slow down cell cycle progression in order to adapt to unfavorable stress conditions. Yeast (Saccharomyces cerevisiae) responds to osmotic stress by triggering G1 and G2 checkpoint delays that are dependent on the mitogen-activated protein kinase (MAPK) Hog1. The high-osmolarity glycerol (HOG) pathway is also activated by arsenite, and the hog1Δ mutant is highly sensitive to arsenite, partly due to increased arsenite influx into hog1Δ cells. Yeast cell cycle regulation in response to arsenite and the role of Hog1 in this process have not yet been analyzed. Here, we found that long-term exposure to arsenite led to transient G1 and G2 delays in wild-type cells, whereas cells that lack the HOG1 gene or are defective in Hog1 kinase activity displayed persistent G1 cell cycle arrest. Elevated levels of intracellular arsenite and “cross talk” between the HOG and pheromone response pathways, observed in arsenite-treated hog1Δ cells, prolonged the G1 delay but did not cause a persistent G1 arrest. In contrast, deletion of the SIC1 gene encoding a cyclin-dependent kinase inhibitor fully suppressed the observed block of G1 exit in hog1Δ cells. Moreover, the Sic1 protein was stabilized in arsenite-treated hog1Δ cells. Interestingly, Sic1-dependent persistent G1 arrest was also observed in hog1Δ cells during hyperosmotic stress. Taken together, our data point to an important role of the Hog1 kinase in adaptation to stress-induced G1 cell cycle arrest. PMID:18552285

  19. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  20. Effects of hydrogen sulfide on alternative pathway respiration and induction of alternative oxidase gene expression in rice suspension cells.

    PubMed

    Xiao, Man; Ma, Jun; Li, Hongyu; Jin, Han; Feng, Hanqing

    2010-01-01

    The toxic effects of H2S on plants are well documented. However, the molecular mechanisms reponsible for inhibition of plants by H2S are still not completely understood. We determined the effects of NaHS in the range of 0.5-10 mM on the growth of rice suspension culture cells, as well as on the expression of the alternative oxidase (AOX) gene. AOX is the terminal oxidase of the alternative pathway (AP) and exists in plant mitochondria. The results showed that H2S treatment enhanced the AP activity. During the process of H2S treatment for 4 h, the AP activity increased dramatically and achieved the peak value at a concentration of 2 mM NaHS. Then it declined at higher concentrations of NaHS (5-10 mM) and maintained a steady level. The AOX1 gene transcript level also showed a similar change as the AP activity. Interestingly, different NaHS concentrations seemed to have different effects on the expression of AOX1a, AOX1b, and AOX1c. The induction of AOX expression by low concentrations of NaHS was inferred through a reactive oxygen species (ROS)-independent pathway. At the same time, rice cells grown in culture were very sensitive to H2S, different H2S concentrations induced an increase in the cell viability. These results indicate that the H2S-induced AOX induction might play a role in inhibiting the ROS production and have an influence on cell viability.

  1. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.

    PubMed

    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M

    2003-01-01

    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants.

  2. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  3. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

    2014-03-11

    Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

  4. METHYLATION OF SODIUM ARSENITE BY VARIOUS MAMMALIAN CELLS

    EPA Science Inventory


    Methylation of Sodium Arsenite by various Mammalian Cells

    Methylation of arsenite (As 3-1) is thought to play an important role in the carcinogenicity of arsenic. AIM: I. Characterization of methylation of arsenite in primary rodent and transformed human cell lines. ...

  5. METHYLATION OF SODIUM ARSENITE BY VARIOUS MAMMALIAN CELLS

    EPA Science Inventory


    Methylation of Sodium Arsenite by various Mammalian Cells

    Methylation of arsenite (As 3-1) is thought to play an important role in the carcinogenicity of arsenic. AIM: I. Characterization of methylation of arsenite in primary rodent and transformed human cell lines. ...

  6. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    PubMed

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  7. Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

    PubMed

    Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

    2012-01-01

    Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

  8. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  9. Effect of ascorbate oxidase over-expression on ascorbate recycling gene expression in response to agents imposing oxidative stress.

    PubMed

    Fotopoulos, Vasileios; Sanmartin, Maite; Kanellis, Angelos K

    2006-01-01

    Ascorbate oxidase (AO) is a cell wall-localized enzyme that uses oxygen to catalyse the oxidation of ascorbate (AA) to the unstable radical monodehydroascorbate (MDHA) which rapidly disproportionates to yield dehydroascorbate (DHA) and AA, and thus contributes to the regulation of the AA redox state. Here, it is reported that in vivo lowering of the apoplast AA redox state, through increased AO expression in transgenic tobacco (Nicotiana tabacum L. cv. Xanthi), exerts no effects on the expression levels of genes involved in AA recycling under normal growth conditions, but plants display enhanced sensitivity to various oxidative stress-promoting agents. RNA blot analyses suggest that this response correlates with a general suppression of the plant's antioxidative metabolism as demonstrated by lower expression levels of AA recycling genes. Furthermore, studies using Botrytis cinerea reveal that transgenic plants exhibit increased sensitivity to fungal infection, although the response is not accompanied by a similar suppression of AA recycling gene expression. Our current findings, combined with previous studies which showed the contribution of AO in the regulation of AA redox state, suggest that the reduction in the AA redox state in the leaf apoplast of these transgenic plants results in shifts in their capacity to withstand oxidative stress imposed by agents imposing oxidative stress.

  10. High-resolution melting analysis of 15 genes in 60 patients with cytochrome-c oxidase deficiency.

    PubMed

    Vondrackova, Alzbeta; Vesela, Katerina; Hansikova, Hana; Docekalova, Dagmar Zajicova; Rozsypalova, Eva; Zeman, Jiri; Tesarova, Marketa

    2012-07-01

    Cytochrome-c oxidase (COX) deficiency is one of the common childhood mitochondrial disorders. Mutations in genes for the assembly factors SURF1 and SCO2 are prevalent in children with COX deficiency in the Slavonic population. Molecular diagnosis is difficult because of the number of genes involved in COX biogenesis and assembly. The aim of this study was to screen for mutations in 15 nuclear genes that encode the 10 structural subunits, their isoforms and two assembly factors of COX in 60 unrelated Czech children with COX deficiency. Nine novel variants were identified in exons and adjacent intronic regions of COX4I2, COX6A1, COX6A2, COX7A1, COX7A2 and COX10 using high-resolution melting (HRM) analysis. Online bioinformatics servers were used to predict the importance of the newly identified amino-acid substitutions. The newly characterized variants updated the contemporary spectrum of known genetic sequence variations that are present in the Czech population, which will be important for further targeted mutation screening in Czech COX-deficient children. HRM and predictive bioinformatics methodologies are advantageous because they are low-cost screening tools that complement large-scale genomic studies and reduce the required time and effort.

  11. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

    PubMed

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

    2015-03-01

    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  12. Molecular cloning of TvDAO1, a gene encoding a D-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis.

    PubMed

    González, F J; Montes, J; Martin, F; López, M C; Fermiñán, E; Catalán, J; Galán, M A; Domínguez, A

    1997-12-01

    The DAO1 gene of Trigonopsis variabilis encoding a D-amino acid oxidase (EC 1.4.3.3) was isolated from genomic clones selected for their specific hybridization to synthetic oligodeoxyribonucleotide probes based on regions of the enzyme that have been conserved through evolution. The nucleotide sequence of the gene predicts a protein with similarities to human, pig, rabbit, mouse and Fusarium solani D-amino acid oxidases. The open reading frame of the T. variabilis DAO1 gene was interrupted by an intron. The Dao1p sequence displays two regions, one in the N-terminal section--the FAD binding site--and the other near the C-terminal region that contains conserved signatures found in all the D-amino acid oxidases. The three C-terminal amino acids suggest that the enzyme may be located in peroxisomes. Northern blot experiments showed that no transcriptional activation occurred in the presence of D-methionine. The cDNA encoding Dao1p was expressed in Saccharomyces cerevisiae and Kluyveromyces lactis. Both yeast species are able to synthesize a functional enzyme under the control of the GAL1 promoter. In K. lactis, up to six times more enzyme units per gram of dry weight are produced with a multicopy plasmid in comparison with the wild-type strain of T. variabilis. The yeast expression system we describe may constitute an alternative source for the production of D-amino acid oxidases at industrial level.

  13. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.

    PubMed

    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang

    2015-10-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes.

  15. Induction of heme oxygenase 1 by arsenite inhibits cytokine-induced monocyte adhesion to human endothelial cells

    SciTech Connect

    Sun Xi; Pi Jingbo; Liu Wenlan; Hudson, Laurie G.; Liu Kejian; Feng Changjian

    2009-04-15

    Heme oxygenase-1 (HO-1) is an oxidative stress responsive gene upregulated by various physiological and exogenous stimuli. Arsenite, as an oxidative stressor, is a potent inducer of HO-1 in human and rodent cells. In this study, we investigated the mechanistic role of arsenite-induced HO-1 in modulating tumor necrosis factor {alpha} (TNF-{alpha}) induced monocyte adhesion to human umbilical vein endothelial cells (HUVEC). Arsenite pretreatment, which upregulated HO-1 in a time- and concentration-dependent manner, inhibited TNF-{alpha}-induced monocyte adhesion to HUVEC and intercellular adhesion molecule 1 protein expression by 50% and 40%, respectively. Importantly, knockdown of HO-1 by small interfering RNA abolished the arsenite-induced inhibitory effects. These results indicate that induction of HO-1 by arsenite inhibits the cytokine-induced monocyte adhesion to HUVEC by suppressing adhesion molecule expression. These findings established an important mechanistic link between the functional monocyte adhesion properties of HUVEC and the induction of HO-1 by arsenite.

  16. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  17. Genetic and in silico comparative mapping of the polyphenol oxidase gene in bread wheat (Triticum aestivum L.).

    PubMed

    Raman, Rosy; Raman, Harsh; Johnstone, Katie; Lisle, Chris; Smith, Alison; Martin, Peter; Matin, Peter; Allen, Helen

    2005-10-01

    Polyphenol oxidases (PPOs) are involved in the time-dependent darkening and discolouration of Asian noodles and other wheat end products. In this study, a doubled haploid (DH) population derived from Chara (moderately high PPO activity)/WW2449 (low PPO activity) was screened for PPO activity based on L-DOPA and L-tyrosine assays using whole seeds. Both these assays were significantly genetically correlated (r = 0.91) in measuring the PPO activity in this DH population. Quantitative trait loci (QTLs) analysis utilising a skeleton map enabled us to identify a major QTL controlling PPO activity based on L-DOPA and L-tyrosine on the long arm of chromosome 2A. The simple sequence repeat (SSR) marker GWM294b explained over 82% of the line mean phenotypic variation from samples collected in both 2000 and 2003. Four SSR markers were validated for PPO linkage in genetically diverse backgrounds and proven to correctly predict the PPO activity in more than 92% of wheat lines. Physical mapping using deletion lines of Chinese Spring has confirmed the location of the GWM294b, GWM312 and WMC170 on chromosome 2AL, between deletion breakpoints 2AL-C to 0.85. In order to identify functional gene markers, data searches for alignments between rice BAC/PAC clones assembled on chromosome 1 and 4, chromosome 7, and (1) the wheat expressed sequence tags mapped in deletion bin (2AL-C to 0.85) and (2) the coding sequence of a previously cloned wheat PPO gene were made and found significant sequence similarities with the PPO gene or common central domain of tyrosinase. Available PPO gene sequences in the National Centre for Biotechnology Information (NCBI) database have revealed that there is a significant molecular diversity at the nucleotide and amino acid level in the wheat PPO genes.

  18. Gremlin utilizes canonical and non-canonical TGFβ signaling to induce lysyl oxidase (LOX) genes in human trabecular meshwork cells☆

    PubMed Central

    Sethi, Anirudh; Wordinger, Robert J.; Clark, Abbot F.

    2013-01-01

    The TGFβ/BMP signaling pathways are involved in glaucomatous damage to the trabecular meshwork (TM) leading to elevated intraocular pressure (IOP), which is a major risk factor for the development and progression of glaucoma. The BMP antagonist gremlin is elevated in glaucomatous TM cells and tissues and can directly elevate IOP. Gremlin utilizes the TGFβ2/SMAD pathway to induce TM extracellular matrix (ECM) proteins. The purpose of this study is to determine whether expression of the ECM cross-linking lysyl oxidase (LOX) genes is regulated by gremlin in cultured human TM cells. Human TM cells were treated with recombinant gremlin, and expression of the LOX genes was examined by quantitative RT-PCR and western immunoblotting. TM cells were pretreated with TGFBR inhibitors (LY364947 or SB431542), an inhibitor of the SMAD signaling pathway (SIS3), or with JNK (SP600125) and p38 MAPK (SB203580) inhibitors to identify the signaling pathway(s) involved in gremlin induction of LOX protein expression. All five LOX genes (LOX and LOXL1–4) were induced by gremlin. Gremlin induction of LOX genes and protein expression was blocked by TGFBR inhibitors as well as by inhibitors of the SMAD3, JNK and p38 MAPK signaling pathways. We conclude that gremlin employs both canonical TGFβ/SMAD and the non-canonical JNK and p38 MAPK signaling pathways to induce LOX genes and proteins in cultured human TM cells. Increased LOX levels may be at least partially responsible for gremlin-mediated IOP elevation and increased aqueous humor outflow resistance leading to glaucoma. PMID:23748100

  19. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.

    2013-01-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  20. Expressional divergence of insect GOX genes: From specialist to generalist glucose oxidase.

    PubMed

    Yang, Lihong; Wang, Xiongya; Bai, Sufen; Li, Xin; Gu, Shaohua; Wang, Chen-Zhu; Li, Xianchun

    2017-07-01

    Insect herbivores often secrete glucose oxidase (GOX) onto plants to counteract plant defenses and potential pathogens. Whether generalist herbivores always have significantly higher GOX activities than their specialist counterparts at any comparable stage or conditions and how this is realized remain unknown. To address these two general questions, we subjected larvae of a pair of sister species differed mainly in host range, the generalist Helicoverpa armigera and its specialist counterpart Helicoverpa assulta, to the same sets of stage, protein to digestible carbohydrate (P:C) ratio, allelochemical or host plant treatments for simultaneous analyses of GOX transcripts and activities in their labial glands. GOX activity and transcripts are upregulated concurrently with food ingestion and body growth, downregulated with stopping ingestion and wandering for pupation in both species. The three tested host plants upregulated GOX transcripts, and to a lesser extent, GOX activity in both species. There were significant differences in both GOX transcripts and activity elicited by allelochemicals, but only in GOX transcripts by P:C ratios in both species. GOX activities were higher in H. armigera than H. assulta in all the comparable treatments, but GOX transcripts were significantly higher either in generalists or in specialists, depending on the developmental stages, host plants, P:C ratio and allelochemicals they encounter. These data indicate that the greater GOX activity in generalist herbivores is not achieved by greater transcription rate, but by greater transcript stability, greater translation rate, better enzyme stability and/or their combination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Impact of Arsenite on the Bacterial Community Structure and Diversity in Soil

    PubMed Central

    Dong, Dian-Tao; Yamamura, Shigeki; Amachi, Seigo

    2016-01-01

    The impact of arsenite (As[III]) on the bacterial community structure and diversity in soil was determined by incubating soil slurries with 50, 500, and 5,000 μM As(III). As(III) was oxidized to arsenate (As[V]), and the microbial contribution to As(III) oxidation was 70–100%. PCR-denaturing gradient gel electrophoresis revealed that soil bacterial diversity decreased in the presence of As(III). Bacteria closely related to the family Bacillaceae were predominant in slurry spiked with 5,000 μM As(III). The population size of culturable As(III)-resistant bacteria was 37-fold higher in this slurry than in unspiked slurry (p < 0.01), indicating that high levels of As(III) stimulate the emergence of As(III)-resistant bacteria. As(III)-resistant bacteria isolated from slurry spiked with 5,000 μM As(III) were mainly affiliated with the genus Bacillus; however, no strains showed As(III)-oxidizing capacity. An As(III)-oxidizing bacterial community analysis based on As(III) oxidase gene (aioA) sequences demonstrated that diversity was the lowest in slurry spiked with 5,000 μM As(III). The deduced AioA sequences affiliated with Alphaproteobacteria accounted for 91–93% of all sequences in this slurry, among which those closely related to Bosea spp. were predominant (48–86%). These results suggest that exposure to high levels of As(III) has a significant impact on the composition and diversity of the soil bacterial community, including the As(III)-oxidizing bacterial community. Certain As(III)-oxidizing bacteria with strong As(III) resistance may be enriched under high As(III) levels, while more sensitive As(III) oxidizers are eliminated under these conditions. PMID:26903368

  2. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli.

  3. Second-order modeling of arsenite transport in soils

    NASA Astrophysics Data System (ADS)

    Zhang, Hua; Magdi Selim, H.

    2011-11-01

    Rate limited processes including kinetic adsorption-desorption can greatly impact the fate and behavior of toxic arsenic compounds in heterogeneous soils. In this study, miscible displacement column experiments were carried out to investigate the extent of reactivity during transport of arsenite in soils. Arsenite breakthrough curves (BTCs) of Olivier and Windsor soils exhibited strong retardation with diffusive effluent fronts followed by slow release or tailing during leaching. Such behavior is indicative of the dominance of kinetic retention reactions for arsenite transport in the soil columns. Sharp decrease or increase in arsenite concentration in response to flow interruptions (stop-flow) further verified that non-equilibrium conditions are dominant. After some 40-60 pore volumes of continued leaching, 30-70% of the applied arsenite was retained by the soil in the columns. Furthermore, continued arsenite slow release for months was evident by the high levels of residual arsenite concentrations observed during leaching. In contrast, arsenite transport in a reference sand material exhibited no retention where complete mass recovery in the effluent solution was attained. A second-order model (SOM) which accounts for equilibrium, reversible, and irreversible retention mechanisms was utilized to describe arsenite transport results from the soil columns. Based on inverse and predictive modeling results, the SOM model successfully depicted arsenite BTCs from several soil columns. Based on inverse and predictive modeling results, a second-order model which accounts for kinetic reversible and irreversible reactions is recommended for describing arsenite transport in soils.

  4. Characterization of Fasciola hepatica genotypes from cattle and sheep in Iran using cytochrome C oxidase gene (CO1).

    PubMed

    Moazeni, Mohammad; Sharifiyazdi, Hassan; Izadpanah, Afshin

    2012-06-01

    The present study compared the genetic variation among 19 different isolates of Fasciola hepatica from cattle and sheep in different areas of Iran using sequence data for mitochondrial DNA gene, the subunit 1 of cytochrome C oxidase gene (CO1). Four different CO1 genotypes were detected among F. hepatica isolates that showed five variable nucleotide positions (accession nos.; GQ398051, GQ398052, GQ398053, GQ398054). Nucleotide sequence variation among 19 isolates for CO1 analyzed in this study ranged from 0% to 0.98% in Iran. Among the five polymorphism sites identified in this study, only one (T to G at position 51 in 5'end of GQ175362) resulted in putative amino acid alteration of phenylalanine (TTT) to leucine (TTG) in CO1. A phylogenetic analysis of the sequence data revealed that host associations and geographic location are likely not useful markers for Fasciola genotype classification. In addition, morphological analysis showed that the ratios of body length and body width of some (n = 5) of the 19 examined F. hepatica isolates were intermediate between F. hepatica and Fasciola gigantica, representing the substantial polymorphism of the F. hepatica species and the difficulty in the accurate recognition based on morphological features. In conclusion, Iranian F. hepatica exhibited the presence of considerable genetic diversity at CO1.

  5. Tracking the evolution of epialleles during neural differentiation and brain development: D-Aspartate oxidase as a model gene

    PubMed Central

    Florio, Ermanno; Keller, Simona; Coretti, Lorena; Affinito, Ornella; Scala, Giovanni; Errico, Francesco; Fico, Annalisa; Boscia, Francesca; Sisalli, Maria Josè; Reccia, Mafalda Giovanna; Miele, Gennaro; Monticelli, Antonella; Scorziello, Antonella; Lembo, Francesca; Colucci-D'Amato, Luca; Minchiotti, Gabriella; Avvedimento, Vittorio Enrico; Usiello, Alessandro; Cocozza, Sergio; Chiariotti, Lorenzo

    2017-01-01

    ABSTRACT We performed ultra-deep methylation analysis at single molecule level of the promoter region of developmentally regulated D-Aspartate oxidase (Ddo), as a model gene, during brain development and embryonic stem cell neural differentiation. Single molecule methylation analysis enabled us to establish the effective epiallele composition within mixed or pure brain cell populations. In this framework, an epiallele is defined as a specific combination of methylated CpG within Ddo locus and can represent the epigenetic haplotype revealing a cell-to-cell methylation heterogeneity. Using this approach, we found a high degree of polymorphism of methylated alleles (epipolymorphism) evolving in a remarkably conserved fashion during brain development. The different sets of epialleles mark stage, brain areas, and cell type and unravel the possible role of specific CpGs in favoring or inhibiting local methylation. Undifferentiated embryonic stem cells showed non-organized distribution of epialleles that apparently originated by stochastic methylation events on individual CpGs. Upon neural differentiation, despite detecting no changes in average methylation, we observed that the epiallele distribution was profoundly different, gradually shifting toward organized patterns specific to the glial or neuronal cell types. Our findings provide a deep view of gene methylation heterogeneity in brain cell populations promising to furnish innovative ways to unravel mechanisms underlying methylation patterns generation and alteration in brain diseases. PMID:27858532

  6. A wheat aminocyclopropane-1-carboxylate oxidase gene, TaACO1, negatively regulates salinity stress in Arabidopsis thaliana.

    PubMed

    Chen, Donghua; Ma, Xiaoyan; Li, Chunlong; Zhang, Wei; Xia, Guangmin; Wang, Mei

    2014-11-01

    TaACO1 could catalyze ACC into ethylene in vitro. Constitutive expression of TaACO1 in Arabidopsis conferred salt sensitivity, and TaACO1 regulates salt stress mainly via the DREB1/CBF signal transduction pathway. Ethylene signaling plays essential roles in mediating plant responses to biotic and abiotic stresses, besides regulating plant growth and development. The roles of ethylene biosynthesis in abiotic stress, however, remain elusive. In this study, an aminocyclopropane-1-carboxylate oxidase gene, TaACO1, affecting the terminal step in ethylene biosynthesis, was isolated from a salt-tolerant bread wheat introgression line Shanrong No. 3 (SR3) and its effect on salt-stress response was examined. Purified recombinant protein of TaACO1 heterogenously expressed in Escherchia coli could catalyze ACC into ethylene in vitro. TaACO1 transcripts were down-regulated by salt, drought, oxidative stress and ABA. TaACO1-transgenic plants conferred salt sensitivity as judged from the seed germination, cotyledon greening and the relative root growth under salt stress. Constitutive expression of TaACO1 in Arabidopsis increased AtMYB15 expression and suppressed the expression of stress-responsive genes AtRAB18, AtCBF1 and AtCBF3. These findings are helpful in understanding the roles of ethylene biosynthesis in plant salt-stress response.

  7. Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay

    PubMed Central

    He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry

    2011-01-01

    Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

  8. Novel Homozygous Missense Mutation in SPG20 Gene Results in Troyer Syndrome Associated with Mitochondrial Cytochrome c Oxidase Deficiency.

    PubMed

    Spiegel, Ronen; Soiferman, Devorah; Shaag, Avraham; Shalev, Stavit; Elpeleg, Orly; Saada, Ann

    2016-08-19

    Troyer syndrome is an autosomal recessive form of hereditary spastic paraplegia (HSP) caused by deleterious mutations in the SPG20 gene. Although the disease is associated with a loss of function mechanism of spartin, the protein encoded by SPG20, the precise pathogenesis is yet to be elucidated. Recent data indicated an important role for spartin in both mitochondrial maintenance and function. Here we report a child presenting with progressive spastic paraparesis, generalized muscle weakness, dysarthria, impaired growth, and severe isolated decrease in muscle cytochrome c oxidase (COX) activity. Whole exome sequencing identified the homozygous c.988A>G variant in SPG20 gene (p.Met330Val) resulting in almost complete loss of spartin in skeletal muscle. Further analyses demonstrated significant tissue specific reduction of COX 4, a nuclear encoded subunit of COX, in muscle suggesting a role for spartin in proper mitochondrial respiratory chain function mediated by COX activity. Our findings need to be verified in other Troyer syndrome patients in order to classify it as a form of HSP caused by mitochondrial dysfunction.

  9. Apparent selection intensity for the cytochrome oxidase subunit I gene varies with mode of reproduction in echinoderms.

    PubMed

    Foltz, David W; Hrincevich, Adam W; Rocha-Olivares, Axayácatl

    2004-10-01

    When most amino acid substitutions in protein-coding genes are slightly deleterious rather than selectively neutral, life history differences can potentially modify the effective population size or the selective regime, resulting in altered ratios of non-synonymous to synonymous substitutions among taxa. We studied substitution patterns for the mitochondrial cytochrome oxidase subunit I (COI) gene in a sea star genus (Leptasterias spp.) with an obligate brood-protecting mode of reproduction and small-scale population genetic subdivision, and compared the results to available COI sequences in nine other genera of echinoderms with pelagic larvae: three sea stars, five sea urchins and one brittle star. We predicted that this life history difference would be associated with differences in the ratio of non-synonymous (dN) to synonymous (dS) substitution rates. Leptasterias had a significantly greater dN/dS ratio (both between species and within species), a significantly smaller transition/transversion rate ratio, and a significantly lower average nucleotide diversity within species, than did the non-brooding genera. Other explanations for the results, such as altered mutation rates or selective sweeps, were not supported by the data analysis. These findings highlight the potential influence of reproductive traits and other life history factors on patterns of nucleotide substitution within and between species.

  10. ACC oxidase genes expressed in the wood-forming tissues of loblolly pine (Pinus taeda L.) include a pair of nearly identical paralogs (NIPs).

    PubMed

    Yuan, S; Wang, Y; Dean, J F D

    2010-03-15

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final reaction of the ethylene biosynthetic pathway, converting the unusual cyclic amino acid, ACC, into ethylene. Past studies have shown a possible link between ethylene and compression wood formation in conifers, but the relationship has received no more than modest study at the gene expression level. In this study, a cDNA clone encoding a putative ACC oxidase, PtACO1, was isolated from a cDNA library produced using mRNA from lignifying xylem of loblolly pine (Pinus taeda) trunk wood. The cDNA clone comprised an open reading frame of 1461 bp encoding a protein of 333 amino acids. Using PCR amplification techniques, a genomic clone corresponding to PtACO1 was isolated and shown to contain three introns with typical GT/AG boundaries defining the splice junctions. The PtACO1 gene product shared 70% identity with an ACC oxidase from European white birch (Betula pendula), and phylogenetic analyses clearly placed the gene product in the ACC oxidase cluster of the Arabidopsis thaliana 2-oxoglutarate-dependent dioxygenase superfamily tree. The PtACO1 sequence was used to identify additional ACC oxidase clones from loblolly pine root cDNA libraries characterized as part of an expressed sequence tag (EST) discovery project. The PtACO1 sequence was also used to recover additional paralogous sequences from genomic DNA, one of which (PtACO2) turned out to be >98% identical to PtACO1 in the nucleotide coding sequence, leading to its classification as a "nearly identical paralog" (NIP). Quantitative PCR analyses showed that the expression level of PtACO1-like transcripts varied in different tissues, as well as in response to hormonal treatments and bending. Possible roles for PtACO1 in compression wood formation in loblolly pine and the discovery of its NIP are discussed in light of these results.

  11. Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity

    PubMed Central

    Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra

    2015-01-01

    Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal

  12. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  13. The P450-4 gene of Gibberella fujikuroi encodes ent-kaurene oxidase in the gibberellin biosynthesis pathway.

    PubMed

    Tudzynski, B; Hedden, P; Carrera, E; Gaskin, P

    2001-08-01

    At least five genes of the gibberellin (GA) biosynthesis pathway are clustered on chromosome 4 of Gibberella fujikuroi; these genes encode the bifunctional ent-copalyl diphosphate synthase/ent-kaurene synthase, a GA-specific geranylgeranyl diphosphate synthase, and three cytochrome P450 monooxygenases. We now describe a fourth cytochrome P450 monooxygenase gene (P450-4). Gas chromatography-mass spectrometry analysis of extracts of mycelia and culture fluid of a P450-4 knockout mutant identified ent-kaurene as the only intermediate of the GA pathway. Incubations with radiolabeled precursors showed that the metabolism of ent-kaurene, ent-kaurenol, and ent-kaurenal was blocked in the transformants, whereas ent-kaurenoic acid was metabolized efficiently to GA(4). The GA-deficient mutant strain SG139, which lacks the 30-kb GA biosynthesis gene cluster, converted ent-kaurene to ent-kaurenoic acid after transformation with P450-4. The B1-41a mutant, described as blocked between ent-kaurenal and ent-kaurenoic acid, was fully complemented by P450-4. There is a single nucleotide difference between the sequence of the B1-41a and wild-type P450-4 alleles at the 3' consensus sequence of intron 2 in the mutant, resulting in reduced levels of active protein due to a splicing defect in the mutant. These data suggest that P450-4 encodes a multifunctional ent-kaurene oxidase catalyzing all three oxidation steps between ent-kaurene and ent-kaurenoic acid.

  14. Quantitative transcriptome, proteome, and sulfur metabolite profiling of the Saccharomyces cerevisiae response to arsenite.

    PubMed

    Thorsen, Michael; Lagniel, Gilles; Kristiansson, Erik; Junot, Christophe; Nerman, Olle; Labarre, Jean; Tamás, Markus J

    2007-06-19

    Arsenic is ubiquitously present in nature, and various mechanisms have evolved enabling cells to evade toxicity and acquire tolerance. Herein, we explored how Saccharomyces cerevisiae (budding yeast) respond to trivalent arsenic (arsenite) by quantitative transcriptome, proteome, and sulfur metabolite profiling. Arsenite exposure affected transcription of genes encoding functions related to protein biosynthesis, arsenic detoxification, oxidative stress defense, redox maintenance, and proteolytic activity. Importantly, we observed that nearly all components of the sulfate assimilation and glutathione biosynthesis pathways were induced at both gene and protein levels. Kinetic metabolic profiling evidenced a significant increase in the pools of sulfur metabolites as well as elevated cellular glutathione levels. Moreover, the flux in the sulfur assimilation pathway as well as the glutathione synthesis rate strongly increased with a concomitant reduction of sulfur incorporation into proteins. By combining comparative genomics and molecular analyses, we pinpointed transcription factors that mediate the core of the transcriptional response to arsenite. Taken together, our data reveal that arsenite-exposed cells channel a large part of assimilated sulfur into glutathione biosynthesis, and we provide evidence that the transcriptional regulators Yap1p and Met4p control this response in concert.

  15. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

    Treesearch

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

    2004-01-01

    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  16. Arsenite oxidation regulator AioR regulates bacterial chemotaxis towards arsenite in Agrobacterium tumefaciens GW4

    PubMed Central

    Shi, Kaixiang; Fan, Xia; Qiao, Zixu; Han, Yushan; McDermott, Timothy R.; Wang, Qian; Wang, Gejiao

    2017-01-01

    Some arsenite [As(III)]-oxidizing bacteria exhibit positive chemotaxis towards As(III), however, the related As(III) chemoreceptor and regulatory mechanism remain unknown. The As(III)-oxidizing bacterium Agrobacterium tumefaciens GW4 displays positive chemotaxis towards 0.5–2 mM As(III). Genomic analyses revealed a putative chemoreceptor-encoding gene, mcp, located in the arsenic gene island and having a predicted promoter binding site for the As(III) oxidation regulator AioR. Expression of mcp and other chemotaxis related genes (cheA, cheY2 and fliG) was inducible by As(III), but not in the aioR mutant. Using capillary assays and intrinsic tryptophan fluorescence spectra analysis, Mcp was confirmed to be responsible for chemotaxis towards As(III) and to bind As(III) (but not As(V) nor phosphate) as part of the sensing mechanism. A bacterial one-hybrid system technique and electrophoretic mobility shift assays showed that AioR interacts with the mcp regulatory region in vivo and in vitro, and the precise AioR binding site was confirmed using DNase I foot-printing. Taken together, these results indicate that this Mcp is responsible for the chemotactic response towards As(III) and is regulated by AioR. Additionally, disrupting the mcp gene affected bacterial As(III) oxidation and growth, inferring that Mcp may exert some sort of functional connection between As(III) oxidation and As(III) chemotaxis. PMID:28256605

  17. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA

    PubMed Central

    2004-01-01

    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354→Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [35S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  18. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients

    PubMed Central

    Nucci, Laura A.; Santos, Sidnéia S.; Brunialti, Milena K. C.; Sharma, Narendra Kumar; Machado, Flavia R.; Assunção, Murillo; de Azevedo, Luciano C. P.

    2017-01-01

    Background and objectives Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients. Materials and methods Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0), and after 7 days (D7, N = 10) of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant. Results Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients. Conclusion Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by

  19. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

    2013-01-01

    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  20. Characterization of the regulatory and expression context of an alternative oxidase gene provides insights into cyanide-insensitive respiration during growth and development.

    PubMed

    Ho, Lois H M; Giraud, Estelle; Lister, Ryan; Thirkettle-Watts, David; Low, Jasmine; Clifton, Rachel; Howell, Katharine A; Carrie, Chris; Donald, Tamzin; Whelan, James

    2007-04-01

    Alternative oxidase (AOX) is encoded in small multigene families in plants. Functional analysis of the Arabidopsis (Arabidopsis thaliana) alternative oxidase 1c (AtAOX1c) promoter, an AOX gene not induced by oxidative stress, indicated that regulation of expression was complex, with the upstream promoter region containing positive and negative response regions. Comparison to the promoter region of soybean (Glycine max) alternative oxidase 2b (GmAOX2b), another AOX gene not induced by oxidative stress, revealed that they contained seven sequence elements in common. All elements were active in the promoter region of AtAOX1c in suspension cells and in leaf tissue from Columbia and mutant plants, where a mitochondrial protein import receptor was inactivated. Analysis of coexpressed and putatively coregulated genes, the latter defined as containing five or more sequence elements functional in AtAOX1c, indicated that AtAOX1c was coregulated with components involved with cell division and growth. Consistent with this analysis, we demonstrated that site II elements, previously shown to regulate the proliferating cell nuclear antigen, are present in the upstream promoter region of AtAOX1c and were strong negative regulators of AtAOX1c expression. It was demonstrated that NDB4, a gene encoding an external NAD(P)H dehydrogenase, displayed strong coexpression with AtAOX1c. Overall, these results indicate that AtAOX1c is regulated by growth and developmental signals.

  1. Polymorphisms in the canine monoamine oxidase a (MAOA) gene: identification and variation among five broad dog breed groups.

    PubMed

    Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael

    2017-01-01

    In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.

  2. Association of Lysyl Oxidase-Like 1 Gene Polymorphism in Turkish Patients With Pseudoexfoliation Syndrome and Pseudoexfoliation Glaucoma.

    PubMed

    Asfuroglu, Mahmut; Cavdarli, Busranur; Koz, Ozlem G; A Yarangumeli, Ahmet; Ozdemir, Emine Y

    2017-02-01

    To investigate the genetic association of lysyl oxidase-like 1 (LOXL1) gene polymorphisms in patients with pseudoexfoliation (PEX) syndrome and PEX glaucoma of Turkish descent. Three LOXL1 single nucleotide polymorphisms (SNPs) (rs1048661, rs3825942, and rs2165241) were analyzed in 109 Turkish patients (44 patients with PEX syndrome, 65 patients with PEX glaucoma) and 47 healthy subjects. "A" allele of SNP rs3825942 was underrepresented in control group compared with the glaucoma [odds ratio (OR)=4.5, confidence interval (CI): 95%] and syndrome (OR=4.5, CI: 95%) groups. "AA+AG" genotype of SNP rs3825942 was more frequent in the syndrome group (OR=10, CI: 95%) rather than the control group. "GT" genotype of SNP rs1048661 was presented less frequently in the control group compared with the glaucoma group (OR=4.25, CI: 95%). "T" allele of SNP rs1048661 was more frequent in glaucoma group (OR=2.05, CI: 95%) compared with control group. "T" allele of SNP rs2165241 was more frequent in the syndrome (OR=2.59, CI: 95%) and the glaucoma group (OR=3.78, CI: 95%) compared with the control group. "TT" genotype of SNP rs2165241 was underrepresented in control group compared with the syndrome (OR=3.85, CI: 95%) and the glaucoma (OR=6.58, CI: 95%) group. Findings of this current study indicate a different LOXL1 gene expression pattern compared with a recent study that was also performed in the Turkish population. Other gene replication studies are required to accurately assess genetic factors in the pathogenesis of PEX syndrome and glaucoma.

  3. Silver nanoparticle exposure in pregnant rats increases gene expression of tyrosine hydroxylase and monoamine oxidase in offspring brain.

    PubMed

    Fatemi Tabatabaie, Seyed Reza; Mehdiabadi, Babak; Mori Bakhtiari, Najmeh; Tabandeh, Mohammad Reza

    2017-10-01

    Maternal exposure to silver nanoparticles (AgNPs) affects neurobehavioral reflexes and spatial memory formation in offspring. Although the transmission of AgNPs into the brain has been reported, its toxic effect on dopamine metabolism in the brain of offspring has not been studied so far. The aim of the present study was to investigate the expression levels of tyrosine hydroxylase (TH) and monoamine oxidase A (MAO-A) genes in the brain of offspring exposed in utero to various concentrations of AgNPs. Time mated pregnant adult rats were assigned into three groups including control, low dose of AgNPs (0.2 mg/kg) and high dose of AgNPs (2 mg/kg). AgNPs were subcutaneously (SC) injected at days of 1, 4, 7, 10, 13, 16 and 19 of pregnancy. Gene expression of TH and MAO-A was analyzed in the brain of offspring (male and female) at days of 1, 7, 14 and 21 after birth. Administration of AgNPs to pregnant rats in a time- and dose-dependent manner increased the expression levels of TH in the brain of male and female pups at all tested days after birth (p < 0.05). AgNPs had stimulatory effect on MAO-A mRNA expression in pups only at the age of 7 and 14. Female pups showed the higher level of TH and MAO-A compared to that in male pups (p < 0.001). Results obtained here demonstrated that the exposure of pregnant rats to AgNPs increases the expression of genes involved in dopamine metabolism in the brain of offspring.

  4. Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite permeability and tolerance in plants.

    PubMed

    Mosa, Kareem A; Kumar, Kundan; Chhikara, Sudesh; Mcdermott, Joseph; Liu, Zijuan; Musante, Craig; White, Jason C; Dhankher, Om Parkash

    2012-12-01

    Rice accumulates high level of arsenic (As) in its edible parts and thus plays an important role in the transfer of As into the food chain. However, the mechanisms of As uptake and its detoxification in rice are not well understood. Recently, members of the Nodulin 26-like intrinsic protein (NIP) subfamily of plant aquaporins were shown to transport arsenite in rice and Arabidopsis. Here we report that members of the rice plasma membrane intrinsic protein (PIP) subfamily are also involved in As tolerance and transport. Based on the homology search with the mammalian AQP9 and yeast Fps1 arsenite transporters, we identified and cloned five rice PIP gene subfamily members. qRT-PCR analysis of PIPs in rice root and shoot tissues revealed a significant down regulation of transcripts encoding OsPIP1;2, OsPIP1;3, OsPIP2;4, OsPIP2;6, and OsPIP2;7 in response to arsenite treatment. Heterologous expression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Xenopus laevis oocytes significantly increased the uptake of arsenite. Overexpression of OsPIP2;4, OsPIP2;6, and OsPIP2;7 in Arabidopsis yielded enhanced arsenite tolerance and higher biomass accumulation. Further, these transgenic plants showed no significant accumulation of As in shoot and root tissues in long term uptake assays. Whereas, short duration exposure to arsenite caused both active influx and efflux of As in the roots. The data suggests a bidirectional arsenite permeability of rice PIPs in plants. These rice PIPs genes will be highly useful for engineering important food and biofuel crops for enhanced crop productivity on contaminated soils without increasing the accumulation of toxic As in the biomass or edible tissues.

  5. From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.

    PubMed

    Luz, Anthony L; Godebo, Tewodros R; Bhatt, Dhaval P; Ilkayeva, Olga R; Maurer, Laura L; Hirschey, Matthew D; Meyer, Joel N

    2016-08-01

    Millions of people worldwide are chronically exposed to arsenic through contaminated drinking water. Despite decades of research studying the carcinogenic potential of arsenic, the mechanisms by which arsenic causes cancer and other diseases remain poorly understood. Mitochondria appear to be an important target of arsenic toxicity. The trivalent arsenical, arsenite, can induce mitochondrial reactive oxygen species production, inhibit enzymes involved in energy metabolism, and induce aerobic glycolysis in vitro, suggesting that metabolic dysfunction may be important in arsenic-induced disease. Here, using the model organism Caenorhabditis elegans and a novel metabolic inhibition assay, we report an in vivo induction of aerobic glycolysis following arsenite exposure. Furthermore, arsenite exposure induced severe mitochondrial dysfunction, including altered pyruvate metabolism; reduced steady-state ATP levels, ATP-linked respiration and spare respiratory capacity; and increased proton leak. We also found evidence that induction of autophagy is an important protective response to arsenite exposure. Because these results demonstrate that mitochondria are an important in vivo target of arsenite toxicity, we hypothesized that deficiencies in mitochondrial electron transport chain genes, which cause mitochondrial disease in humans, would sensitize nematodes to arsenite. In agreement with this, nematodes deficient in electron transport chain complexes I, II, and III, but not ATP synthase, were sensitive to arsenite exposure, thus identifying a novel class of gene-environment interactions that warrant further investigation in the human populace. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

    PubMed

    Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

    2008-02-01

    The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.

  7. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.

    PubMed

    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

    2014-08-01

    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures. © 2014 The Royal Entomological Society.

  8. Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants.

    PubMed Central

    Wu, G; Shortt, B J; Lawrence, E B; Levine, E B; Fitzsimmons, K C; Shah, D M

    1995-01-01

    Plant defense responses to pathogen infection involve the production of active oxygen species, including hydrogen peroxide (H2O2). We obtained transgenic potato plants expressing a fungal gene encoding glucose oxidase, which generates H2O2 when glucose is oxidized. H2O2 levels were elevated in both leaf and tuber tissues of these plants. Transgenic potato tubers exhibited strong resistance to a bacterial soft rot disease caused by Erwinia carotovora subsp carotovora, and disease resistance was sustained under both aerobic and anaerobic conditions of bacterial infection. This resistance to soft rot was apparently mediated by elevated levels of H2O2, because the resistance could be counteracted by exogenously added H2O2-degrading catalase. The transgenic plants with increased levels of H2O2 also exhibited enhanced resistance to potato late blight caused by Phytophthora infestans. The development of lesions resulting from infection by P. infestans was significantly delayed in leaves of these plants. Thus, the expression of an active oxygen species-generating enzyme in transgenic plants represents a novel approach for engineering broad-spectrum disease resistance in plants. PMID:8589621

  9. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

  10. Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

    PubMed

    Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

    2013-07-01

    Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

  11. SAM levels, gene expression of SAM synthetase, methionine synthase and ACC oxidase, and ethylene emission from N. suaveolens flowers.

    PubMed

    Roeder, Susanna; Dreschler, Katharina; Wirtz, Markus; Cristescu, Simona M; van Harren, Frans J M; Hell, Rüdiger; Piechulla, Birgit

    2009-07-01

    S'adenosyl-L: -methionine (SAM) is a ubiquitous methyl donor and a precursor in the biosynthesis of ethylene, polyamines, biotin, and nicotianamine in plants. Only limited information is available regarding its synthesis (SAM cycle) and its concentrations in plant tissues. The SAM concentrations in flowers of Nicotiana suaveolens were determined during day/night cycles and found to fluctuate rhythmically between 10 and 50 nmol g(-1) fresh weight. Troughs of SAM levels were measured in the evening and night, which corresponds to the time when the major floral scent compound, methyl benzoate, is synthesized by a SAM dependent methyltransferase (NsBSMT) and when this enzyme possesses its highest activity. The SAM synthetase (NsSAMS1) and methionine synthase (NsMS1) are enzymes, among others, which are involved in the synthesis and regeneration of SAM. Respective genes were isolated from a N. suaveolens petal cDNA library. Transcript accumulation patterns of both SAM regenerating enzymes matched perfectly those of the bifunctional NsBSMT; maximum mRNA accumulations of NsMS1 and NsSAMS1 were attained in the evening. Ethylene, which is synthesized from SAM, reached only low levels of 1-2 ppbv in N. suaveolens flowers. It is emitted in a burst at the end of the life span of the flowers, which correlates with the increased expression of the 1-aminocyclopropane-1-carboxylate oxidase (NsACO).

  12. Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene.

    PubMed

    Sánchez, Elizabeth; Cáceres, Omar; Náquira, César; Garcia, David; Patiño, Gladys; Silvia, Herrera; Volotão, Aline C; Fernandes, Octavio

    2010-09-01

    Echinococcus granulosus, the etiologic agent of cystic echinococcosis (CE) in humans and other animal species, is distributed worldwide. Ten intra-specific variants, or genotypes (G1-G10), have been defined based on genetic diversity. To determine the genotypes present in endemic areas of Peru, samples were collected from cattle (44), sheep (41) and humans (14) from Junín, Puno Huancavelica, Cusco, Arequipa and Ayacucho. DNA was extracted from protoscolex and/or germinal layers derived from 99 E. granulosus isolates and used as templates to amplify the mitochondrial cytochrome C oxidase subunit 1 gene. The resulting polymerase chain reaction products were sequenced and further examined by sequence analysis. All isolates, independent of the host, exhibited the G1 genotype. Phylogenetic analysis showed that three isolates from Ayacucho shared the same cluster with microvariant G1(4). The G1 genotype is considered the most widespread and infectious form of E. granulosus worldwide and our results confirm that the same patterns apply to this country. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for CE in Peru.

  13. Genome Sequence of the Facultative Anaerobic Arsenite-Oxidizing and Nitrate-Reducing Bacterium Acidovorax sp. Strain NO1

    PubMed Central

    Huang, Yinyan; Li, Hang; Rensing, Christopher; Zhao, Kai; Johnstone, Laurel

    2012-01-01

    Acidovorax sp. strain NO1, isolated from gold mine soil, was shown to be a facultative anaerobic arsenite-oxidizing and nitrate-reducing bacterium. The reported draft genome predicts the presence of genes involved in arsenic metabolism, nitrate reduction, phosphate transport, and multiple metal resistances and indicates putative horizontal gene transfer events. PMID:22374962

  14. Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

    PubMed

    Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

    2012-12-30

    The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism.

  15. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  16. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  17. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  18. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR.

    PubMed

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji

    2017-10-01

    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. Copyright © 2012 Elsevier

  20. Overexpression of the gibberellin 2-oxidase gene from Torenia fournieri induces dwarf phenotypes in the liliaceous monocotyledon Tricyrtis sp.

    PubMed

    Otani, Masahiro; Meguro, Shuhei; Gondaira, Haruka; Hayashi, Megumi; Saito, Misaki; Han, Dong-Sheng; Inthima, Phithak; Supaibulwatana, Kanyaratt; Mori, Shiro; Jikumaru, Yusuke; Kamiya, Yuji; Li, Tuoping; Niki, Tomoya; Nishijima, Takaaki; Koshioka, Masaji; Nakano, Masaru

    2013-11-01

    Gibberellins (GAs) are the plant hormones that control many aspects of plant growth and development, including stem elongation. Genes encoding enzymes related to the GA biosynthetic and metabolic pathway have been isolated and characterized in many plant species. Gibberellin 2-oxidase (GA2ox) catalyzes bioactive GAs or their immediate precursors to inactive forms; therefore, playing a direct role in determining the levels of bioactive GAs. In the present study, we produced transgenic plants of the liliaceous monocotyledon Tricyrtis sp. overexpressing the GA2ox gene from the linderniaceous dicotyledon Torenia fournieri (TfGA2ox2). All six transgenic plants exhibited dwarf phenotypes, and they could be classified into two classes according to the degree of dwarfism: three plants were moderately dwarf and three were severely dwarf. All of the transgenic plants had small or no flowers, and smaller, rounder and darker green leaves. Quantitative real-time reverse transcription-polymerase chain reaction (PCR) analysis showed that the TfGA2ox2 expression level generally correlated with the degree of dwarfism. The endogenous levels of bioactive GAs, GA1 and GA4, largely decreased in transgenic plants as shown by liquid chromatography-mass spectrometry (LC-MS) analysis, and the level also correlated with the degree of dwarfism. Exogenous treatment of transgenic plants with gibberellic acid (GA3) resulted in an increased shoot length, indicating that the GA signaling pathway might normally function in transgenic plants. Thus, morphological changes in transgenic plants may result from a decrease in the endogenous levels of bioactive GAs. Finally, a possibility of molecular breeding for plant form alteration in liliaceous ornamental plants by genetically engineering the GA metabolic pathway is discussed. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Reconstructing Mammalian Phylogenies: A Detailed Comparison of the Cytochrome b and Cytochrome Oxidase Subunit I Mitochondrial Genes

    PubMed Central

    Tobe, Shanan S.; Kitchener, Andrew C.; Linacre, Adrian M. T.

    2010-01-01

    The phylogeny and taxonomy of mammalian species were originally based upon shared or derived morphological characteristics. However, genetic analyses have more recently played an increasingly important role in confirming existing or establishing often radically different mammalian groupings and phylogenies. The two most commonly used genetic loci in species identification are the cytochrome oxidase I gene (COI) and the cytochrome b gene (cyt b). For the first time this study provides a detailed comparison of the effectiveness of these two loci in reconstructing the phylogeny of mammals at different levels of the taxonomic hierarchy in order to provide a basis for standardizing methodologies in the future. Interspecific and intraspecific variation is assessed and for the first time, to our knowledge, statistical confidence is applied to sequence comparisons. Comparison of the DNA sequences of 217 mammalian species reveals that cyt b more accurately reconstructs their phylogeny and known relationships between species based on other molecular and morphological analyses at Super Order, Order, Family and generic levels. Cyt b correctly assigned 95.85% of mammal species to Super Order, 94.31% to Order and 98.16% to Family compared to 78.34%, 93.36% and 96.93% respectively for COI. Cyt b also gives better resolution when separating species based on sequence data. Using a Kimura 2-parameter p-distance (x100) threshold of 1.5–2.5, cyt b gives a better resolution for separating species with a lower false positive rate and higher positive predictive value than those of COI. PMID:21152400

  2. A rice semi-dwarf gene, Tan-Ginbozu (D35), encodes the gibberellin biosynthesis enzyme, ent-kaurene oxidase.

    PubMed

    Itoh, Hironori; Tatsumi, Tomoko; Sakamoto, Tomoaki; Otomo, Kazuko; Toyomasu, Tomonobu; Kitano, Hidemi; Ashikari, Motoyuki; Ichihara, Shigeyuki; Matsuoka, Makoto

    2004-03-01

    A rice (Oryza sativa L.) semi-dwarf cultivar, Tan-Ginbozu (d35Tan-Ginbozu), contributed to the increase in crop productivity in Japan in the 1950s. Previous studies suggested that the semi-dwarf stature of d35Tan-Ginbozu is caused by a defective early step of gibberellin biosynthesis, which is catalyzed by ent-kaurene oxidase (KO). To study the molecular characteristics of d35Tan-Ginbozu, we isolated 5 KO-like (KOL) genes from the rice genome, which encoded proteins highly homologous to Arabidopsis and pumpkin KOs. The genes (OsKOL1 to 5) were arranged as tandem repeats in the same direction within a 120 kb sequence. Expression analysis revealed that OsKOL2 and OsKOL4 were actively transcribed in various organs, while OsKOL1 and OsKOL5 were expressed only at low levels; OsKOL3 may be a pseudogene. Sequence analysis and complementation experiments demonstrated that OsKOL2 corresponds to D35. Homozygote with null alleles of D35 showed a severe dwarf phenotype; therefore, d35Tan-Ginbozu is a weak allele of D35. Introduction of OsKOL4 into d35Tan-Ginbozu did not rescue its dwarf phenotype, indicating that OsKOL4 is not involved in GA biosynthesis. OsKOL4 and OsKOL5 are likely to take part in phytoalexin biosynthesis, because their expression was promoted by UV irradiation and/or elicitor treatment. Comparing d35Tan-Ginbozu with other high yielding cultivars, we discuss strategies to produce culm architectures suitable for high crop yield by decreasing GA levels.

  3. Current issues in species identification for forensic science and the validity of using the cytochrome oxidase I (COI) gene.

    PubMed

    Wilson-Wilde, Linzi; Norman, Janette; Robertson, James; Sarre, Stephen; Georges, Arthur

    2010-09-01

    Species identification techniques commonly utilized in Australian Forensic Science laboratories are gel immunodifussion antigen antibody reactions and hair comparison analysis. Both of these techniques have significant limitations and should be considered indicative opinion based tests. The Barcode of Life Initiative aims to sequence a section of DNA (~648 base pairs) for the Cytochrome Oxidase I mitochondrial gene (COI) in all living species on Earth, with the data generated being uploaded to the Barcode of Life Database (BOLD) which can then be used for species identification. The COI gene therefore offers forensics scientists an opportunity to use the marker to analyze unknown samples and compare sequences generated in BOLD. Once sequences from enough species are on the database, it is anticipated that routine identification of an unknown species may be possible. However, most forensic laboratories are not yet suited to this type of analysis and do not have the expertise to fully interpret the implications of matches and non matches involving a poorly sampled taxa (for example where there are cryptic species) and in providing the required opinion evidence. Currently, the use of BOLD is limited by the number of relevant species held in the database and the quality assurance and regulation of sequences that are there. In this paper, the COI methodology and BOLD are tested on a selection of introduced and Australian mammals in a forensic environment as the first step necessary in the implementation of this approach in the Australian context. Our data indicates that the COI methodology performs well on distinct species but needs further exploration when identifying more closely related species. It is evident from our study that changes will be required to implement DNA based wildlife forensics using the BOLD approach for forensic applications and recommendations are made for the future adoption of this technology into forensic laboratories.

  4. Pear ACO genes encoding putative 1-aminocyclopropane-1-carboxylate oxidase homologs are functionally expressed during fruit ripening and involved in response to salicylic acid.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2012-10-01

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final reaction of the ethylene biosynthetic pathway, converting ACC into ethylene. Past studies have shown a possible link between ACC oxidase and salicylic acid during fruit ripening in pear, but the relationship has received no more than modest study at the gene expression level. In this study, two cDNA clones encoding putative ACC oxidase, PpACO1 and PpACO2, were isolated from a cDNA library constructed by our own laboratory and produced using mRNA from mesocarp of pear (Pyrus pyrifolia Nakai. cv.Whangkeumbae). One cDNA clone, designated PpACO1 (GenBank accession No. JN807390), comprised an open reading frame of 945 bp encoding a protein of 314 amino acids. The other cDNA, designated PpACO2 (GenBank accession No. JN807392), encodes a protein with 322 amino acids that shares high similarity with the known plant ACOs. Using PCR amplification techniques, two genomic clones corresponding to PpACO1 and PpACO2 were isolated and shown to contain independently three introns with typical GT/AG boundaries defining the splice junctions. The PpACO1 gene product shared 99 % identity with an ACC oxidase from pear (Pyrus × bretschneideri Rehd.cv.Yali), and phylogenetic analyses clearly placed the gene product in the ACC oxidase cluster of the pear 2-oxoglutarate-dependent dioxygenase superfamily tree. Quantitative RT-PCR analysis indicated that the two PpACO genes are differentially expressed in pear tissues. PpACO1 and PpACO2 were predominantly expressed in fruit. The transcripts of PpACO1 were accumulated at relatively low levels in early fruit, but strongly high levels in fruit ripening and senescence stages, while the transcripts of PpACO2 were accumulated at higher levels in early fruit and much lower levels with further fruit cell development than the transcripts of PpACO1. In addition, PpACO1 gene was down-regulated in fruit by salicylic acid (SA). Nevertheless, PpACO2 gene was dramatically up-regulated in

  5. Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

    PubMed

    Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

    2011-03-01

    "Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

  6. Terminal Oxidase Diversity and Function in “Metallosphaera yellowstonensis”: Gene Expression and Protein Modeling Suggest Mechanisms of Fe(II) Oxidation in the Sulfolobales▿ †

    PubMed Central

    Kozubal, M. A.; Dlakić, M.; Macur, R. E.; Inskeep, W. P.

    2011-01-01

    “Metallosphaera yellowstonensis” is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b558/566, several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic

  7. Monoamine Oxidase A and B Gene Polymorphisms and Negative and Positive Symptoms in Schizophrenia

    PubMed Central

    Camarena, Beatriz; Fresán, Ana; Aguilar, Alejandro; Escamilla, Raúl; Saracco, Ricardo; Palacios, Jorge; Tovilla, Alfonso; Nicolini, Humberto

    2012-01-01

    Given that schizophrenia is a heterogeneous disorder, the analysis of clinical characteristics could help to identify homogeneous phenotypes that may be of relevance in genetic studies. Linkage and association studies have suggested that a locus predisposing to schizophrenia may reside within Xp11. We analyzed uVNTR and rs1137070, polymorphisms from MAOA and rs1799836 of MAOB genes to perform single SNP case-control association study in a sample of 344 schizophrenia patients and 124 control subjects. Single polymorphism analysis of uVNTR, rs1137070 and rs1799836 SNPs did not show statistical differences between cases and controls. Multivariate ANOVA analysis of clinical characteristics showed statistical differences between MAOB/rs1799836 and affective flattening scores (F = 4.852, P = 0.009), and significant association between MAOA/uVNTR and affective flattening in female schizophrenia patients (F = 4.236, P = 0.016) after Bonferroni's correction. Our preliminary findings could suggest that severity of affective flattening may be associated by modifier variants of MAOA and MAOB genes in female Mexican patients with schizophrenia. However, further large-scale studies using quantitative symptom-based phenotypes and several candidate variants should be analyzed to obtain a final conclusion. PMID:23738213

  8. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  9. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

    PubMed

    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

    2013-10-01

    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

  10. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  11. Functional expression of the Acanthamoeba castellanii alternative oxidase in Escherichia coli; regulation of the activity and evidence for Acaox gene function.

    PubMed

    Antos-Krzeminska, Nina; Jarmuszkiewicz, Wieslawa

    2014-06-01

    To evidence Acanthamoeba castellanii alternative oxidase (AcAOX) gene product function, we studied alterations in the levels of mRNA and protein and AcAOX activity during growth in amoeba batch culture. Moreover, heterologous expression of AcAOX in AOX-deficient Escherichia coli confirmed by the protein immunodetection and functional studies was performed. Despite the presence of native bo and bd quinol oxidases in E. coli membrane, from which the latter is known to be cyanide-resistant, functional expression of AcAOX in E. coli conferred cyanide-resistant benzohydroxamate-sensitive respiration on the bacteria. Moreover, AcAOX activity in transformed bacteria was stimulated by GMP and inhibited by ATP, indicating that AcAOX is regulated by mutual exclusion of purine nucleotides, which was previously demonstrated in the mitochondria of A. castellanii.

  12. Chemolithoautotrophic arsenite oxidation by a thermophilic Anoxybacillus flavithermus strain TCC9-4 from a hot spring in Tengchong of Yunnan, China

    PubMed Central

    Jiang, Dawei; Li, Ping; Jiang, Zhou; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Guo, Qinghai; Wang, Yanxin

    2015-01-01

    A new facultative chemolithoautotrophic arsenite (AsIII)-oxidizing bacterium TCC9-4 was isolated from a hot spring microbial mat in Tengchong of Yunnan, China. This strain could grow with AsIII as an energy source, CO2–HCO3- as a carbon source and oxygen as the electron acceptor in a minimal salts medium. Under chemolithoautotrophic conditions, more than 90% of 100 mg/L AsIII could be oxidized by the strain TCC9-4 in 36 h. Temperature was an important environmental factor that strongly influenced the AsIII oxidation rate and AsIII oxidase (Aio) activity; the highest Aio activity was found at the temperature of 40∘C. Addition of 0.01% yeast extract enhanced the growth significantly, but delayed the AsIII oxidation. On the basis of 16S rRNA phylogenetic sequence analysis, strain TCC9-4 was identified as Anoxybacillus flavithermus. To our best knowledge, this is the first report of arsenic (As) oxidation by A. flavithermus. The Aio gene in TCC9-4 might be quite novel relative to currently known gene sequences. The results of this study expand our current understanding of microbially mediated As oxidation in hot springs. PMID:25999920

  13. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    PubMed

    He, X Y; He, Z H; Zhang, L P; Sun, D J; Morris, C F; Fuerst, E P; Xia, X C

    2007-06-01

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the present study, complete genomic DNA sequences of two PPO genes, one each located on chromosomes 2A and 2D and their allelic variants were characterized by means of in silico cloning and experimental validation. Sequences were aligned at both DNA and protein levels. Two haplotypes on chromosome 2D showed 95.2% sequence identity at the DNA level, indicating much more sequence diversity than those on chromosome 2A with 99.6% sequence identity. Both of the PPO genes on chromosomes 2A and 2D contain an open reading frame (ORF) of 1,731 bp, encoding a PPO precursor peptide of 577 amino acids with a predicted molecular mass of approximately 64 kD. Two complementary dominant STS markers, PPO16 and PPO29, were developed based on the PPO gene haplotypes located on chromosome 2D; they amplify a 713-bp fragment in cultivars with low PPO activity and a 490-bp fragment in those with high PPO activity, respectively. The two markers were mapped on chromosome 2DL using a doubled haploid population derived from the cross Zhongyou 9507/CA9632, and a set of nullisomic-tetrasomic lines and ditelosomic line 2DS of Chinese Spring. QTL analysis indicated that the PPO gene co-segregated with the two STS markers and was closely linked to SSR marker Xwmc41 on chromosome 2DL, explaining from 9.6 to 24.4% of the phenotypic variance for PPO activity across three environments. In order to simultaneously detect PPO loci on chromosomes 2A and 2D, a multiplexed marker combination PPO33/PPO16 was developed and yielded distinguishable DNA patterns in a number of cultivars. The STS marker PPO33 for the PPO gene on chromosome 2A was developed from the same gene sequences as PPO18 that we reported previously, and

  14. Variation in the Lysyl Oxidase (LOX) Gene Is Associated with Keratoconus in Family-Based and Case-Control Studies

    PubMed Central

    Bykhovskaya, Yelena; Li, Xiaohui; Epifantseva, Irina; Haritunians, Talin; Siscovick, David; Aldave, Anthony; Szczotka-Flynn, Loretta; Iyengar, Sudha K.; Taylor, Kent D.; Rotter, Jerome I.; Rabinowitz, Yaron S

    2012-01-01

    Purpose. Keratoconus is a bilateral noninflammatory progressive corneal disorder with complex genetic inheritance and a common cause for cornea transplantation in young adults. A genomewide linkage scan in keratoconus families identified a locus at 5q23.2, overlapping the gene coding for the lysyl oxidase (LOX). LOX encodes an enzyme responsible for collagen cross-linking in a variety of tissues including the cornea. Corneal collagen cross-linking with long-wave ultraviolet light and riboflavin is a promising new treatment for keratoconus. To determine whether LOX is a genetic determinant of the pathogenesis of keratoconus, we analyzed association results of LOX polymorphisms in two independent case-control samples and in keratoconus families. Methods. Association results were analyzed of single-nucleotide polymorphisms (SNPs) in the LOX gene from a Genome-Wide Association Study (GWAS) investigation in two independent panels of patients with keratoconus and controls and in keratoconus families. Results. Evidence of association was found at SNPs rs10519694 and rs2956540 located in intron 4 of LOX in the GWAS discovery case-control panel with P values of 2.3 × 10−3 and 7 × 10−3, respectively. The same two SNPs were found to be associated with keratoconus by family-based association testing with P values of 2.7 × 10−3 and 7.7 × 10−4, respectively. Meta P values of 4.0 × 10−5 and 4.0 × 10−7 were calculated for SNPs rs10519694 and rs2956540 by analyzing case-control and family samples simultaneously. Sequencing of LOX exons in a subset of keratoconus patients identified two polymorphisms, rs1800449 and rs2288393, located in LOX transcripts I and II, associated with keratoconus in case-control and family samples with a meta P value of 0.02. Conclusions. Results provided strong genetic evidence that LOX variants lead to increased susceptibility to developing of keratoconus. PMID:22661479

  15. Pilot study indicate role of preferentially transmitted monoamine oxidase gene variants in behavioral problems of male ADHD probands.

    PubMed

    Karmakar, Arijit; Goswami, Rishov; Saha, Tanusree; Maitra, Subhamita; Roychowdhury, Anirban; Panda, Chinmay Kumar; Sinha, Swagata; Ray, Anirban; Mohanakumar, Kochupurackal P; Rajamma, Usha; Mukhopadhyay, Kanchan

    2017-10-05

    Attention deficit hyperactivity disorder (ADHD) is an etiologically complex childhood onset neurobehavioral disorder characterized by age-inappropriate inattention, hyperactivity, and impulsivity. Symptom severity varies widely and boys are diagnosed more frequently than girls. ADHD probands were reported to have abnormal transmissions of dopamine, serotonin, and/or noradrenaline. Monoamine oxidase A (MAOA) and B (MAOB), mitochondrial outer membrane bound two isoenzymes, mediate degradation of these neurotransmitters and thus regulating their circulating levels. Case-control analyses in different populations, including Indians, suggested involvement of MAOA and MAOB genes in the etiology of ADHD. Due to high heritability rate of ADHD, we tested familial transmission of MAOA and MAOB variants to ADHD probands in 190 nuclear families having ADHD probands from Indo-Caucasoid ethnicity. Subjects were recruited following the Diagnostic and Statistical Manual of Mental Disorders-4th edition (DSM-IV). Appropriate scales were used for measuring the behavioral traits in probands. Genotyping was performed through PCR-based amplification of target sites followed by DNA-sequencing and/or gel-electrophoresis. Data obtained were analyzed by family based statistical methods. Out of 58 variants present in the analyzed sites only 15 were found to be polymorphic (30 bp-uVNTR, rs5906883, rs1465107, rs1465108, rs5905809, rs5906957, rs6323, rs1137070 from MAOA and rs4824562, rs56220155, rs2283728, rs2283727, rs3027441, rs6324, rs3027440 from MAOB). Statistically significant maternal transmission of alleles to male probands was observed for MAOA rs5905809 'G' (p = 0.04), rs5906957 'A' (p = 0.04), rs6323 'G' (p = 0.0001) and MAOB rs56220155 'A' (p = 0.002), rs2283728 'C' (p = 0.0008), rs2283727 'C' (p = 0.0008), rs3027441 'T' (p = 0.003), rs6324 'C' (p = 0.003), rs3027440 'T' (p = 0.0002). Significantly preferential maternal transmissions of different haplotype

  16. Human malaria diagnosis using a single-step direct-PCR based on the Plasmodium cytochrome oxidase III gene.

    PubMed

    Echeverry, Diego F; Deason, Nicholas A; Davidson, Jenna; Makuru, Victoria; Xiao, Honglin; Niedbalski, Julie; Kern, Marcia; Russell, Tanya L; Burkot, Thomas R; Collins, Frank H; Lobo, Neil F

    2016-02-29

    Nested PCRs based on the Plasmodium 18s-rRNA gene have been extensively used for human malaria diagnosis. However, they are not practical when large quantities of samples need to be processed, further there have been challenges in the performance and when interpreting results, especially when submicroscopic infections are analysed. Here the use of "direct PCR" was investigated with the aim of improving diagnosis in the malaria elimination era. The performance of the Plasmodium cytochrome oxidase III gene (COX-III) based novel malaria detection strategies (direct nested PCR and direct single PCR) were compared using a 18s-rRNA direct nested PCR as a reference tool. Evaluations were based on sensitivity, specificity and the ability to detect mixed infections using control blood spot samples and field collected blood samples with final species diagnosis confirmation by sequencing. The COX-III direct PCR (limit of detection: 0.6-2 parasites/μL) was more sensitive than the 18s-rRNA direct nested PCR (limit of detection: 2-10 parasites/μL). The COX-III direct PCR identified all 21 positive controls (no mixed infections detected) while the 18s-rRNA direct nested PCR identified 18/21 (including four mixed infections). Different concentrations of simulated mixed infections (Plasmodium vivax and Plasmodium falciparum) suggest that the COX-III direct PCR detects only the predominant species. When the 18s-rRNA direct nested PCR was used to detect Plasmodium in field collected bloods spots (n = 3833), there was discrepancy in the results from the genus PCR (16 % positive) and the species-specific PCR (5 % positive). Further, a large portion of a subset of these positive samples (93 % for genus and 60 % for P. vivax), did not align with Plasmodium sequences. In contrast, the COX-III direct PCR clearly identified (single bands confirmed with sequencing) 2 % positive Plasmodium samples including P. vivax, P. falciparum, Plasmodium malariae and Plasmodium ovale wallikeri. The COX

  17. Drosophila lysyl oxidases Dmloxl-1 and Dmloxl-2 are differentially expressed and the active DmLOXL-1 influences gene expression and development.

    PubMed

    Molnar, Janos; Ujfaludi, Zsuzsanna; Fong, Sheri F T; Bollinger, John A; Waro, Girma; Fogelgren, Ben; Dooley, David M; Mink, Matyas; Csiszar, Katalin

    2005-06-17

    Mammalian lysyl oxidase (LOX) is essential for the catalysis of lysyl-derived cross-links in fibrillar collagens and elastin in the extracellular matrix and has also been implicated in cell motility, differentiation, and tumor cell invasion. The active LOX has been shown to translocate to the nuclei of smooth muscle cells and regulate chromatin structure and transcription. It is difficult to interpret the role of the LOX protein as it is co-expressed with other members of the LOX amine oxidase family in most mammalian cells. To investigate the function of the LOX proteins, we have characterized the Drosophila lysyl oxidases Dmloxl-1 and Dmloxl-2. We present the gene, domain structure, and expression pattern of Dmloxl-1 and Dmloxl-2 during development. In early development, only Dmloxl-1 was expressed, which allowed functional studies. We have expressed Dmloxl-1 in S2 cells and determined that it is a catalytically active enzyme, inhibited by beta-amino-proprionitrile (BAPN), a specific LOX inhibitor. We localized DmLOXL-1 in the nuclei in embryos and in adult salivary gland cells in the nuclei, cytoplasm, and cell surface, using immunostaining and a DmLOXL-1 antibody. To address the biological function of Dmloxl-1, we raised larvae under BAPN inhibitory conditions and over-expressed Dmloxl-1 in transgenic Drosophila. DmLOXL-1 inhibition resulted in developmental delay and a shift in sex ratio; over-expression in the w(m4) variegating strain increased drosopterin production, demonstrating euchromatinization. Our previous data on the transcriptional down-regulation of seven ribosomal genes and the glue gene under inhibitory conditions and the current results collectively support a nuclear role for Dmloxl-1 in euchromatinization and gene regulation.

  18. Sensitivity to sodium arsenite in human melanoma cells depends upon susceptibility to arsenite-induced mitotic arrest

    SciTech Connect

    McNeely, Samuel C.; Belshoff, Alex C.; Taylor, B. Frazier; Fan, Teresa W-M.; McCabe, Michael J.; Pinhas, Allan R.

    2008-06-01

    Arsenic induces clinical remission in patients with acute promyelocytic leukemia and has potential for treatment of other cancers. The current study examines factors influencing sensitivity to arsenic using human malignant melanoma cell lines. A375 and SK-Mel-2 cells were sensitive to clinically achievable concentrations of arsenite, whereas SK-Mel-3 and SK-Mel-28 cells required supratherapeutic levels for toxicity. Inhibition of glutathione synthesis, glutathione S-transferase (GST) activity, and multidrug resistance protein (MRP) transporter function attenuated arsenite resistance, consistent with studies suggesting that arsenite is extruded from the cell as a glutathione conjugate by MRP-1. However, MRP-1 was not overexpressed in resistant lines and GST-{pi} was only slightly elevated. ICP-MS analysis indicated that arsenite-resistant SK-Mel-28 cells did not accumulate less arsenic than arsenite-sensitive A375 cells, suggesting that resistance was not attributable to reduced arsenic accumulation but rather to intrinsic properties of resistant cell lines. The mode of arsenite-induced cell death was apoptosis. Arsenite-induced apoptosis is associated with cell cycle alterations. Cell cycle analysis revealed arsenite-sensitive cells arrested in mitosis whereas arsenite-resistant cells did not, suggesting that induction of mitotic arrest occurs at lower intracellular arsenic concentrations. Higher intracellular arsenic levels induced cell cycle arrest in the S-phase and G{sub 2}-phase in SK-Mel-3 and SK-Mel-28 cells, respectively. The lack of arsenite-induced mitotic arrest in resistant cell lines was associated with a weakened spindle checkpoint resulting from reduced expression of spindle checkpoint protein BUBR1. These data suggest that arsenite has potential for treatment of solid tumors but a functional spindle checkpoint is a prerequisite for a positive response to its clinical application.

  19. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  20. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    PubMed

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  1. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  2. Novel autotrophic arsenite-oxidizing bacteria isolated from soil and sediments.

    PubMed

    Garcia-Dominguez, Elizabeth; Mumford, Adam; Rhine, Elizabeth Danielle; Paschal, Amber; Young, Lily Y

    2008-11-01

    Arsenic oxidation is recognized as being mediated by both heterotrophic and chemoautotrophic microorganisms. Enrichment cultures were established to determine whether chemoautotrophic microorganisms capable of oxidizing arsenite As(III) to arsenate As(V) are present in selected contaminated but nonextreme environments. Three new organisms, designated as strains OL-1, S-1 and CL-3, were isolated and found to oxidize 10 mM arsenite to arsenate under aerobic conditions using CO2-bicarbonate (CO2/HCO3-) as a carbon source. Based on 16S rRNA gene sequence analyses, strain OL-1 was 99% most closely related to the genus Ancylobacter, strain S-1 was 99% related to Thiobacillus and strain CL-3 was 98% related to the genus Hydrogenophaga. The isolates are facultative autotrophs and growth of isolated strains on different inorganic electron donors other than arsenite showed that all three had a strong preference for several sulfur species, while CL-3 was also able to grow on ammonium and nitrite. The RuBisCO Type I (cbbL) gene was positively amplified and sequenced in strain CL-3, and the Type II (cbbM) gene was detected in strains OL-1 and S-1, supporting the autotrophic nature of the organisms.

  3. Isolated sulfite oxidase deficiency.

    PubMed

    Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

    1996-12-01

    Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

  4. METHYLATION OF ARSENITE BY SOME MAMMALIAN CELL LINES

    EPA Science Inventory

    THIS ABSTRACT WAS SUBMITTED ELECTRONICALLY;. SPACE CONSTRAINTS WERE SEVERE)

    Methylation of Arsenite by Some Mammalian Cell Lines.

    Methylation of arsenite is thought to play an important role in the carcinogenicity of arsenic.
    Aim 1: Determine if there is diffe...

  5. ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    EPA Science Inventory

    ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    Useful biomarkers of arsenic effects in both experimental animals and humans are needed. Arsenate and arsenite are good inducers of rat hepatic and renal heme oxygenase (HO); monomethylarsonic acid (MMA) and dimethylarsi...

  6. METHYLATION OF ARSENITE BY SOME MAMMALIAN CELL LINES

    EPA Science Inventory

    THIS ABSTRACT WAS SUBMITTED ELECTRONICALLY;. SPACE CONSTRAINTS WERE SEVERE)

    Methylation of Arsenite by Some Mammalian Cell Lines.

    Methylation of arsenite is thought to play an important role in the carcinogenicity of arsenic.
    Aim 1: Determine if there is diffe...

  7. ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    EPA Science Inventory

    ARSENITE INDUCTION OF HEME OXYGENASE AS A BIOMARKER

    Useful biomarkers of arsenic effects in both experimental animals and humans are needed. Arsenate and arsenite are good inducers of rat hepatic and renal heme oxygenase (HO); monomethylarsonic acid (MMA) and dimethylarsi...

  8. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    USDA-ARS?s Scientific Manuscript database

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  9. Altered iron homeostasis involvement in arsenite-mediated cell transformation

    PubMed Central

    Wu, Jing; Eckard, Jonathan; Chen, Haobin; Costa, Max; Frenkel, Krystyna; Huang, Xi

    2010-01-01

    Chronic exposure to low doses of arsenite causes transformation of human osteogenic sarcoma (HOS) cells. Although oxidative stress is considered important in arsenite-induced cell transformation, the molecular and cellular mechanisms by which arsenite transforms human cells are still unknown. In the present study, we investigated whether altered iron homeostasis, known to affect cellular oxidative stress, can contribute to the arsenite-mediated cell transformation. Using arsenite-induced HOS cell transformation as a model, it was found that total iron levels are significantly higher in transformed HOS cells in comparison to parental control HOS cells. Under normal iron metabolism conditions, iron homeostasis is tightly controlled by inverse regulation of ferritin and transferrin receptor (TfR) through iron regulatory proteins (IRP). Increased iron levels in arsenite transformed cells should theoretically lead to higher ferritin and lower TfR in these cells than in controls. However, the results showed that both ferritin and TfR are decreased, apparently through two different mechanisms. A lower ferritin level in cytoplasm was due to the decreased mRNA in the arsenite-transformed HOS cells, while the decline in TfR was due to a lowered IRP-binding activity. By challenging cells with iron, it was further established that arsenite-transformed HOS cells are less responsive to iron treatment than control HOS cells, which allows accumulation of iron in the transformed cells, as exemplified by significantly lower ferritin induction. On the other hand, caffeic acid phenethyl ester (CAPE), an antioxidant previously shown to suppress As-mediated cell transformation, prevents As-mediated ferritin depletion. In conclusion, our results suggest that altered iron homeostasis contributes to arsenite-induced oxidative stress and, thus, may be involved in arsenite-mediated cell transformation. PMID:16443159

  10. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit.

  11. Over-expression of genes coding for proline oxidase, riboflavin kinase, cytochrome c oxidase and an MFS transporter induced by acriflavin in Trichophyton rubrum.

    PubMed

    Segato, Fernando; Nozawa, Sérgio R; Rossi, Antonio; Martinez-Rossi, Nilce M

    2008-03-01

    Acriflavin (3,6-acridinediamine) and other acridine derivatives act in both prokaryotic and eukaryotic cells at the level of DNA-coiling enzymes (topoisomerases) causing the stabilization of the enzyme-DNA cleavable complex. In order to better understand the mode of action of acriflavin, Differential Display RT-PCR was used to isolate transcripts specifically over-expressed during exposure of Trichophyton rubrum mycelia to this drug. Five transcripts, whose differential expressions were confirmed by Northern blotting, revealed genes not previously described in this dermatophyte. Functional grouping identified putative enzymes possibly involved in the mitochondrial respiratory electron-transport chain and in iron transport. These results may be relevant to our understanding of the molecular events involved in the stress response of T. rubrum to acriflavin.

  12. Genomic evidence reveals the extreme diversity and wide distribution of the arsenic-related genes in Burkholderiales.

    PubMed

    Li, Xiangyang; Zhang, Linshuang; Wang, Gejiao

    2014-01-01

    So far, numerous genes have been found to associate with various strategies to resist and transform the toxic metalloid arsenic (here, we denote these genes as "arsenic-related genes"). However, our knowledge of the distribution, redundancies and organization of these genes in bacteria is still limited. In this study, we analyzed the 188 Burkholderiales genomes and found that 95% genomes harbored arsenic-related genes, with an average of 6.6 genes per genome. The results indicated: a) compared to a low frequency of distribution for aio (arsenite oxidase) (12 strains), arr (arsenate respiratory reductase) (1 strain) and arsM (arsenite methytransferase)-like genes (4 strains), the ars (arsenic resistance system)-like genes were identified in 174 strains including 1,051 genes; b) 2/3 ars-like genes were clustered as ars operon and displayed a high diversity of gene organizations (68 forms) which may suggest the rapid movement and evolution for ars-like genes in bacterial genomes; c) the arsenite efflux system was dominant with ACR3 form rather than ArsB in Burkholderiales; d) only a few numbers of arsM and arrAB are found indicating neither As III biomethylation nor AsV respiration is the primary mechanism in Burkholderiales members; (e) the aio-like gene is mostly flanked with ars-like genes and phosphate transport system, implying the close functional relatedness between arsenic and phosphorus metabolisms. On average, the number of arsenic-related genes per genome of strains isolated from arsenic-rich environments is more than four times higher than the strains from other environments. Compared with human, plant and animal pathogens, the environmental strains possess a larger average number of arsenic-related genes, which indicates that habitat is likely a key driver for bacterial arsenic resistance.

  13. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.

    PubMed

    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

    2013-12-01

    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  14. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.

    PubMed

    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei

    2004-04-01

    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties.

  15. Genomic Evidence Reveals the Extreme Diversity and Wide Distribution of the Arsenic-Related Genes in Burkholderiales

    PubMed Central

    Li, Xiangyang; Zhang, Linshuang; Wang, Gejiao

    2014-01-01

    So far, numerous genes have been found to associate with various strategies to resist and transform the toxic metalloid arsenic (here, we denote these genes as “arsenic-related genes”). However, our knowledge of the distribution, redundancies and organization of these genes in bacteria is still limited. In this study, we analyzed the 188 Burkholderiales genomes and found that 95% genomes harbored arsenic-related genes, with an average of 6.6 genes per genome. The results indicated: a) compared to a low frequency of distribution for aio (arsenite oxidase) (12 strains), arr (arsenate respiratory reductase) (1 strain) and arsM (arsenite methytransferase)-like genes (4 strains), the ars (arsenic resistance system)-like genes were identified in 174 strains including 1,051 genes; b) 2/3 ars-like genes were clustered as ars operon and displayed a high diversity of gene organizations (68 forms) which may suggest the rapid movement and evolution for ars-like genes in bacterial genomes; c) the arsenite efflux system was dominant with ACR3 form rather than ArsB in Burkholderiales; d) only a few numbers of arsM and arrAB are found indicating neither As III biomethylation nor AsV respiration is the primary mechanism in Burkholderiales members; (e) the aio-like gene is mostly flanked with ars-like genes and phosphate transport system, implying the close functional relatedness between arsenic and phosphorus metabolisms. On average, the number of arsenic-related genes per genome of strains isolated from arsenic-rich environments is more than four times higher than the strains from other environments. Compared with human, plant and animal pathogens, the environmental strains possess a larger average number of arsenic-related genes, which indicates that habitat is likely a key driver for bacterial arsenic resistance. PMID:24632831

  16. Tumor necrosis factor alpha activates transcription of the NADPH oxidase organizer 1 (NOXO1) gene and upregulates superoxide production in colon epithelial cells.

    PubMed

    Kuwano, Yuki; Tominaga, Kumiko; Kawahara, Tsukasa; Sasaki, Hidekazu; Takeo, Keiko; Nishida, Kensei; Masuda, Kiyoshi; Kawai, Tomoko; Teshima-Kondo, Shigetada; Rokutan, Kazuhito

    2008-12-15

    NADPH oxidase 1 (Nox1) is a multicomponent enzyme consisting of p22(phox), Nox organizer 1 (NOXO1), Nox1 activator 1, and Rac1. Interleukin-1beta, flagellin, interferon-gamma, and tumor necrosis factor alpha (TNF-alpha) similarly induced Nox1 in a colon cancer cell line (T84), whereas only TNF-alpha fully induced NOXO1 and upregulated superoxide-producing activity by ninefold. This upregulation was canceled by knockdown of NOXO1 with small interfering RNAs. TNF-alpha rapidly phosphorylated p38 mitogen-activated protein kinase and c-Jun N-terminal kinase 1/2, followed by phosphorylation of c-Jun and c-Fos and appearance of an AP-1 binding activity within 30 min. We cloned the 5' flank of the human NOXO1 gene (-3888 to +263 bp), and found that the region between -585 and -452 bp, which contains consensus elements of YY-1, AP-1, and Ets, and the GC-rich region encoding three putative binding sites for SP-1, was crucial for TNF-alpha-dependent promoter activity. Serial mutation analysis of the elements identified an AP-1 binding site (from -561 to -551 bp, agtAAGtcatg) as a crucial element for TNF-alpha-stimulated transcription of the human NOXO1 gene, which was also confirmed by the AP-1 decoy experiments. Thus, TNF-alpha acts as a potent activator of Nox1-based oxidase in colon epithelial cells, suggesting a potential role of this oxidase in inflammation of the colon.

  17. The terminal oxidases of Paracoccus denitrificans.

    PubMed

    de Gier, J W; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D J; van Spanning, R J; Stouthamer, A H; van der Oost, J

    1994-07-01

    Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to complement a double mutant (delta ctaDI, delta ctaDII), indicating that they are isoforms of subunit I of the aa3-type oxidase. The genomic locus of a quinol oxidase has been isolated: cyoABC. This protohaem-containing oxidase, called cytochrome bb3, is the only quinol oxidase expressed under the conditions used. In a triple oxidase mutant (delta ctaDI, delta ctaDII, cyoB::KmR) an alternative cytochrome c oxidase has been characterized; this cbb3-type oxidase has been partially purified. Both cytochrome aa3 and cytochrome bb3 are redox-driven proton pumps. The proton-pumping capacity of cytochrome cbb3 has been analysed; arguments for and against the active transport of protons by this novel oxidase complex are discussed.

  18. Metabolism of arsenite and arsenate by the rat

    SciTech Connect

    Lerman, S.A.

    1982-01-01

    The metabolism of arsenite and arsenate by mice and rats was investigated. In initial studies, mice eliminated almost 100 percent of a single intraperitoneal dose (0.5 mg/kg) of sodium arsenite or arsenate. About 90 percent of the arsenic eliminated in urine by 24 hours was dimethylarsinic acid (DMA). Rats, however, eliminated only about 50 percent of the same dose of sodium arsenate and only 10 percent of the arsenic in the urine was DMA. Further studies were focused on the metabolism of arsenic by the rat. After i.v. administration of 4.8 nmole arsenite or arsenate to male Sprague-Dawley rats, blood levels of arsenic rose over four hours to about 60 percent of the initial dose of arsenite and 30 percent of the initial dose of arsenate. The predominant form of arsenic in the blood was DMA. Arsenite was rapidly distributed to both liver and kidney; arsenate was rapidly distributed to kidney only. The metabolite, DMA, appeared in the urine by one hour after administration of either form. These studies suggest that inorganic arsenic is rapidly taken up by liver and kidney, depending on the valence of the arsenic. The liver is more important in the metabolism of arsenite, but the kidney takes up and methylates both arsenite and arsenate. The DMA produced by these organs binds to the red blood cells. This binding appears to be the main difference between the rat and other mammalian species. 76 references, 33 figures, 7 tables.

  19. Metabolism of arsenite and arsenate by the rat

    SciTech Connect

    Lerman, S.A.

    1983-01-01

    The metabolism of arsenite and arsenate by mice and rats was investigated. In initial studies, mice eliminated almost 100% of a single intraperitoneal dose (0.5 mg/kg) of sodium arsenite or arsenate. About 90% of the arsenic eliminated in urine by 24 hours was dimethylarsinic acid (DMA). Rats, however, eliminated only about 50% of the same dose of sodium arsenate and only 10% of the arsenic in the urine was DMA. Further studies were focused on the metabolism of arsenic by the rat. After four hours of exposure to arsenite, liver slices had taken up six times more arsenic and kidney slices two times more arsenic than after exposure to arsenate. Isolated hepatocytes took up as much as 20 times more arsenic after arsenite exposure. DMA was found in the medium of the liver slices and hepatocytes exposed to arsenite, but very little DMA was found in the medium 85%. These studies suggest that inorganic arsenic is rapidly taken up by liver and kidney, depending on the valence of the arsenic. The liver is more important in the metabolism of arsenite, but the kidney takes up and methylates both arsenite and arsenate. The DMA produced by these organs binds to the red blood cells. This binding appears to be the main difference between the rat and other mammalian species.

  20. Identification of a gene for pyruvate-insensitive mitochondrial alternative oxidase expressed in the thermogenic appendices in Arum maculatum.

    PubMed

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S; Moore, Anthony L

    2011-12-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum.

  1. Functional analysis reveals effects of tobacco alternative oxidase gene (NtAOX1a) on regulation of defence responses against abiotic and biotic stresses.

    PubMed

    Zhang, Yi; Xi, Dongmei; Wang, Jian; Zhu, Dongfang; Guo, Xingqi

    2009-07-22

    Mitochondrial AOX (alternative oxidase) is the terminal oxidase of the CN (cyanide)-resistant alternative respiratory pathway in plants. To investigate the role of the tobacco AOX gene (NtAOX1a) (where Nt is Nicotiana tabacum) under deleterious conditions which could induce ROS (reactive oxygen species) accumulation, we generated and characterized a number of independent transgenic tobacco (N. tabacum) lines with altered NtAOX1a gene expression and AP (alternative pathway) capacity. AOX efficiently inhibited the production of low-temperature-induced H2O2 and might be a major enzyme for scavenging H2O2 at low temperature. Furthermore, NtAOX1a may act as a regulator of KCN-induced resistance to TMV (tobacco mosaic virus) through the regulation of H2O2. Notably, a moderate accumulation of H2O2 under the control of NtAOX1a was crucial in viral resistance. Analysis of seed germination indicated an important role for NtAOX1a in germination under H2O2-induced oxidative stress when the CP (cytochrome pathway) was inhibited. These results demonstrate that NtAOX1a is necessary for plants to survive low temperature, pathogen attack and oxidative stress by scavenging ROS under these adverse conditions when the CP is restricted.

  2. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  3. Overexpression of a Maize Sulfite Oxidase Gene in Tobacco Enhances Tolerance to Sulfite Stress via Sulfite Oxidation and CAT-Mediated H2O2 Scavenging

    PubMed Central

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO2/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E.coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H2O2 accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  4. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease.

    PubMed

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E; Ortiz, Genaro Gabriel

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  5. Facultative anoxygenic photosynthesis in cyanobacteria driven by arsenite and sulfide with evidence for the support of nitrogen fixation

    NASA Astrophysics Data System (ADS)

    Wolfe-Simon, F.; Hoeft, S. E.; Baesman, S. M.; Oremland, R. S.

    2010-12-01

    The rise in atmospheric oxygen (O2) over geologic time is attributed to the evolution and widespread proliferation of oxygenic photosynthesis in cyanobacteria. However, cyanobacteria maintain a metabolic flexibility that may not always result in O2 release. In the environment, cyanobacteria may use a variety of alternative electron donors rather than water that are known to be used by other anoxygenic phototrophs (eg. purple sulfur bacteria) including reduced forms of sulfur, iron, nitrogen, and arsenic. Recent evidence suggests cyanobacteria actively take advantage of at least a few of these alternatives. We used a classical Winogradsky approach to enrich for cyanobacteria from the high salinity, elevated pH and arsenic-enriched waters of Mono Lake (CA). Experiments, optimized for cyanobacteria, revealed light-dependent, anaerobic arsenite-oxidation in sub-cultured sediment-free enrichments dominated by a filamentous cyanobacteria. We isolated and identified the dominant member of this enrichment to be a member of the Oscillatoriales by 16S rDNA. Addition of 1 mM arsenite induced facultative anoxygenic photosynthesis under continuous and circadian light. This isolate also oxidized sulfide under the same light-based conditions. Aerobic conditions elicited no arsenite oxidation in the light or dark and the isolate grew as a typical cyanobacterium using oxygenic photosynthesis. Under near-infrared light (700 nm) there was a direct correlation of enhanced growth with an increase in the rate arsenite or sulfide oxidation suggesting the use of photosystem I. Additionally, to test the wide-spread nature of this metabolism in the Oscillatoriales, we followed similar arsenite- and sulfide-driven facultative anoxygenic photosynthesis as well as nitrogen fixation (C2H2 reduction) in the axenic isolate Oscillatoria sp. CCMP 1731. Future characterization includes axenic isolation of the Mono Lake Oscillatoria sp. as well as the arsenite oxidase responsible for electron

  6. Evidence for Lateral Transfer of Genes Encoding Ferredoxins, Nitroreductases, NADH Oxidase, and Alcohol Dehydrogenase 3 from Anaerobic Prokaryotes to Giardia lamblia and Entamoeba histolytica

    PubMed Central

    Nixon, Julie E. J.; Wang, Amy; Field, Jessica; Morrison, Hilary G.; McArthur, Andrew G.; Sogin, Mitchell L.; Loftus, Brendan J.; Samuelson, John

    2002-01-01

    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica. PMID

  7. Oxygen Reactivity of Both Respiratory Oxidases in Campylobacter jejuni: the cydAB Genes Encode a Cyanide-Resistant, Low-Affinity Oxidase That Is Not of the Cytochrome bd Type▿

    PubMed Central

    Jackson, Rachel J.; Elvers, Karen T.; Lee, Lucy J.; Gidley, Mark D.; Wainwright, Laura M.; Lightfoot, James; Park, Simon F.; Poole, Robert K.

    2007-01-01

    The microaerophilic bacterium Campylobacter jejuni is a significant food-borne pathogen and is predicted to possess two terminal respiratory oxidases with unknown properties. Inspection of the genome reveals an operon (cydAB) apparently encoding a cytochrome bd-like oxidase homologous to oxidases in Escherichia coli and Azotobacter vinelandii. However, C. jejuni cells lacked all spectral signals characteristic of the high-spin hemes b and d of these oxidases. Mutation of the cydAB operon of C. jejuni did not have a significant effect on growth, but the mutation reduced formate respiration and the viability of cells cultured in 5% oxygen. Since cyanide resistance of respiration was diminished in the mutant, we propose that C. jejuni CydAB be renamed CioAB (cyanide-insensitive oxidase), as in Pseudomonas aeruginosa. We measured the oxygen affinity of each oxidase, using a highly sensitive assay that exploits globin deoxygenation during respiration-catalyzed oxygen uptake. The CioAB-type oxidase exhibited a relatively low affinity for oxygen (Km = 0.8 μM) and a Vmax of >20 nmol/mg/s. Expression of cioAB was elevated fivefold in cells grown at higher rates of oxygen provision. The alternative, ccoNOQP-encoded cyanide-sensitive oxidase, expected to encode a cytochrome cb′-type enzyme, plays a major role in the microaerobic respiration of C. jejuni, since it appeared to be essential for viability and exhibited a much higher oxygen affinity, with a Km value of 40 nM and a Vmax of 6 to 9 nmol/mg/s. Low-temperature photodissociation spectrophotometry revealed that neither oxidase has ligand-binding activity typical of the heme-copper oxidase family. These data are consistent with cytochrome oxidation during photolysis at low temperatures. PMID:17172349

  8. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  9. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  10. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  11. Sequences of the cytochrome C oxidase subunit I (COI) gene are suitable for species identification of Korean Calliphorinae flies of forensic importance (Diptera: Calliphoridae).

    PubMed

    Park, Seong Hwan; Zhang, Yong; Piao, Huguo; Yu, Dong Ha; Jeong, Hyun Ju; Yoo, Ga Young; Jo, Tae-Ho; Hwang, Juck-Joon

    2009-09-01

    Calliphorinae fly species are important indicators of the postmortem interval especially during early spring and late fall in Korea. Although nucleotide sequences of various Calliphorinae fly species are available, there has been no research on the cytochrome c oxidase subunit I (COI) nucleotide sequences of Korean Calliphorinae flies. Here, we report the full-length sequences of the COI gene of four Calliphorinae fly species collected in Korea (five individuals of Calliphora vicina, five Calliphora lata, four Triceratopyga calliphoroides and three Aldrichina grahami). Each COI gene was amplified by polymerase chain reaction and directly sequenced and the resulting nucleotide sequences were aligned and analyzed by MEGA4 software. The results indicate that COI nucleotide sequences can be used to distinguish between these four species. Our phylogenetic result coincides with recent taxonomic views on the subfamily Calliphorinae in that the genera Aldrichina and Triceratopyga are nested within the genus Calliphora.

  12. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  13. Effects of arsenic on modification of promyelocytic leukemia (PML): PML responds to low levels of arsenite

    SciTech Connect

    Hirano, Seishiro; Watanabe, Takayuki; Kobayashi, Yayoi

    2013-12-15

    Inorganic arsenite (iAs{sup 3+}) is a two-edged sword. iAs{sup 3+} is a well-known human carcinogen; nevertheless, it has been used as a therapeutic drug for acute promyelocytic leukemia (APL), which is caused by a fusion protein comprising retinoic acid receptor-α and promyelocytic leukemia (PML). PML, a nuclear transcription factor, has a RING finger domain with densely positioned cysteine residues. To examine PML-modulated cellular responses to iAs{sup 3+}, CHO-K1 and HEK293 cells were each used to establish cell lines that expressed ectopic human PML. Overexpression of PML increased susceptibility to iAs{sup 3+} in CHO-K1 cells, but not in HEK293 cells. Exposure of PML-transfected cells to iAs{sup 3+} caused PML to change from a soluble form to less soluble forms, and this modification of PML was observable even with just 0.1 μM iAs{sup 3+} (7.5 ppb). Western blot and immunofluorescent microscopic analyses revealed that the biochemical changes of PML were caused at least in part by conjugation with small ubiquitin-like modifier proteins (SUMOylation). A luciferase reporter gene was used to investigate whether modification of PML was caused by oxidative stress or activation of antioxidant response element (ARE) in CHO-K1 cells. Modification of PML protein occurred faster than activation of the ARE in response to iAs{sup 3+}, suggesting that PML was not modified as a consequence of oxidative stress-induced ARE activation. - Highlights: • PML was found in nuclear microspecles in response to arsenite. • Arsenite triggers SUMOylation of PML. • Arsenite modifies PML at as low as 0.1 μM. • Modification of PML is not caused by ARE activation.

  14. Short dysfunctional telomeres impair the repair of arsenite-induced oxidative damage in mouse cells.

    PubMed

    Newman, Jennifer P A; Banerjee, Birendranath; Fang, Wanru; Poonepalli, Anuradha; Balakrishnan, Lakshmidevi; Low, Grace Kah Mun; Bhattacharjee, Rabindra N; Akira, Shizuo; Jayapal, Manikandan; Melendez, Alirio J; Baskar, Rajamanickam; Lee, Han-Woong; Hande, M Prakash

    2008-03-01

    Telomeres and telomerase appear to participate in the repair of broken DNA ends produced by oxidative damage. Arsenite is an environmental contaminant and a potent human carcinogen, which induces oxidative stress on cells via the generation of reactive oxygen species affecting cell viability and chromosome stability. It promotes telomere attrition and reduces cell survival by apoptosis. In this study, we used mouse embryonic fibroblasts (MEFs) from mice lacking telomerase RNA component (mTERC(-/-) mice) with long (early passage or EP) and short (late passage or LP) telomeres to investigate the extent of oxidative damage by comparing the differences in DNA damage, chromosome instability, and cell survival at 24 and 48 h of exposure to sodium arsenite (As3+; NaAsO2). There was significantly high level of DNA damage in mTERC(-/-) cells with short telomeres as determined by alkaline comet assay. Consistent with elevated DNA damage, increased micronuclei (MN) induction reflecting gross genomic instability was also observed. Fluorescence in situ hybridization (FISH) analysis revealed that increasing doses of arsenite augmented the chromosome aberrations, which contributes to genomic instability leading to possibly apoptotic cell death and cell cycle arrest. Microarray analysis has revealed that As3+ treatment altered the expression of 456 genes of which 20% of them have known functions in cell cycle and DNA damage signaling and response, cell growth, and/or maintenance. Results from our studies imply that short dysfunctional telomeres impair the repair of oxidative damage caused by arsenite. The results will have implications in risk estimation as well as cancer chemotherapy. (c) 2007 Wiley-Liss, Inc.

  15. [The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

    PubMed

    Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

    2009-01-01

    Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

  16. Arsenite Elicits Anomalous Sulfur Starvation Responses in Barley1[W

    PubMed Central

    Reid, Rob; Gridley, Kate; Kawamata, Yuta; Zhu, Yongguan

    2013-01-01

    Treatment of barley (Hordeum vulgare) seedlings with arsenite (AsIII) rapidly induced physiological and transcriptional changes characteristic of sulfur deficiency, even in plants replete with sulfur. AsIII and sulfur deficiency induced 5- to 20-fold increases in the three genes responsible for sulfate reduction. Both treatments also caused up-regulation of a sulfate transporter, but only in the case of sulfur deficiency was there an increase in sulfate influx. Longer-term changes included reduction in transfer of sulfur from roots to shoots and an increase in root growth relative to shoot growth. Genes involved in complexation and compartmentation of arsenic were up-regulated by AsIII, but not by sulfur deficiency. The rate at which arsenic accumulated appeared to be controlled by the rate of thiol synthesis. Over a range of AsIII concentrations and growth periods, the ratio of thiols to arsenic was always close to 3:1, which is consistent with the formation of a stable complex between three glutathione molecules per AsIII. The greater toxicity of arsenic under sulfur-limiting conditions is likely to be due to an intensification of sulfur deficiency as a result of thiol synthesis, rather than to a direct toxicity to metabolism. Because influx of AsIII was nearly 20-fold faster than the rate of synthesis of thiols, it is questionable whether this complexation strategy can be effective in preventing arsenic toxicity, unless arsenic uptake becomes limited by diffusive resistances in the rhizosphere. PMID:23482871

  17. Advancing nematode barcoding: a primer cocktail for the cytochrome c oxidase subunit I gene from vertebrate parasitic nematodes.

    PubMed

    Prosser, Sean W J; Velarde-Aguilar, Maria G; León-Règagnon, Virginia; Hebert, Paul D N

    2013-11-01

    Although nematodes are one of the most diverse metazoan phyla, species identification through morphology is difficult. Several genetic markers have been used for their identification, but most do not provide species-level resolution in all groups, and those that do lack primer sets effective across the phylum, precluding high-throughput processing. This study describes a cocktail of three novel primer pairs that overcome this limitation by recovering cytochrome c oxidase I (COI) barcodes from diverse nematode lineages parasitic on vertebrates, including members of three orders and eight families. Its effectiveness across a broad range of nematodes enables high-throughput processing. © 2013 John Wiley & Sons Ltd.

  18. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-05

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  19. Arsenite cocarcinogenesis: an animal model derived from genetic toxicology studies.

    PubMed Central

    Rossman, Toby G; Uddin, Ahmed N; Burns, Fredric J; Bosland, Maarten C

    2002-01-01

    Although epidemiologic evidence shows an association between inorganic arsenic in drinking water and increased risk of skin, lung, and bladder cancers, no animal model for arsenic carcinogenesis has been successful. This lack has hindered mechanistic studies of arsenic carcinogenesis. Previously, we and others found that low concentrations (< or =5 microm) of arsenite (the likely environmental carcinogen), which are not mutagenic, can enhance the mutagenicity of other agents, including ultraviolet radiation (UVR) and alkylating agents. This enhancing effect appears to result from inhibition of DNA repair by arsenite, but not via inhibition of DNA repair enzymes. Rather, low concentrations of arsenite disrupt p53 function and upregulate cyclin D1. Failure to find an animal model for arsenic carcinogenesis might be because arsenite is not a carcinogen per se but acts as an enhancing agent (cocarcinogen) with a genotoxic partner. We tested this hypothesis with solar UVR in hairless but immunocompetent Skh1 mice. Mice were given 10 mg/L sodium arsenite in drinking water (or not) and irradiated with 1.7 KJ/m(2) solar UVR 3 times weekly. As expected, no tumors appeared in any organs in control mice or in mice given arsenite alone. After 26 weeks irradiated mice given arsenite had a 2.4-fold increase in skin tumor yield compared with mice given UVR alone. The tumors were mostly squamous cell carcinomas, and those occurring in mice given UVR plus arsenite were much larger and more invasive. These results are consistent with the hypothesis that arsenic acts as a cocarcinogen with a second (genotoxic) agent by inhibiting DNA repair and/or enhancing positive growth signaling. Skin cancers in populations drinking water containing arsenic may be caused by the enhancement by arsenic compounds of carcinogenesis induced by UVR (or other environmental agents). It is possible that lung and bladder cancers associated with arsenic in drinking water may also require a carcinogenic

  20. Associations of a regulatory polymorphism of monoamine oxidase-A gene promoter (MAOA-uVNTR) with symptoms of depression and sleep quality.

    PubMed

    Brummett, Beverly H; Krystal, Andrew D; Siegler, Ilene C; Kuhn, Cynthia; Surwit, Richard S; Züchner, Stephan; Ashley-Koch, Allison; Barefoot, John C; Williams, Redford B

    2007-06-01

    To examine the relationships among the variable number of tandem repeats in the monoamine oxidase-A linked polymorphic region allelic variation (MAOA-uVNTR) and the symptoms of depression and sleep quality. The monoamine oxidase-A (MAOA) gene, which plays a vital role in degradation of neurotransmitters such as serotonin, norepinephrine, and dopamine, contains a polymorphism in its promoter region (MAOA-uVNTR) that affects transcriptional efficiency. MAOA-uVNTR genotype has been associated with both psychological and physical measures. The sample consisted of 74 males enrolled in a case/control study of caregivers for relatives with dementia. Age- and race-adjusted linear regression models were used to examine the association between low versus high MAOA-uVNTR activity alleles, symptoms of depression (Center for Epidemiological Studies of Depression), and sleep quality ratings (Pittsburgh Sleep Quality Index). MAOA-uVNTR alleles associated with less transcriptional activity were related to increased symptoms of depression (p < .04; Cohen's d = 0.52) and poorer sleep quality (p < .04; Cohen's d = 0.31). Individuals with less active MAOA-uVNTR alleles may be at increased risk for depressive symptoms and poor sleep.

  1. Photoinduced Oxidation of Arsenite to Arsenate on Ferrihydrite

    SciTech Connect

    N Bhandari; R Reeder; D Strongin

    2011-12-31

    The photochemistry of an aqueous suspension of the iron oxyhydroxide, ferrihydrite, in the presence of arsenite has been investigated using attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR), X-ray absorption near edge structure (XANES), and solution phase analysis. Both ATR-FTIR and XANES show that the exposure of ferrihydrite to arsenite in the dark leads to no change in the As oxidation state, but the exposure of this arsenite-bearing surface, which is in contact with pH 5 water, to light leads to the conversion of the majority of the adsorbed arsenite to the As(V) bearing species, arsenate. Analysis of the solution phase shows that ferrous iron is released into solution during the oxidation of arsenite. The photochemical reaction, however, shows the characteristics of a self-terminating reaction in that there is a significant suppression of this redox chemistry before 10% of the total iron making up the ferrihydrite partitions into solution as ferrous iron. The self-terminating behavior exhibited by this photochemical arsenite/ferrihydrite system is likely due to the passivation of the ferrihydrite surface by the strongly bound arsenate product.

  2. Sodium arsenite-induced inhibition of cell proliferation is related to inhibition of IL-2 mRNA expression in mouse activated T cells.

    PubMed

    Conde, Patricia; Acosta-Saavedra, Leonor C; Goytia-Acevedo, Raquel C; Calderon-Aranda, Emma S

    2007-04-01

    A proposed mechanism for the As-induced inhibition of cell proliferation is the inhibition of IL-2 secretion. However, the effects of arsenite on IL-2 mRNA expression or on the ERK pathway in activated-T cells have not yet been described. We examined the effect of arsenite on IL-2 mRNA expression, cell activation and proliferation in PHA-stimulated murine lymphocytes. Arsenite (1 and 10 microM) decreased IL-2 mRNA expression, IL-2 secretion and cell proliferation. Arsenite (10 microM) strongly inhibited ERK-phosphorylation. However, the partial inhibition (50%) of IL-2 mRNA produced by 1 microM, consistent with the effects on IL-2 secretion and cell proliferation, could not be explained by the inhibition of ERK-phosphorylation, which was not affected at this concentration. The inhibition of IL-2 mRNA expression caused by 1 microM could be associated to effects on pathways located downstream or parallel to ERK. Arsenite also decreased early activation (surface CD69+ expression) in both CD4+ and CD8+, and decreased total CD8+ count without significantly affecting CD4+, supporting that the cellular immune response mediated by cytotoxic T cells is an arsenic target. Thus, our results suggest that arsenite decreases IL-2 mRNA levels and T-cell activation and proliferation. However, further studies on the effects of arsenite on IL-2 gene transcription and IL-2 mRNA stability are needed.

  3. Sequence analysis of diamine oxidase gene from fava bean and its expression related to γ-aminobutyric acid accumulation in seeds germinating under hypoxia-NaCl stress.

    PubMed

    Yang, Runqiang; Yin, Yongqi; Guo, Liping; Han, Yongbin; Gu, Zhenxin

    2014-06-01

    γ-Aminobutyric acid (GABA) is synthesized via the polyamine degradation pathway in plants, with diamine oxidase (DAO) being the key enzyme. In this study the cDNA of DAO in fava bean was cloned and its expression in seeds germinating under hypoxia-NaCl stress was investigated. Fava bean DAO cDNA is 2199 bp long and contains 2025 bp of open reading frame that encodes 675 amino acid peptides with a calculated molecular weight of 76.31 kDa and a pI of 5.41. Hypoxia and hypoxia-NaCl stress enhanced DAO activity and resulted in GABA accumulation in germinating fava bean. However, DAO gene expression was down-regulated under hypoxia compared with non-stress condition, while its expression in the cotyledon and shoot was up-regulated under hypoxia-NaCl. In addition, DAO expression could be promoted to enhance GABA accumulation after increasing the stress intensity using NaCl. DAO gene expression was significantly inhibited by aminoguanidine treatment under hypoxia but increased under hypoxia-NaCl. Under hypoxia, GABA accumulation due to NaCl was mainly concentrated in the cotyledon. The GABA content increase under hypoxia did not result from DAO gene expression, but DAO existing in seeds was activated under hypoxia. DAO gene expression was up-regulated to enhance GABA accumulation after increasing the stress intensity. © 2013 Society of Chemical Industry.

  4. Physiological role of the D-amino acid oxidase gene, DAO1, in carbon and nitrogen metabolism in the methylotrophic yeast Candida boidinii.

    PubMed

    Yurimoto, H; Hasegawa, T; Sakai, Y; Kato, N

    2000-09-30

    A methylotrophic yeast, Candida boidinii, exhibits D-amino acid oxidase activity (DAO, EC 1.4.3.3) during its growth on D-alanine as a sole carbon or a nitrogen source. The structural gene (DAO1), encoding DAO, was cloned from a genomic library of C. boidinii. The 1035-bp gene encoded 345 amino acids and the predicted amino acid sequence showed significant similarity to those of DAOs from other organisms. The DAO1 gene was disrupted in the C. boidinii genome by one-step gene disruption. The DAO1-deleted strain did not grow on D-alanine as a carbon source but did grow on D-alanine as a sole nitrogen source (with glucose as the carbon source). These results suggested that, while DAO is critically involved in growth on D-alanine as a carbon source, there should be another enzyme system which metabolizes D-alanine as a nitrogen source in C. boidinii. We also showed that the three C-terminal amino acid sequence of DAO, -AKL was necessary and sufficient for the import of DAO into peroxisomes. Copyright 2000 John Wiley & Sons, Ltd.

  5. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression

    PubMed Central

    Beck, Emily A.; Thompson, Aaron C.; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana

    2015-01-01

    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba—D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear‐encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear‐ and mitochondrial‐encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum‐likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial‐encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  6. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  7. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

  8. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded.

  9. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.

    PubMed

    Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce

    2010-05-01

    Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements.

  10. Deficiencies in mitochondrial dynamics sensitize Caenorhabditis elegans to arsenite and other mitochondrial toxicants by reducing mitochondrial adaptability.

    PubMed

    Luz, Anthony L; Godebo, Tewodros R; Smith, Latasha L; Leuthner, Tess C; Maurer, Laura L; Meyer, Joel N

    2017-07-15

    Mitochondrial fission, fusion, and mitophagy are interlinked processes that regulate mitochondrial shape, number, and size, as well as metabolic activity and stress response. The fundamental importance of these processes is evident in the fact that mutations in fission (DRP1), fusion (MFN2, OPA1), and mitophagy (PINK1, PARK2) genes can cause human disease (collectively >1/10,000). Interestingly, however, the age of onset and severity of clinical manifestations varies greatly between patients with these diseases (even those harboring identical mutations), suggesting a role for environmental factors in the development and progression of certain mitochondrial diseases. Using the model organism Caenorhabditis elegans, we screened ten mitochondrial toxicants (2, 4-dinitrophenol, acetaldehyde, acrolein, aflatoxin B1, arsenite, cadmium, cisplatin, doxycycline, paraquat, rotenone) for increased or decreased toxicity in fusion (fzo-1, eat-3)-, fission (drp-1)-, and mitophagy (pdr-1, pink-1)-deficient nematodes using a larval growth assay. In general, fusion-deficient nematodes were the most sensitive to toxicants, including aflatoxin B1, arsenite, cisplatin, paraquat, and rotenone. Because arsenite was particularly potent in fission- and fusion-deficient nematodes, and hundreds of millions of people are chronically exposed to arsenic, we investigated the effects of these genetic deficiencies on arsenic toxicity in more depth. We found that deficiencies in fission and fusion sensitized nematodes to arsenite-induced lethality throughout aging. Furthermore, low-dose arsenite, which acted in a "mitohormetic" fashion by increasing mitochondrial function (in particular, basal and maximal oxygen consumption) in wild-type nematodes by a wide range of measures, exacerbated mitochondrial dysfunction in fusion-deficient nematodes. Analysis of multiple mechanistic changes suggested that disruption of pyruvate metabolism and Krebs cycle activity underlie the observed arsenite

  11. Genetics Home Reference: cytochrome c oxidase deficiency

    MedlinePlus

    ... DNA in specialized structures in the cell called mitochondria . This type of DNA is known as mitochondrial ... oxidase deficiency are involved in energy production in mitochondria through a process called oxidative phosphorylation . The gene ...

  12. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

    PubMed

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

    2017-02-09

    In Neurospora crassa, blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa, we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  13. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

  14. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism

    PubMed Central

    Qi, Zhigang; Smith, Kristina M.; Bredeweg, Erin L.; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E.

    2016-01-01

    In Neurospora crassa, blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa, we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. PMID:27986792

  15. The Core Promoter and Redox-sensitive Cis-elements as Key Targets for Inactivation of the Lysyl Oxidase Gene by Cadmium

    PubMed Central

    Li, Jianmin; Cheng, Guang; Zheng, Maoguen; Zhao, Yinzhi; Zhou, Jing; Li, Wande

    2015-01-01

    Exposure of humans to cadmium (Cd) either from environmental contamination or from cigarette smoke, often induces lung emphysema and cancers. Lysyl oxidase (LOX), a copper-dependent enzyme essential for crosslinking of the extracellular matrix, displays antagonistic effects on emphysema and cancer pathogenesis. Our previous studies showed down-regulation of LOX in Cd-resistant (CdR) rat fetal lung fibroblasts (RFL6) derived from parental cells via long-term Cd exposure. The cloned rat LOX gene promoter −804/−1 (relative to ATG) with the maximal promoter activity contains the Inr-DPE core promoter, putative NFI binding sites, metal response elements (MRE) and antioxidant response elements (ARE). ChIP assays reported here further characterize the rat LOX gene promoter in response to Cd. CdR cells exhibited enhanced methylation of CpG at the LOX core promoter region and reduced activities of the NFI binding sites and MRE, but increased activity of the ARE in a dose-dependent manner. The collective effect of Cd on the LOX promoter is trans-inhibition of the LOX gene as shown by suppression of histone H3 acetylation in the LOX core promoter region. Thus, the LOX core promoter and redox-sensitive cis-elements are key Cd targets for down-regulation of LOX relevant to mechanisms for Cd-induced emphysema and lung cancers. PMID:25741534

  16. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  17. Phylogenetic relationships within Taenia taeniaeformis variants and other taeniid cestodes inferred from the nucleotide sequence of the cytochrome c oxidase subunit I gene.

    PubMed

    Okamoto, M; Bessho, Y; Kamiya, M; Kurosawa, T; Horii, T

    1995-01-01

    Nucleotide sequence variations in a region of the mitochondrial cytochrome c oxidase subunit I (COI) gene (391 bp) were examined within seven species of the genus Taenia and two species of the genus Echinococcus, including ten isolates of T. taeniaeformis and six isolates of E. multilocularis. More than a 12% rate of nucleotide differences between taeniid species was found, allowing the species to be distinguished. In E. multilocularis, no sequence variation was observed among isolates, regardless of the host (gray red-backed vole, tundra vole, pig, Norway rat) or area (Japan, Alaska) from which each metacestode had been isolated. In contrast, six distinct sequences were detected among the ten T. taeniaeformis isolates examined. The level of nucleotide variation in the COI gene within T. taeniaeformis isolates except for one isolate from the gray red-backed vole (TtACR), which has been proposed as a distinct strain or a different species, was about 0.3%-4.1%, whereas the COI gene sequence for TtACR differed from those of the other isolates, with levels being 9.0%-9.5%. Phylogenetic trees were then inferred from these sequence data using two different algorithms.

  18. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  19. Structural insights into sulfite oxidase deficiency.

    PubMed

    Karakas, Erkan; Wilson, Heather L; Graf, Tyler N; Xiang, Song; Jaramillo-Busquets, Sandra; Rajagopalan, K V; Kisker, Caroline

    2005-09-30

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  20. Burkholderia pseudomallei Evades Nramp1 (Slc11a1)- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

    PubMed Central

    Muangsombut, Veerachat; Withatanung, Patoo; Srinon, Varintip; Chantratita, Narisara; Stevens, Mark P.; Blackwell, Jenefer M.; Korbsrisate, Sunee

    2017-01-01

    Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1) which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+) control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1), the Bsa Type III Secretion System (T3SS-3) and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence-associated genes by

  1. Circ100284, via miR-217 regulation of EZH2, is involved in the arsenite-accelerated cell cycle of human keratinocytes in carcinogenesis.

    PubMed

    Xue, Junchao; Liu, Yang; Luo, Fei; Lu, Xiaolin; Xu, Hui; Liu, Xinlu; Lu, Lu; Yang, Qianlei; Chen, Chao; Fan, Weimin; Liu, Qizhan

    2017-03-01

    Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of the cell cycle, a circRNA microarray was performed to analyze the variability of circRNAs in arsenite-treated HaCaT (As-HaCaT) cells and in arsenite-transformed (T-HaCaT) cells in comparison to control HaCaT cells. Among the circRNAs up-regulated in both As-HaCaT cells and T-HaCaT cells, hsa:circRNA_100284 (circ100284) had the greatest increase and was chosen for further research. The presence of circ100284 was confirmed in HaCaT cells. In these cells, arsenite induced increases of EZH2 and cyclin D1 and accelerated the cell cycle. MicroRNA (miR)-217 suppressed the expression of EZH2 was involved in regulation of the cell cycle. Further, in HaCaT cells exposed to arsenite, EZH2 regulated the cell cycle by binding to the promoter of CCND1, which codes for cyclin D1. Moreover, knockdown of circ100284 with siRNA inhibited the cell cycle acceleration induced by arsenite, but this inhibition was reversed by co-transfection with circ100284 siRNA and by a miR-217 inhibitor. Knockdown of circ100284 with siRNA or transfected with miR-217 mimic inhibited the capacity of T-HaCaT cells for colony formation, invasion, and migration, effects that were reversed by co-transfection with a miR-217 inhibitor or by epigenetic expression of EZH2. These results suggest that, in HaCaT cells, arsenite increases circ100284 levels, which act as a sponge for miR-217 and up-regulate the miR-217 target, EZH2, which, in turn, up-regulates cyclin D1and CDK4, and thus accelerates the cell cycle and leads to malignant transformation. Thus, circ100284, via miR-217 regulation of EZH2, is involved in the arsenite-accelerated cell cycle of human keratinocytes in carcinogenesis. This establishes a previously unknown

  2. Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

    PubMed

    Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

    2015-03-28

    Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

  3. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  4. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  5. Alternative oxidase 1 (Aox1) gene expression in roots of Medicago truncatula is a genotype-specific component of salt stress tolerance.

    PubMed

    Mhadhbi, Haythem; Fotopoulos, Vasileios; Mylona, Photini V; Jebara, Moez; Aouani, Mohamed Elarbi; Polidoros, Alexios N

    2013-01-01

    Alternative oxidase (AOX) is the central component of the non-phosphorylating alternative respiratory pathway in plants and may be important for mitochondrial function during environmental stresses. Recently it has been proposed that Aox can be used as a functional marker for breeding stress tolerant plant varieties. This requires characterization of Aox alleles in plants with different degree of tolerance in a certain stress, affecting plant phenotype in a recognizable way. In this study we examined Aox1 gene expression levels in Medicago truncatula genotypes differing in salt stress tolerance, in order to uncover any correlation between Aox expression and tolerance to salt stress. Results demonstrated a specific induction of Aox1 gene expression in roots of the tolerant genotype that presented the lowest modulation in phenotypic and biochemical stress indices such as morphologic changes, protein level, lipid peroxidation and ROS generation. Similarly, in a previous study we reported that induction of antioxidant gene expression in the tolerant genotype contributed to the support of the antioxidant cellular machinery and stress tolerance. Correlation between expression patterns of the two groups of genes was revealed mainly in 48 h treated roots. Taken together, results from both experiments suggest that M. truncatula tolerance to salt stress may in part due to an efficient control of oxidative balance thanks to (i) induction of antioxidant systems and (ii) involvement of the AOX pathway. This reinforces the conclusion that differences in antioxidant mechanisms can be essential for salt stress tolerance in M. truncatula and possibly the corresponding genes, especially Aox, could be utilized as functional marker.

  6. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    PubMed

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  7. Sodium arsenite accelerates TRAIL-mediated apoptosis in melanoma cells through upregulation of TRAIL-R1/R2 surface levels and downregulation of cFLIP expression

    SciTech Connect

    Ivanov, Vladimir N. . E-mail: vni3@columbia.edu; Hei, Tom K.

    2006-12-10

    AP-1/cJun, NF-{kappa}B and STAT3 transcription factors control expression of numerous genes, which regulate critical cell functions including proliferation, survival and apoptosis. Sodium arsenite is known to suppress both the IKK-NF-{kappa}B and JAK2-STAT3 signaling pathways and to activate the MAPK/JNK-cJun pathways, thereby committing some cancers to undergo apoptosis. Indeed, sodium arsenite is an effective drug for the treatment of acute promyelocytic leukemia with little nonspecific toxicity. Malignant melanoma is highly refractory to conventional radio- and chemotherapy. In the present study, we observed strong effects of sodium arsenite treatment on upregulation of TRAIL-mediated apoptosis in human and mouse melanomas. Arsenite treatment upregulated surface levels of death receptors, TRAIL-R1 and TRAIL-R2, through increased translocation of these proteins from cytoplasm to the cell surface. Furthermore, activation of cJun and suppression of NF-{kappa}B by sodium arsenite resulted in upregulation of the endogenous TRAIL and downregulation of the cFLIP gene expression (which encodes one of the main anti-apoptotic proteins in melanomas) followed by cFLIP protein degradation and, finally, by acceleration of TRAIL-induced apoptosis. Direct suppression of cFLIP expression by cFLIP RNAi also accelerated TRAIL-induced apoptosis in these melanomas, while COX-2 suppression substantially increased levels of both TRAIL-induced and arsenite-induced apoptosis. In contrast, overexpression of permanently active AKTmyr inhibited TRAIL-mediated apoptosis via downregulation of TRAIL-R1 levels. Finally, AKT overactivation increased melanoma survival in cell culture and dramatically accelerated growth of melanoma transplant in vivo, highlighting a role of AKT suppression for effective anticancer treatment.

  8. Cloning and expression of zebrafish genes encoding the heme synthesis enzymes uroporphyrinogen III synthase (UROS) and protoporphyrinogen oxidase (PPO).

    PubMed

    Hanaoka, Ryuki; Dawid, Igor B; Kawahara, Atsuo

    2007-02-01

    Heme is synthesized from glycine and succinyl CoA by eight heme synthesis enzymes. Although genetic defects in any of these enzymes are known to cause severe human blood diseases, their developmental expression in mammals is unknown. In this paper, we report two zebrafish heme synthesis enzymes, uroporphyrinogen III synthase (UROS) and protoporphyrinogen oxidase (PPO) that are well conserved in comparison to their human counterparts. Both UROS and PPO formed pairs of bilateral stripes in the lateral plate mesoderm at the 15-somite stage. At 24 h post-fertilization (hpf), UROS and PPO were predominantly expressed in the intermediate cell mass (ICM) that is the major site of primitive hematopoiesis. The expression of UROS and PPO was drastically suppressed in the bloodless mutants cloche and vlad tepes/gata 1 from 15-somite to 24hpf stages, indicating that both cloche and vlad tepes/gata 1 are required for the induction and maintenance of UROS and PPO expression in the ICM.

  9. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.

    PubMed

    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C

    2003-12-01

    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  10. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  11. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

  12. Association of A/G polymorphism in intron 13 of the monoamine oxidase B gene with schizophrenia in a Spanish population.

    PubMed

    Gassó, Patricia; Bernardo, Miquel; Mas, Sergi; Crescenti, Anna; Garcia, Clemente; Parellada, Eduard; Lafuente, Amalia

    2008-01-01

    Monoamine oxidase B (MAO-B) enzyme is involved in the oxidative metabolism of dopamine. We studied whether the A644G polymorphism in intron 13 of the MAO-B gene is a risk factor for schizophrenia. 242 subjects diagnosed with schizophrenia and related disorders and 290 hospital-based controls participated in the study. Genomic DNA was isolated from whole blood and genotyped with the allele-specific oligonucleotide polymerase chain reaction method. This polymorphism was studied by diagnosis subgroups and the G allele was identified as a risk factor for developing schizophrenia (p = 0.006). When we performed a sex-specific analysis, the G allele was only a risk factor for developing schizophrenia in women (p = 0.01). Although the frequency of the G allele is higher in male patients than in male controls, no statistically significant association with schizophrenia was found. Our results support the involvement of the MAO-B gene in schizophrenia, particularly in women. Copyright 2008 S. Karger AG, Basel.

  13. Over-expression of a gibberellin 2-oxidase gene from Phaseolus coccineus L. enhances gibberellin inactivation and induces dwarfism in Solanum species.

    PubMed

    Dijkstra, C; Adams, E; Bhattacharya, A; Page, A F; Anthony, P; Kourmpetli, S; Power, J B; Lowe, K C; Thomas, S G; Hedden, P; Phillips, A L; Davey, M R

    2008-03-01

    Gibberellins (GAs) are endogenous hormones that play a predominant role in regulating plant stature by increasing cell division and elongation in stem internodes. The product of the GA 2-oxidase gene from Phaseolus coccineus (PcGA2ox1) inactivates C(19)-GAs, including the bioactive GAs GA(1 )and GA(4), by 2beta-hydroxylation, reducing the availability of these GAs in plants. The PcGA2ox1 gene was introduced into Solanum melanocerasum and S. nigrum (Solanaceae) by Agrobacterium-mediated transformation with the aim of decreasing the amounts of bioactive GA in these plants and thereby reducing their stature. The transgenic plants exhibited a range of dwarf phenotypes associated with a severe reduction in the concentrations of the biologically active GA(1) and GA(4). Flowering and fruit development were unaffected. The transgenic plants contained greater concentrations of chlorophyll b (by 88%) and total chlorophyll (11%), although chlorophyll a and carotenoid contents were reduced by 8 and 50%, respectively. This approach may provide an alternative to the application of chemical growth retardants for reducing the stature of plants, particularly ornamentals, in view of concerns over the potential environmental and health hazards of such compounds.

  14. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

    PubMed Central

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-01-01

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag+-responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism. PMID:28304398

  15. Inhibition of development of experimental abdominal aortic aneurysm by c-jun N-terminal protein kinase inhibitor combined with lysyl oxidase gene modified smooth muscle progenitor cells.

    PubMed

    Chen, Feng; Zhang, ZhenDong; Zhu, XianHua

    2015-11-05

    Chronic inflammation, imbalance between the extracellular matrix synthesis and degradation, and loss of vascular smooth muscle cells (SMCs) contribute to the development of abdominal aortic aneurysm (AAA). The purpose of this study was to investigate the effect of the therapy with periaortic incubation of c-Jun N-terminal protein kinase inhibitor SP600125 infused from an osmotic pump and subadventitial injection of lysyl oxidase (LOX) gene modified autologous smooth muscle progenitor cells (SPCs) on treatment of AAA in a rabbit model. Obvious dilation of the abdominal aorta in the control group was caused by periaortic incubation of calcium chloride and elastase. But the progression of aortic dilation was significantly decreased after the treatment with SP600125 and LOX gene modified SPCs compared to the treatment with phosphate-buffered saline. This therapy could inhibit matrix metalloproteinases expression, enhance elastin synthesis, improve preservation of elastic laminar integrity, benefit SPCs survival and restore SMCs population. It seemed that this method might provide a novel therapeutic strategy to treat AAA.

  16. Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

    PubMed Central

    Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

    2012-01-01

    Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974

  17. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  18. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

    PubMed

    Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

    2006-06-01

    The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

  19. A mutation in the FAM36A gene, the human ortholog of COX20, impairs cytochrome c oxidase assembly and is associated with ataxia and muscle hypotonia.

    PubMed

    Szklarczyk, Radek; Wanschers, Bas F J; Nijtmans, Leo G; Rodenburg, Richard J; Zschocke, Johannes; Dikow, Nicola; van den Brand, Mariël A M; Hendriks-Franssen, Marthe G M; Gilissen, Christian; Veltman, Joris A; Nooteboom, Marco; Koopman, Werner J H; Willems, Peter H G M; Smeitink, Jan A M; Huynen, Martijn A; van den Heuvel, Lambertus P

    2013-02-15

    The mitochondrial respiratory chain complex IV (cytochrome c oxidase) is a multi-subunit enzyme that transfers electrons from cytochrome c to molecular oxygen, yielding water. Its biogenesis requires concerted expression of mitochondria- and nuclear-encoded subunits and assembly factors. In this report, we describe a homozygous missense mutation in FAM36A from a patient who displays ataxia and muscle hypotonia. The FAM36A gene is a remote, putative ortholog of the fungal complex IV assembly factor COX20. Messenger RNA (mRNA) and protein co-expression analyses support the involvement of FAM36A in complex IV function in mammals. The c.154A>C mutation in the FAM36A gene, a mutation that is absent in sequenced exomes, leads to a reduced activity and lower levels of complex IV and its protein subunits. The FAM36A protein is nearly absent in patient's fibroblasts. Cells affected by the mutation accumulate subassemblies of complex IV that contain COX1 but are almost devoid of COX2 protein. We observe co-purification of FAM36A and COX2 proteins, supporting that the FAM36A defect hampers the early step of complex IV assembly at the incorporation of the COX2 subunit. Lentiviral complementation of patient's fibroblasts with wild-type FAM36A increases the complex IV activity as well as the amount of holocomplex IV and of individual subunits. These results establish the function of the human gene FAM36A/COX20 in complex IV assembly and support a causal role of the gene in complex IV deficiency.

  20. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy.

    PubMed

    Kartavtsev, Yuri Ph; Sharina, Svetlana N; Goto, Tadasuke; Chichvarkhin, Anton Y; Balanov, Andrey A; Vinnikov, Kirill A; Ivankov, Vyacheslav N; Hanzawa, Naoto

    2008-12-01

    Mitochondrial DNA at the cytochrome oxidase 1 (Co-1) gene region was sequenced for six flatfish species (in total, 11 sequences of at least 539 base pairs) from the Far East of Russia and compared with other sequences of Pleuronectiformes, comprising altogether 26 flatfish sequences and two outgroup sequences (Perciformes). An analysis of the protein-coding Co-1 gene revealed a statistically substantiated bias in (T + C):(A + G) content, supporting earlier findings. Average scores of the p-distances for different scales of the evolutionary history at the Co-1 gene revealed a clear pattern of increased nucleotide diversity at four different levels: (1) intraspecies, (2) intragenus, (3) intrafamily, and (4) intra-order. Scores of average p-distances of the four categories of comparison in flatfishes were (1) 0.17 +/- 0.09%, (2) 10.60 +/- 1.57%, (3) 12.40 +/- 0.27%, and (4) 19.93 +/- 0.05%, respectively (mean +/- standard error). These data jointly with current knowledge support the concept that speciation in the order Pleuronectiformes mostly follows a geographic mode through accumulation of numerous small genetic changes over a long period of time. A phylogenetic tree for 26 sequences of flatfishes and two other fishes belonging to ray-finned fishes (Actinopterigii) was developed using the Co-1 gene and four different analytical approaches: neighbour-joining, Bayesian (BA), maximum parsimony (MP), and maximum likelihood. The analysis revealed a monophyletic origin for the representatives of Pleuronectidae, which is the principal flatfish family investigated (73-100% support level in our MP and BA analyses). According to the current and literary data, the monophyletic origin for the six compared flatfish families was well supported. Species identification on a per-individual basis (barcoding tagging) was high.

  1. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  2. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species.

  3. Endoplasmic reticulum stress is involved in arsenite-induced oxidative injury in rat brain

    SciTech Connect

    Lin, Anya M.Y.; Chao, P.L.; Fang, S.F.; Chi, C.W.; Yang, C.H.

    2007-10-15

    The mechanism underlying sodium arsenite (arsenite)-induced neurotoxicity was investigated in rat brain. Arsenite was locally infused in the substantia nigra (SN) of anesthetized rat. Seven days after infusion, lipid peroxidation in the infused SN was elevated and dopamine level in the ipsilateral striatum was reduced in a concentration-dependent manner (0.3-5 nmol). Furthermore, local infusion of arsenite (5 nmol) decreased GSH content and increased expression of heat shock protein 70 and heme oxygenase-1 in the infused SN. Aggregation of {alpha}-synuclein, a putative pathological protein involved in several CNS neurodegenerative diseases, was elevated in the arsenite-infused SN. From the breakdown pattern of {alpha}-spectrin, both necrosis and apoptosis were involved in the arsenite-induced neurotoxicity. Pyknotic nuclei, cellular shrinkage and cytoplasmic disintegration, indicating necrosis, and TUNEL-positive cells and DNA ladder, indicating apoptosis was observed in the arsenite-infused SN. Arsenite-induced apoptosis was mediated via two different organelle pathways, mitochondria and endoplasmic reticulum (ER). For mitochondrial activation, cytosolic cytochrome c and caspase-3 levels were elevated in the arsenite-infused SN. In ER pathway, arsenite increased activating transcription factor-4, X-box binding protein 1, C/EBP homologues protein (CHOP) and cytosolic immunoglobulin binding protein levels. Moreover, arsenite reduced procaspase 12 levels, an ER-specific enzyme in the infused SN. Taken together, our study suggests that arsenite is capable of inducing oxidative injury in CNS. In addition to mitochondria, ER stress was involved in the arsenite-induced apoptosis. Arsenite-induced neurotoxicity clinically implies a pathophysiological role of arsenite in CNS neurodegeneration.

  4. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidasegene variations and the risk of noise-induced hearing loss].

    PubMed

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidasegene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group (n=286) and the control group (n=286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidasegene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  5. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Treesearch

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  6. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    USDA-ARS?s Scientific Manuscript database

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  7. Isolation of arsenite-oxidizing bacteria from a natural biofilm associated to volcanic rocks of Atacama Desert, Chile.

    PubMed

    Campos, V L; Escalante, G; Yañez, J; Zaror, C A; Mondaca, M A

    2009-09-01

    Arsenic is naturally present in rocks, soil, water, and air. It is released to the environment by natural processes such as volcanic eruptions, and rock erosion. In this study, two arsenite-oxidizing strains were isolated from volcanic rocks obtained from the Camarones Valley, Atacama Desert, Chile. Strains were isolated from biofilms and identified by 16s ARNr sequences analysis. aox genes were detected by RT-PCR. The arsenic oxidation ability was assayed with silver nitrate and HPLC-HG-AAS. Four arsenite-resistant strains were isolated (8 mM). RT-PCR analysis showed the presence of aox genes in UC-2 and UC-6 strains. In addition, UC-2 and UC-6 strains were able to oxidize 90 and 95% arsenite present in the medium to arsenate, at a rate of 9.3 and 9.8 microg ml(-1) h(-1 )respectively. Bicarbonate (HCO(3) (-)) was used as unique carbon source. Finally, the significative oxidation capacity shown by both strains opens the way to further studies aimed at implementing biological systems to treat arsenic rich wastewater. Copyright 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.

    PubMed

    Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

    2014-05-01

    Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect.

  9. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

    PubMed

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

    2016-12-01

    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  11. Overexpression of the cytochrome c oxidase subunit I gene associated with a pyrethroid resistant strain of German cockroaches, Blattella germanica (L.).

    PubMed

    Pridgeon, Julia W; Liu, Nannan

    2003-10-01

    A cytochrome c oxidase subunit I gene (COXI) was identified and isolated as a differentially expressed gene between insecticide susceptible ACY and resistant Apyr-R German cockroach strains using PCR-selected subtractive hybridization and cDNA array techniques. The cDNA sequence of COXI has an open reading frame of 1533 nucleotides encoding a putative protein of 511 amino acid residues. Northern blot analysis indicated that levels of COXI expression were similar in three life stages (eggs, nymphs, and adults) of the susceptible ACY strain. The expression of COXI in the resistant Apyr-R strain was developmentally regulated, with low expression in eggs, an increase (approximately 1.4-fold) in nymphs, and rose to a maximum (approximately 3-fold) in both adult females and males. Comparison of COXI expression between ACY and Apyr-R strains indicated that there was no difference in the eggs of the two strains, but expression was higher (approximately 1.5-fold) in nymphs and much higher (approximately 3- to 4-fold) in adult males and females of the Apyr-R strain. The levels of COXI mRNA showed about 1.4- and 1.7-fold increase in the abdomen tissues compared with the head+thorax tissues of ACY and Apyr-R strains, respectively. Although expression patterns of COXI in head+thorax and abdomen tissues were similar (i.e. lower in the head+thorax tissues and higher in the abdomen tissues) in both the ACY and Apyr-R strains, the expression of COXI was about 2.5-fold higher in the head+thorax and approximately 3-fold higher in the abdomen tissues of the Apyr-R strain compared with the corresponding ACY samples. The overexpression of COXI in resistant German cockroaches merits the investigation of the importance of the gene in insecticide resistant German cockroaches.

  12. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.

    PubMed

    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov

    2012-06-01

    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  13. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.

    PubMed

    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea

    2011-03-01

    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

    PubMed Central

    Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

    2012-01-01

    Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis. PMID:23378972

  15. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  16. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  17. Deficiency of long isoforms of Nfe2l1 sensitizes MIN6 pancreatic β cells to arsenite-induced cytotoxicity.

    PubMed

    Cui, Qi; Fu, Jingqi; Hu, Yuxin; Li, Yongfang; Yang, Bei; Li, Lu; Sun, Jing; Chen, Chengjie; Sun, Guifan; Xu, Yuanyuan; Zhang, Qiang; Pi, Jingbo

    2017-08-15

    Increasing evidence indicates that chronic inorganic arsenic exposure is associated with type 2 diabetes (T2D), a disease of growing prevalence. Pancreatic β-cells were targeted and damaged by oxidative stress induced by arsenite. We previously showed that nuclear factor erythroid 2 like 2 (Nfe2l2)-deficient pancreatic β-cells were vulnerable to cell damage induced by oxidative stressors including arsenite, due to a muted antioxidant response. Like nuclear factor erythroid 2 like 2 (NFE2L2), NFE2L1 also belongs to the cap 'n' collar (CNC) basic-region leucine zipper (bZIP) transcription factor family, and regulates antioxidant response element (ARE) related genes. Our prior work showed NFE2L1 regulates glucose-stimulated insulin secretion (GSIS) in pancreatic β-cells and isolated islets. In the current study, we demonstrated that MIN6 cells with a specific knockdown of long isoforms of Nfe2l1 (L-Nfe2l1) by lentiviral shRNA (Nfe2l1(L)-KD) were vulnerable to arsenite-induced apoptosis and cell damage. The expression levels of antioxidant genes, such as Gclc, Gclm and Ho-1, and intracellular reactive oxygen species (ROS) levels were not different in Scramble and Nfe2l1(L)-KD cells, while the expression of arsenic metabolism related-genes, such as Gsto1, Gstm1 and Nqo1, increased in Nfe2l1(L)-KD cells with or without arsenite treatment. The up-regulation of arsenic biotransformation genes was due to activated NFE2L2 in Nfe2l1(L)-KD MIN6 cells. Furthermore, the level of intracellular monomethylarsenic (MMA) was higher in Nfe2l1(L)-KD MIN6 cells than in Scramble cells. These results showed that deficiency of L-Nfe2l1 in pancreatic β-cells increased susceptibility to acute arsenite-induced cytotoxicity by promoting arsenic biotransformation and intracellular MMA levels. Copyright © 2017. Published by Elsevier Inc.

  18. ZERO-VALENT IRON FOR HIGH-LEVEL ARSENITE REMOVAL

    EPA Science Inventory

    This study conducted by flow through column systems was aimed at investigating the feasibility of using zero-valent iron for arsenic remediation in groundwater. A high concentration arsenic solution (50 mg l-1) was prepared by using sodium arsenite (arsenic (III)) to simulate gr...

  19. Proteomic Profiling of Bladders from Mice Exposed with Sodium Arsenite

    EPA Science Inventory

    Arsenic, an environmental contaminant, has been linked with cancer of the bladder in humans. To study the mode of action of arsenic, female CH3 mice were exposed to 85 ppm sodium arsenite in their drinking water for 30 days. Following the exposure a comparative proteomic analysis...

  20. Decrease of fibrinolytic activity in human endothelial cells by arsenite.

    PubMed

    Jiang, Shinn-Jong; Lin, Tsun-Mei; Wu, Hua-Lin; Han, Huai-Song; Shi, Guey-Yueh

    2002-01-01

    Blackfoot disease (BFD) is an endemic peripheral vascular occlusive disease that occurred in the southwest coast of Taiwan. It is believed that arsenic in the drinking water from artesian wells plays an important role in the development of the disease. We have previously shown that BFD patients had significant lower tissue-type plasminogen activator (t-PA) antigen level and higher plasminogen activator inhibitor, Type 1 (PAI-1) antigen level than normal controls. The purpose of this study was to investigate the effects of arsenite on the fibrinolytic and anticoagulant activities of cultured macrovascular and microvascular endothelial cells. Incubation of human microvascular endothelial cells (HMEC-1), but not human umbilical vein endothelial cells (HUVECs), with arsenite caused a decrease of t-PA mRNA level, a rise of both PAI-1 mRNA level and PAI activity. Arsenite could also inhibit the thrombomodulin (TM) mRNA expression and reduce the TM antigen level in HMEC-1. In conclusion, arsenite had a greater effect on HMEC-1 as compared to HUVECs in lowering the fibrinolytic activity and may be responsible for the reduced capacity of fibrinolysis associated with BFD.

  1. Traveling Waves in the Arsenite-Iodate System.

    ERIC Educational Resources Information Center

    Epstein, Irving R.

    1983-01-01

    The reaction between arsenite and iodate in acidic solution offers an excellent pedagogic introduction to such phenomena as traveling waves. Component reactions, traveling waves, and a mathematical model are discussed. Demonstrations described can easily be elaborated into a full laboratory experiment. (Author/JN)

  2. Proteomic Profiling of Bladders from Mice Exposed with Sodium Arsenite

    EPA Science Inventory

    Arsenic, an environmental contaminant, has been linked with cancer of the bladder in humans. To study the mode of action of arsenic, female CH3 mice were exposed to 85 ppm sodium arsenite in their drinking water for 30 days. Following the exposure a comparative proteomic analysis...

  3. Inhibition of mitotic-specific histone phophorylation by sodium arsenite

    SciTech Connect

    Cobo, J.M.; Valdez, J.G.; Gurley, L.R.

    1994-10-01

    Synchronized cultures of Chinese hamster cells (line CHO) were used to measure the effects of 10{mu}M sodium arsenite on histone phosphorylation. This treatment caused cell proliferation to be temporarily arrested, after which the cells spontaneously resumed cell proliferation in a radiomimetric manner. Immediately following treatment, it was found that sodium arsenite affected only mitotic-specific HI and H3 phosphorylations. Neither interphase, nor mitotic, H2A and H4 phosphorylations were affected, nor was interphase HI Phosphorylation affected. The phosphorylation of HI was inhibited only in mitosis, reducing HI phosphorylation to 38.1% of control levels, which was the level of interphase HI phosphorylation. The phosphorylation of both H3 variants was inhibited in mitosis, the less hydrophobic H3 to 19% and the more hydrophobic H3 to 24% of control levels. These results suggest that sodium arsenite may inhibite cell proliferation by interfering with the cyclin B/p34{sup cdc2} histone kinase activity which is thought to play a key role in regulating the cell cycle. It has been proposed by our laboratory that HI and H3 phosphorylations play a role in restructuring interphase chromatin into metaphase chromosomes. Interference of this process by sodium arsenite may lead to structurally damaged chromosomes resulting in the increased cancer risks known to be produced by arsenic exposure from the environment.

  4. Evidence that the methylation state of the monoamine oxidase A (MAOA) gene predicts brain activity of MAOA enzyme in healthy men

    PubMed Central

    Shumay, Elena; Logan, Jean; Volkow, Nora D.; Fowler, Joanna S.

    2012-01-01

    Human brain function is mediated by biochemical processes, many of which can be visualized and quantified by positron emission tomography (PET). PET brain imaging of monoamine oxidase A (MAOA)—an enzyme metabolizing neurotransmitters—revealed that MAOA levels vary widely between healthy men and this variability was not explained by the common MAOA genotype (VNTR genotype), suggesting that environmental factors, through epigenetic modifications, may mediate it. Here, we analyzed MAOA methylation in white blood cells (by bisulphite conversion of genomic DNA and subsequent sequencing of cloned DNA products) and measured brain MAOA levels (using PET and [11C]clorgyline, a radiotracer with specificity for MAOA) in 34 healthy non-smoking male volunteers. We found significant interindividual differences in methylation status and methylation patterns of the core MAOA promoter. The VNTR genotype did not influence the methylation status of the gene or brain MAOA activity. In contrast, we found a robust association of the regional and CpG site-specific methylation of the core MAOA promoter with brain MAOA levels. These results suggest that the methylation status of the MAOA promoter (detected in white blood cells) can reliably predict the brain endophenotype. Therefore, the status of MAOA methylation observed in healthy males merits consideration as a variable contributing to interindividual differences in behavior. PMID:22948232

  5. Evidence that the methylation state of the monoamine oxidase A (MAOA) gene predicts brain activity of MAO A enzyme in healthy men.

    PubMed

    Shumay, Elena; Logan, Jean; Volkow, Nora D; Fowler, Joanna S

    2012-10-01

    Human brain function is mediated by biochemical processes, many of which can be visualized and quantified by positron emission tomography (PET). PET brain imaging of monoamine oxidase A (MAO A)-an enzyme metabolizing neurotransmitters-revealed that MAO A levels vary widely between healthy men and this variability was not explained by the common MAOA genotype (VNTR genotype), suggesting that environmental factors, through epigenetic modifications, may mediate it. Here, we analyzed MAOA methylation in white blood cells (by bisulphite conversion of genomic DNA and subsequent sequencing of cloned DNA products) and measured brain MAO A levels (using PET and [(11)C]clorgyline, a radiotracer with specificity for MAO A) in 34 healthy non-smoking male volunteers. We found significant interindividual differences in methylation status and methylation patterns of the core MAOA promoter. The VNTR genotype did not influence the methylation status of the gene or brain MAO A activity. In contrast, we found a robust association of the regional and CpG site-specific methylation of the core MAOA promoter with brain MAO A levels. These results suggest that the methylation status of the MAOA promoter (detected in white blood cells) can reliably predict the brain endophenotype. Therefore, the status of MAOA methylation observed in healthy males merits consideration as a variable contributing to interindividual differences in behavior.

  6. Genetic Susceptibility for Individual Cooperation Preferences: The Role of Monoamine Oxidase A Gene (MAOA) in the Voluntary Provision of Public Goods

    PubMed Central

    Mertins, Vanessa; Schote, Andrea B.; Hoffeld, Wolfgang; Griessmair, Michele; Meyer, Jobst

    2011-01-01

    In the context of social dilemmas, previous research has shown that human cooperation is mainly based on the social norm of conditional cooperation. While in most cases individuals behave according to such a norm, deviant behavior is no exception. Recent research further suggests that heterogeneity in social behavior might be associated with varying genetic predispositions. In this study, we investigated the relationship between individuals' behavior in a public goods experiment and the promoter-region functional repeat polymorphism in the monoamine oxidase A gene (MAOA). In a dynamic setting of increasing information about others' contributions, we analyzed differences in two main components of conditional cooperation, namely the players' own contribution and their beliefs regarding the contribution of other players. We showed that there is a significant association between individuals' behavior in a repeated public goods game and MAOA. Our results suggest that male carriers of the low activity alleles cooperate significantly less than those carrying the high activity alleles given a situation where subjects had to rely on their innate beliefs about others' contributions. With increasing information about the others' cooperativeness, the genetic effect diminishes. Furthermore, significant opposing effects for female subjects carrying two low activity alleles were observed. PMID:21698196

  7. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata).

    PubMed

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-10-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria.

  8. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.

    PubMed

    Makouloutou, P; Setsuda, A; Yokoyama, M; Tsuji, T; Saita, E; Torii, H; Kaneshiro, Y; Sasaki, M; Maeda, K; Une, Y; Hasegawa, H; Sato, H

    2013-09-01

    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan.

  9. Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

    PubMed Central

    Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

    2012-01-01

    A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

  10. The rebalanced pathway significantly enhances acetoin production by disruption of acetoin reductase gene and moderate-expression of a new water-forming NADH oxidase in Bacillus subtilis.

    PubMed

    Zhang, Xian; Zhang, Rongzhen; Bao, Teng; Rao, Zhiming; Yang, Taowei; Xu, Meijuan; Xu, Zhenghong; Li, Huazhong; Yang, Shangtian

    2014-05-01

    Bacillus subtilis produces acetoin as a major extracellular product. However, the by-products of 2,3-butanediol, lactic acid and ethanol were accompanied in the NADH-dependent pathways. In this work, metabolic engineering strategies were proposed to redistribute the carbon flux to acetoin by manipulation the NADH levels. We first knocked out the acetoin reductase gene bdhA to block the main flux from acetoin to 2,3-butanediol. Then, among four putative candidates, we successfully screened an active water-forming NADH oxidase, YODC. Moderate-expression of YODC in the bdhA disrupted B. subtilis weakened the NADH-linked pathways to by-product pools of acetoin. Through these strategies, acetoin production was improved to 56.7g/l with an increase of 35.3%, while the production of 2,3-butanediol, lactic acid and ethanol were decreased by 92.3%, 70.1% and 75.0%, respectively, simultaneously the fermentation duration was decreased 1.7-fold. Acetoin productivity by B. subtilis was improved to 0.639g/(lh). Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  11. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial.

  12. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-01-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  13. Down-regulation of acyl-CoA oxidase gene expression and increased NF-kappaB activity in etomoxir-induced cardiac hypertrophy.

    PubMed

    Cabrero, Agatha; Merlos, Manuel; Laguna, Juan C; Carrera, Manuel Vázquez

    2003-02-01

    Activation of nuclear factor-kappaB (NF-kappaB) is required for hypertrophic growth of cardiomyocytes. Etomoxir is an irreversible inhibitor of carnitine palmitoyltransferase I (CPT-I) that activates peroxisome proliferator-activated receptor alpha (PPARalpha) and induces cardiac hypertrophy through an unknown mechanism. We studied the mRNA expression of genes involved in fatty acid oxidation in the heart of mice treated for 1 or 10 days with etomoxir (100 mg/kg/day). Etomoxir administration for 1 day significantly increased (4.4-fold induction) the mRNA expression of acyl-CoA oxidase (ACO), which catalyzes the rate-limiting step in peroxisomal beta-oxidation. In contrast, etomoxir treatment for 10 days dramatically decreased ACO mRNA levels by 96%. The reduction in ACO expression in the hearts of 10-day etomoxir-treated mice was accompanied by an increase in the mRNA expression of the antioxidant enzyme glutathione peroxidase and the cardiac marker of oxidative stress bax. Moreover, the activity of the redox-regulated transcription factor NF-kappaB was increased in heart after 10 days of etomoxir treatment. Overall, the findings here presented show that etomoxir treatment may induce cardiac hypertrophy via increased cellular oxidative stress and NF-kappaB activation.

  14. An mtDNA mutation in the initiation codon of the cytochrome C oxidase subunit II gene results in lower levels of the protein and a mitochondrial encephalomyopathy.

    PubMed Central

    Clark, K M; Taylor, R W; Johnson, M A; Chinnery, P F; Chrzanowska-Lightowlers, Z M; Andrews, R M; Nelson, I P; Wood, N W; Lamont, P J; Hanna, M G; Lightowlers, R N; Turnbull, D M

    1999-01-01

    A novel heteroplasmic 7587T-->C mutation in the mitochondrial genome which changes the initiation codon of the gene encoding cytochrome c oxidase subunit II (COX II), was found in a family with mitochondrial disease. This T-->C transition is predicted to change the initiating methionine to threonine. The mutation load was present at 67% in muscle from the index case and at 91% in muscle from the patient's clinically affected son. Muscle biopsy samples revealed isolated COX deficiency and mitochondrial proliferation. Single-muscle-fiber analysis revealed that the 7587C copy was at much higher load in COX-negative fibers than in COX-positive fibers. After microphotometric enzyme analysis, the mutation was shown to cause a decrease in COX activity when the mutant load was >55%-65%. In fibroblasts from one family member, which contained >95% mutated mtDNA, there was no detectable synthesis or any steady-state level of COX II. This new mutation constitutes a new mechanism by which mtDNA mutations can cause disease-defective initiation of translation. PMID:10205264

  15. Overexpression of alternative oxidase gene confers aluminum tolerance by altering the respiratory capacity and the response to oxidative stress in tobacco cells.

    PubMed

    Panda, Sanjib Kumar; Sahoo, Lingaraj; Katsuhara, Maki; Matsumoto, Hideaki

    2013-06-01

    Aluminum (Al) stress represses mitochondrial respiration and produces reactive oxygen species (ROS) in plants. Mitochondrial alternative oxidase (AOX) uncouples respiration from mitochondrial ATP production and may improve plant performance under Al stress by preventing excess accumulation of ROS. We tested respiratory changes and ROS production in isolated mitochondria and whole cell of tobacco (SL, ALT 301) under Al stress. Higher capacities of AOX pathways relative to cytochrome pathways were observed in both isolated mitochondria and whole cells of ALT301 under Al stress. AOX1 when studied showed higher AOX1 expression in ALT 301 than SL cells under stress. In order to study the function of tobacco AOX gene under Al stress, we produced transformed tobacco cell lines by introducing NtAOX1 expressed under the control of the cauliflower mosaic virus (CaMV) 35 S promoter in sensitive (SL) Nicotiana tabacum L. cell lines. The enhancement of endogenous AOX1 expression and AOX protein with or without Al stress was in the order of transformed tobacco cell lines > ALT301 > wild type (SL). A decreased respiratory inhibition and reduced ROS production with a better growth capability were the significant features that characterized AOX1 transformed cell lines under Al stress. These results demonstrated that AOX plays a critical role in Al stress tolerance with an enhanced respiratory capacity, reducing mitochondrial oxidative stress burden and improving the growth capability in tobacco cells.

  16. Amine Oxidase Copper-containing 1 (AOC1) Is a Downstream Target Gene of the Wilms Tumor Protein, WT1, during Kidney Development*

    PubMed Central

    Kirschner, Karin M.; Braun, Julian F.W.; Jacobi, Charlotte L.; Rudigier, Lucas J.; Persson, Anja Bondke; Scholz, Holger

    2014-01-01

    Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. Despite the importance of AOC1 in regulating polyamine breakdown, very little is known about the molecular mechanisms that control its expression. We report here that the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Antisense inhibition of WT1 protein translation strongly reduced Aoc1 transcripts in cultured murine embryonic kidneys and gonads. Aoc1 mRNA levels correlated with WT1 protein in several cell lines. Double immunofluorescent staining revealed a co-expression of WT1 and AOC1 proteins in the developing genitourinary system of mice and rats. Strikingly, induced changes in polyamine homeostasis affected branching morphogenesis of cultured murine embryonic kidneys in a developmental stage-specific manner. These findings suggest that WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis. PMID:25037221

  17. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  18. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyw