McCormick, M K; Campbell, E; Deaven, L; Moyzis, R
1993-01-01
Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075
Sex Chromosome Evolution in Amniotes: Applications for Bacterial Artificial Chromosome Libraries
Janes, Daniel E.; Valenzuela, Nicole; Ezaz, Tariq; Amemiya, Chris; Edwards, Scott V.
2011-01-01
Variability among sex chromosome pairs in amniotes denotes a dynamic history. Since amniotes diverged from a common ancestor, their sex chromosome pairs and, more broadly, sex-determining mechanisms have changed reversibly and frequently. These changes have been studied and characterized through the use of many tools and experimental approaches but perhaps most effectively through applications for bacterial artificial chromosome (BAC) libraries. Individual BAC clones carry 100–200 kb of sequence from one individual of a target species that can be isolated by screening, mapped onto karyotypes, and sequenced. With these techniques, researchers have identified differences and similarities in sex chromosome content and organization across amniotes and have addressed hypotheses regarding the frequency and direction of past changes. Here, we review studies of sex chromosome evolution in amniotes and the ways in which the field of research has been affected by the advent of BAC libraries. PMID:20981143
Miller, A M; Savinelli, E A; Couture, S M; Hannigan, G M; Han, Z; Selden, R F; Treco, D A
1993-01-01
Recombination walking is based on the genetic selection of specific human clones from a yeast artificial chromosome (YAC) library by homologous recombination. The desired clone is selected from a pooled (unordered) YAC library, eliminating labor-intensive steps typically used in organizing and maintaining ordered YAC libraries. Recombination walking represents an efficient approach to library screening and is well suited for chromosome-walking approaches to the isolation of genes associated with common diseases. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8367472
Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis
Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.
2000-01-01
Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956
USDA-ARS?s Scientific Manuscript database
For map-based cloning of genes conferring important traits in the hexaploid wheat line 92R137, a bacterial artificial chromosome (BAC) library, including two sub libraries, was constructed using the genomic DNA of 92R137 digested with restriction enzymes HindIII and BamHI. The BAC library was compos...
Bacterial Artificial Chromosome Libraries of Pulse Crops: Characteristics and Applications
Yu, Kangfu
2012-01-01
Pulse crops are considered minor on a global scale despite their nutritional value for human consumption. Therefore, they are relatively less extensively studied in comparison with the major crops. The need to improve pulse crop production and quality will increase with the increasing global demand for food security and people's awareness of nutritious food. The improvement of pulse crops will require fully utilizing all their genetic resources. Bacterial artificial chromosome (BAC) libraries of pulse crops are essential genomic resources that have the potential to accelerate gene discovery and enhance molecular breeding in these crops. Here, we review the availability, characteristics, applications, and potential applications of the BAC libraries of pulse crops. PMID:21811383
2010-01-01
Background The presence of closely related genomes in polyploid species makes the assembly of total genomic sequence from shotgun sequence reads produced by the current sequencing platforms exceedingly difficult, if not impossible. Genomes of polyploid species could be sequenced following the ordered-clone sequencing approach employing contigs of bacterial artificial chromosome (BAC) clones and BAC-based physical maps. Although BAC contigs can currently be constructed for virtually any diploid organism with the SNaPshot high-information-content-fingerprinting (HICF) technology, it is currently unknown if this is also true for polyploid species. It is possible that BAC clones from orthologous regions of homoeologous chromosomes would share numerous restriction fragments and be therefore included into common contigs. Because of this and other concerns, physical mapping utilizing the SNaPshot HICF of BAC libraries of polyploid species has not been pursued and the possibility of doing so has not been assessed. The sole exception has been in common wheat, an allohexaploid in which it is possible to construct single-chromosome or single-chromosome-arm BAC libraries from DNA of flow-sorted chromosomes and bypass the obstacles created by polyploidy. Results The potential of the SNaPshot HICF technology for physical mapping of polyploid plants utilizing global BAC libraries was evaluated by assembling contigs of fingerprinted clones in an in silico merged BAC library composed of single-chromosome libraries of two wheat homoeologous chromosome arms, 3AS and 3DS, and complete chromosome 3B. Because the chromosome arm origin of each clone was known, it was possible to estimate the fidelity of contig assembly. On average 97.78% or more clones, depending on the library, were from a single chromosome arm. A large portion of the remaining clones was shown to be library contamination from other chromosomes, a feature that is unavoidable during the construction of single-chromosome
Construction of BAC Libraries from Flow-Sorted Chromosomes.
Šafář, Jan; Šimková, Hana; Doležel, Jaroslav
2016-01-01
Cloned DNA libraries in bacterial artificial chromosome (BAC) are the most widely used form of large-insert DNA libraries. BAC libraries are typically represented by ordered clones derived from genomic DNA of a particular organism. In the case of large eukaryotic genomes, whole-genome libraries consist of a hundred thousand to a million clones, which make their handling and screening a daunting task. The labor and cost of working with whole-genome libraries can be greatly reduced by constructing a library derived from a smaller part of the genome. Here we describe construction of BAC libraries from mitotic chromosomes purified by flow cytometric sorting. Chromosome-specific BAC libraries facilitate positional gene cloning, physical mapping, and sequencing in complex plant genomes.
Airmet, K. W.; Hinckley, J. D.; Tree, L. T.; Moss, M.; Blumell, S.; Ulicny, K.; Gustafson, A. K.; Weed, M.; Theodosis, R.; Lehnardt, M.; Genho, J.; Stevens, M. R.; Kooyman, D. L.
2012-01-01
The Ilama is an important agricultural livestock in much of South America. The llama is increasing in popularity in the United States as a companion animal. Little work has been done to improve llama production using modern technology. A paucity of information is available regarding the llama genome. We report the construction of a llama bacterial artificial chromosome (BAC) library of about 196,224 clones in the vector pECBAC1. Using flow cytometry and bovine, human, mouse, and chicken as controls, we determined the llama genome size to be 2.4 × 109 bp. The average insert size of the library is 137.8 kb corresponding to approximately 9-fold genome coverage. Further studies are needed to further characterize the library and llama genome. We anticipate that this new library will help facilitate future genomic studies in the llama. PMID:22811594
A strategy for rapid production and screening of yeast artificial chromosome libraries.
Strauss, W M; Jaenisch, E; Jaenisch, R
1992-01-01
We describe methods for rapid production and screening of yeast artificial chromosome (YAC) libraries. Utilizing complete restriction digests of mouse genomic DNA for ligations in agarose, a 32,000-clone library was produced and screened in seven weeks. Screening was accomplished by subdividing primary transformation plates into pools of approximately 100 clones which were transferred into a master glycerol stock. These master stocks were used to inoculate liquid cultures to produce culture "pools," and ten pools of 100 clones were then combined to yield superpools of 1,000 clones. Both pool and superpool DNA was screened by polymerase chain reaction (PCR) and positive pools representing 100 clones were then plated on selective medium and screened by in situ hybridization. Screening by the two tiered PCR assay and by in situ hybridization was completed in 4-5 days. Utilizing this methodology we have isolated a 150 kb clone spanning the alpha 1(I) collagen (Col1a1) gene as well as 40 kb clones from the Hox-2 locus. To characterize the representation of the YAC library, the size distribution of genomic Sal I fragments was compared to that of clones picked at random from the library. The results demonstrate significant biasing of the cloned fragment distribution, resulting in a loss of representation for larger fragments.
The development and characterisation of a bacterial artificial chromosome library for Fragaria vesca
Bonet, Julio; Girona, Elena Lopez; Sargent, Daniel J; Muñoz-Torres, Monica C; Monfort, Amparo; Abbott, Albert G; Arús, Pere; Simpson, David W; Davik, Jahn
2009-01-01
Background The cultivated strawberry Fragaria ×ananassa is one of the most economically-important soft-fruit species. Few structural genomic resources have been reported for Fragaria and there exists an urgent need for the development of physical mapping resources for the genus. The first stage in the development of a physical map for Fragaria is the construction and characterisation of a high molecular weight bacterial artificial chromosome (BAC) library. Methods A BAC library, consisting of 18,432 clones was constructed from Fragaria vesca f. semperflorens accession 'Ali Baba'. BAC DNA from individual library clones was pooled to create a PCR-based screening assay for the library, whereby individual clones could be identified with just 34 PCR reactions. These pools were used to screen the BAC library and anchor individual clones to the diploid Fragaria reference map (FV×FN). Findings Clones from the BAC library developed contained an average insert size of 85 kb, representing over seven genome equivalents. The pools and superpools developed were used to identify a set of BAC clones containing 70 molecular markers previously mapped to the diploid Fragaria FV×FN reference map. The number of positive colonies identified for each marker suggests the library represents between 4× and 10× coverage of the diploid Fragaria genome, which is in accordance with the estimate of library coverage based on average insert size. Conclusion This BAC library will be used for the construction of a physical map for F. vesca and the superpools will permit physical anchoring of molecular markers using PCR. PMID:19772672
Noutoshi, Y; Arai, R; Fujie, M; Yamada, T
1997-01-01
As a model for plant-type chromosomes, we have been characterizing molecular organization of the Chlorella vulgaris C-169 chromosome I. To identify chromosome structural elements including the centromeric region and replication origins, we constructed a chromosome I specific cosmid library and aligned each cosmid clones to generate contigs. So far, more than 80% of the entire chromosome I has been covered. A complete clonal physical reconstitution of chromosome I provides information on the structure and genomic organization of plant genome. We propose our strategy to construct an artificial chromosome by assembling the functional chromosome structural elements identified on Chrorella chromosome I.
Yim, Young-Sun; Davis, Georgia L.; Duru, Ngozi A.; Musket, Theresa A.; Linton, Eric W.; Messing, Joachim W.; McMullen, Michael D.; Soderlund, Carol A.; Polacco, Mary L.; Gardiner, Jack M.; Coe, Edward H.
2002-01-01
Three maize (Zea mays) bacterial artificial chromosome (BAC) libraries were constructed from inbred line B73. High-density filter sets from all three libraries, made using different restriction enzymes (HindIII, EcoRI, and MboI, respectively), were evaluated with a set of complex probes including the185-bp knob repeat, ribosomal DNA, two telomere-associated repeat sequences, four centromere repeats, the mitochondrial genome, a multifragment chloroplast DNA probe, and bacteriophage λ. The results indicate that the libraries are of high quality with low contamination by organellar and λ-sequences. The use of libraries from multiple enzymes increased the chance of recovering each region of the genome. Ninety maize restriction fragment-length polymorphism core markers were hybridized to filters of the HindIII library, representing 6× coverage of the genome, to initiate development of a framework for anchoring BAC contigs to the intermated B73 × Mo17 genetic map and to mark the bin boundaries on the physical map. All of the clones used as hybridization probes detected at least three BACs. Twenty-two single-copy number core markers identified an average of 7.4 ± 3.3 positive clones, consistent with the expectation of six clones. This information is integrated into fingerprinting data generated by the Arizona Genomics Institute to assemble the BAC contigs using fingerprint contig and contributed to the process of physical map construction. PMID:12481051
Liu, Changqing; Bai, Chunyu; Guo, Yu; Liu, Dan; Lu, Taofeng; Li, Xiangchen; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun
2014-01-01
Bacterial artificial chromosome (BAC) libraries are extremely valuable for the genome-wide genetic dissection of complex organisms. The Siberian tiger, one of the most well-known wild primitive carnivores in China, is an endangered animal. In order to promote research on its genome, a high-redundancy BAC library of the Siberian tiger was constructed and characterized. The library is divided into two sub-libraries prepared from blood cells and two sub-libraries prepared from fibroblasts. This BAC library contains 153,600 individually archived clones; for PCR-based screening of the library, BACs were placed into 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 116.5 kb, representing approximately 6.46 genome equivalents of the haploid genome and affording a 98.86% statistical probability of obtaining at least one clone containing a unique DNA sequence. Screening the library with 19 microsatellite markers and a SRY sequence revealed that each of these markers were present in the library; the average number of positive clones per marker was 6.74 (range 2 to 12), consistent with 6.46 coverage of the tiger genome. Additionally, we identified 72 microsatellite markers that could potentially be used as genetic markers. This BAC library will serve as a valuable resource for physical mapping, comparative genomic study and large-scale genome sequencing in the tiger. PMID:24608928
Technique of laser chromosome welding for chromosome repair and artificial chromosome creation.
Huang, Yao-Xiong; Li, Lin; Yang, Liu; Zhang, Yi
2018-04-01
Here we report a technique of laser chromosome welding that uses a violet pulse laser micro-beam for welding. The technique can integrate any size of a desired chromosome fragment into recipient chromosomes by combining with other techniques of laser chromosome manipulation such as chromosome cutting, moving, and stretching. We demonstrated that our method could perform chromosomal modifications with high precision, speed and ease of use in the absence of restriction enzymes, DNA ligases and DNA polymerases. Unlike the conventional methods such as de novo artificial chromosome synthesis, our method has no limitation on the size of the inserted chromosome fragment. The inserted DNA size can be precisely defined and the processed chromosome can retain its intrinsic structure and integrity. Therefore, our technique provides a high quality alternative approach to directed genetic recombination, and can be used for chromosomal repair, removal of defects and artificial chromosome creation. The technique may also have applicability on the manipulation and extension of large pieces of synthetic DNA.
Rondon, Michelle R.; Raffel, Sandra J.; Goodman, Robert M.; Handelsman, Jo
1999-01-01
As the study of microbes moves into the era of functional genomics, there is an increasing need for molecular tools for analysis of a wide diversity of microorganisms. Currently, biological study of many prokaryotes of agricultural, medical, and fundamental scientific interest is limited by the lack of adequate genetic tools. We report the application of the bacterial artificial chromosome (BAC) vector to prokaryotic biology as a powerful approach to address this need. We constructed a BAC library in Escherichia coli from genomic DNA of the Gram-positive bacterium Bacillus cereus. This library provides 5.75-fold coverage of the B. cereus genome, with an average insert size of 98 kb. To determine the extent of heterologous expression of B. cereus genes in the library, we screened it for expression of several B. cereus activities in the E. coli host. Clones expressing 6 of 10 activities tested were identified in the library, namely, ampicillin resistance, zwittermicin A resistance, esculin hydrolysis, hemolysis, orange pigment production, and lecithinase activity. We analyzed selected BAC clones genetically to identify rapidly specific B. cereus loci. These results suggest that BAC libraries will provide a powerful approach for studying gene expression from diverse prokaryotes. PMID:10339608
2013-01-01
Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome
Luo, Meizhong; Kim, Hyeran; Kudrna, Dave; Sisneros, Nicholas B; Lee, So-Jeong; Mueller, Christopher; Collura, Kristi; Zuccolo, Andrea; Buckingham, E Bryan; Grim, Suzanne M; Yanagiya, Kazuyo; Inoko, Hidetoshi; Shiina, Takashi; Flajnik, Martin F; Wing, Rod A; Ohta, Yuko
2006-05-03
Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC) library for the nurse shark, Ginglymostoma cirratum. The BAC library consists of 313,344 clones with an average insert size of 144 kb, covering ~4.5 x 1010 bp and thus providing an 11-fold coverage of the haploid genome. BAC end sequence analyses revealed, in addition to LINEs and SINEs commonly found in other animal and plant genomes, two new groups of nurse shark-specific repetitive elements, NSRE1 and NSRE2 that seem to be major components of the nurse shark genome. Screening the library with single-copy or multi-copy gene probes showed 6-28 primary positive clones per probe of which 50-90% were true positives, demonstrating that the BAC library is representative of the different regions of the nurse shark genome. Furthermore, some BAC clones contained multiple genes, making physical mapping feasible. We have constructed a deep-coverage, high-quality, large insert, and publicly available BAC library for a cartilaginous fish. It will be very useful to the scientific community interested in shark genomic structure, comparative genomics, and functional studies. We found two new groups of repetitive elements specific to the nurse shark genome, which may contribute to the architecture and evolution of the nurse shark genome.
Liu, R; Zhang, H H; Chen, Z X; Shahid, M Q; Fu, X L; Liu, X D
2015-10-29
Oryza officinalis has proven to be a natural gene reservoir for the improvement of domesticated rice as it carries many desirable traits; however, the transfer of elite genes to cultivated rice by conventional hybridization has been a challenge for rice breeders. In this study, the conserved sequence of plant stress-related NAC transcription factors was selected as a probe to screen the O. officinalis genomic transformation-competent artificial chromosome library by Southern blot; 11 positive transformation-competent artificial chromosome clones were subsequently detected. By Agrobacterium-mediated transformation, an indica rice variety, Huajingxian 74 (HJX74), was transformed with a TAC clone harboring a NAC gene-positive genomic fragment from O. officinalis. Molecular analysis revealed that the O. officinalis genomic fragment was integrated into the genome of HJX74. The transgenic lines exhibited high tolerance to drought stress. Our results demonstrate that the introduction of stress-related transformation-competent artificial chromosome clones, coupled with a transgenic validation approach, is an effective method of transferring agronomically important genes from O. officinalis to cultivated rice.
Satellite DNA-based artificial chromosomes for use in gene therapy.
Hadlaczky, G
2001-04-01
Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.
Characterization of a microdissection library from human chromosome region 3p14
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bardenheuer, W.; Szymanski, S.; Lux, A.
1994-01-15
Structural alterations in human chromosome region 3p14-p23 resulting in the inactivation of one or more tumor suppressor genes are thought to play a pathogenic role in small cell lung cancer, renal cell carcinoma, and other human neoplasms. To identify putative tumor suppressor genes, 428 recombinant clones from a microdissection library specific for human chromosome region 3p14 were isolated and characterized. Ninety-six of these (22.5%) were human single-copy DNA sequences, 57 of which were unique sequence clones. Forty-four of these were mapped to the microdissected region using a cell hybrid mapping panel. Within this mapping panel, four probes detected two newmore » chromosome breakpoints that were previously indistinguishable from the translocation breakpoint t(3;8) in 3p14.2 in hereditary renal cell carcinoma. One probe maps to the homozygously deleted region of the small cell lung cancer cell line U2020. In addition, microdissection clones have been shown to be suitable for isolation of yeast artificial chromosomes. 52 refs., 3 figs., 2 tabs.« less
[Cosmid libraries containing DNA from human chromosome 13].
Kapanadze, B I; Brodianskiĭ, V M; Baranova, A V; Sevat'ianov, S Iu; Fedorova, N D; Kurskov, M M; Kostina, M A; Mironov, A A; Sineokiĭ, S P; Zakhar'ev, V M; Grafodatskiĭ, A S; Modianov, N N; Iankovskiĭ, N K
1996-03-01
We characterized two cosmid libraries constructed from flow-sorted chromosome 13 at the Imperial Cancer Research Fund (ICRF), UK (13,000 clones) and Los Alamos National Laboratory (LANL), USA (17,000 clones). After storage for two years, clones showed high viability (95%) and structural stability. EcoR I and Hind III restriction patterns were studied in more than 500 ICRF and 200 LANL cosmids. The average size of inserts was shown to be 35-37 kb in both the libraries. Most cosmids (83% and 93% of ICRF and LANL libraries, respectively) exceed the lower size limit of DNA fragments that can be packaged and represent a good source for physical mapping of chromosome 13. Total length of inserts is four and five genome equivalents in the ICRF and LANL libraries, respectively. ICRF cosmids showed hybridization to 22 of 24 unique probes tested, which corresponds to a 90% probability of having any DNA fragment represented in the library. More than 1 Mb of chromosome 13 is overlapped by 90 cosmids of 22 groups revealed. A chromosomal region of more than 150 kb, containing the ATP1AL1 gene for alpha-1 peptide of Na+, K(+)-ATPase, is covered by 12 cosmids forming a contig. The results of restriction and hybridization analyses are stored in a CLONE database. These data and all the cosmids described are publicly available.
Construction of human chromosome 21-specific yeast artificial chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCormick, M.K.; Shero, J.H.; Hieter, P.A.
1989-12-01
Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less
[Research progress in human artificial chromosomes(HACs) and the potentials in application].
Zuo, Guo-Wei; Lü, Feng-Lin
2005-11-01
Since the first report of the establishment of human artificial chromosome(HAC) was published in 1997, several types of HAC have been created by different strategies. Compared to other artificial chromosomes, such as yeast artificial chromosome (YAC) and bacterial artificial chromosome(BAC), HAC exists in a cell independently, in other words, HAC does not integrated into the cellular genome, and can undergo normal mitosis and meiosis from generation to generation in vitro and in vivo. Recent results proved that HAC, as a DNA carrier, is able to host a large fragment of DNA or mini-chromosome, thus it could be a very important tool in the study of human gene expression and regulation, human chromosome function and minimum functional elements and animal models for human diseases. In the near future, HAC can also be used in gene therapy for human genetic diseases.
Isolation of mini- and microsatellite loci from chromosome 19 library
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.
Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less
De novo formed satellite DNA-based mammalian artificial chromosomes and their possible applications.
Katona, Robert L
2015-02-01
Mammalian artificial chromosomes (MACs) are non-integrating, autonomously replicating natural chromosome-based vectors that may carry a vast amount of genetic material, which in turn enable potentially prolonged, safe, and regulated therapeutic transgene expression and render MACs as attractive genetic vectors for "gene replacement" or for controlling differentiation pathways in target cells. Satellite-DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian and plant species. These artificially generated accessory chromosomes are composed of predictable DNA sequences, and they contain defined genetic information. SATACs have already passed a number of obstacles crucial to their further development as gene therapy vectors, including large-scale purification, transfer of purified artificial chromosomes into different cells and embryos, generation of transgenic animals and germline transmission with purified SATACs, and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals. SATACs could be used in cell therapy protocols. For these methods, the most versatile target cell would be one that was pluripotent and self-renewing to address multiple disease target cell types, thus making multilineage stem cells, such as adult derived early progenitor cells and embryonic stem cells, as attractive universal host cells.
Oesterle, Sabine; Gerngross, Daniel; Schmitt, Steven; Roberts, Tania Michelle; Panke, Sven
2017-09-26
Multiplexed gene expression optimization via modulation of gene translation efficiency through ribosome binding site (RBS) engineering is a valuable approach for optimizing artificial properties in bacteria, ranging from genetic circuits to production pathways. Established algorithms design smart RBS-libraries based on a single partially-degenerate sequence that efficiently samples the entire space of translation initiation rates. However, the sequence space that is accessible when integrating the library by CRISPR/Cas9-based genome editing is severely restricted by DNA mismatch repair (MMR) systems. MMR efficiency depends on the type and length of the mismatch and thus effectively removes potential library members from the pool. Rather than working in MMR-deficient strains, which accumulate off-target mutations, or depending on temporary MMR inactivation, which requires additional steps, we eliminate this limitation by developing a pre-selection rule of genome-library-optimized-sequences (GLOS) that enables introducing large functional diversity into MMR-proficient strains with sequences that are no longer subject to MMR-processing. We implement several GLOS-libraries in Escherichia coli and show that GLOS-libraries indeed retain diversity during genome editing and that such libraries can be used in complex genome editing operations such as concomitant deletions. We argue that this approach allows for stable and efficient fine tuning of chromosomal functions with minimal effort.
Rudd, M. Katharine; Mays, Robert W.; Schwartz, Stuart; Willard, Huntington F.
2003-01-01
Human artificial chromosomes have been used to model requirements for human chromosome segregation and to explore the nature of sequences competent for centromere function. Normal human centromeres require specialized chromatin that consists of alpha satellite DNA complexed with epigenetically modified histones and centromere-specific proteins. While several types of alpha satellite DNA have been used to assemble de novo centromeres in artificial chromosome assays, the extent to which they fully recapitulate normal centromere function has not been explored. Here, we have used two kinds of alpha satellite DNA, DXZ1 (from the X chromosome) and D17Z1 (from chromosome 17), to generate human artificial chromosomes. Although artificial chromosomes are mitotically stable over many months in culture, when we examined their segregation in individual cell divisions using an anaphase assay, artificial chromosomes exhibited more segregation errors than natural human chromosomes (P < 0.001). Naturally occurring, but abnormal small ring chromosomes derived from chromosome 17 and the X chromosome also missegregate more than normal chromosomes, implicating overall chromosome size and/or structure in the fidelity of chromosome segregation. As different artificial chromosomes missegregate over a fivefold range, the data suggest that variable centromeric DNA content and/or epigenetic assembly can influence the mitotic behavior of artificial chromosomes. PMID:14560014
Rudd, M Katharine; Mays, Robert W; Schwartz, Stuart; Willard, Huntington F
2003-11-01
Human artificial chromosomes have been used to model requirements for human chromosome segregation and to explore the nature of sequences competent for centromere function. Normal human centromeres require specialized chromatin that consists of alpha satellite DNA complexed with epigenetically modified histones and centromere-specific proteins. While several types of alpha satellite DNA have been used to assemble de novo centromeres in artificial chromosome assays, the extent to which they fully recapitulate normal centromere function has not been explored. Here, we have used two kinds of alpha satellite DNA, DXZ1 (from the X chromosome) and D17Z1 (from chromosome 17), to generate human artificial chromosomes. Although artificial chromosomes are mitotically stable over many months in culture, when we examined their segregation in individual cell divisions using an anaphase assay, artificial chromosomes exhibited more segregation errors than natural human chromosomes (P < 0.001). Naturally occurring, but abnormal small ring chromosomes derived from chromosome 17 and the X chromosome also missegregate more than normal chromosomes, implicating overall chromosome size and/or structure in the fidelity of chromosome segregation. As different artificial chromosomes missegregate over a fivefold range, the data suggest that variable centromeric DNA content and/or epigenetic assembly can influence the mitotic behavior of artificial chromosomes.
Anhidrotic ectodermal dysplasia gene region cloned in yeast artificial chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kere, J.; Grzeschik, K.H.; Limon, J.
1993-05-01
Anhidrotic ectodermal dysplasia (EDA), an X-chromosomal recessive disorder, is expressed in a few females with chromosomal translocations involving bands Xq12-q13. Using available DNA markers from the region and somatic cell hybrids the authors mapped the X-chromosomal breakpoints in two such translocations. The breakpoints were further mapped within a yeast artificial chromosome contig constructed by chromosome walking techniques. Genomic DNA markers that map between the two translocation breakpoints were recovered representing putative portions of the EDA gene. 32 refs., 3 figs., 1 tab.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blennow, E.; Werelius, B.; Nordenskjoeld, M.
Constitutional extra {open_quotes}marker chromosomes{close_quotes} are found in {approx}0.5/1000 of newborns. Of these, 50% are inverted duplications of the pericentromeric region of chromosome 15, including two variants; (1) inv dup(15)(pter{yields}q11:q11{yields}pter) and (2) inv dup(15) (pter{yields}q12-13::q12-13{yields}pter). Variant (1) is found in phenotypically normal individuals, whereas variant (2) will produce a typical clinical picture including mental retardation, autism, hyperactivity and discrete dysmorphic features. Fluorescence in situ hybridization (FISH) using single copy probes from the Prader-Willi region confirms these observations as well as chromosome painting using a flow-sorted marker chromosome-specific library from a variant (1) marker, hybridized to the chromosomes of a patient withmore » a variant (2) marker chromosome. Followingly, a flow-sorted biotinylated variant (1) library was subtracted from a non-labeled variant (2) library using magnetic beads and subsequent amplification by degenerate oligonucleotide-primed PCR (DOP-PCR). The successful result was demonstrated by using the amplified material for chromosome painting on chromosome slides from variant (1) and variant (2) patients. We have constructed a library from 15q11-13. This region contains genes producing a specific abnormal phenotype when found in a tri- or tetrasomic state. The region also contains the genes responsible for the Prader-Willi and Angelman syndromes when the paternal/maternal copy is missing, respectively. It is therefore a region where parental imprinting plays an important role. The isolated library may be used to isolate single copy clones which will allow further investigations of this region.« less
Artificial Neural Network for the Prediction of Chromosomal Abnormalities in Azoospermic Males.
Akinsal, Emre Can; Haznedar, Bulent; Baydilli, Numan; Kalinli, Adem; Ozturk, Ahmet; Ekmekçioğlu, Oğuz
2018-02-04
To evaluate whether an artifical neural network helps to diagnose any chromosomal abnormalities in azoospermic males. The data of azoospermic males attending to a tertiary academic referral center were evaluated retrospectively. Height, total testicular volume, follicle stimulating hormone, luteinising hormone, total testosterone and ejaculate volume of the patients were used for the analyses. In artificial neural network, the data of 310 azoospermics were used as the education and 115 as the test set. Logistic regression analyses and discriminant analyses were performed for statistical analyses. The tests were re-analysed with a neural network. Both logistic regression analyses and artificial neural network predicted the presence or absence of chromosomal abnormalities with more than 95% accuracy. The use of artificial neural network model has yielded satisfactory results in terms of distinguishing patients whether they have any chromosomal abnormality or not.
Xu, Min; Wang, Yemin; Zhao, Zhilong; Gao, Guixi; Huang, Sheng-Xiong; Kang, Qianjin; He, Xinyi; Lin, Shuangjun; Pang, Xiuhua; Deng, Zixin
2016-01-01
ABSTRACT Genome sequencing projects in the last decade revealed numerous cryptic biosynthetic pathways for unknown secondary metabolites in microbes, revitalizing drug discovery from microbial metabolites by approaches called genome mining. In this work, we developed a heterologous expression and functional screening approach for genome mining from genomic bacterial artificial chromosome (BAC) libraries in Streptomyces spp. We demonstrate mining from a strain of Streptomyces rochei, which is known to produce streptothricins and borrelidin, by expressing its BAC library in the surrogate host Streptomyces lividans SBT5, and screening for antimicrobial activity. In addition to the successful capture of the streptothricin and borrelidin biosynthetic gene clusters, we discovered two novel linear lipopeptides and their corresponding biosynthetic gene cluster, as well as a novel cryptic gene cluster for an unknown antibiotic from S. rochei. This high-throughput functional genome mining approach can be easily applied to other streptomycetes, and it is very suitable for the large-scale screening of genomic BAC libraries for bioactive natural products and the corresponding biosynthetic pathways. IMPORTANCE Microbial genomes encode numerous cryptic biosynthetic gene clusters for unknown small metabolites with potential biological activities. Several genome mining approaches have been developed to activate and bring these cryptic metabolites to biological tests for future drug discovery. Previous sequence-guided procedures relied on bioinformatic analysis to predict potentially interesting biosynthetic gene clusters. In this study, we describe an efficient approach based on heterologous expression and functional screening of a whole-genome library for the mining of bioactive metabolites from Streptomyces. The usefulness of this function-driven approach was demonstrated by the capture of four large biosynthetic gene clusters for metabolites of various chemical types, including
Refined human artificial chromosome vectors for gene therapy and animal transgenesis
Kazuki, Y; Hoshiya, H; Takiguchi, M; Abe, S; Iida, Y; Osaki, M; Katoh, M; Hiratsuka, M; Shirayoshi, Y; Hiramatsu, K; Ueno, E; Kajitani, N; Yoshino, T; Kazuki, K; Ishihara, C; Takehara, S; Tsuji, S; Ejima, F; Toyoda, A; Sakaki, Y; Larionov, V; Kouprina, N; Oshimura, M
2011-01-01
Human artificial chromosomes (HACs) have several advantages as gene therapy vectors, including stable episomal maintenance, and the ability to carry large gene inserts. We previously developed HAC vectors from the normal human chromosomes using a chromosome engineering technique. However, endogenous genes were remained in these HACs, limiting their therapeutic applications. In this study, we refined a HAC vector without endogenous genes from human chromosome 21 in homologous recombination-proficient chicken DT40 cells. The HAC was physically characterized using a transformation-associated recombination (TAR) cloning strategy followed by sequencing of TAR-bacterial artificial chromosome clones. No endogenous genes were remained in the HAC. We demonstrated that any desired gene can be cloned into the HAC using the Cre-loxP system in Chinese hamster ovary cells, or a homologous recombination system in DT40 cells. The HAC can be efficiently transferred to other type of cells including mouse ES cells via microcell-mediated chromosome transfer. The transferred HAC was stably maintained in vitro and in vivo. Furthermore, tumor cells containing a HAC carrying the suicide gene, herpes simplex virus thymidine kinase (HSV-TK), were selectively killed by ganciclovir in vitro and in vivo. Thus, this novel HAC vector may be useful not only for gene and cell therapy, but also for animal transgenesis. PMID:21085194
Novel method to load multiple genes onto a mammalian artificial chromosome.
Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L
2014-01-01
Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.
Construction of trypanosome artificial mini-chromosomes.
Lee, M G; E, Y; Axelrod, N
1995-01-01
We report the preparation of two linear constructs which, when transformed into the procyclic form of Trypanosoma brucei, become stably inherited artificial mini-chromosomes. Both of the two constructs, one of 10 kb and the other of 13 kb, contain a T.brucei PARP promoter driving a chloramphenicol acetyltransferase (CAT) gene. In the 10 kb construct the CAT gene is followed by one hygromycin phosphotransferase (Hph) gene, and in the 13 kb construct the CAT gene is followed by three tandemly linked Hph genes. At each end of these linear molecules are telomere repeats and subtelomeric sequences. Electroporation of these linear DNA constructs into the procyclic form of T.brucei generated hygromycin-B resistant cell lines. In these cell lines, the input DNA remained linear and bounded by the telomere ends, but it increased in size. In the cell lines generated by the 10 kb construct, the input DNA increased in size to 20-50 kb. In the cell lines generated by the 13 kb constructs, two sizes of linear DNAs containing the input plasmid were detected: one of 40-50 kb and the other of 150 kb. The increase in size was not the result of in vivo tandem repetitions of the input plasmid, but represented the addition of new sequences. These Hph containing linear DNA molecules were maintained stably in cell lines for at least 20 generations in the absence of drug selection and were subsequently referred to as trypanosome artificial mini-chromosomes, or TACs. Images PMID:8532534
Huang, D; Wu, W; Zhou, Y; Hu, Z; Lu, L
2004-05-01
Construction of single chromosomal DNA libraries by means of chromosome microdissection and microcloning will be useful for genomic research, especially for those species that have not been extensively studied genetically. Application of the technology of microdissection and microcloning to woody fruit plants has not been reported hitherto, largely due to the generally small sizes of metaphase chromosomes and the difficulty of chromosome preparation. The present study was performed to establish a method for single chromosome microdissection and microcloning in woody fruit species using pomelo as a model. The standard karyotype of a pomelo cultivar ( Citrus grandis cv. Guanxi) was established based on 20 prometaphase photomicrographs. According to the standard karyotype, chromosome 1 was identified and isolated with fine glass microneedles controlled by a micromanipulator. DNA fragments ranging from 0.3 kb to 2 kb were acquired from the isolated single chromosome 1 via two rounds of PCR mediated by Sau3A linker adaptors and then cloned into T-easy vectors to generate a DNA library of chromosome 1. Approximately 30,000 recombinant clones were obtained. Evaluation based on 108 randomly selected clones showed that the sizes of the cloned inserts varied from 0.5 kb to 1.5 kb with an average of 860 bp. Our research suggests that microdissection and microcloning of single small chromosomes in woody plants is feasible.
Artificial Intelligence and School Library Media Centers.
ERIC Educational Resources Information Center
Young, Robert J.
1990-01-01
Discusses developments in artificial intelligence in terms of their impact on school library media centers and the role of media specialists. Possible uses of expert systems, hypertext, and CD-ROM technologies in school media centers are examined and the challenges presented by these technologies are discussed. Fourteen sources of additional…
Construction of a general human chromosome jumping library, with application to cystic fibrosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, F.S.; Drumm, M.L.; Cole, J.L.
1987-02-27
In many genetic disorders, the responsible gene and its protein product are unknown. The technique known as reverse genetics, in which chromosomal map positions and genetically linked DNA markers are used to identify and clone such genes, is complicated by the fact that the molecular distances from the closest DNA markers to the gene itself are often too large to traverse by standard cloning techniques. To address this situation, a general human chromosome jumping library was constructed that allows the cloning of DNA sequences approximately 100 kilobases away from any starting point in genomic DNA. As an illustration of itsmore » usefulness, this library was searched for a jumping clone, starting at the met oncogene, which is a marker tightly linked to the cystic fibrosis gene that is located on human chromosome 7. Mapping of the new genomic fragment by pulsed field gel electrophoresis confirmed that it resides on chromosome 7 within 240 kilobases downstream of the met gene. The use of chromosome jumping should be applicable to any genetic locus for which a closely linked DNA marker is available.« less
Six rice chromosome segment substitution lines libraries with O. rufipogon introgressions
USDA-ARS?s Scientific Manuscript database
Chromosome segment substitution lines (CSSLs) are a powerful tool for identifying naturally occurring, favorable alleles in unadapted germplasm. Six CSSL libraries in rice (Oryza sativa) were developed from crosses between three different accessions ('Khao Pa', W1944, IRGC105567) of the rice progeni...
Highly stable maintenance of a mouse artificial chromosome in human cells and mice.
Kazuki, Kanako; Takehara, Shoko; Uno, Narumi; Imaoka, Natsuko; Abe, Satoshi; Takiguchi, Masato; Hiramatsu, Kei; Oshimura, Mitsuo; Kazuki, Yasuhiro
2013-12-06
Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements. Previously, we showed that a MAC vector developed from a natural mouse chromosome by chromosome engineering was more stably maintained in adult tissues and hematopoietic cells in mice than HAC vectors. In this study, to expand the utility for a gene delivery vector in human cells and mice, we investigated the long-term stability of the MACs in cultured human cells and transchromosomic mice. We also investigated the chromosomal copy number-dependent expression of genes on the MACs in mice. The MAC was stably maintained in human HT1080 cells in vitro during long-term culture. The MAC was stably maintained at least to the F8 and F4 generations in ICR and C57BL/6 backgrounds, respectively. The MAC was also stably maintained in hematopoietic cells and tissues derived from old mice. Transchromosomic mice containing two or four copies of the MAC were generated by breeding. The DNA contents were comparable to the copy number of the MACs in each tissue examined, and the expression of the EGFP gene on the MAC was dependent on the chromosomal copy number. Therefore, the MAC vector may be useful not only for gene delivery in mammalian cells but also for animal transgenesis. Copyright © 2013 Elsevier Inc. All rights reserved.
2001-10-25
neural network (ANN) has been adopted for the human chromosome classification. It is important to select optimum features for training neural network...Many studies for computer-based chromosome analysis have shown that it is possible to classify chromosomes into 24 subgroups. In addition, artificial
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leana-Cox, J.; Wulfsberg, E.; Raffel, L.J.
Fluorescence in situ hybridization (FISH) with chromosome-specific DNA libraries was performed on samples from eight patients with de novo chromosomal duplications. In five cases, the clinical phenotype and/or cytogenetic evaluations suggested a likely origin of the duplicated material. In the remaining three cases, careful examination of the GTG-banding pattern indicated multiple possible origins; hybridization with more than one chromosome-specific library was performed on two of these cases. In all cases, FISH conclusively identified the chromosomal origin of the duplicated material. In addition, the hybridization pattern was useful in quantitatively delineating the duplication in two cases. 21 refs., 2 figs., 1more » tab.« less
Preparation of BAC libraries from marine microbial populations.
Sabehi, Gazalah; Béjà, Oded
2013-01-01
A protocol is presented here for the construction of BAC (bacterial artificial chromosome) libraries from planktonic microbial communities collected in marine environments. The protocol describes the collection and preparation of the planktonic microbial cells, high molecular weight DNA purification from those cells, the preparation of the BAC vector, and the special ligation and electrotransformation procedures required for successful library preparation. With small modifications, this protocol can be applied to microbes collected from other environments. © 2013 Elsevier Inc. All rights reserved.
Survey of Artificial Intelligence and Expert Systems in Library and Information Science Literature.
ERIC Educational Resources Information Center
Hsieh, Cynthia C.; Hall, Wendy
1989-01-01
Examines the definition and history of artificial intelligence (AI) and investigates the body of literature on AI found in "Library Literature" and "Library and Information Science Abstracts." The results reported include the number of articles by year and per journal, and the percentage of articles dealing with library…
Moralli, Daniela; Monaco, Zoia L
2015-02-01
De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.
X Chromosome Evolution in Cetartiodactyla
Proskuryakova, Anastasia A.; Kulemzina, Anastasia I.; Makunin, Alexey I.; Kukekova, Anna V.; Lynn Johnson, Jennifer; Lemskaya, Natalya A.; Beklemisheva, Violetta R.; Roelke-Parker, Melody E.; Bellizzi, June; Ryder, Oliver A.; O’Brien, Stephen J.; Graphodatsky, Alexander S.
2017-01-01
The phenomenon of a remarkable conservation of the X chromosome in eutherian mammals has been first described by Susumu Ohno in 1964. A notable exception is the cetartiodactyl X chromosome, which varies widely in morphology and G-banding pattern between species. It is hypothesized that this sex chromosome has undergone multiple rearrangements that changed the centromere position and the order of syntenic segments over the last 80 million years of Cetartiodactyla speciation. To investigate its evolution we have selected 26 evolutionarily conserved bacterial artificial chromosome (BAC) clones from the cattle CHORI-240 library evenly distributed along the cattle X chromosome. High-resolution BAC maps of the X chromosome on a representative range of cetartiodactyl species from different branches: pig (Suidae), alpaca (Camelidae), gray whale (Cetacea), hippopotamus (Hippopotamidae), Java mouse-deer (Tragulidae), pronghorn (Antilocapridae), Siberian musk deer (Moschidae), and giraffe (Giraffidae) were obtained by fluorescent in situ hybridization. To trace the X chromosome evolution during fast radiation in specious families, we performed mapping in several cervids (moose, Siberian roe deer, fallow deer, and Pere David’s deer) and bovid (muskox, goat, sheep, sable antelope, and cattle) species. We have identified three major conserved synteny blocks and rearrangements in different cetartiodactyl lineages and found that the recently described phenomenon of the evolutionary new centromere emergence has taken place in the X chromosome evolution of Cetartiodactyla at least five times. We propose the structure of the putative ancestral cetartiodactyl X chromosome by reconstructing the order of syntenic segments and centromere position for key groups. PMID:28858207
USDA-ARS?s Scientific Manuscript database
Transgressive variation was reported as an increase in grain yield for several rice (Oryza sativa x O. rufipogon) advanced backcross mapping populations. The objective of this study was to develop chromosome segment substitution line (CSSL) libraries to further dissect the reported transgressive var...
Active role of a human genomic insert in replication of a yeast artificial chromosome.
van Brabant, A J; Fangman, W L; Brewer, B J
1999-06-01
Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christian, A T; Coleman, M A; Tucker, J D
2001-02-08
Gene Recovery Microdissection (GRM) is a unique and cost-effective process for producing chromosome region-specific libraries of expressed genes. It accelerates the pace, reduces the cost, and extends the capabilities of functional genomic research, the means by which scientists will put to life-saving, life-enhancing use their knowledge of any plant or animal genome.
Hasterok, Robert; Marasek, Agnieszka; Donnison, Iain S.; Armstead, Ian; Thomas, Ann; King, Ian P.; Wolny, Elzbieta; Idziak, Dominika; Draper, John; Jenkins, Glyn
2006-01-01
As part of an initiative to develop Brachypodium distachyon as a genomic “bridge” species between rice and the temperate cereals and grasses, a BAC library has been constructed for the two diploid (2n = 2x = 10) genotypes, ABR1 and ABR5. The library consists of 9100 clones, with an approximate average insert size of 88 kb, representing 2.22 genome equivalents. To validate the usefulness of this species for comparative genomics and gene discovery in its larger genome relatives, the library was screened by PCR using primers designed on previously mapped rice and Poaceae sequences. Screening indicated a degree of synteny between these species and B. distachyon, which was confirmed by fluorescent in situ hybridization of the marker-selected BACs (BAC landing) to the 10 chromosome arms of the karyotype, with most of the BACs hybridizing as single loci on known chromosomes. Contiguous BACs colocalized on individual chromosomes, thereby confirming the conservation of genome synteny and proving that B. distachyon has utility as a temperate grass model species alternative to rice. PMID:16489232
Hasterok, Robert; Marasek, Agnieszka; Donnison, Iain S; Armstead, Ian; Thomas, Ann; King, Ian P; Wolny, Elzbieta; Idziak, Dominika; Draper, John; Jenkins, Glyn
2006-05-01
As part of an initiative to develop Brachypodium distachyon as a genomic "bridge" species between rice and the temperate cereals and grasses, a BAC library has been constructed for the two diploid (2n = 2x = 10) genotypes, ABR1 and ABR5. The library consists of 9100 clones, with an approximate average insert size of 88 kb, representing 2.22 genome equivalents. To validate the usefulness of this species for comparative genomics and gene discovery in its larger genome relatives, the library was screened by PCR using primers designed on previously mapped rice and Poaceae sequences. Screening indicated a degree of synteny between these species and B. distachyon, which was confirmed by fluorescent in situ hybridization of the marker-selected BACs (BAC landing) to the 10 chromosome arms of the karyotype, with most of the BACs hybridizing as single loci on known chromosomes. Contiguous BACs colocalized on individual chromosomes, thereby confirming the conservation of genome synteny and proving that B. distachyon has utility as a temperate grass model species alternative to rice.
USDA-ARS?s Scientific Manuscript database
Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek’s disease virus (MDV) is a highly oncogenic herpe...
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates
Reprogramming cell fate with a genome-scale library of artificial transcription factors.
Eguchi, Asuka; Wleklinski, Matthew J; Spurgat, Mackenzie C; Heiderscheit, Evan A; Kropornicka, Anna S; Vu, Catherine K; Bhimsaria, Devesh; Swanson, Scott A; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J; Slukvin, Igor; Thomson, James A; Dutton, James R; Ansari, Aseem Z
2016-12-20
Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices.
Reprogramming cell fate with a genome-scale library of artificial transcription factors
Eguchi, Asuka; Wleklinski, Matthew J.; Spurgat, Mackenzie C.; Heiderscheit, Evan A.; Kropornicka, Anna S.; Vu, Catherine K.; Bhimsaria, Devesh; Swanson, Scott A.; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J.; Slukvin, Igor; Thomson, James A.; Dutton, James R.; Ansari, Aseem Z.
2016-01-01
Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices. PMID:27930301
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, V.; Bonnycastle, L.; Poorkai, P.
1994-09-01
We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contigmore » by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.« less
An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint.
van Brabant, A J; Buchanan, C D; Charboneau, E; Fangman, W L; Brewer, B J
2001-04-01
Checkpoint controls coordinate entry into mitosis with the completion of DNA replication. Depletion of nucleotide precursors by treatment with the drug hydroxyurea triggers such a checkpoint response. However, it is not clear whether the signal for this hydroxyurea-induced checkpoint pathway is the presence of unreplicated DNA, or rather the persistence of single-stranded or damaged DNA. In a yeast artificial chromosome (YAC) we have engineered an approximately 170 kb region lacking efficient replication origins that allows us to explore the specific effects of unreplicated DNA on cell cycle progression. Replication of this YAC extends the length of S phase and causes cells to engage an S/M checkpoint. In the absence of Rad9 the YAC becomes unstable, undergoing deletions within the origin-free region.
Borst, Eva Maria; Benkartek, Corinna; Messerle, Martin
2007-05-01
Cloning of cytomegalovirus (CMV) genomes as bacterial artificial chromosomes (BAC) in E. coli and their manipulation using the techniques of bacterial genetics has greatly facilitated the construction of CMV mutants. This unit describes easily applicable procedures that allow rapid introduction of any kind of targeted mutation into BAC-cloned CMV genomes. Protocols for the reconstitution of virus from isolated BAC DNA, preparation of a virus stock, and isolation and characterization of viral DNA are also included. Special emphasis is laid on description of critical steps and thorough characterization of the altered BACs.
Chromosome specific repetitive DNA sequences
Moyzis, Robert K.; Meyne, Julianne
1991-01-01
A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).
Amplification of chromosomal DNA in situ
Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.
2002-01-01
Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.
USDA-ARS?s Scientific Manuscript database
Commercialization of fuel ethanol production from lignocellulosic biomass has focused on engineering the glucose-fermenting industrial yeast Saccharomyces cerevisiae to utilize pentose sugars. A yeast artificial chromosome (YAC) was engineered to contain a polyprotein gene construct expressing xylos...
The Chromosome Microdissection and Microcloning Technique.
Zhang, Ying-Xin; Deng, Chuan-Liang; Hu, Zan-Min
2016-01-01
Chromosome microdissection followed by microcloning is an efficient tool combining cytogenetics and molecular genetics that can be used for the construction of the high density molecular marker linkage map and fine physical map, the generation of probes for chromosome painting, and the localization and cloning of important genes. Here, we describe a modified technique to microdissect a single chromosome, paint individual chromosomes, and construct single-chromosome DNA libraries.
Construction of human artificial chromosome vectors by recombineering.
Kotzamanis, George; Cheung, Wing; Abdulrazzak, Hassan; Perez-Luz, Sara; Howe, Steven; Cooke, Howard; Huxley, Clare
2005-05-23
Human artificial chromosomes (HACs) can be formed de novo by transfection of large fragments of cloned alphoid DNA into human HT1080 cells in tissue culture. In order to generate HACs carrying a gene of interest, one can either co-transfect the alphoid DNA and the gene of interest, or one can clone both into a single vector prior to transfection. Here we describe linking approximately 70 kb of alphoid DNA onto a 156-kb BAC carrying the human HPRT gene using Red homologous recombination in the EL350 Escherichia coli host [Lee et al., Genomics 73 (2001) 56-65]. A selectable marker and EGFP marker were then added by loxP/Cre recombination using the arabinose inducible cre gene in the EL350 bacteria. The final construct generates minichromosomes in HT1080 cells and the HPRT gene is expressed. The retrofitting vector can be used to add the approximately 70 kb of alphoid DNA to any BAC carrying a gene of interest to generate a HAC vector. The method can also be used to link any unrelated BAC or PAC insert onto another BAC clone. The EL350 bacteria are an excellent host for building up complex vectors by a combination of homologous and loxP/Cre recombination.
Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan
2011-01-01
As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.
Kehrer-Sawatzki, Hildegard; Schreiner, Bettina; Tänzer, Simone; Platzer, Matthias; Müller, Stefan; Hameister, Horst
2002-01-01
A comparison of the human genome with that of the chimpanzee is an attractive approach to attempts to understand the specificity of a certain phenotype's development. The two karyotypes differ by one chromosome fusion, nine pericentric inversions, and various additions of heterochromatin to chromosomal telomeres. Only the fusion, which gave rise to human chromosome 2, has been characterized at the sequence level. During the present study, we investigated the pericentric inversion by which chimpanzee chromosome 19 differs from human chromosome 17. Fluorescence in situ hybridization was used to identify breakpoint-spanning bacterial artificial chromosomes (BACs) and plasmid artificial chromosomes (PACs). By sequencing the junction fragments, we localized breakpoints in intergenic regions rich in repetitive elements. Our findings suggest that repeat-mediated nonhomologous recombination has facilitated inversion formation. No addition or deletion of any sequence element was detected at the breakpoints or in the surrounding sequences. Next to the break, at a distance of 10.2–39.1 kb, the following genes were found: NGFR and NXPH3 (on human chromosome 17q21.3) and GUC2D and ALOX15B (on human chromosome 17p13). The inversion affects neither the genomic structure nor the gene-activity state with regard to replication timing of these genes. PMID:12094327
Bacterial Artificial Chromosome Clones of Viruses Comprising the Towne Cytomegalovirus Vaccine
Cui, Xiaohong; Adler, Stuart P.; Davison, Andrew J.; Smith, Larry; Habib, EL-Sayed E.; McVoy, Michael A.
2012-01-01
Bacterial artificial chromosome (BAC) clones have proven invaluable for genetic manipulation of herpesvirus genomes. BAC cloning can also be useful for capturing representative genomes that comprise a viral stock or mixture. The Towne live attenuated cytomegalovirus vaccine was developed in the 1970s by serial passage in cultured fibroblasts. Although its safety, immunogenicity, and efficacy have been evaluated in nearly a thousand human subjects, the vaccine itself has been little studied. Instead, genetic composition and in vitro growth properties have been inferred from studies of laboratory stocks that may not always accurately represent the viruses that comprise the vaccine. Here we describe the use of BAC cloning to define the genotypic and phenotypic properties of viruses from the Towne vaccine. Given the extensive safety history of the Towne vaccine, these BACs provide a logical starting point for the development of next-generation rationally engineered cytomegalovirus vaccines. PMID:22187535
Bacterial artificial chromosome clones of viruses comprising the towne cytomegalovirus vaccine.
Cui, Xiaohong; Adler, Stuart P; Davison, Andrew J; Smith, Larry; Habib, El-Sayed E; McVoy, Michael A
2012-01-01
Bacterial artificial chromosome (BAC) clones have proven invaluable for genetic manipulation of herpesvirus genomes. BAC cloning can also be useful for capturing representative genomes that comprise a viral stock or mixture. The Towne live attenuated cytomegalovirus vaccine was developed in the 1970s by serial passage in cultured fibroblasts. Although its safety, immunogenicity, and efficacy have been evaluated in nearly a thousand human subjects, the vaccine itself has been little studied. Instead, genetic composition and in vitro growth properties have been inferred from studies of laboratory stocks that may not always accurately represent the viruses that comprise the vaccine. Here we describe the use of BAC cloning to define the genotypic and phenotypic properties of viruses from the Towne vaccine. Given the extensive safety history of the Towne vaccine, these BACs provide a logical starting point for the development of next-generation rationally engineered cytomegalovirus vaccines.
Nakamura, S; Asakawa, S; Ohmido, N; Fukui, K; Shimizu, N; Kawasaki, S
1997-05-01
We constructed a rice Bacterial Artificial Chromosome (BAC) library from green leaf protoplasts of the cultivar Shimokita harboring the rice blast resistance gene Pi-ta. The average insert size of 155 kb and the library size of seven genome equivalents make it one of the most comprehensive BAC libraries available, and larger than many plant YAC libraries. The library clones were plated on seven high density membranes of microplate size, enabling efficient colony identification in colony hybridization experiments. Seven percent of clones carried chloroplast DNA. By probing with markers close to the blast resistance genes Pi-ta2(closely linked to Pi-ta) and Pi-b, respectively located in the centromeric region of chromosome 12 and near the telomeric end of chromosome 2, on average 2.2 +/- 1.3 and 8.0 +/- 2.6 BAC clones/marker were isolated. Differences in chromosomal structures may contribute to this wide variation in yield. A contig of about 800 kb, consisting of 19 clones, was constructed in the Pi-ta2 region. This region had a high frequency of repetitive sequences. To circumvent this difficulty, we devised a "two-step walking" method. The contig spanned a 300 kb region between markers located at 0 cM and 0.3 cM from Pi-ta. The ratio of physical to genetic distances (> 1,000 kb/cM) was more than three times larger than the average of rice (300 kb/cM). The low recombination rate and high frequency of repetitive sequences may also be related to the near centromeric character of this region. Fluorescent in situ hybridization (FISH) with a BAC clone from the Pi-b region yielded very clear signals on the long arm of chromosome 2, while a clone from the Pi-ta2 region showed various cross-hybridizing signals near the centromeric regions of all chromosomes.
A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.
Pedersen, Carsten; Wu, Boqian; Giese, Henriette
2002-11-01
A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.
Erliandri, Indri; Fu, Haiqing; Nakano, Megumi; Kim, Jung-Hyun; Miga, Karen H.; Liskovykh, Mikhail; Earnshaw, William C.; Masumoto, Hiroshi; Kouprina, Natalay; Aladjem, Mirit I.; Larionov, Vladimir
2014-01-01
In human chromosomes, centromeric regions comprise megabase-size arrays of 171 bp alpha-satellite DNA monomers. The large distances spanned by these arrays preclude their replication from external sites and imply that the repetitive monomers contain replication origins. However, replication within these arrays has not previously been profiled and the role of alpha-satellite DNA in initiation of DNA replication has not yet been demonstrated. Here, replication of alpha-satellite DNA in endogenous human centromeric regions and in de novo formed Human Artificial Chromosome (HAC) was analyzed. We showed that alpha-satellite monomers could function as origins of DNA replication and that replication of alphoid arrays organized into centrochromatin occurred earlier than those organized into heterochromatin. The distribution of inter-origin distances within centromeric alphoid arrays was comparable to the distribution of inter-origin distances on randomly selected non-centromeric chromosomal regions. Depletion of CENP-B, a kinetochore protein that binds directly to a 17 bp CENP-B box motif common to alpha-satellite DNA, resulted in enrichment of alpha-satellite sequences for proteins of the ORC complex, suggesting that CENP-B may have a role in regulating the replication of centromeric regions. Mapping of replication initiation sites in the HAC revealed that replication preferentially initiated in transcriptionally active regions. PMID:25228468
Solov'ev, I V; Iurov, Iu B; Vorsanova, S G; Marcais, B; Rogaev, E I; Kapanadze, B I; Brodianskiĭ, V M; Iankovskiĭ, N K; Roizes, G
1998-11-01
Fluorescent in situ hybridization (FISH) was employed in mapping the alpha-satellite DNA that was revealed in the cosmid libraries specific for human chromosomes 13, 21, and 22. In total, 131 clones were revealed. They contained various elements of centromeric alphoid DNA sequences of acrocentric chromosomes, including those located close to SINEs, LINEs, and classical satellite sequences. The heterochromatin of acrocentric chromosomes was shown to contain two different groups of alphoid sequences: (1) those immediately adjacent to the centromeric regions (alpha 13-1, alpha 21-1, and alpha 22-1 loci) and (2) those located in the short arm of acrocentric chromosomes (alpha 13-2, alpha 21-2, and alpha 22-2 loci). Alphoid DNA sequences from the alpha 13-2, alpha 21-2, and alpha 22-2 loci are apparently not involved in the formation of centromeres and are absent from mitotically stable marker chromosomes with a deleted short arm. Robertsonian translocations t(13q; 21q) and t(14q; 22q), and chromosome 21p-. The heterochromatic regions of chromosomes 13, 21, and 22 were also shown to contain relatively chromosome-specific repetitive sequences of various alphoid DNA families, whose numerous copies occur in other chromosomes. Pools of centromeric alphoid cosmids can be of use in further studies of the structural and functional properties of heterochromatic DNA and the identification of centromeric sequences. Moreover, these clones can be employed in high-resolution mapping and in sequencing the heterochromatic regions of the human genome. The detailed FISH analysis of numerous alphoid cosmid clones allowed the identification of several new, highly specific DNA probes of molecular cytogenetic studies--in particular, the interphase and metaphase analyses of chromosomes 2, 9, 11, 14, 15, 16, 18, 20, 21-13, 22-14, and X.
Process of labeling specific chromosomes using recombinant repetitive DNA
Moyzis, R.K.; Meyne, J.
1988-02-12
Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cremer, T.; Popp, S.; Emmerich, P.
1990-01-01
Chromosomal in situ suppression (CISS)-hybridization of biotinylated phage DNA-library inserts from sorted human chromosomes was used to decorate chromosomes 1 and 7 specifically from pter to qter and to detect structural aberrations of these chromosomes in irradiated human peripheral lymphocytes. In addition, probe pUC1.77 was used to mark the 1q12 subregion in normal and aberrant chromosomes 1. Low LET radiation (60Co-gamma-rays; 1.17 and 1.33 MeV) of lymphocyte cultures was performed with various doses (D = 0, 2, 4, 8 Gy) 5 h after stimulation with phytohaemagglutinin. Irradiated cells were cultivated for an additional 67 h before Colcemid arrested metaphase spreadsmore » were obtained. Aberrations of the specifically stained chromosomes, such as deletions, dicentrics, and rings, were readily scored after in situ hybridization with either the 1q12 specific probe or DNA-library inserts. By the latter approach, translocations of the specifically stained chromosomes could also be reliably assessed. A linear increase of the percentage of specifically stained aberrant chromosomes was observed when plotted as a function of the square of the dose D. A particular advantage of this new approach is provided by the possibility to delineate numerical and structural chromosome aberrations directly in interphase nuclei. These results indicate that cytogenetic monitoring of ionizing radiation may be considerably facilitated by CISS-hybridization.« less
Molecular mapping of chromosomes 17 and X
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barker, D.F.
1991-01-15
Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.« less
Rock, Cassandra; Shamlou, Parviz Ayazi; Levy, M. Susana
2003-01-01
A method is described for high-throughput monitoring of DNA backbone integrity in plasmids and artificial chromosomes in solution. The method is based on the denaturation properties of double-stranded DNA in alkaline conditions and uses PicoGreen fluorochrome to monitor denaturation. In the present method, fluorescence enhancement of PicoGreen at pH 12.4 is normalised by its value at pH 8 to give a ratio that is proportional to the average backbone integrity of the DNA molecules in the sample. A good regression fit (r2 > 0.98) was obtained when results derived from the present method and those derived from agarose gel electrophoresis were compared. Spiking experiments indicated that the method is sensitive enough to detect a proportion of 6% (v/v) molecules with an average of less than two breaks per molecule. Under manual operation, validation parameters such as inter-assay and intra-assay variation gave values of <5% coefficient of variation. Automation of the method showed equivalence to the manual procedure with high reproducibility and low variability within wells. The method described requires as little as 0.5 ng of DNA per well and a 96-well microplate can be analysed in 12 min providing an attractive option for analysis of high molecular weight vectors. A preparation of a 116 kb bacterial artificial chromosome was subjected to chemical and shear degradation and DNA integrity was tested using the method. Good correlation was obtained between time of chemical degradation and shear rate with fluorescence response. Results obtained from pulsed- field electrophoresis of sheared samples were in agreement with those obtained using the microplate-based method. PMID:12771229
Ohmido, Nobuko; Iwata, Aiko; Kato, Seiji; Wako, Toshiyuki; Fukui, Kiichi
2018-01-01
A quantitative pachytene chromosome map of rice (Oryza sativa L.) was developed using imaging methods. The map depicts not only distribution patterns of chromomeres specific to pachytene chromosomes, but also the higher order information of chromosomal structures, such as heterochromatin (condensed regions), euchromatin (decondensed regions), the primary constrictions (centromeres), and the secondary constriction (nucleolar organizing regions, NOR). These features were image analyzed and quantitatively mapped onto the map by Chromosome Image Analyzing System ver. 4.0 (CHIAS IV). Correlation between H3K9me2, an epigenetic marker and formation and/or maintenance of heterochromatin, thus was, clearly visualized. Then the pachytene chromosome map was unified with the existing somatic chromosome and linkage maps by physically mapping common DNA markers among them, such as a rice A genome specific tandem repeat sequence (TrsA), 5S and 45S ribosomal RNA genes, five bacterial artificial chromosome (BAC) clones, four P1 bacteriophage artificial chromosome (PAC) clones using multicolor fluorescence in situ hybridization (FISH). Detailed comparison between the locations of the DNA probes on the pachytene chromosomes using multicolor FISH, and the linkage map enabled determination of the chromosome number and short/long arms of individual pachytene chromosomes using the chromosome number and arm assignment designated for the linkage map. As a result, the quantitative pachytene chromosome map was unified with two other major rice chromosome maps representing somatic prometaphase chromosomes and genetic linkages. In conclusion, the unification of the three rice maps serves as an indispensable basic information, not only for an in-depth comparison between genetic and chromosomal data, but also for practical breeding programs.
Chromosomal location and gene paucity of the male specific region on papaya Y chromosome.
Yu, Qingyi; Hou, Shaobin; Hobza, Roman; Feltus, F Alex; Wang, Xiue; Jin, Weiwei; Skelton, Rachel L; Blas, Andrea; Lemke, Cornelia; Saw, Jimmy H; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Vyskot, Boris; Ming, Ray
2007-08-01
Sex chromosomes in flowering plants evolved recently and many of them remain homomorphic, including those in papaya. We investigated the chromosomal location of papaya's small male specific region of the hermaphrodite Y (Yh) chromosome (MSY) and its genomic features. We conducted chromosome fluorescence in situ hybridization mapping of Yh-specific bacterial artificial chromosomes (BACs) and placed the MSY near the centromere of the papaya Y chromosome. Then we sequenced five MSY BACs to examine the genomic features of this specialized region, which resulted in the largest collection of contiguous genomic DNA sequences of a Y chromosome in flowering plants. Extreme gene paucity was observed in the papaya MSY with no functional gene identified in 715 kb MSY sequences. A high density of retroelements and local sequence duplications were detected in the MSY that is suppressed for recombination. Location of the papaya MSY near the centromere might have provided recombination suppression and fostered paucity of genes in the male specific region of the Y chromosome. Our findings provide critical information for deciphering the sex chromosomes in papaya and reference information for comparative studies of other sex chromosomes in animals and plants.
Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening
Lane, Andrew B.; Strzelecka, Magdalena; Ettinger, Andreas; Grenfell, Andrew W.; Wittmann, Torsten; Heald, Rebecca
2015-01-01
Summary CRISPR-based technologies have emerged as powerful tools to alter genomes and mark chromosomal loci, but an inexpensive method for generating large numbers of RNA guides for whole genome screening and labeling is lacking. Using a method that permits library construction from any source of DNA, we generated guide libraries that label repetitive loci or a single chromosomal locus in Xenopus egg extracts and show that a complex library can target the E. coli genome at high frequency. PMID:26212133
Flow karyotyping and sorting of human chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gray, J.W.; Lucas, J.; Peters, D.
1986-07-16
Flow cytometry and sorting are becoming increasingly useful as tools for chromosome classfication and for the detection of numerical and structural chromosome aberrations. Chromosomes of a single type can be purified with these tools to facilitate gene mapping or production of chromosome specific recombinant DNA libraries. For analysis of chromosomes with flow cytometry, the chromosomes are extracted from mitotic cells, stained with one or more fluorescent dyes and classified one-by-one according to their dye content(s). Thus, the flow approach is fundamentally different than conventional karyotyping where chromosomes are classified within the context of a metaphase spread. Flow sorting allows purificationmore » of chromosomes that can be distinguished flow cytometrically. The authors describe the basic principles of flow cytometric chromosome classification i.e. flow karyotyping, and chromosome sorting and describe several applications. 30 refs., 8 figs.« less
Lin, Jinke; Kudrna, Dave; Wing, Rod A.
2011-01-01
We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344
Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening.
Lane, Andrew B; Strzelecka, Magdalena; Ettinger, Andreas; Grenfell, Andrew W; Wittmann, Torsten; Heald, Rebecca
2015-08-10
CRISPR-based technologies have emerged as powerful tools to alter genomes and mark chromosomal loci, but an inexpensive method for generating large numbers of RNA guides for whole genome screening and labeling is lacking. Using a method that permits library construction from any source of DNA, we generated guide libraries that label repetitive loci or a single chromosomal locus in Xenopus egg extracts and show that a complex library can target the E. coli genome at high frequency. Copyright © 2015 Elsevier Inc. All rights reserved.
Ohno, Yuko; Ogiyama, Yuki; Kubota, Yoshino; Kubo, Takuya; Ishii, Kojiro
2016-01-01
The centromeres of many eukaryotic chromosomes are established epigenetically on potentially variable tandem repeats; hence, these chromosomes are at risk of being acentric. We reported previously that artificially created acentric chromosomes in the fission yeast Schizosaccharomyces pombe can be rescued by end-to-end fusion with functional chromosomes. Here, we show that most acentric/functional chromosome fusion events in S. pombe cells harbouring an acentric chromosome I differed from the non-homologous end-joining-mediated rearrangements that result in deleterious dicentric fusions in normal cells, and were elicited by a previously unidentified homologous recombination (HR) event between chromosome end-associated sequences. The subtelomere repeats associated with the non-fusogenic ends were also destabilized in the surviving cells, suggesting a causal link between general subtelomere destabilization and acentric/functional chromosome fusion. A mutational analysis indicated that a non-canonical HR pathway was involved in the rearrangement. These findings are indicative of a latent mechanism that conditionally induces general subtelomere instability, presumably in the face of accidental centromere loss events, resulting in rescue of the fatal acentric chromosomes by interchromosomal HR. PMID:26433224
Molecular mapping of chromosomes 17 and X. Progress report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barker, D.F.
1991-01-15
Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition ofmore » new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping@ clones from a larger genome.« less
Lan, Hong; Chen, Hui; Chen, Li-Cheng; Wang, Bei-Bing; Sun, Li; Ma, Mei-Ying; Fang, Sheng-Guo; Wan, Qiu-Hong
2014-01-01
Defensins play a key role in the innate immunity of various organisms. Detailed genomic studies of the defensin cluster have only been reported in a limited number of birds. Herein, we present the first characterization of defensins in a Pelecaniformes species, the crested ibis (Nipponia nippon), which is one of the most endangered birds in the world. We constructed bacterial artificial chromosome libraries, including a 4D-PCR library and a reverse-4D library, which provide at least 40 equivalents of this rare bird's genome. A cluster including 14 β-defensin loci within 129 kb was assigned to chromosome 3 by FISH, and one gene duplication of AvBD1 was found. The ibis defensin genes are characterized by multiform gene organization ranging from two to four exons through extensive exon fusion. Splicing signal variations and alternative splice variants were also found. Comparative analysis of four bird species identified one common and multiple species-specific duplications, which might be associated with high GC content. Evolutionary analysis revealed birth-and-death mode and purifying selection for avian defensin evolution, resulting in different defensin gene numbers among bird species and functional conservation within orthologous genes, respectively. Additionally, we propose various directions for further research on genetic conservation in the crested ibis. PMID:25372018
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ying-Tai Wang; Zhao-Cai Wang; Bajalica, S.
We present the first case of direct and inverted reciprocal chromosome insertions between human chromosomes 7 and 14, ascertained because of repeated spontaneous abortions. Prometaphase GTG banding analysis showed the karyotype to be 46, XX, inv ins (7;14)(7pter {yields} 7q11.23::14q32.2 {yields} 14q22::7q21.2 {yields} 7qter), dir ins(14;7)(14pter {yields} 14q22::7q11.23 {yields} 7q21.2::14q32.2 {yields} 14qter). Origins of the insertion have been confirmed by chromosome painting with libraries specific for chromosomes 7 and 14 using fluorescence in situ hybridization. 5 refs., 3 figs.
Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo
2017-05-31
Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem
Strive, Tanja; Hardy, Christopher M; French, Nigel; Wright, John D; Nagaraja, Nitin; Reubel, Gerhard H
2006-02-13
Using bacterial artificial chromosome (BAC) technology, a canine herpesvirus (CHV)-based recombinant vaccine vector was produced for the development of an antifertility vaccine for foxes. Infectious viruses were recovered following transfection of canid cells with a BAC plasmid carrying the complete CHV genome. In vitro growth characteristics of BAC-derived viruses were similar to that of wildtype (wt)-CHV. Two recombinant antigens, fox zona pellucida protein subunit 3 (fZPC) and enhanced green fluorescent protein (EGFP) as control antigen, were inserted into thymidine kinase (TK) locus of the CHV genome and shown to be efficiently expressed in vitro. Inoculation of foxes with transgenic CHVs induced CHV specific antibodies, but was innocuous and failed to elicit transgene-specific antibody responses. Infectious virus or viral DNA was not detected in mucosal secretions or tissues of vaccinated foxes. The CHV-BAC system proved to be a quick and reliable method to manipulate the CHV genome. It will help to readily apply changes in the vector design in order to improve virus replication in vivo.
Naturally occurring minichromosome platforms in chromosome engineering: an overview.
Raimondi, Elena
2011-01-01
Artificially modified chromosome vectors are non-integrating gene delivery platforms that can shuttle very large DNA fragments in various recipient cells: theoretically, no size limit exists for the chromosome segments that an engineered minichromosome can accommodate. Therefore, genetically manipulated chromosomes might be potentially ideal vector systems, especially when the complexity of higher eukaryotic genes is concerned. This review focuses on those chromosome vectors generated using spontaneously occurring small markers as starting material. The definition and manipulation of the centromere domain is one of the main obstacles in chromosome engineering: naturally occurring minichromosomes, due to their inherent small size, were helpful in defining some aspects of centromere function. In addition, several distinctive features of small marker chromosomes, like their appearance as supernumerary elements in otherwise normal karyotypes, have been successfully exploited to use them as gene delivery vectors. The key technologies employed for minichromosome engineering are: size reduction, gene targeting, and vector delivery in various recipient cells. In spite of the significant advances that have been recently achieved in all these fields, several unsolved problems limit the potential of artificially modified chromosomes. Still, these vector systems have been exploited in a number of applications where the investigation of the controlled expression of large DNA segments is needed. A typical example is the analysis of genes whose expression strictly depends on the chromosomal environment in which they are positioned, where engineered chromosomes can be envisaged as epigenetically regulated expression systems. A novel and exciting advance concerns the use of engineered minichromosomes to study the organization and dynamics of local chromatin structures.
USDA-ARS?s Scientific Manuscript database
A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...
Wang, Chun Ming; Lo, Loong Chueng; Feng, Felicia; Gong, Ping; Li, Jian; Zhu, Ze Yuan; Lin, Grace; Yue, Gen Hua
2008-03-25
Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map. This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group. We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.
ERIC Educational Resources Information Center
Lancaster, F. W., Ed.; Smith, Linda C., Ed.
Some of the 12 conference papers presented in this proceedings focus on the present and potential capabilities of artificial intelligence and expert systems as they relate to a wide range of library applications, including descriptive cataloging, technical services, collection development, subject indexing, reference services, database searching,…
In Pursuit of Artificial Intelligence.
ERIC Educational Resources Information Center
Watstein, Sarah; Kesselman, Martin
1986-01-01
Defines artificial intelligence and reviews current research in natural language processing, expert systems, and robotics and sensory systems. Discussion covers current commercial applications of artificial intelligence and projections of uses and limitations in library technical and public services, e.g., in cataloging and online information and…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauss, W.M.; Dausman, J.; Beard, C.
Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protectionmore » analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.« less
2011-01-01
Background A robust bacterial artificial chromosome (BAC)-based physical map is essential for many aspects of genomics research, including an understanding of chromosome evolution, high-resolution genome mapping, marker-assisted breeding, positional cloning of genes, and quantitative trait analysis. To facilitate turkey genetics research and better understand avian genome evolution, a BAC-based integrated physical, genetic, and comparative map was developed for this important agricultural species. Results The turkey genome physical map was constructed based on 74,013 BAC fingerprints (11.9 × coverage) from two independent libraries, and it was integrated with the turkey genetic map and chicken genome sequence using over 41,400 BAC assignments identified by 3,499 overgo hybridization probes along with > 43,000 BAC end sequences. The physical-comparative map consists of 74 BAC contigs, with an average contig size of 13.6 Mb. All but four of the turkey chromosomes were spanned on this map by three or fewer contigs, with 14 chromosomes spanned by a single contig and nine chromosomes spanned by two contigs. This map predicts 20 to 27 major rearrangements distinguishing turkey and chicken chromosomes, despite up to 40 million years of separate evolution between the two species. These data elucidate the chromosomal evolutionary pattern within the Phasianidae that led to the modern turkey and chicken karyotypes. The predominant rearrangement mode involves intra-chromosomal inversions, and there is a clear bias for these to result in centromere locations at or near telomeres in turkey chromosomes, in comparison to interstitial centromeres in the orthologous chicken chromosomes. Conclusion The BAC-based turkey-chicken comparative map provides novel insights into the evolution of avian genomes, a framework for assembly of turkey whole genome shotgun sequencing data, and tools for enhanced genetic improvement of these important agricultural and model species. PMID:21906286
Guellouz, Asma; Valerio-Lepiniec, Marie; Urvoas, Agathe; Chevrel, Anne; Graille, Marc; Fourati-Kammoun, Zaineb; Desmadril, Michel; van Tilbeurgh, Herman; Minard, Philippe
2013-01-01
We previously designed a new family of artificial proteins named αRep based on a subgroup of thermostable helicoidal HEAT-like repeats. We have now assembled a large optimized αRep library. In this library, the side chains at each variable position are not fully randomized but instead encoded by a distribution of codons based on the natural frequency of side chains of the natural repeats family. The library construction is based on a polymerization of micro-genes and therefore results in a distribution of proteins with a variable number of repeats. We improved the library construction process using a "filtration" procedure to retain only fully coding modules that were recombined to recreate sequence diversity. The final library named Lib2.1 contains 1.7×10(9) independent clones. Here, we used phage display to select, from the previously described library or from the new library, new specific αRep proteins binding to four different non-related predefined protein targets. Specific binders were selected in each case. The results show that binders with various sizes are selected including relatively long sequences, with up to 7 repeats. ITC-measured affinities vary with Kd values ranging from micromolar to nanomolar ranges. The formation of complexes is associated with a significant thermal stabilization of the bound target protein. The crystal structures of two complexes between αRep and their cognate targets were solved and show that the new interfaces are established by the variable surfaces of the repeated modules, as well by the variable N-cap residues. These results suggest that αRep library is a new and versatile source of tight and specific binding proteins with favorable biophysical properties.
Construction of physical maps for the sex-specific regions of papaya sex chromosomes.
Na, Jong-Kuk; Wang, Jianping; Murray, Jan E; Gschwend, Andrea R; Zhang, Wenli; Yu, Qingyi; Navajas-Pérez, Rafael; Feltus, F Alex; Chen, Cuixia; Kubat, Zdenek; Moore, Paul H; Jiang, Jiming; Paterson, Andrew H; Ming, Ray
2012-05-08
Papaya is a major fruit crop in tropical and subtropical regions worldwide. It is trioecious with three sex forms: male, female, and hermaphrodite. Sex determination is controlled by a pair of nascent sex chromosomes with two slightly different Y chromosomes, Y for male and Yh for hermaphrodite. The sex chromosome genotypes are XY (male), XYh (hermaphrodite), and XX (female). The papaya hermaphrodite-specific Yh chromosome region (HSY) is pericentromeric and heterochromatic. Physical mapping of HSY and its X counterpart is essential for sequencing these regions and uncovering the early events of sex chromosome evolution and to identify the sex determination genes for crop improvement. A reiterate chromosome walking strategy was applied to construct the two physical maps with three bacterial artificial chromosome (BAC) libraries. The HSY physical map consists of 68 overlapped BACs on the minimum tiling path, and covers all four HSY-specific Knobs. One gap remained in the region of Knob 1, the only knob structure shared between HSY and X, due to the lack of HSY-specific sequences. This gap was filled on the physical map of the HSY corresponding region in the X chromosome. The X physical map consists of 44 BACs on the minimum tiling path with one gap remaining in the middle, due to the nature of highly repetitive sequences. This gap was filled on the HSY physical map. The borders of the non-recombining HSY were defined genetically by fine mapping using 1460 F2 individuals. The genetically defined HSY spanned approximately 8.5 Mb, whereas its X counterpart extended about 5.4 Mb including a 900 Kb region containing the Knob 1 shared by the HSY and X. The 8.5 Mb HSY corresponds to 4.5 Mb of its X counterpart, showing 4 Mb (89%) DNA sequence expansion. The 89% increase of DNA sequence in HSY indicates rapid expansion of the Yh chromosome after genetic recombination was suppressed 2-3 million years ago. The genetically defined borders coincide with the common
Fauth, E; Scherthan, H; Zankl, H
1998-05-01
Chromosome painting with library DNA probes specific for all human chromosomes was used to study the chromosomal content of micronuclei (MN) in normal and 5-azacytidine (5-aza-C)-treated lymphocyte cultures. More than 60,000 normal lymphocytes were screened for associated MN after in situ hybridization. At least 50 MN were scored for each probe. With the exception of chromosomes 12 and 19, which did not occur in MN, all other chromosomes were detected in MN at frequencies varying from 1 to 11.5%. Treatment of lymphocyte cultures with 5-aza-C induced preferential exclusion of chromosomes 1 (34%), 9 (32%) and 16 (20%) material in MN, whereas chromosome 8, 10, 12-15 and 21 material was not detected in MN. The results obtained from normal lymphocytes allow for the first time an estimation of the frequency of occurrence of all chromosomes in spontaneously occurring MN in human cells. Data derived from 5-aza-C-treated lymphocytes are furthermore consistent with the view that undermethylation of heterochromatin may be associated with loss of specific chromosomes at metaphase.
Mapping genes to human chromosome 19
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connolly, Sarah
1996-05-01
For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less
Chevrel, Anne; Graille, Marc; Fourati-Kammoun, Zaineb; Desmadril, Michel; van Tilbeurgh, Herman; Minard, Philippe
2013-01-01
We previously designed a new family of artificial proteins named αRep based on a subgroup of thermostable helicoidal HEAT-like repeats. We have now assembled a large optimized αRep library. In this library, the side chains at each variable position are not fully randomized but instead encoded by a distribution of codons based on the natural frequency of side chains of the natural repeats family. The library construction is based on a polymerization of micro-genes and therefore results in a distribution of proteins with a variable number of repeats. We improved the library construction process using a “filtration” procedure to retain only fully coding modules that were recombined to recreate sequence diversity. The final library named Lib2.1 contains 1.7×109 independent clones. Here, we used phage display to select, from the previously described library or from the new library, new specific αRep proteins binding to four different non-related predefined protein targets. Specific binders were selected in each case. The results show that binders with various sizes are selected including relatively long sequences, with up to 7 repeats. ITC-measured affinities vary with Kd values ranging from micromolar to nanomolar ranges. The formation of complexes is associated with a significant thermal stabilization of the bound target protein. The crystal structures of two complexes between αRep and their cognate targets were solved and show that the new interfaces are established by the variable surfaces of the repeated modules, as well by the variable N-cap residues. These results suggest that αRep library is a new and versatile source of tight and specific binding proteins with favorable biophysical properties. PMID:24014183
The Library as a Motivating Factor.
ERIC Educational Resources Information Center
Moody, Mildred T.
The librarian working in a hospital or institution with patients and the therapy staff must go beyond conventional library service. With many kinds of resources available the library becomes an integral part of the remedial and rehabilitative program. Strong and sustained motivation is necessary because the institution is an artificial environment…
Schmouth, Jean-François; Castellarin, Mauro; Laprise, Stéphanie; Banks, Kathleen G; Bonaguro, Russell J; McInerny, Simone C; Borretta, Lisa; Amirabbasi, Mahsa; Korecki, Andrea J; Portales-Casamar, Elodie; Wilson, Gary; Dreolini, Lisa; Jones, Steven J M; Wasserman, Wyeth W; Goldowitz, Daniel; Holt, Robert A; Simpson, Elizabeth M
2013-10-14
The next big challenge in human genetics is understanding the 98% of the genome that comprises non-coding DNA. Hidden in this DNA are sequences critical for gene regulation, and new experimental strategies are needed to understand the functional role of gene-regulation sequences in health and disease. In this study, we build upon our HuGX ('high-throughput human genes on the X chromosome') strategy to expand our understanding of human gene regulation in vivo. In all, ten human genes known to express in therapeutically important brain regions were chosen for study. For eight of these genes, human bacterial artificial chromosome clones were identified, retrofitted with a reporter, knocked single-copy into the Hprt locus in mouse embryonic stem cells, and mouse strains derived. Five of these human genes expressed in mouse, and all expressed in the adult brain region for which they were chosen. This defined the boundaries of the genomic DNA sufficient for brain expression, and refined our knowledge regarding the complexity of gene regulation. We also characterized for the first time the expression of human MAOA and NR2F2, two genes for which the mouse homologs have been extensively studied in the central nervous system (CNS), and AMOTL1 and NOV, for which roles in CNS have been unclear. We have demonstrated the use of the HuGX strategy to functionally delineate non-coding-regulatory regions of therapeutically important human brain genes. Our results also show that a careful investigation, using publicly available resources and bioinformatics, can lead to accurate predictions of gene expression.
Lu, Xiao-Hong
2009-01-01
Basal ganglia neurodegenerative disorders, such as Parkinson's disease (PD) and Huntington's disease (HD), are characterized by not only spectrum of motor deficits, ranging form hypokinesia to hyperkinesia, but also emotional, cognitive, and psychiatric manifestations. The symptoms and pathogenic mechanism of these disorders should be viewed as dysfunctions of specific cortico-subcortical neurocircuits. Transgenic approaches using large genomic inserts, such as bacterial artificial chromosome (BAC)-mediated transgenesis, due to its capacity to propagate large-size genomic DNA and faithful production of endogenous-like gene expression pattern/lever, have provided an ideal basis for the generation of transgenic mice as model for basal ganglia neurodegenerative disorders, as well as the functional and structural analysis of neurocircuits. In this chapter, the basic concepts and practical approaches about application of BAC transgenic system are introduced. Existent major BAC transgenic mouse models for PD and HD are evaluated according to their construct, face, and predicative validity. Finally, considerations, possible solutions, and future perspectives of using BAC transgenic approach to study basal ganglia neurodegenerative disorders are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko
2008-05-09
Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-{beta}-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 daysmore » after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells.« less
[Detection of linear chromosomes and plasmids among 15 genera in the Actinomycetales].
Ma, Ning; Ma, Wei; Jiang, Chenglin; Fang, Ping; Qin, Zhongjun
2003-10-01
Bacterial chromosomes and plasmids are commonly circular, however, linear chromosomes and plasmids were discovered among 5 genera of the Actinomycetales. Here, we use pulsed field gel electrophoresis to study the genomes of 19 species which belong to 15 genera in the Actinomycetales. All chromosomes of 19 species are linear DNA, and linear plasmids with different sizes and copy numbers are detected among 5 species. This work provide basis for investigating the possible novel functions of linear replicons beyond Streptomyces and also helps to develop Actinomycetales artificial linear chromosome.
2012-01-01
Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695
Physical mapping of the torsion dystonia region of human chromosome 9q34
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ozelius, L.J.; Hewett, J.; Shalish, C.
1994-09-01
Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less
Chiatante, Giorgia; Giannuzzi, Giuliana; Calabrese, Francesco Maria; Eichler, Evan E; Ventura, Mario
2017-07-01
Dicentric chromosomes are products of genomic rearrangements that place two centromeres on the same chromosome. Due to the presence of two primary constrictions, they are inherently unstable and overcome their instability by epigenetically inactivating and/or deleting one of the two centromeres, thus resulting in functionally monocentric chromosomes that segregate normally during cell division. Our understanding to date of dicentric chromosome formation, behavior and fate has been largely inferred from observational studies in plants and humans as well as artificially produced de novo dicentrics in yeast and in human cells. We investigate the most recent product of a chromosome fusion event fixed in the human lineage, human chromosome 2, whose stability was acquired by the suppression of one centromere, resulting in a unique difference in chromosome number between humans (46 chromosomes) and our most closely related ape relatives (48 chromosomes). Using molecular cytogenetics, sequencing, and comparative sequence data, we deeply characterize the relicts of the chromosome 2q ancestral centromere and its flanking regions, gaining insight into the ancestral organization that can be easily broadened to all acrocentric chromosome centromeres. Moreover, our analyses offered the opportunity to trace the evolutionary history of rDNA and satellite III sequences among great apes, thus suggesting a new hypothesis for the preferential inactivation of some human centromeres, including IIq. Our results suggest two possible centromere inactivation models to explain the evolutionarily stabilization of human chromosome 2 over the last 5-6 million years. Our results strongly favor centromere excision through a one-step process. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Kokura, Kenji; Kuromi, Yasushi; Endo, Takeshi; Anzai, Naohiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Ohbayashi, Tetsuya
2016-10-01
Kidney injury molecule-1 (Kim-1) has been validated as a urinary biomarker for acute and chronic renal damage. The expression of Kim-1 mRNA is also activated by acute kidney injury induced by cisplatin in rodents and humans. To date, the measurement of Kim-1 expression has not fully allowed the detection of in vitro cisplatin nephrotoxicity in immortalized culture cells, such as human kidney-2 cells and immortalized proximal tubular epithelial cells. We measured the augmentation of Kim-1 mRNA expression after the addition of cisplatin using immortalized S3 cells established from the kidneys of transgenic mice harboring temperature-sensitive large T antigen from Simian virus 40. A mouse Kim-1 gene luciferase reporter in conjunction with an Hprt gene reporter detected cisplatin-induced nephrotoxicity in S3 cells. These two reporter genes were contained in a mouse artificial chromosome, and two luciferases that emitted different wavelengths were used to monitor the respective gene expression. However, the Kim-1 reporter gene failed to respond to cisplatin in A9 fibroblast cells that contained the same reporter mouse artificial chromosome, suggesting cell type-specificity for activation of the reporter. We report the feasibility of measuring in vitro cisplatin nephrotoxicity using a Kim-1 reporter gene in S3 cells. © 2016 The Authors. The Journal of Gene Medicine Published by John Wiley & Sons, Ltd.
2011-01-01
Background Apomixis, asexual seed production in plants, holds great potential for agriculture as a means to fix hybrid vigor. Apospory is a form of apomixis where the embryo develops from an unreduced egg that is derived from a somatic nucellar cell, the aposporous initial, via mitosis. Understanding the molecular mechanism regulating aposporous initial specification will be a critical step toward elucidation of apomixis and also provide insight into developmental regulation and downstream signaling that results in apomixis. To discover candidate transcripts for regulating aposporous initial specification in P. squamulatum, we compared two transcriptomes derived from microdissected ovules at the stage of aposporous initial formation between the apomictic donor parent, P. squamulatum (accession PS26), and an apomictic derived backcross 8 (BC8) line containing only the Apospory-Specific Genomic Region (ASGR)-carrier chromosome from P. squamulatum. Toward this end, two transcriptomes derived from ovules of an apomictic donor parent and its apomictic backcross derivative at the stage of apospory initiation, were sequenced using 454-FLX technology. Results Using 454-FLX technology, we generated 332,567 reads with an average read length of 147 base pairs (bp) for the PS26 ovule transcriptome library and 363,637 reads with an average read length of 142 bp for the BC8 ovule transcriptome library. A total of 33,977 contigs from the PS26 ovule transcriptome library and 26,576 contigs from the BC8 ovule transcriptome library were assembled using the Multifunctional Inertial Reference Assembly program. Using stringent in silico parameters, 61 transcripts were predicted to map to the ASGR-carrier chromosome, of which 49 transcripts were verified as ASGR-carrier chromosome specific. One of the alien expressed genes could be assigned as tightly linked to the ASGR by screening of apomictic and sexual F1s. Only one transcript, which did not map to the ASGR, showed expression
Structural features of the rice chromosome 4 centromere.
Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin
2004-01-01
A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.
Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25
DOE Office of Scientific and Technical Information (OSTI.GOV)
Legerski, R.J.; Liu, P.; Li, L.
1994-05-01
The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less
2011-01-01
Background Lupinus angustifolius L, also known as narrow-leafed lupin (NLL), is becoming an important grain legume crop that is valuable for sustainable farming and is becoming recognised as a potential human health food. Recent interest is being directed at NLL to improve grain production, disease and pest management and health benefits of the grain. However, studies have been hindered by a lack of extensive genomic resources for the species. Results A NLL BAC library was constructed consisting of 111,360 clones with an average insert size of 99.7 Kbp from cv Tanjil. The library has approximately 12 × genome coverage. Both ends of 9600 randomly selected BAC clones were sequenced to generate 13985 BAC end-sequences (BESs), covering approximately 1% of the NLL genome. These BESs permitted a preliminary characterisation of the NLL genome such as organisation and composition, with the BESs having approximately 39% G:C content, 16.6% repetitive DNA and 5.4% putative gene-encoding regions. From the BESs 9966 simple sequence repeat (SSR) motifs were identified and some of these are shown to be potential markers. Conclusions The NLL BAC library and BAC-end sequences are powerful resources for genetic and genomic research on lupin. These resources will provide a robust platform for future high-resolution mapping, map-based cloning, comparative genomics and assembly of whole-genome sequencing data for the species. PMID:22014081
Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng
2016-02-01
The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.
Dalsass, Alessia; Mestichelli, Francesca; Ruggieri, Miriana; Gaspari, Paola; Pezzoni, Valerio; Vagnoni, Davide; Angelini, Mario; Angelini, Stefano; Bigazzi, Catia; Falcioni, Sadia; Troiani, Emanuela; Alesiani, Francesco; Catarini, Massimo; Attolico, Immacolata; Scortechini, Ilaria; Discepoli, Giancarlo; Galieni, Piero
2013-07-01
Deletions of the long arm of chromosome 6 are known to occur at relatively low frequency (3-6%) in chronic lymphocytic leukemia (CLL), and they are more frequently observed in 6q21. Few data have been reported regarding other bands on 6q involved by cytogenetic alterations in CLL. The cytogenetic study was performed in nuclei and metaphases obtained after stimulation with a combination of CpG-oligonucleotide DSP30 and interleukin-2. Four bacterial artificial chromosome (BAC) clones mapping regions in bands 6q16, 6q23, 6q25, 6q27 were used as probes for fluorescence in situ hybridization in 107 CLL cases in order to analyze the occurrence and localization of 6q aberrations. We identified 11 cases (10.2%) with 6q deletion of 107 patients studied with CLL. The trends of survival curves and the treatment-free intervals (TFI) of patients with deletion suggest a better outcome than the other cytogenetic risk groups. We observed two subgroups with 6q deletion as the sole anomaly: two cases with 6q16 deletion, and three cases with 6q25.2-27 deletion. There were differences of age, stage, and TFI between both subgroups. By using BAC probes, we observed that 6q deletion has a higher frequency in CLL and is linked with a good prognosis. In addition, it was observed that the deletion in 6q16 appears to be the most frequent and, if present as the only abnormality, it could be associated with a most widespread disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Marbouty, Martial; Cournac, Axel; Flot, Jean-François; Marie-Nelly, Hervé; Mozziconacci, Julien; Koszul, Romain
2014-01-01
Genomic analyses of microbial populations in their natural environment remain limited by the difficulty to assemble full genomes of individual species. Consequently, the chromosome organization of microorganisms has been investigated in a few model species, but the extent to which the features described can be generalized to other taxa remains unknown. Using controlled mixes of bacterial and yeast species, we developed meta3C, a metagenomic chromosome conformation capture approach that allows characterizing individual genomes and their average organization within a mix of organisms. Not only can meta3C be applied to species already sequenced, but a single meta3C library can be used for assembling, scaffolding and characterizing the tridimensional organization of unknown genomes. By applying meta3C to a semi-complex environmental sample, we confirmed its promising potential. Overall, this first meta3C study highlights the remarkable diversity of microorganisms chromosome organization, while providing an elegant and integrated approach to metagenomic analysis. DOI: http://dx.doi.org/10.7554/eLife.03318.001 PMID:25517076
Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi
BRIDI, L. C.; SHARAKHOVA, M. V.; SHARAKHOV, I. V.; CORDEIRO, J.; AZEVEDO, G. M.; TADEI, W. P.; RAFAEL, M. S.
2012-01-01
Physical and genetic maps have been used for chromosomal localization of genes in vectors of infectious diseases. The availability of polytene chromosomes in malaria mosquitoes provides a unique opportunity to precisely map genes of interest. We report physical mapping of two actin genes on polytene chromosomes of the major malaria vector in Amazon Anopheles darlingi. The clones with the actin genes sequences were obtained from a cDNA library constructed from RNA isolated from adult females and males of An. darlingi. Each of the two clones was mapped to a unique site on the chromosomal arm 2L in subdivisions 21A (clone pl05-A04) and 23B (clone pl17-G06). The obtained results together with previous mapping data provide a suitable basis for comparative genomics and for establishing chromosomal homologies among major malaria vectors. PMID:22804344
Yleaf: Software for Human Y-Chromosomal Haplogroup Inference from Next-Generation Sequencing Data.
Ralf, Arwin; Montiel González, Diego; Zhong, Kaiyin; Kayser, Manfred
2018-05-01
Next-generation sequencing (NGS) technologies offer immense possibilities given the large genomic data they simultaneously deliver. The human Y-chromosome serves as good example how NGS benefits various applications in evolution, anthropology, genealogy, and forensics. Prior to NGS, the Y-chromosome phylogenetic tree consisted of a few hundred branches, based on NGS data, it now contains many thousands. The complexity of both, Y tree and NGS data provide challenges for haplogroup assignment. For effective analysis and interpretation of Y-chromosome NGS data, we present Yleaf, a publically available, automated, user-friendly software for high-resolution Y-chromosome haplogroup inference independently of library and sequencing methods.
Achenbach, Ute C; Tang, Xiaomin; Ballvora, Agim; de Jong, Hans; Gebhardt, Christiane
2010-02-01
Potato chromosome 5 harbours numerous genes for important qualitative and quantitative traits, such as resistance to the root cyst nematode Globodera pallida and the late blight fungus, Phytophthora infestans. The genes make up part of a "hot spot" for resistances to various pathogens covering a genetic map length of 3 cM between markers GP21 and GP179. We established the physical size and position of this region on chromosome 5 in potato and tomato using fluorescence in situ hybridization (FISH) on pachytene chromosomes. Five potato bacterial artificial chromosome (BAC) clones with the genetically anchored markers GP21, R1-contig (proximal end), CosA, GP179, and StPto were selected, labeled with different fluorophores, and hybridized in a five-colour FISH experiment. Our results showed the location of the BAC clones in the middle of the long arm of chromosome 5 in both potato and tomato. Based on chromosome measurements, we estimate the physical size of the GP21-GP179 interval at 0.85 Mb and 1.2 Mb in potato and tomato, respectively. The GP21-GP179 interval is part of a genome segment known to have inverted map positions between potato and tomato.
High-resolution FISH on super-stretched flow-sorted plant chromosomes.
Valárik, M; Bartos, J; Kovárová, P; Kubaláková, M; de Jong, J H; Dolezel, J
2004-03-01
A novel high-resolution fluorescence in situ hybridisation (FISH) strategy, using super-stretched flow-sorted plant chromosomes as targets, is described. The technique that allows longitudinal extension of chromosomes of more than 100 times their original metaphase size is especially attractive for plant species with large chromosomes, whose pachytene chromosomes are generally too long and heterochromatin patterns too complex for FISH analysis. The protocol involves flow cytometric sorting of metaphase chromosomes, mild proteinase-K digestion of air-dried chromosomes on microscopic slides, followed by stretching with ethanol:acetic acid (3 : 1). Stretching ratios were assessed in a number of FISH experiments with super-stretched chromosomes from barley, wheat, rye and chickpea, hybridised with 45S and 5S ribosomal DNAs and the [GAA]n microsatellite, the [TTTAGGG]n telomeric repeat and a bacterial artificial chromosome (BAC) clone as probes. FISH signals on stretched chromosomes were brighter than those on the untreated control, resulting from better accessibility of the stretched chromatin and maximum observed sensitivity of 1 kbp. Spatial resolution of neighbouring loci was improved down to 70 kbp as compared to 5-10 Mbp after FISH on mitotic chromosomes, revealing details of adjacent DNA sequences hitherto not obtained with any other method. Stretched chromosomes are advantageous over extended DNA fibres from interphase nuclei as targets for FISH studies because they still retain chromosomal integrity. Although the method is confined to species for which chromosome flow sorting has been developed, it provides a unique system for controlling stretching degree of mitotic chromosomes and high-resolution bar-code FISH.
Sequence conservation on the Y chromosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gibson, L.H.; Yang-Feng, L.; Lau, C.
The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less
Madrigal, I; Rodríguez-Revenga, L; Armengol, L; González, E; Rodriguez, B; Badenas, C; Sánchez, A; Martínez, F; Guitart, M; Fernández, I; Arranz, JA; Tejada, MI; Pérez-Jurado, LA; Estivill, X; Milà, M
2007-01-01
Background Aproximately 5–10% of cases of mental retardation in males are due to copy number variations (CNV) on the X chromosome. Novel technologies, such as array comparative genomic hybridization (aCGH), may help to uncover cryptic rearrangements in X-linked mental retardation (XLMR) patients. We have constructed an X-chromosome tiling path array using bacterial artificial chromosomes (BACs) and validated it using samples with cytogenetically defined copy number changes. We have studied 54 patients with idiopathic mental retardation and 20 controls subjects. Results Known genomic aberrations were reliably detected on the array and eight novel submicroscopic imbalances, likely causative for the mental retardation (MR) phenotype, were detected. Putatively pathogenic rearrangements included three deletions and five duplications (ranging between 82 kb to one Mb), all but two affecting genes previously known to be responsible for XLMR. Additionally, we describe different CNV regions with significant different frequencies in XLMR and control subjects (44% vs. 20%). Conclusion This tiling path array of the human X chromosome has proven successful for the detection and characterization of known rearrangements and novel CNVs in XLMR patients. PMID:18047645
Development of a bacteriophage displayed peptide library and biosensor
NASA Astrophysics Data System (ADS)
Chin, Robert C.; Salazar, Noe; Mayo, Michael W.; Villavicencio, Victor I.; Taylor, Richard B.; Chambers, James P.; Valdes, James J.
1996-04-01
A miniaturized, handheld biosensor for identification of hazardous biowarfare agents with high specificity is being developed. An innovative biological recognition system based on bacteriophage displayed peptide receptors will be utilized in conjunction with the miniature biosensor technology being developed. A bacteriophage library has been constructed to provide the artificial receptors. The library can contain millions of bacteriophage with randomly displayed peptide sequences in the phage outer protein coat which act as binding sites for the agents of interest. This library will be used to 'bio-pan' for phages that bind to a number of toxins and infectious agents and can, thus, provide an endless supply of low cost, reliable, specific, and stable artificial receptors. The biosensor instrument will utilize evanescent wave, planar waveguide, far-red dyes, diode laser and miniature circuit technologies for performance and portability.
Bronze-da-Rocha, E; Catita, J A; Sunkel, C E
1998-02-01
Systemic lupus erythematosus autoantibodies were used to identify and to characterize new human chromosome-associated proteins. Previous immunolocalization studies in human and murine tissue culture cells showed that some of these monoclonal antibodies recognize nuclear antigens that associate with condensed chromosomes during mitosis. One antibody was selected for screening a human HeLa S3 cDNA expression library, and cDNAs that code for an antigen of 31-33 kDa were isolated. Immunological, biochemical and cell fractionation data indicate that the 31- to 33-kDa antigen corresponds to the chromosome-associated protein recognized by the original monoclonal antibody. Sequence analysis shows that we isolated a novel human gene. Immunolocalization to human tissue culture cells shows that during interphase the antigen is dispersed in the nucleus and that during mitosis it associates exclusively with condensed chromosomes. A similar pattern of localization was also observed in mouse fibroblasts, suggesting that the antigen is conserved among different species. Finally, we show that part of the antigen remains bound to the scaffold/matrix component, even after high salt extraction.
The Electronic Hermit: Trends in Library Automation.
ERIC Educational Resources Information Center
LaRue, James
1988-01-01
Reviews trends in library software development including: (1) microcomputer applications; (2) CD-ROM; (3) desktop publishing; (4) public access microcomputers; (5) artificial intelligence; (6) mainframes and minicomputers; and (7) automated catalogs. (MES)
Clevenger, Kenneth D; Ye, Rosa; Bok, Jin Woo; Thomas, Paul M; Islam, Md Nurul; Miley, Galen P; Robey, Matthew T; Chen, Cynthia; Yang, KaHoua; Swyers, Michael; Wu, Edward; Gao, Peng; Wu, Chengcang C; Keller, Nancy P; Kelleher, Neil L
2018-03-20
The benzodiazepine benzomalvin A/D is a fungally derived specialized metabolite and inhibitor of the substance P receptor NK1, biosynthesized by a three-gene nonribosomal peptide synthetase cluster. Here, we utilize fungal artificial chromosomes with metabolomic scoring (FAC-MS) to perform molecular genetic pathway dissection and targeted metabolomics analysis to assign the in vivo role of each domain in the benzomalvin biosynthetic pathway. The use of FAC-MS identified the terminal cyclizing condensation domain as BenY-C T and the internal C-domains as BenZ-C 1 and BenZ-C 2 . Unexpectedly, we also uncovered evidence suggesting BenY-C T or a yet to be identified protein mediates benzodiazepine formation, representing the first reported benzodiazepine synthase enzymatic activity. This work informs understanding of what defines a fungal C T domain and shows how the FAC-MS platform can be used as a tool for in vivo analyses of specialized metabolite biosynthesis and for the discovery and dissection of new enzyme activities.
Miller, Hilary C.; O’Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A.; Edwards, Scott
2015-01-01
Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. PMID:25953959
Miller, Hilary C; O'Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A; Edwards, Scott
2015-05-07
Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. Copyright © 2015 Miller et al.
The Case for Artificial Intelligence in Medicine
Reggia, James A.
1983-01-01
Current artificial intelligence (AI) technology can be viewed as producing “systematic artifacts” onto which we project an interpretation of intelligent behavior. One major benefit this technology could bring to medicine is help with handling the tremendous and growing volume of medical knowledge. The reader is led to a vision of the medical library of tomorrow, an interactive, artificially intelligent knowledge source that is fully and directly integrated with daily patient care.
Comparison of spontaneous and idoxuridine-induced micronuclei by chromosome painting.
Fauth, E; Zankl, H
1999-04-06
Fluorescence in situ hybridisation (FISH) technique with chromosome specific library (CSL) DNA probes for all human chromosomes were used to study about 9000 micronuclei (MN) in normal and idoxuridine (IUdR)-treated lymphocyte cultures of female and male donors. In addition, MN rates and structural chromosome aberrations were scored in Giemsa-stained chromosome spreads of these cultures. IUdR treatment (40 microg/ml) induced on the average a 12-fold increase of the MN rate. Metaphase analysis revealed no distinct increase of chromosome breaks but a preferential decondensation at chromosome 9q12 (28-79%) and to a lower extend at 1q12 (8-21%). Application of FISH technique with CSL probes to one male and one female untreated proband showed that all human chromosomes except chromosome 12 (and to a striking high frequency chromosomes 9, X and Y) occurred in spontaneous MN. In cultures containing IUdR, the chromosomal spectrum found in MN was reduced to 10 chromosomes in the male and 13 in the female proband. Eight chromosomes (2, 6, 12, 13, 14, 15, 17 and 18) did not occur in MN of both probands. On the contrary chromosomes 1 and especially 9 were found much more frequently in the MN of IUdR-treated cultures than in MN of control cultures. DAPI-staining revealed heterochromatin signals in most of the IUdR-induced MN. In an additional study, spontaneous and IUdR-induced MN were investigated in lymphocytes of another female donor using CSL probes only for chromosomes 1, 6, 9, 15, 16 and X. The results confirmed the previous finding that chromosomes 1 and 9 occur very often in MN after IUdR-treatment. The results indicate that decondensation of heterochromatic regions on chromosomes 1 and 9 caused by IUdR treatment strongly correlates with MN formation by these chromosomes. Copyright 1999 Elsevier Science B.V.
Arii, Jun; Hushur, Orkash; Kato, Kentaro; Kawaguchi, Yasushi; Tohya, Yukinobu; Akashi, Hiroomi
2006-04-01
Canine herpesvirus (CHV) is an attractive candidate not only for use as a recombinant vaccine to protect dogs from a variety of canine pathogens but also as a viral vector for gene therapy in domestic animals. However, developments in this area have been impeded by the complicated techniques used for eukaryotic homologous recombination. To overcome these problems, we used bacterial artificial chromosomes (BACs) to generate infectious BACs. Our findings may be summarized as follows: (i) the CHV genome (pCHV/BAC), in which a BAC flanked by loxP sites was inserted into the thymidine kinase gene, was maintained in Escherichia coli; (ii) transfection of pCHV/BAC into A-72 cells resulted in the production of infectious virus; (iii) the BAC vector sequence was almost perfectly excisable from the genome of the reconstituted virus CHV/BAC by co-infection with CHV/BAC and a recombinant adenovirus that expressed the Cre recombinase; and (iv) a recombinant virus in which the glycoprotein C gene was deleted was generated by lambda recombination followed by Flp recombination, which resulted in a reduction in viral titer compared with that of the wild-type virus. The infectious clone pCHV/BAC is useful for the modification of the CHV genome using bacterial genetics, and CHV/BAC should have multiple applications in the rapid generation of genetically engineered CHV recombinants and the development of CHV vectors for vaccination and gene therapy in domestic animals.
Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.
2017-01-01
Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Rapid divergence and expansion of the X chromosome in papaya
Gschwend, Andrea R.; Yu, Qingyi; Tong, Eric J.; Zeng, Fanchang; Han, Jennifer; VanBuren, Robert; Aryal, Rishi; Charlesworth, Deborah; Moore, Paul H.; Paterson, Andrew H.; Ming, Ray
2012-01-01
X chromosomes have long been thought to conserve the structure and gene content of the ancestral autosome from which the sex chromosomes evolved. We compared the recently evolved papaya sex chromosomes with a homologous autosome of a close relative, the monoecious Vasconcellea monoica, to infer changes since recombination stopped between the papaya sex chromosomes. We sequenced 12 V. monoica bacterial artificial chromosomes, 11 corresponding to the papaya X-specific region, and 1 to a papaya autosomal region. The combined V. monoica X-orthologous sequences are much shorter (1.10 Mb) than the corresponding papaya region (2.56 Mb). Given that the V. monoica genome is 41% larger than that of papaya, this finding suggests considerable expansion of the papaya X; expansion is supported by a higher repetitive sequence content of the X compared with the papaya autosomal sequence. The alignable regions include 27 transcript-encoding sequences, only 6 of which are functional X/V. monoica gene pairs. Sequence divergence from the V. monoica orthologs is almost identical for papaya X and Y alleles; the Carica-Vasconcellea split therefore occurred before the papaya sex chromosomes stopped recombining, making V. monoica a suitable outgroup for inferring changes in papaya sex chromosomes. The papaya X and the hermaphrodite-specific region of the Yh chromosome and V. monoica have all gained and lost genes, including a surprising amount of changes in the X. PMID:22869742
Yan, Wei; Li, Furong; Wang, Li; Zhu, Yaxin; Dong, Zhiyang; Bai, Linhan
2017-03-01
A new gene encoding a lipase (designated as Lip-1 ) was identified from a metagenomic bacterial artificial chromosome(BAC) library prepared from a concentrated water sample collected from a hot spring field in Niujie, Eryuan of Yunnan province in China. The open reading frame of this gene encoded 622 amino acid residues. It was cloned, fused with the oleosin gene and over expressed in Escherichia coli to prepare immobilized lipase artificial oil body AOB-sole-lip-1. The monomeric Sole-lip-1 fusion protein presented a molecular mass of 102.4 kDa. Enzyme assays using olive oil and methanol as the substrates in petroleum ether confirmed its transesterification activity. Hexadecanoic acid methyl ester, 8,11-Octadecadienoic acid methyl ester, 8-Octadecenoic acid methyl ester, and Octadecanoic acid methyl ester were detected. It showed favorable transesterification activity with optimal temperature 45 °C. Besides, the maximal biodiesel yield was obtained when the petroleum ether system as the organic solvent and the substrate methanol in 350 mmol/L (at a molar ratio of methanol of 10.5:1) and the water content was 1%. In light of these advantages, this lipase presents a promising resource for biodiesel production.
The Roles of the Future Library.
ERIC Educational Resources Information Center
Murr, Lawrence E.; Williams, James B.
1987-01-01
Discusses emerging roles for the library and librarian, including services in the following areas: (1) special collection management and reference; (2) information systems; (3) expert systems; (4) electronic publishing; (5) telecommunications networking; and (6) computer support. The technologies of artificial intelligence, graphic imaging,…
Structural and functional partitioning of bread wheat chromosome 3B.
Choulet, Frédéric; Alberti, Adriana; Theil, Sébastien; Glover, Natasha; Barbe, Valérie; Daron, Josquin; Pingault, Lise; Sourdille, Pierre; Couloux, Arnaud; Paux, Etienne; Leroy, Philippe; Mangenot, Sophie; Guilhot, Nicolas; Le Gouis, Jacques; Balfourier, Francois; Alaux, Michael; Jamilloux, Véronique; Poulain, Julie; Durand, Céline; Bellec, Arnaud; Gaspin, Christine; Safar, Jan; Dolezel, Jaroslav; Rogers, Jane; Vandepoele, Klaas; Aury, Jean-Marc; Mayer, Klaus; Berges, Hélène; Quesneville, Hadi; Wincker, Patrick; Feuillet, Catherine
2014-07-18
We produced a reference sequence of the 1-gigabase chromosome 3B of hexaploid bread wheat. By sequencing 8452 bacterial artificial chromosomes in pools, we assembled a sequence of 774 megabases carrying 5326 protein-coding genes, 1938 pseudogenes, and 85% of transposable elements. The distribution of structural and functional features along the chromosome revealed partitioning correlated with meiotic recombination. Comparative analyses indicated high wheat-specific inter- and intrachromosomal gene duplication activities that are potential sources of variability for adaption. In addition to providing a better understanding of the organization, function, and evolution of a large and polyploid genome, the availability of a high-quality sequence anchored to genetic maps will accelerate the identification of genes underlying important agronomic traits. Copyright © 2014, American Association for the Advancement of Science.
Lu, Fu-Hao; McKenzie, Neil; Kettleborough, George; Heavens, Darren; Clark, Matthew D; Bevan, Michael W
2018-05-01
The accurate sequencing and assembly of very large, often polyploid, genomes remains a challenging task, limiting long-range sequence information and phased sequence variation for applications such as plant breeding. The 15-Gb hexaploid bread wheat (Triticum aestivum) genome has been particularly challenging to sequence, and several different approaches have recently generated long-range assemblies. Mapping and understanding the types of assembly errors are important for optimising future sequencing and assembly approaches and for comparative genomics. Here we use a Fosill 38-kb jumping library to assess medium and longer-range order of different publicly available wheat genome assemblies. Modifications to the Fosill protocol generated longer Illumina sequences and enabled comprehensive genome coverage. Analyses of two independent Bacterial Artificial Chromosome (BAC)-based chromosome-scale assemblies, two independent Illumina whole genome shotgun assemblies, and a hybrid Single Molecule Real Time (SMRT-PacBio) and short read (Illumina) assembly were carried out. We revealed a surprising scale and variety of discrepancies using Fosill mate-pair mapping and validated several of each class. In addition, Fosill mate-pairs were used to scaffold a whole genome Illumina assembly, leading to a 3-fold increase in N50 values. Our analyses, using an independent means to validate different wheat genome assemblies, show that whole genome shotgun assemblies based solely on Illumina sequences are significantly more accurate by all measures compared to BAC-based chromosome-scale assemblies and hybrid SMRT-Illumina approaches. Although current whole genome assemblies are reasonably accurate and useful, additional improvements will be needed to generate complete assemblies of wheat genomes using open-source, computationally efficient, and cost-effective methods.
A selective sweep of >8 Mb on chromosome 26 in the Boxer genome.
Quilez, Javier; Short, Andrea D; Martínez, Verónica; Kennedy, Lorna J; Ollier, William; Sanchez, Armand; Altet, Laura; Francino, Olga
2011-07-01
Modern dog breeds display traits that are either breed-specific or shared by a few breeds as a result of genetic bottlenecks during the breed creation process and artificial selection for breed standards. Selective sweeps in the genome result from strong selection and can be detected as a reduction or elimination of polymorphism in a given region of the genome. Extended regions of homozygosity, indicative of selective sweeps, were identified in a genome-wide scan dataset of 25 Boxers from the United Kingdom genotyped at ~20,000 single-nucleotide polymorphisms (SNPs). These regions were further examined in a second dataset of Boxers collected from a different geographical location and genotyped using higher density SNP arrays (~170,000 SNPs). A selective sweep previously associated with canine brachycephaly was detected on chromosome 1. A novel selective sweep of over 8 Mb was observed on chromosome 26 in Boxer and for a shorter region in English and French bulldogs. It was absent in 171 samples from eight other dog breeds and 7 Iberian wolf samples. A region of extended increased heterozygosity on chromosome 9 overlapped with a previously reported copy number variant (CNV) which was polymorphic in multiple dog breeds. A selective sweep of more than 8 Mb on chromosome 26 was identified in the Boxer genome. This sweep is likely caused by strong artificial selection for a trait of interest and could have inadvertently led to undesired health implications for this breed. Furthermore, we provide supporting evidence for two previously described regions: a selective sweep on chromosome 1 associated with canine brachycephaly and a CNV on chromosome 9 polymorphic in multiple dog breeds.
1983-11-03
capability. An intelligent library management system will be supported by knowledge-based techniques. In fact, until a formal specification of library...from artificial intelligence and information science 2 might also be useful, for example automatic indexing and cataloging schemes, methods for fast...Artificial Intelligence 5:1045-1058, 1977. [Burstall & Goguen 801 Burstall, R. M., and Goguen, J. A. The Semantics of Clear, a Specification Language. In
Cowell, John K; Matsui, Sei-Ichi; Wang, Yong D; LaDuca, Jeffrey; Conroy, Jeffrey; McQuaid, Devin; Nowak, Norma J
2004-05-01
Identification of genetic losses and gains is valuable in analysis of brain tumors. Locus-by-locus analyses have revealed correlations between prognosis and response to chemotherapy and loss or gain of specific genes and loci. These approaches are labor intensive and do not provide a global view of the genetic changes within the tumor cells. Bacterial artificial chromosome (BAC) arrays, which cover the genome with an average resolution of less than 1 MbP, allow defining the sum total of these genetic changes in a single comparative genomic hybridization (CGH) experiment. These changes are directly overlaid on the human genome sequence, thus providing the extent of the amplification or deletion, reflected by a megabase position, and gene content of the abnormal region. Although this array-based CGH approach (CGHa) seems to detect the extent of the genetic changes in tumors reliably, it has not been robustly tested. We compared genetic changes in four newly derived, early-passage glioma cell lines, using spectral karyotyping (SKY) and CGHa. Chromosome changes seen in cell lines under SKY analysis were also detected with CGHa. In addition, CGHa detected cryptic genetic gains and losses and resolved the nature of subtle marker chromosomes that could not be resolved with SKY, thus providing distinct advantages over previous technologies. There was remarkable general concordance between the CGHa results comparing the cell lines to the original tumor, except that the magnitude of the changes seen in the tumor sample was generally suppressed compared with the cell lines, a consequence of normal cells contaminating the tumor sample. CGHa revealed changes in cell lines that were not present in the original tumors and vice versa, even when analyzed at the earliest passage possible, which highlights the adaptation of the cells to in vitro culture. CGHa proved to be highly accurate and efficient for identifying genetic changes in tumor cells. This approach can accurately
Chromosomal localization and structure of the human type II IMP dehydrogenase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Glesne, D.; Huberman, E.; Collart, F.
1994-05-01
We determined the chromosomal localization and structure of the gene encoding human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205), an enzyme associated with cellular proliferation, malignant transformation, and differentiation. Using polymerase chain reaction (PCR) primers specific for type II IMPDH, we screened a panel of human-Chinese hamster cell somatic hybrids and a separate deletion panel of chromosome 3 hybrids and localized the gene to 3p21.1{yields}p24.2. Two overlapping yeast artificial chromosome clones containing the full gene for type II IMPDH were isolated and a physical map of 117 kb of human genomic DNA in this region of chromosome 3 wasmore » constructed. The gene for type II IMPDH was localized and oriented on this map and found to span no more than 12.5 kb.« less
Kim, Jung-Hyun; Lee, Hee-Sheung; Lee, Nicholas C O; Goncharov, Nikolay V; Kumeiko, Vadim; Masumoto, Hiroshi; Earnshaw, William C; Kouprina, Natalay; Larionov, Vladimir
2016-03-22
Accumulating data indicates that chromosome instability (CIN) common to cancer cells can be used as a target for cancer therapy. At present the rate of chromosome mis-segregation is quantified by laborious techniques such as coupling clonal cell analysis with karyotyping or fluorescence in situ hybridization (FISH). Recently, a novel assay was developed based on the loss of a non-essential human artificial chromosome (HAC) carrying a constitutively expressed EGFP transgene ("loss of signal" assay). Using this system, anticancer drugs can be easily ranked on by their effect on HAC loss. However, it is problematic to covert this "loss of signal" assay into a high-throughput screen to identify drugs and mutations that increase CIN levels. To address this point, we re-designed the HAC-based assay. In this new system, the HAC carries a constitutively expressed shRNA against the EGFP transgene integrated into human genome. Thus, cells that inherit the HAC display no green fluorescence, while cells lacking the HAC do. We verified the accuracy of this "gain of signal" assay by measuring the level of CIN induced by known antimitotic drugs and added to the list of previously ranked CIN inducing compounds, two newly characterized inhibitors of the centromere-associated protein CENP-E, PF-2771 and GSK923295 that exhibit the highest effect on chromosome instability measured to date. The "gain of signal" assay was also sensitive enough to detect increase of CIN after siRNA depletion of known genes controlling mitotic progression through distinct mechanisms. Hence this assay can be utilized in future experiments to uncover novel human CIN genes, which will provide novel insight into the pathogenesis of cancer. Also described is the possible conversion of this new assay into a high-throughput screen using a fluorescence microplate reader to characterize chemical libraries and identify new conditions that modulate CIN level.
A genetic linkage map of the long arm of human chromosome 22.
Rouleau, G A; Haines, J L; Bazanowski, A; Colella-Crowley, A; Trofatter, J A; Wexler, N S; Conneally, P M; Gusella, J F
1989-01-01
We have used a recombinant phage library enriched for chromosome 22 sequences to isolate and characterize eight anonymous DNA probes detecting restriction fragment length polymorphisms on this autosome. These were used in conjunction with eight previously reported loci, including the genes BCR, IGLV, and PDGFB, four anonymous DNA markers, and the P1 blood group antigen, to construct a linkage map for chromosome 22. The linkage group is surprisingly large, spanning 97 cM on the long arm of the chromosome. There are no large gaps in the map; the largest intermarker interval is 14 cM. Unlike several other chromosomes, little overall difference was observed for sex-specific recombination rates on chromosome 22. The availability of a genetic map will facilitate investigation of chromosome 22 rearrangements in such disorders as cat eye syndrome and DiGeorge syndrome, deletions in acoustic neuroma and meningioma, and translocations in Ewing sarcoma. This defined set of linked markers will also permit testing chromosome 22 for the presence of particular disease genes by family studies and should immediately support more precise mapping and identification of flanking markers for NF2, the defective gene causing bilateral acoustic neurofibromatosis.
Do, Ltk; Wittayarat, M; Terazono, T; Sato, Y; Taniguchi, M; Tanihara, F; Takemoto, T; Kazuki, Y; Kazuki, K; Oshimura, M; Otoi, T
2016-12-01
The current applications for cat cloning include production of models for the study of human and animal diseases. This study was conducted to investigate the optimal fusion protocol on in vitro development of transgenic cloned cat embryos by comparing duration of electric pulse. Cat fibroblast cells containing a human artificial chromosome (HAC) vector were used as genetically modified nuclear donor cells. Couplets were fused and activated simultaneously with a single DC pulse of 3.0 kV/cm for either 30 or 60 μs. Low rates of fusion and embryo development to the blastocyst stage were observed in the reconstructed HAC-transchromosomic embryos, when the duration of fusion was prolonged to 60 μs. In contrast, the prolongation of electric pulse duration improved the embryo development and quality in the reconstructed control embryos without HAC vector. Our results suggested that the optimal parameters of electric pulses for fusion in cat somatic cell nuclear transfer vary among the types used for donor cells. © 2016 Blackwell Verlag GmbH.
Kipling, D; Wilson, H E; Thomson, E J; Cooke, H J
1995-06-01
Three Mus musculus DBA/2 YAC libraries were constructed using a half-YAC telomere cloning vector. This functional complementation approach yields libraries which include terminal restriction fragments of the mouse genome. Screening all three libraries led to the isolation of 32 independent clones which carry linear YACs containing the mouse terminal repeat sequence, (TTAGGG)n. These YACs provide a resource to isolate regions of the mouse genome close to chromosome termini and excluded from existing conventional YAC libraries. To demonstrate their utility, a hybridization probe was isolated from Mtel-1, the first (TTAGGG)n-containing YAC isolated. This probe detects a approximately 70 kb Kpnl fragment in the mouse genome which is sensitive to pretreatment with BAL31 exonuclease. A PCR-based genetic marker generated from the sequence of this probe maps 4.4 cM from the most distal anchor locus on chromosome 10 in the EUCIB interspecific backcross. STS primers for this locus, D10Hgu1, were used to isolate YAC 110F4 from a commercially available mouse YAC library. Fluorescence in situ hybridization demonstrates that YAC 110F4 hybridizes to the distal telomere of chromosome 10. Clones in this collection of telomere YACs therefore partially overlap clones in conventional YAC libraries, and thus the previously unavailable terminal regions of the mouse genome can now be linked with the developing mouse STS YAC contig. Genetic markers such as D10Hgu1 allow the ends of the mouse genetic map to be defined, thus closing the map.
Veltsos, Paris; Cossard, Guillaume; Beaudoing, Emmanuel; Beydon, Genséric; Savova Bianchi, Dessislava; Roux, Camille; C González-Martínez, Santiago; R Pannell, John
2018-05-29
Dioecious plants vary in whether their sex chromosomes are heteromorphic or homomorphic, but even homomorphic sex chromosomes may show divergence between homologues in the non-recombining, sex-determining region (SDR). Very little is known about the SDR of these species, which might represent particularly early stages of sex-chromosome evolution. Here, we assess the size and content of the SDR of the diploid dioecious herb Mercurialis annua , a species with homomorphic sex chromosomes and mild Y-chromosome degeneration. We used RNA sequencing (RNAseq) to identify new Y-linked markers for M. annua. Twelve of 24 transcripts showing male-specific expression in a previous experiment could be amplified by polymerase chain reaction (PCR) only from males, and are thus likely to be Y-linked. Analysis of genome-capture data from multiple populations of M. annua pointed to an additional six male-limited (and thus Y-linked) sequences. We used these markers to identify and sequence 17 sex-linked bacterial artificial chromosomes (BACs), which form 11 groups of non-overlapping sequences, covering a total sequence length of about 1.5 Mb. Content analysis of this region suggests that it is enriched for repeats, has low gene density, and contains few candidate sex-determining genes. The BACs map to a subset of the sex-linked region of the genetic map, which we estimate to be at least 14.5 Mb. This is substantially larger than estimates for other dioecious plants with homomorphic sex chromosomes, both in absolute terms and relative to their genome sizes. Our data provide a rare, high-resolution view of the homomorphic Y chromosome of a dioecious plant.
USDA-ARS?s Scientific Manuscript database
Two ghrelin receptor (GHS-R) genes were isolated from channel catfish tissue and a bacterial artificial chromosome (BAC) library. The two receptors were characterized by determining tissue distribution, ontogeny of receptor mRNA expression, and effects of exogenous homologous ghrelin administration ...
Genetic and physical map of the von Recklinghausen neurofibromatosis (NF1) region on chromosome 17
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagle, M.K.; Parruti, G.; Xu, W.
The von Recklinghausen neurofibromatosis 1 (NF1) locus has been previously assigned to the proximal long arm of chromosome 17, and two NF1 patients have been identified who have constitutional balanced translocations involving 17q11.2. The authors have constructed a cosmid library from a chromosome-mediated gene transfectant, KLT8, that contains approximately 10% of chromosome 17, including 17q11.2. Cosmids isolated from this library have been mapped across a panel of somatic cell hybrids, including the hybrids from the two patients, and have been localized to seven small regions of proximal 17q. They have 5 cosmids that map directly above the two NF1 translocations,more » and 11 cosmids that map directly below. Of these, 2 cosmids in each region are linked to the disease locus and 3 of these cosmids show no recombination. One distal cosmid, 2B/B35, detects the two NF1 translocations by pulsed-field gel analysis and has been used to produce a long-range restriction map that covers the translocations.« less
Wang, Jia-Chi; Boyar, Fatih Z
2016-01-01
Chromosomal microarray analysis (CMA) has been recommended and practiced routinely in the large reference laboratories of U.S.A. as the first-tier test for the postnatal evaluation of individuals with intellectual disability, autism spectrum disorders, and/or multiple congenital anomalies. Using CMA as a diagnostic tool and without a routine setting of fluorescence in situ hybridization with labeled bacterial artificial chromosome probes (BAC-FISH) in the large reference laboratories becomes a challenge in the characterization of chromosome 9 pericentric region. This region has a very complex genomic structure and contains a variety of heterochromatic and euchromatic polymorphic variants. These variants were usually studied by G-banding, C-banding and BAC-FISH analysis. Chromosomal microarray analysis (CMA) was not recommended since it may lead to false positive results. Here, we presented a cohort of four cases, in which high-resolution CMA was used as the first-tier test or simultaneously with G-banding analysis on the proband to identify pathogenic copy number variants (CNVs) in the whole genome. CMA revealed large pathogenic CNVs from chromosome 9 in 3 cases which also revealed different G-banding patterns between the two chromosome 9 homologues. Although we demonstrated that high-resolution CMA played an important role in the identification of pathogenic copy number variants in chromosome 9 pericentric regions, the lack of BAC-FISH analysis or other useful tools renders significant challenges in the characterization of chromosome 9 pericentric regions. None; it is not a clinical trial, and the cases were retrospectively collected and analyzed.
Chromatin Folding, Fragile Sites, and Chromosome Aberrations Induced by Low- and High- LET Radiation
NASA Technical Reports Server (NTRS)
Zhang, Ye; Cox, Bradley; Asaithamby, Aroumougame; Chen, David J.; Wu, Honglu
2013-01-01
We previously demonstrated non-random distributions of breaks involved in chromosome aberrations induced by low- and high-LET radiation. To investigate the factors contributing to the break point distribution in radiation-induced chromosome aberrations, human epithelial cells were fixed in G1 phase. Interphase chromosomes were hybridized with a multicolor banding in situ hybridization (mBAND) probe for chromosome 3 which distinguishes six regions of the chromosome in separate colors. After the images were captured with a laser scanning confocal microscope, the 3-dimensional structure of interphase chromosome 3 was reconstructed at multimega base pair scale. Specific locations of the chromosome, in interphase, were also analyzed with bacterial artificial chromosome (BAC) probes. Both mBAND and BAC studies revealed non-random folding of chromatin in interphase, and suggested association of interphase chromatin folding to the radiation-induced chromosome aberration hotspots. We further investigated the distribution of genes, as well as the distribution of breaks found in tumor cells. Comparisons of these distributions to the radiation hotspots showed that some of the radiation hotspots coincide with the frequent breaks found in solid tumors and with the fragile sites for other environmental toxins. Our results suggest that multiple factors, including the chromatin structure and the gene distribution, can contribute to radiation-induced chromosome aberrations.
Speech Recognition for A Digital Video Library.
ERIC Educational Resources Information Center
Witbrock, Michael J.; Hauptmann, Alexander G.
1998-01-01
Production of the meta-data supporting the Informedia Digital Video Library interface is automated using techniques derived from artificial intelligence research. Speech recognition and natural-language processing, information retrieval, and image analysis are applied to produce an interface that helps users locate information and navigate more…
Yuan, Suxia; Su, Yanbin; Liu, Yumei; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian
2015-01-01
Chromosome doubling of microspore-derived plants is an important factor in the practical application of microspore culture technology because breeding programs require a large number of genetically stable, homozygous doubled haploid plants with a high level of fertility. In the present paper, 29 populations of microspore-derived plantlets from cabbage (Brassica oleracea var. capitata) and broccoli (Brassica oleracea var. italica) were used to study the ploidy level and spontaneous chromosome doubling of these populations, the artificial chromosome doubling induced by colchicine, and the influence of tissue culture duration on the chromosomal ploidy of the microspore-derived regenerants. Spontaneous chromosome doubling occurred randomly and was genotype dependent. In the plant populations derived from microspores, there were haploids, diploids, and even a low frequency of polyploids and mixed-ploidy plantlets. The total spontaneous doubling in the 14 cabbage populations ranged from 0 to 76.9%, compared with 52.2 to 100% in the 15 broccoli populations. To improve the rate of chromosome doubling, an efficient and reliable artificial chromosome doubling protocol (i.e., the immersion of haploid plantlet roots in a colchicine solution) was developed for cabbage and broccoli microspore-derived haploids. The optimal chromosome doubling of the haploids was obtained with a solution of 0.2% colchicine for 9–12 h or 0.4% colchicine for 3–9 h for cabbage and 0.05% colchicine for 6–12 h for broccoli. This protocol produced chromosome doubling in over 50% of the haploid genotypes for most of the populations derived from cabbage and broccoli. Notably, after 1 or more years in tissue culture, the chromosomes of the haploids were doubled, and most of the haploids turned into doubled haploid or mixed-ploidy plants. This is the first report indicating that tissue culture duration can change the chromosomal ploidy of microspore-derived regenerants. PMID:26734028
Yuan, Suxia; Su, Yanbin; Liu, Yumei; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian
2015-01-01
Chromosome doubling of microspore-derived plants is an important factor in the practical application of microspore culture technology because breeding programs require a large number of genetically stable, homozygous doubled haploid plants with a high level of fertility. In the present paper, 29 populations of microspore-derived plantlets from cabbage (Brassica oleracea var. capitata) and broccoli (Brassica oleracea var. italica) were used to study the ploidy level and spontaneous chromosome doubling of these populations, the artificial chromosome doubling induced by colchicine, and the influence of tissue culture duration on the chromosomal ploidy of the microspore-derived regenerants. Spontaneous chromosome doubling occurred randomly and was genotype dependent. In the plant populations derived from microspores, there were haploids, diploids, and even a low frequency of polyploids and mixed-ploidy plantlets. The total spontaneous doubling in the 14 cabbage populations ranged from 0 to 76.9%, compared with 52.2 to 100% in the 15 broccoli populations. To improve the rate of chromosome doubling, an efficient and reliable artificial chromosome doubling protocol (i.e., the immersion of haploid plantlet roots in a colchicine solution) was developed for cabbage and broccoli microspore-derived haploids. The optimal chromosome doubling of the haploids was obtained with a solution of 0.2% colchicine for 9-12 h or 0.4% colchicine for 3-9 h for cabbage and 0.05% colchicine for 6-12 h for broccoli. This protocol produced chromosome doubling in over 50% of the haploid genotypes for most of the populations derived from cabbage and broccoli. Notably, after 1 or more years in tissue culture, the chromosomes of the haploids were doubled, and most of the haploids turned into doubled haploid or mixed-ploidy plants. This is the first report indicating that tissue culture duration can change the chromosomal ploidy of microspore-derived regenerants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
Bendre, Shweta; Hall, Conrad; Lin, Yu-Chih
2016-01-01
The dynamic regulation of microtubules (MTs) during mitosis is critical for accurate chromosome segregation and genome stability. Cancer cell lines with hyperstabilized kinetochore MTs have increased segregation errors and elevated chromosomal instability (CIN), but the genetic defects responsible remain largely unknown. The MT depolymerase MCAK (mitotic centromere-associated kinesin) can influence CIN through its impact on MT stability, but how its potent activity is controlled in cells remains unclear. In this study, we show that GTSE1, a protein found overexpressed in aneuploid cancer cell lines and tumors, regulates MT stability during mitosis by inhibiting MCAK MT depolymerase activity. Cells lacking GTSE1 have defects in chromosome alignment and spindle positioning as a result of MT instability caused by excess MCAK activity. Reducing GTSE1 levels in CIN cancer cell lines reduces chromosome missegregation defects, whereas artificially inducing GTSE1 levels in chromosomally stable cells elevates chromosome missegregation and CIN. Thus, GTSE1 inhibition of MCAK activity regulates the balance of MT stability that determines the fidelity of chromosome alignment, segregation, and chromosomal stability. PMID:27881713
Prada, Carlos F; Delprat, Alejandra; Ruiz, Alfredo
2011-02-01
The chromosomal relationships of the four martensis cluster species are among the most complex and intricate within the entire Drosophila repleta group, due to the so-called sharing of inversions. Here, we have revised these relationships using comparative mapping of bacterial artificial chromosome (BAC) clones on the salivary gland chromosomes. A physical map of chromosome 2 of Drosophila uniseta (one of the cluster members) was generated by in situ hybridization of 82 BAC clones from the physical map of the Drosophila buzzatii genome (an outgroup that represents the ancestral arrangement). By comparing the marker positions, we determined the number, order, and orientation of conserved chromosomal segments between chromosome 2 of D. buzzatii and D. uniseta. GRIMM software was used to infer that a minimum of five chromosomal inversions are necessary to transform the chromosome 2 of D. buzzatii into that of D. uniseta. Two of these inversions have been overlooked in previous cytological analyses. The five fixed inversions entail two breakpoint reuses because only nine syntenic segments and eight interruptions were observed. We tested for the presence of the five inversions fixed in D. uniseta in the other three species of the martensis cluster by in situ hybridization of eight breakpoint-bearing BAC clones. The results shed light on the chromosomal phylogeny of the martensis cluster, yet leave a number of questions open.
Imagining the Digital Library in a Commercialized Internet.
ERIC Educational Resources Information Center
Heckart, Ronald J.
1999-01-01
Discusses digital library planning in light of Internet commerce and technological innovation in marketing and customer relations that are transforming user expectations about Web sites that offer products and services. Topics include user self-sufficiency; personalized service; artificial intelligence; collaborative filtering; and electronic…
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Evaluation of an automated karyotyping system for chromosome aberration analysis
NASA Technical Reports Server (NTRS)
Prichard, Howard M.
1987-01-01
Chromosome aberration analysis is a promising complement to conventional radiation dosimetry, particularly in the complex radiation fields encountered in the space environment. The capabilities of a recently developed automated karyotyping system were evaluated both to determine current capabilities and limitations and to suggest areas where future development should be emphasized. Cells exposed to radiometric chemicals and to photon and particulate radiation were evaluated by manual inspection and by automated karyotyping. It was demonstrated that the evaluated programs were appropriate for image digitization, storage, and transmission. However, automated and semi-automated scoring techniques must be advanced significantly if in-flight chromosome aberration analysis is to be practical. A degree of artificial intelligence may be necessary to realize this goal.
Assembly of YAC contigs on the long arm of human chromosome 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, J.; Fujiwara, T.M.; Wang, J.X.
1994-09-01
We have previously identified approximately 2,000 chromosome 2-specific YACs by screening the CEPH Mark I YAC library (`Midi- YACs`). Using STS content mapping, we have been able to order groups of these YACs along chromosome 2q. The four biggest YAC groups were associated with VIL (2q35), FN (2q34), PAX3 (2q36), ALPI (2q37) and contained 113, 107, 79, and 63 YACs, respectively. We have identified the minimal tiling paths for most YAC groups and determined the insert sizes of over 300 YACs. Furthermore, on human chromosome 2q31-q37, 15 microsatellite markers were linked to various expressed genes through overlapping YACs and themore » physical distance of microsatellites to expressed genes was determined. The precise mapping of a set of highly informative microsatellite markers with respect to known genes provides a useful tool for linkage studies and the identification of disease genes from the long arm of human chromosome 2.« less
Kouprina, Natalay; Samoshkin, Alexander; Erliandri, Indri; Nakano, Megumi; Lee, Hee-Sheung; Fu, Haiging; Iida, Yuichi; Aladjem, Mirit; Oshimura, Mitsuo; Masumoto, Hiroshi; Earnshaw, William C.; Larionov, Vladimir
2012-01-01
Human artificial chromosomes (HACs) represent a novel promising episomal system for functional genomics, gene therapy and synthetic biology. HACs are engineered from natural and synthetic alphoid DNA arrays upon transfection into human cells. The use of HACs for gene expression studies requires the knowledge of their structural organization. However, none of de novo HACs constructed so far has been physically mapped in detail. Recently we constructed a synthetic alphoidtetO-HAC that was successfully used for expression of full-length genes to correct genetic deficiencies in human cells. The HAC can be easily eliminated from cell populations by inactivation of its conditional kinetochore. This unique feature provides a control for phenotypic changes attributed to expression of HAC-encoded genes. This work describes organization of a megabase-size synthetic alphoid DNA array in the alphoidtetO-HAC that has been formed from a ~50 kb synthetic alphoidtetO-construct. Our analysis showed that this array represents a 1.1 Mb continuous sequence assembled from multiple copies of input DNA, a significant part of which was rearranged before assembling. The tandem and inverted alphoid DNA repeats in the HAC range in size from 25 to 150 kb. In addition, we demonstrated that the structure and functional domains of the HAC remains unchanged after several rounds of its transfer into different host cells. The knowledge of the alphoidtetO-HAC structure provides a tool to control HAC integrity during different manipulations. Our results also shed light on a mechanism for de novo HAC formation in human cells. PMID:23411994
Molecular mapping of chromosomes 17 and X
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barker, D.F.
1989-01-01
The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less
Tanaka, Atsushi; Nagayoshi, Motoi; Awata, Shoichiro; Mawatari, Yoshifumi; Tanaka, Izumi; Kusunoki, Hiroshi
2004-01-01
To evaluate the safety and accuracy of karyotyping the blastomere chromosomes at metaphase in the natural cell cycle for preimplantation diagnosis. A pilot study. A private infertility clinic and a university laboratory. Eleven patients undergoing IVF and preimplantation diagnosis. Intact human embryos at the 4- to 6-cell stage and human-mouse heterokaryons were cultured and checked hourly for disappearance of the nuclear envelope. After it disappeared, the metaphase chromosomes were analyzed by fluorescence in situ hybridization. Percentage of analyzable metaphase plates and safety and accuracy of the method. The success rate of electrofusion to form human-mouse heterokaryons was 87.1% (27/31), and analyzable chromosomes were obtained from 77.4% (24/31) of the heterokaryons. On the other hand, disappearance of the nuclear envelope occurred in 89.5% (17/19) of the human embryos and it began earlier than that in the heterokaryons. Analyzable chromosomes were obtained and their translocation sites were identified in all blastomeres biopsied from the 17 embryos. After the biopsy, 67.0% of the embryos could develop to the blastocyst stage. The natural cell cycle method reported herein requires frequent observation, but it is safe, with no artificial effects on the chromosomes and without loss of or damage to blastomeres, which occurred with the electrofusion method. Using the natural cell cycle method, we could perform preimplantation diagnosis with nearly 100% accuracy.
USDA-ARS?s Scientific Manuscript database
In this paper we generated DNA fingerprints and end sequences from bacterial artificial chromosomes (BACs) from two new libraries to improve the first generation integrated physical and genetic map of the rainbow trout (Oncorhynchus mykiss) genome. The current version of the physical map is compose...
Relationships between chromosome structure and chromosomal aberrations
NASA Astrophysics Data System (ADS)
Eidelman, Yuri; Andreev, Sergey
An interphase nucleus of human lymphocyte was simulated by the novel Monte Carlo tech-nique. The main features of interphase chromosome structure and packaging were taken into account: different levels of chromatin organisation; nonrandom localisation of chromosomes within a nucleus; chromosome loci dynamics. All chromosomes in a nucleus were modelled as polymer globules. A dynamic pattern of intra/interchromosomal contacts was simulated. The detailed information about chromosomal contacts, such as distribution of intrachromoso-mal contacts over the length of each chromosome and dependence of contact probability on genomic separation between chromosome loci, were calculated and compared to the new exper-imental data obtained by the Hi-C technique. Types and frequencies of simple and complex radiation-induced chromosomal exchange aberrations (CA) induced by X-rays were predicted with taking formation and decay of chromosomal contacts into account. Distance dependence of exchange formation probability was calculated directly. mFISH data for human lymphocytes were analysed. The calculated frequencies of simple CA agreed with the experimental data. Complex CA were underestimated despite the dense packaging of chromosome territories within a nucleus. Possible influence of chromosome-nucleus structural organisation on the frequency and spectrum of radiation-induced chromosome aberrations is discussed.
2013-10-09
have desirable traits. We aim to enlarge the E. coli genome using Lactobacillusplantarum genes to build cells tolerant to EtOH and BT. L. plantarum is...chemicals III. Approach Objective 1 & la: Integrated heterologous (L. plantarum ) DNA into the E. coli chromosome and selected for insertions that...developed in combination with genes identified from screening L. plantarum libraries. Additionally, we have screened heterologous libraries for
A Fine Physical Map of the Rice Chromosome 4
Zhao, Qiang; Zhang, Yu; Cheng, Zhukuan; Chen, Mingsheng; Wang, Shengyue; Feng, Qi; Huang, Yucheng; Li, Ying; Tang, Yesheng; Zhou, Bo; Chen, Zhehua; Yu, Shuliang; Zhu, Jingjie; Hu, Xin; Mu, Jie; Ying, Kai; Hao, Pei; Zhang, Lei; Lu, Yiqi; Zhang, Lei S.; Liu, Yilei; Yu, Zhen; Fan, Danlin; Weng, Qijun; Chen, Ling; Lu, Tingting; Liu, Xiaohui; Jia, Peixin; Sun, Tongguo; Wu, Yongrui; Zhang, Yujun; Lu, Ying; Li, Can; Wang, Rong; Lei, Haiyan; Li, Tao; Hu, Hao; Wu, Mei; Zhang, Runquan; Guan, Jianping; Zhu, Jia; Fu, Gang; Gu, Minghong; Hong, Guofan; Xue, Yongbiao; Wing, Rod; Jiang, Jiming; Han, Bin
2002-01-01
As part of an international effort to completely sequence the rice genome, we have produced a fine bacterial artificial chromosome (BAC)-based physical map of the Oryza sativa japonica Nipponbare chromosome 4 through an integration of 114 sequenced BAC clones from a taxonomically related subspecies O. sativa indica Guangluai 4 and 182 RFLP and 407 expressed sequence tag (EST) markers with the fingerprinted data of the Nipponbare genome. The map consists of 11 contigs with a total length of 34.5 Mb covering 94% of the estimated chromosome size (36.8 Mb). BAC clones corresponding to telomeres, as well as to the centromere position, were determined by BAC-pachytene chromosome fluorescence in situ hybridization (FISH). This gave rise to an estimated length ratio of 5.13 for the long arm and 2.9 for the short arm (on the basis of the physical map), which indicates that the short arm is a highly condensed one. The FISH analysis and physical mapping also showed that the short arm and the pericentromeric region of the long arm are rich in heterochromatin, which occupied 45% of the chromosome, indicating that this chromosome is likely very difficult to sequence. To our knowledge, this map provides the first example of a rapid and reliable physical mapping on the basis of the integration of the data from two taxonomically related subspecies. [The following individuals and institutions kindly provided reagents, samples, or unpublished information as indicated in the paper: S. McCouch, T. Sasaki, and Monsanto.] PMID:11997348
Generic Features of Tertiary Chromatin Structure as Detected in Natural Chromosomes
Müller, Waltraud G.; Rieder, Dietmar; Kreth, Gregor; Cremer, Christoph; Trajanoski, Zlatko; McNally, James G.
2004-01-01
Knowledge of tertiary chromatin structure in mammalian interphase chromosomes is largely derived from artificial tandem arrays. In these model systems, light microscope images reveal fibers or beaded fibers after high-density targeting of transactivators to insertional domains spanning several megabases. These images of fibers have lent support to chromonema fiber models of tertiary structure. To assess the relevance of these studies to natural mammalian chromatin, we identified two different ∼400-kb regions on human chromosomes 6 and 22 and then examined light microscope images of interphase tertiary chromatin structure when the regions were transcriptionally active and inactive. When transcriptionally active, these natural chromosomal regions elongated, yielding images characterized by a series of adjacent puncta or “beads”, referred to hereafter as beaded images. These elongated structures required transcription for their maintenance. Thus, despite marked differences in the density and the mode of transactivation, the natural and artificial systems showed similarities, suggesting that beaded images are generic features of transcriptionally active tertiary chromatin. We show here, however, that these images do not necessarily favor chromonema fiber models but can also be explained by a radial-loop model or even a simple nucleosome affinity, random-chain model. Thus, light microscope images of tertiary structure cannot distinguish among competing models, although they do impose key constraints: chromatin must be clustered to yield beaded images and then packaged within each cluster to enable decondensation into adjacent clusters. PMID:15485905
Prevalence and consequences of chromosomal abnormalities in Canadian commercial swine herds.
Quach, Anh T; Revay, Tamas; Villagomez, Daniel A F; Macedo, Mariana P; Sullivan, Alison; Maignel, Laurence; Wyss, Stefanie; Sullivan, Brian; King, W Allan
2016-09-12
Structural chromosome abnormalities are well known as factors that reduce fertility rate in domestic pigs. According to large-scale national cytogenetic screening programs that are implemented in France, it is estimated that new chromosome abnormalities occur at a rate of 0.5 % in fertility-unproven boars. This work aimed at estimating the prevalence and consequences of chromosome abnormalities in commercial swine operations in Canada. We found pig carriers at a frequency of 1.64 % (12 out of 732 boars). Carrier pigs consistently showed lower fertility values. The total number of piglets born for litters from carrier boars was between 4 and 46 % lower than the herd average. Similarly, carrier boars produced litters with a total number of piglets born alive that was between 6 and 28 % lower than the herd average. A total of 12 new structural chromosome abnormalities were identified. Reproductive performance is significantly reduced in sires with chromosome abnormalities. The incidence of such abnormal sires appears relatively high in populations without routine cytogenetic screening such as observed for Canada in this study. Systematic cytogenetic screening of potential breeding boars would minimise the risk of carriers of chromosome aberrations entering artificial insemination centres. This would avoid the large negative effects on productivity for the commercial sow herds and reduce the risk of transmitting abnormalities to future generations in nucleus farms.
Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene.
Mollereau, C; Simons, M J; Soularue, P; Liners, F; Vassart, G; Meunier, J C; Parmentier, M
1996-08-06
Nociceptin (orphanin FQ), the newly discovered natural agonist of opioid receptor-like (ORL1) receptor, is a neuropeptide that is endowed with pronociceptive activity in vivo. Nociceptin is derived from a larger precursor, prepronociceptin (PPNOC), whose human, mouse, and rat genes we have now isolated. The PPNOC gene is highly conserved in the three species and displays organizational features that are strikingly similar to those of the genes of preproenkephalin, preprodynorphin, and preproopiomelanocortin, the precursors to endogenous opioid peptides, suggesting the four genes belong to the same family-i.e., have a common evolutionary origin. The PPNOC gene encodes a single copy of nociceptin as well as of other peptides whose sequence is strictly conserved across murine and human species; hence it is likely to be neurophysiologically significant. Northern blot analysis shows that the PPNOC gene is predominantly transcribed in the central nervous system (brain and spinal cord) and, albeit weakly, in the ovary, the sole peripheral organ expressing the gene. By using a radiation hybrid cell line panel, the PPNOC gene was mapped to the short arm of human chromosome 8 (8p21), between sequence-tagged site markers WI-5833 and WI-1172, in close proximity of the locus encoding the neurofilament light chain NEFL. Analysis of yeast artificial chromosome clones belonging to the WC8.4 contig covering the 8p21 region did not allow to detect the presence of the gene on these yeast artificial chromosomes, suggesting a gap in the coverage within this contig.
Antonini, Sylvie; Kim, Chong A; Sugayama, Sofia M; Vianna-Morgante, Angela M
2002-11-22
Two chromosome 3 short arm duplications identified through G-banding were further investigated using fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR) of microsatellite markers, aiming at mapping breakpoints and disclosing mechanisms of origin of these chromosome aberrations. Patient 1 was found to be a mosaic: a 3p12 --> 3p21 duplication was observed in most of his cells, and a normal cell line occurred with a frequency of about 3% in blood. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the short-arm duplication. Using FISH of short-arm sequences, the YAC 961_h_3 was shown to contain the proximal breakpoint (3p12.1 or 3p12.2), and the distal breakpoint was located between the YACs 729_c_3 and 806_h_2, which are adjacent in the WC 3.10 contig (3p21.1). In Patient 2, G-banding indicated a 3p21 --> 3p24 duplication, without mosaicism. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the duplication of short-arm sequences. FISH of chromosome 3 sequences showed that the YAC 749_a_7 spanned the proximal breakpoint (3p21.33). The distal breakpoint mapped to the interval between YACs 932_b_6 (3p24.3) and 909_b_6 (3p25). In both cases, microsatellite genotyping pointed to a rearrangement between paternal sister chromatids. Copyright 2002 Wiley-Liss, Inc.
Structure and chromosomal localization of the human PD-1 gene (PDCD1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shinohara, T.; Ishida, Y.; Kawaichi, M.
1994-10-01
A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.
Pan, Hung-Yin; Chen, Carton W; Huang, Chih-Hung
2018-04-17
Soil bacteria Streptomyces are the most important producers of secondary metabolites, including most known antibiotics. These bacteria and their close relatives are unique in possessing linear chromosomes, which typically harbor 20 to 30 biosynthetic gene clusters of tens to hundreds of kb in length. Many Streptomyces chromosomes are accompanied by linear plasmids with sizes ranging from several to several hundred kb. The large linear plasmids also often contain biosynthetic gene clusters. We have developed a targeted recombination procedure for arm exchanges between a linear plasmid and a linear chromosome. A chromosomal segment inserted in an artificially constructed plasmid allows homologous recombination between the two replicons at the homology. Depending on the design, the recombination may result in two recombinant replicons or a single recombinant chromosome with the loss of the recombinant plasmid that lacks a replication origin. The efficiency of such targeted recombination ranges from 9 to 83% depending on the locations of the homology (and thus the size of the chromosomal arm exchanged), essentially eliminating the necessity of selection. The targeted recombination is useful for the efficient engineering of the Streptomyces genome for large-scale deletion, addition, and shuffling.
Lu, Wei; Liu, Jun; Xin, Qiang; Wan, Lili; Hong, Dengfeng; Yang, Guangsheng
2013-01-01
Background and Aims Spontaneous male sterility is an advantageous trait for both constructing efficient pollination control systems and for understanding the developmental process of the male reproductive unit in many crops. A triallelic genetic male-sterile locus (BnMs5) has been identified in Brassica napus; however, its complicated genome structure has greatly hampered the isolation of this locus. The aim of this study was to physically map BnMs5 through an integrated map-based cloning strategy and analyse the local chromosomal evolution around BnMs5. Methods A large F2 population was used to integrate the existing genetic maps around BnMs5. A map-based cloning strategy in combination with comparative mapping among B. napus, Arabidopsis, Brassica rapa and Brassica oleracea was employed to facilitate the identification of a target bacterial artificial chromosome (BAC) clone covering the BnMs5 locus. The genomic sequences from the Brassica species were analysed to reveal the regional chromosomal evolution around BnMs5. Key Results BnMs5 was finally delimited to a 0·3-cM genetic fragment from an integrated local genetic map, and was anchored on the B. napus A8 chromosome. Screening of a B. napus BAC clone library and identification of the positive clones validated that JBnB034L06 was the target BAC clone. The closest flanking markers restrict BnMs5 to a 21-kb region on JBnB034L06 containing six predicted functional genes. Good collinearity relationship around BnMs5 between several Brassica species was observed, while violent chromosomal evolutionary events including insertions/deletions, duplications and single nucleotide mutations were also found to have extensively occurred during their divergence. Conclusions This work represents major progress towards the molecular cloning of BnMs5, as well as presenting a powerful, integrative method to mapping loci in plants with complex genomic architecture, such as the amphidiploid B. napus. PMID:23243189
Characterizing the walnut genome through analyses of BAC end sequences
USDA-ARS?s Scientific Manuscript database
Persian walnut (Juglans regia L.) is an economically important tree for its nut crop and timber. To gain insight into the structure and evolution of the walnut genome, we constructed two bacterial artificial chromosome (BAC) libraries, containing a total of 129,024 clones, from in vitro-grown shoots...
USDA-ARS?s Scientific Manuscript database
A bacterial artificial chromosome (BAC) library and BAC-end sequences for Gossypium hirsutum L. have recently been developed. Here we report on genomic-based genome-wide SNP mining utilizing re-sequencing data with a BAC-end sequence reference for twelve G. hirsutum L. lines, one G. barbadense L. li...
2010-01-01
Background Physical maps employing libraries of bacterial artificial chromosome (BAC) clones are essential for comparative genomics and sequencing of large and repetitive genomes such as those of the hexaploid bread wheat. The diploid ancestor of the D-genome of hexaploid wheat (Triticum aestivum), Aegilops tauschii, is used as a resource for wheat genomics. The barley diploid genome also provides a good model for the Triticeae and T. aestivum since it is only slightly larger than the ancestor wheat D genome. Gene co-linearity between the grasses can be exploited by extrapolating from rice and Brachypodium distachyon to Ae. tauschii or barley, and then to wheat. Results We report the use of Ae. tauschii for the construction of the physical map of a large distal region of chromosome arm 3DS. A physical map of 25.4 Mb was constructed by anchoring BAC clones of Ae. tauschii with 85 EST on the Ae. tauschii and barley genetic maps. The 24 contigs were aligned to the rice and B. distachyon genomic sequences and a high density SNP genetic map of barley. As expected, the mapped region is highly collinear to the orthologous chromosome 1 in rice, chromosome 2 in B. distachyon and chromosome 3H in barley. However, the chromosome scale of the comparative maps presented provides new insights into grass genome organization. The disruptions of the Ae. tauschii-rice and Ae. tauschii-Brachypodium syntenies were identical. We observed chromosomal rearrangements between Ae. tauschii and barley. The comparison of Ae. tauschii physical and genetic maps showed that the recombination rate across the region dropped from 2.19 cM/Mb in the distal region to 0.09 cM/Mb in the proximal region. The size of the gaps between contigs was evaluated by comparing the recombination rate along the map with the local recombination rates calculated on single contigs. Conclusions The physical map reported here is the first physical map using fingerprinting of a complete Triticeae genome. This study
... St Louis, MO: Elsevier; 2017:chap 69. Taber's Medical Dictionary Online. Chromosome. www.tabers.com/tabersonline/view/Tabers-Dictionary/753321/all/chromosome?q=Chromosome&ti=0 . Accessed June 11, 2017.
Nuclear envelope expansion is crucial for proper chromosomal segregation during a closed mitosis.
Takemoto, Ai; Kawashima, Shigehiro A; Li, Juan-Juan; Jeffery, Linda; Yamatsugu, Kenzo; Elemento, Olivier; Nurse, Paul
2016-03-15
Here, we screened a 10,371 library of diverse molecules using a drug-sensitive fission yeast strain to identify compounds which cause defects in chromosome segregation during mitosis. We identified a phosphorium-ylide-based compound Cutin-1 which inhibits nuclear envelope expansion and nuclear elongation during the closed mitosis of fission yeast, and showed that its target is the β-subunit of fatty acid synthase. A point mutation in the dehydratase domain of Fas1 conferred in vivo and in vitro resistance to Cutin-1. Time-lapse photomicrography showed that the bulk of the chromosomes were only transiently separated during mitosis, and nucleoli separation was defective. Subsequently sister chromatids re-associated leading to chromosomal mis-segregation. These segregation defects were reduced when the nuclear volume was increased and were increased when the nuclear volume was reduced. We propose that there needs to be sufficient nuclear volume to allow the nuclear elongation necessary during a closed mitosis to take place for proper chromosome segregation, and that inhibition of fatty acid synthase compromises nuclear elongation and leads to defects in chromosomal segregation. © 2016. Published by The Company of Biologists Ltd.
Kim, Jung-Hyun; Lee, Hee-Sheung; Lee, Nicholas C. O.; Goncharov, Nikolay V.; Kumeiko, Vadim; Masumoto, Hiroshi; Earnshaw, William C.; Kouprina, Natalay; Larionov, Vladimir
2016-01-01
Accumulating data indicates that chromosome instability (CIN) common to cancer cells can be used as a target for cancer therapy. At present the rate of chromosome mis-segregation is quantified by laborious techniques such as coupling clonal cell analysis with karyotyping or fluorescence in situ hybridization (FISH). Recently, a novel assay was developed based on the loss of a non-essential human artificial chromosome (HAC) carrying a constitutively expressed EGFP transgene (“loss of signal” assay). Using this system, anticancer drugs can be easily ranked on by their effect on HAC loss. However, it is problematic to covert this “loss of signal” assay into a high-throughput screen to identify drugs and mutations that increase CIN levels. To address this point, we re-designed the HAC-based assay. In this new system, the HAC carries a constitutively expressed shRNA against the EGFP transgene integrated into human genome. Thus, cells that inherit the HAC display no green fluorescence, while cells lacking the HAC do. We verified the accuracy of this “gain of signal” assay by measuring the level of CIN induced by known antimitotic drugs and added to the list of previously ranked CIN inducing compounds, two newly characterized inhibitors of the centromere-associated protein CENP-E, PF-2771 and GSK923295 that exhibit the highest effect on chromosome instability measured to date. The “gain of signal” assay was also sensitive enough to detect increase of CIN after siRNA depletion of known genes controlling mitotic progression through distinct mechanisms. Hence this assay can be utilized in future experiments to uncover novel human CIN genes, which will provide novel insight into the pathogenesis of cancer. Also described is the possible conversion of this new assay into a high-throughput screen using a fluorescence microplate reader to characterize chemical libraries and identify new conditions that modulate CIN level. PMID:26943579
Upender, Madhvi B.; Habermann, Jens K.; McShane, Lisa M.; Korn, Edward L.; Barrett, J. Carl; Difilippantonio, Michael J.; Ried, Thomas
2016-01-01
Chromosomal aneuploidies are observed in essentially all sporadic carcinomas. These aneuploidies result in tumor-specific patterns of genomic imbalances that are acquired early during tumorigenesis, continuously selected for and faithfully maintained in cancer cells. Although the paradigm of translocation induced oncogene activation in hematologic malignancies is firmly established, it is not known how genomic imbalances affect chromosome-specific gene expression patterns in particular and how chromosomal aneuploidy dysregulates the genetic equilibrium of cells in general. To model specific chromosomal aneuploidies in cancer cells and dissect the immediate consequences of genomic imbalances on the transcriptome, we generated artificial trisomies in a karyotypically stable diploid yet mismatch repair-deficient, colorectal cancer cell line and in telomerase immortalized, cytogenetically normal human breast epithelial cells using microcell-mediated chromosome transfer. The global consequences on gene expression levels were analyzed using cDNA arrays. Our results show that regardless of chromosome or cell type, chromosomal trisomies result in a significant increase in the average transcriptional activity of the trisomic chromosome. This increase affects the expression of numerous genes on other chromosomes as well. We therefore postulate that the genomic imbalances observed in cancer cells exert their effect through a complex pattern of transcriptional dysregulation. PMID:15466185
Systematic cloning of human minisatellites from ordered array charomid libraries.
Armour, J A; Povey, S; Jeremiah, S; Jeffreys, A J
1990-11-01
We present a rapid and efficient method for the isolation of minisatellite loci from human DNA. The method combines cloning a size-selected fraction of human MboI DNA fragments in a charomid vector with hybridization screening of the library in ordered array. Size-selection of large MboI fragments enriches for the longer, more variable minisatellites and reduces the size of the library required. The library was screened with a series of multi-locus probes known to detect a large number of hypervariable loci in human DNA. The gridded library allowed both the rapid processing of positive clones and the comparative evaluation of the different multi-locus probes used, in terms of both the relative success in detecting hypervariable loci and the degree of overlap between the sets of loci detected. We report 23 new human minisatellite loci isolated by this method, which map to 14 autosomes and the sex chromosomes.
2010-01-01
Background The Asteraceae represents an important plant family with respect to the numbers of species present in the wild and used by man. Nonetheless, genomic resources for Asteraceae species are relatively underdeveloped, hampering within species genetic studies as well as comparative genomics studies at the family level. So far, six BAC libraries have been described for the main crops of the family, i.e. lettuce and sunflower. Here we present the characterization of BAC libraries of chicory (Cichorium intybus L.) constructed from two genotypes differing in traits related to sexual and vegetative reproduction. Resolving the molecular mechanisms underlying traits controlling the reproductive system of chicory is a key determinant for hybrid development, and more generally will provide new insights into these traits, which are poorly investigated so far at the molecular level in Asteraceae. Findings Two bacterial artificial chromosome (BAC) libraries, CinS2S2 and CinS1S4, were constructed from HindIII-digested high molecular weight DNA of the contrasting genotypes C15 and C30.01, respectively. C15 was hermaphrodite, non-embryogenic, and S2S2 for the S-locus implicated in self-incompatibility, whereas C30.01 was male sterile, embryogenic, and S1S4. The CinS2S2 and CinS1S4 libraries contain 89,088 and 81,408 clones. Mean insert sizes of the CinS2S2 and CinS1S4 clones are 90 and 120 kb, respectively, and provide together a coverage of 12.3 haploid genome equivalents. Contamination with mitochondrial and chloroplast DNA sequences was evaluated with four mitochondrial and four chloroplast specific probes, and was estimated to be 0.024% and 1.00% for the CinS2S2 library, and 0.028% and 2.35% for the CinS1S4 library. Using two single copy genes putatively implicated in somatic embryogenesis, screening of both libraries resulted in detection of 12 and 13 positive clones for each gene, in accordance with expected numbers. Conclusions This indicated that both BAC libraries
Gonthier, Lucy; Bellec, Arnaud; Blassiau, Christelle; Prat, Elisa; Helmstetter, Nicolas; Rambaud, Caroline; Huss, Brigitte; Hendriks, Theo; Bergès, Hélène; Quillet, Marie-Christine
2010-08-11
The Asteraceae represents an important plant family with respect to the numbers of species present in the wild and used by man. Nonetheless, genomic resources for Asteraceae species are relatively underdeveloped, hampering within species genetic studies as well as comparative genomics studies at the family level. So far, six BAC libraries have been described for the main crops of the family, i.e. lettuce and sunflower. Here we present the characterization of BAC libraries of chicory (Cichorium intybus L.) constructed from two genotypes differing in traits related to sexual and vegetative reproduction. Resolving the molecular mechanisms underlying traits controlling the reproductive system of chicory is a key determinant for hybrid development, and more generally will provide new insights into these traits, which are poorly investigated so far at the molecular level in Asteraceae. Two bacterial artificial chromosome (BAC) libraries, CinS2S2 and CinS1S4, were constructed from HindIII-digested high molecular weight DNA of the contrasting genotypes C15 and C30.01, respectively. C15 was hermaphrodite, non-embryogenic, and S2S2 for the S-locus implicated in self-incompatibility, whereas C30.01 was male sterile, embryogenic, and S1S4. The CinS2S2 and CinS1S4 libraries contain 89,088 and 81,408 clones. Mean insert sizes of the CinS2S2 and CinS1S4 clones are 90 and 120 kb, respectively, and provide together a coverage of 12.3 haploid genome equivalents. Contamination with mitochondrial and chloroplast DNA sequences was evaluated with four mitochondrial and four chloroplast specific probes, and was estimated to be 0.024% and 1.00% for the CinS2S2 library, and 0.028% and 2.35% for the CinS1S4 library. Using two single copy genes putatively implicated in somatic embryogenesis, screening of both libraries resulted in detection of 12 and 13 positive clones for each gene, in accordance with expected numbers. This indicated that both BAC libraries are valuable tools for molecular
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gemmill, R.
1992-12-31
The First International Mapping Workshop on Human Chromosome 12 was held on Sept. 18--20, 1992, at St Catherine`s College, Oxford, UK. The meeting was hosted by Ian Craig and organized by Drs. Craig, Gemmill and Kutcherlapati. It was attended by 50 participants primarily from Europe and the USA. The workshop was highly successful and achieved the major goal of fostering direct and personal interactions between investigators with strong research interests in this chromosome. Participants reviewed the status of several critical aspects of chromosome mapping and prepared consensus views of the current state of knowledge. In addition, lists of resources availablemore » for this chromosome including somatic cell hybrids, individual DNA clones and libraries and genetic markers were prepared.« less
Toward an Integrated BAC Library Resource for Genome Sequencing and Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simon, M. I.; Kim, U.-J.
We developed a great deal of expertise in building large BAC libraries from a variety of DNA sources including humans, mice, corn, microorganisms, worms, and Arabidopsis. We greatly improved the technology for screening these libraries rapidly and for selecting appropriate BACs and mapping BACs to develop large overlapping contigs. We became involved in supplying BACs and BAC contigs to a variety of sequencing and mapping projects and we began to collaborate with Drs. Adams and Venter at TIGR and with Dr. Leroy Hood and his group at University of Washington to provide BACs for end sequencing and for mapping andmore » sequencing of large fragments of chromosome 16. Together with Dr. Ian Dunham and his co-workers at the Sanger Center we completed the mapping and they completed the sequencing of the first human chromosome, chromosome 22. This was published in Nature in 1999 and our BAC contigs made a major contribution to this sequencing effort. Drs. Shizuya and Ding invented an automated highly accurate BAC mapping technique. We also developed long-term collaborations with Dr. Uli Weier at UCSF in the design of BAC probes for characterization of human tumors and specific chromosome deletions and breakpoints. Finally the contribution of our work to the human genome project has been recognized in the publication both by the international consortium and the NIH of a draft sequence of the human genome in Nature last year. Dr. Shizuya was acknowledged in the authorship of that landmark paper. Dr. Simon was also an author on the Venter/Adams Celera project sequencing the human genome that was published in Science last year.« less
Cao, Hieu Xuan; Vu, Giang Thi Ha; Wang, Wenqin; Appenroth, Klaus J; Messing, Joachim; Schubert, Ingo
2016-01-01
Duckweeds are aquatic monocotyledonous plants of potential economic interest with fast vegetative propagation, comprising 37 species with variable genome sizes (0.158-1.88 Gbp). The genomic sequence of Spirodela polyrhiza, the smallest and the most ancient duckweed genome, needs to be aligned to its chromosomes as a reference and prerequisite to study the genome and karyotype evolution of other duckweed species. We selected physically mapped bacterial artificial chromosomes (BACs) containing Spirodela DNA inserts with little or no repetitive elements as probes for multicolor fluorescence in situ hybridization (mcFISH), using an optimized BAC pooling strategy, to validate its physical map and correlate it with its chromosome complement. By consecutive mcFISH analyses, we assigned the originally assembled 32 pseudomolecules (supercontigs) of the genomic sequences to the 20 chromosomes of S. polyrhiza. A Spirodela cytogenetic map containing 96 BAC markers with an average distance of 0.89 Mbp was constructed. Using a cocktail of 41 BACs in three colors, all chromosome pairs could be individualized simultaneously. Seven ancestral blocks emerged from duplicated chromosome segments of 19 Spirodela chromosomes. The chromosomally integrated genome of S. polyrhiza and the established prerequisites for comparative chromosome painting enable future studies on the chromosome homoeology and karyotype evolution of duckweed species. © 2015 IPK Gatersleben. New Phytologist © 2015 New Phytologist Trust.
Plaumann, Peter-Louis; Schmidpeter, Johannes; Dahl, Marlis; Taher, Leila; Koch, Christian
2018-01-01
The hemibiotrophic plant pathogen Colletotrichum higginsianum infects Brassicaceae and in combination with Arabidopsis thaliana, represents an important model system to investigate various ecologically important fungal pathogens and their infection strategies. After penetration of plant cells by appressoria, C. higginsianum establishes large biotrophic primary hyphae in the first infected cell. Shortly thereafter, a switch to necrotrophic growth occurs leading to the invasion of neighboring cells by secondary hyphae. In a forward genetic screen for virulence mutants by insertional mutagenesis, we identified mutants that penetrate the plant but show a defect in the passage from biotrophy to necrotrophy. Genome sequencing and pulsed-field gel electrophoresis revealed that two mutants were lacking chromosome 11, encoding potential pathogenicity genes. We established a chromosome loss assay to verify that strains lacking this small chromosome abort infection during biotrophy, while their ability to grow on artificial media was not affected. C. higginsianum harbors a second small chromosome, which can be lost without effects on virulence or growth on agar plates. Furthermore, we found that chromosome 11 is required to suppress Arabidopsis thaliana plant defense mechanisms dependent on tryptophan derived secondary metabolites. PMID:29867895
Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast
Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru
1998-01-01
In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640
Live-cell imaging of nuclear-chromosomal dynamics in bovine in vitro fertilised embryos.
Yao, Tatsuma; Suzuki, Rie; Furuta, Natsuki; Suzuki, Yuka; Kabe, Kyoko; Tokoro, Mikiko; Sugawara, Atsushi; Yajima, Akira; Nagasawa, Tomohiro; Matoba, Satoko; Yamagata, Kazuo; Sugimura, Satoshi
2018-05-10
Nuclear/chromosomal integrity is an important prerequisite for the assessment of embryo quality in artificial reproductive technology. However, lipid-rich dark cytoplasm in bovine embryos prevents its observation by visible light microscopy. We performed live-cell imaging using confocal laser microscopy that allowed long-term imaging of nuclear/chromosomal dynamics in bovine in vitro fertilised (IVF) embryos. We analysed the relationship between nuclear/chromosomal aberrations and in vitro embryonic development and morphological blastocyst quality. Three-dimensional live-cell imaging of 369 embryos injected with mRNA encoding histone H2B-mCherry and enhanced green fluorescent protein (EGFP)-α-tubulin was performed from single-cell to blastocyst stage for eight days; 17.9% reached the blastocyst stage. Abnormalities in the number of pronuclei (PN), chromosomal segregation, cytokinesis, and blastomere number at first cleavage were observed at frequencies of 48.0%, 30.6%, 8.1%, and 22.2%, respectively, and 13.0%, 6.2%, 3.3%, and 13.4%, respectively, for abnormal embryos developed into blastocysts. A multivariate analysis showed that abnormal chromosome segregation (ACS) and multiple PN correlated with delayed timing and abnormal blastomere number at first cleavage, respectively. In morphologically transferrable blastocysts, 30-40% of embryos underwent ACS and had abnormal PN. Live-cell imaging may be useful for analysing the association between nuclear/chromosomal dynamics and embryonic development in bovine embryos.
Molecular mapping of chromosomes 17 and X. Progress report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barker, D.F.
1989-12-31
The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markersmore » in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.« less
Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.
Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A
1996-11-01
Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and
GBParsy: a GenBank flatfile parser library with high speed.
Lee, Tae-Ho; Kim, Yeon-Ki; Nahm, Baek Hie
2008-07-25
GenBank flatfile (GBF) format is one of the most popular sequence file formats because of its detailed sequence features and ease of readability. To use the data in the file by a computer, a parsing process is required and is performed according to a given grammar for the sequence and the description in a GBF. Currently, several parser libraries for the GBF have been developed. However, with the accumulation of DNA sequence information from eukaryotic chromosomes, parsing a eukaryotic genome sequence with these libraries inevitably takes a long time, due to the large GBF file and its correspondingly large genomic nucleotide sequence and related feature information. Thus, there is significant need to develop a parsing program with high speed and efficient use of system memory. We developed a library, GBParsy, which was C language-based and parses GBF files. The parsing speed was maximized by using content-specified functions in place of regular expressions that are flexible but slow. In addition, we optimized an algorithm related to memory usage so that it also increased parsing performance and efficiency of memory usage. GBParsy is at least 5-100x faster than current parsers in benchmark tests. GBParsy is estimated to extract annotated information from almost 100 Mb of a GenBank flatfile for chromosomal sequence information within a second. Thus, it should be used for a variety of applications such as on-time visualization of a genome at a web site.
Vašut, Radim J; Vijverberg, Kitty; van Dijk, Peter J; de Jong, Hans
2014-11-01
Apomixis in dandelions (Taraxacum: Asteraceae) is encoded by two unlinked dominant loci and a third yet undefined genetic factor: diplosporous omission of meiosis (DIPLOSPOROUS, DIP), parthenogenetic embryo development (PARTHENOGENESIS, PAR), and autonomous endosperm formation, respectively. In this study, we determined the chromosomal position of the DIP locus in Taraxacum by using fluorescent in situ hybridization (FISH) with bacterial artificial chromosomes (BACs) that genetically map within 1.2-0.2 cM of DIP. The BACs showed dispersed fluorescent signals, except for S4-BAC 83 that displayed strong unique signals as well. Under stringent blocking of repeats by C0t-DNA fragments, only a few fluorescent foci restricted to defined chromosome regions remained, including one on the nucleolus organizer region (NOR) chromosomes that contains the 45S rDNAs. FISH with S4-BAC 83 alone and optimal blocking showed discrete foci in the middle of the long arm of one of the NOR chromosomes only in triploid and tetraploid diplosporous dandelions, while signals in sexual diploids were lacking. This agrees with the genetic model of a single dose, dominant DIP allele, absent in sexuals. The length of the DIP region is estimated to cover a region of 1-10 Mb. FISH in various accessions of Taraxacum and the apomictic sister species Chondrilla juncea, confirmed the chromosomal position of DIP within Taraxacum but not outside the genus. Our results endorse that, compared to other model apomictic species, expressing either diplospory or apospory, the genome of Taraxacum shows a more similar and less diverged chromosome structure at the DIP locus. The different levels of allele sequence divergence at apomeiosis loci may reflect different terms of asexual reproduction. The association of apomeiosis loci with repetitiveness, dispersed repeats, and retrotransposons commonly observed in apomictic species may imply a functional role of these shared features in apomictic reproduction, as is
Coincidence of synteny breakpoints with malignancy-related deletions on human chromosome 3
Kost-Alimova, Maria; Kiss, Hajnalka; Fedorova, Ludmila; Yang, Ying; Dumanski, Jan P.; Klein, George; Imreh, Stefan
2003-01-01
We have found previously that during tumor growth intact human chromosome 3 transferred into tumor cells regularly looses certain 3p regions, among them the ≈1.4-Mb common eliminated region 1 (CER1) at 3p21.3. Fluorescence in situ hybridization analysis of 12 mouse orthologous loci revealed that CER1 splits into two segments in mouse and therefore contains a murine/human conservation breakpoint region (CBR). Several breaks occurred in tumors within the region surrounding the CBR, and this sequence has features that characterize unstable chromosomal regions: deletions in yeast artificial chromosome clones, late replication, gene and segment duplications, and pseudogene insertions. Sequence analysis of the entire 3p12-22 revealed that other cancer-associated deletions (regions eliminated from monochromosomal hybrids carrying an intact chromosome 3 during tumor growth and homozygous deletions found in human tumors) colocalized nonrandomly with murine/human CBRs and were characterized by an increased number of local gene duplications and murine/human conservation mismatches (single genes that do not match into the conserved chromosomal segment). The CBR within CER1 contains a simple tandem TATAGA repeat capable of forming a 40-bp-long secondary hairpin-like structure. This repeat is nonrandomly localized within the other tumor-associated deletions and in the vicinity of 3p12-22 CBRs. PMID:12738884
ERIC Educational Resources Information Center
Kåhre, Peter
2013-01-01
Introduction: This paper concerns the ontological position of library and informations science in the networked society. The aim of the study is to understand library use and library functions in the age of Internet and artificial intelligent programmed search engines. Theoretical approach: The approach discusses so called sociocognitive tools in…
2013-01-01
Background Most eukaryotic species represent stable karyotypes with a particular diploid number. B chromosomes are additional to standard karyotypes and may vary in size, number and morphology even between cells of the same individual. For many years it was generally believed that B chromosomes found in some plant, animal and fungi species lacked active genes. Recently, molecular cytogenetic studies showed the presence of additional copies of protein-coding genes on B chromosomes. However, the transcriptional activity of these genes remained elusive. We studied karyotypes of the Siberian roe deer (Capreolus pygargus) that possess up to 14 B chromosomes to investigate the presence and expression of genes on supernumerary chromosomes. Results Here, we describe a 2 Mbp region homologous to cattle chromosome 3 and containing TNNI3K (partial), FPGT, LRRIQ3 and a large gene-sparse segment on B chromosomes of the Siberian roe deer. The presence of the copy of the autosomal region was demonstrated by B-specific cDNA analysis, PCR assisted mapping, cattle bacterial artificial chromosome (BAC) clone localization and quantitative polymerase chain reaction (qPCR). By comparative analysis of B-specific and non-B chromosomal sequences we discovered some B chromosome-specific mutations in protein-coding genes, which further enabled the detection of a FPGT-TNNI3K transcript expressed from duplicated genes located on B chromosomes in roe deer fibroblasts. Conclusions Discovery of a large autosomal segment in all B chromosomes of the Siberian roe deer further corroborates the view of an autosomal origin for these elements. Detection of a B-derived transcript in fibroblasts implies that the protein coding sequences located on Bs are not fully inactivated. The origin, evolution and effect on host of B chromosomal genes seem to be similar to autosomal segmental duplications, which reinforces the view that supernumerary chromosomal elements might play an important role in genome
Characterization of chromosomal architecture in Arabidopsis by chromosome conformation capture
2013-01-01
Background The packaging of long chromatin fibers in the nucleus poses a major challenge, as it must fulfill both physical and functional requirements. Until recently, insights into the chromosomal architecture of plants were mainly provided by cytogenetic studies. Complementary to these analyses, chromosome conformation capture technologies promise to refine and improve our view on chromosomal architecture and to provide a more generalized description of nuclear organization. Results Employing circular chromosome conformation capture, this study describes chromosomal architecture in Arabidopsis nuclei from a genome-wide perspective. Surprisingly, the linear organization of chromosomes is reflected in the genome-wide interactome. In addition, we study the interplay of the interactome and epigenetic marks and report that the heterochromatic knob on the short arm of chromosome 4 maintains a pericentromere-like interaction profile and interactome despite its euchromatic surrounding. Conclusion Despite the extreme condensation that is necessary to pack the chromosomes into the nucleus, the Arabidopsis genome appears to be packed in a predictive manner, according to the following criteria: heterochromatin and euchromatin represent two distinct interactomes; interactions between chromosomes correlate with the linear position on the chromosome arm; and distal chromosome regions have a higher potential to interact with other chromosomes. PMID:24267747
Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M
2001-04-01
Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi
2010-06-20
Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZ{alpha}-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cellsmore » as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.« less
Detecting Unknown Artificial Urban Surface Materials Based on Spectral Dissimilarity Analysis.
Jilge, Marianne; Heiden, Uta; Habermeyer, Martin; Mende, André; Juergens, Carsten
2017-08-08
High resolution imaging spectroscopy data have been recognised as a valuable data resource for augmenting detailed material inventories that serve as input for various urban applications. Image-specific urban spectral libraries are successfully used in urban imaging spectroscopy studies. However, the regional- and sensor-specific transferability of such libraries is limited due to the wide range of different surface materials. With the developed methodology, incomplete urban spectral libraries can be utilised by assuming that unknown surface material spectra are dissimilar to the known spectra in a basic spectral library (BSL). The similarity measure SID-SCA (Spectral Information Divergence-Spectral Correlation Angle) is applied to detect image-specific unknown urban surfaces while avoiding spectral mixtures. These detected unknown materials are categorised into distinct and identifiable material classes based on their spectral and spatial metrics. Experimental results demonstrate a successful redetection of material classes that had been previously erased in order to simulate an incomplete BSL. Additionally, completely new materials e.g., solar panels were identified in the data. It is further shown that the level of incompleteness of the BSL and the defined dissimilarity threshold are decisive for the detection of unknown material classes and the degree of spectral intra-class variability. A detailed accuracy assessment of the pre-classification results, aiming to separate natural and artificial materials, demonstrates spectral confusions between spectrally similar materials utilizing SID-SCA. However, most spectral confusions occur between natural or artificial materials which are not affecting the overall aim. The dissimilarity analysis overcomes the limitations of working with incomplete urban spectral libraries and enables the generation of image-specific training databases.
Detecting Unknown Artificial Urban Surface Materials Based on Spectral Dissimilarity Analysis
Jilge, Marianne; Heiden, Uta; Habermeyer, Martin; Mende, André; Juergens, Carsten
2017-01-01
High resolution imaging spectroscopy data have been recognised as a valuable data resource for augmenting detailed material inventories that serve as input for various urban applications. Image-specific urban spectral libraries are successfully used in urban imaging spectroscopy studies. However, the regional- and sensor-specific transferability of such libraries is limited due to the wide range of different surface materials. With the developed methodology, incomplete urban spectral libraries can be utilised by assuming that unknown surface material spectra are dissimilar to the known spectra in a basic spectral library (BSL). The similarity measure SID-SCA (Spectral Information Divergence-Spectral Correlation Angle) is applied to detect image-specific unknown urban surfaces while avoiding spectral mixtures. These detected unknown materials are categorised into distinct and identifiable material classes based on their spectral and spatial metrics. Experimental results demonstrate a successful redetection of material classes that had been previously erased in order to simulate an incomplete BSL. Additionally, completely new materials e.g., solar panels were identified in the data. It is further shown that the level of incompleteness of the BSL and the defined dissimilarity threshold are decisive for the detection of unknown material classes and the degree of spectral intra-class variability. A detailed accuracy assessment of the pre-classification results, aiming to separate natural and artificial materials, demonstrates spectral confusions between spectrally similar materials utilizing SID-SCA. However, most spectral confusions occur between natural or artificial materials which are not affecting the overall aim. The dissimilarity analysis overcomes the limitations of working with incomplete urban spectral libraries and enables the generation of image-specific training databases. PMID:28786947
Gametocidal chromosomes enhancing chromosome aberration in common wheat induced by 5-azacytidine.
Su, W-Y; Cong, W-W; Shu, Y-J; Wang, D; Xu, G-H; Guo, C-H
2013-07-08
The gametocidal (Gc) chromosome from Aegilops spp induces chromosome mutation, which is introduced into common wheat as a tool of chromosome manipulation for genetic improvement. The Gc chromosome functions similar to a restriction-modification system in bacteria, in which DNA methylation is an important regulator. We treated root tips of wheat carrying Gc chromosomes with the hypomethylation agent 5-azacytidine; chromosome breakage and micronuclei were observed in these root tips. The frequency of aberrations differed in wheat containing different Gc chromosomes, suggesting different functions inducing chromosome breakage. Gc chromosome 3C caused the greatest degree of chromosome aberration, while Gc chromosome 3C(SAT) and 2C caused only slight chromosome aberration. Gc chromosome 3C induced different degrees of chromosome aberration in wheat varieties Triticum aestivum var. Chinese Spring and Norin 26, demonstrating an inhibition function in common wheat.
2013-01-01
Background Cotton, one of the world’s leading crops, is important to the world’s textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. Results We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome
Yatsenko, Svetlana A.; Shaw, Chad A.; Ou, Zhishuo; Pursley, Amber N.; Patel, Ankita; Bi, Weimin; Cheung, Sau Wai; Lupski, James R.; Chinault, A. Craig; Beaudet, Arthur L.
2009-01-01
In array-comparative genomic hybridization (array-CGH) experiments, the measurement of DNA copy number of sex chromosomal regions depends on the sex of the patient and the reference DNAs used. We evaluated the ability of bacterial artificial chromosomes/P1-derived artificial and oligonucleotide array-CGH analyses to detect constitutional sex chromosome imbalances using sex-mismatched reference DNAs. Twenty-two samples with imbalances involving either the X or Y chromosome, including deletions, duplications, triplications, derivative or isodicentric chromosomes, and aneuploidy, were analyzed. Although concordant results were obtained for approximately one-half of the samples when using sex-mismatched and sex-matched reference DNAs, array-CGH analyses with sex-mismatched reference DNAs did not detect genomic imbalances that were detected using sex-matched reference DNAs in 6 of 22 patients. Small duplications and deletions of the X chromosome were most difficult to detect in female and male patients, respectively, when sex-mismatched reference DNAs were used. Sex-matched reference DNAs in array-CGH analyses provides optimal sensitivity and enables an automated statistical evaluation for the detection of sex chromosome imbalances when compared with an experimental design using sex-mismatched reference DNAs. Using sex-mismatched reference DNAs in array-CGH analyses may generate false-negative, false-positive, and ambiguous results for sex chromosome-specific probes, thus masking potential pathogenic genomic imbalances. Therefore, to optimize both detection of clinically relevant sex chromosome imbalances and ensure proper experimental performance, we suggest that alternative internal controls be developed and used instead of using sex-mismatched reference DNAs. PMID:19324990
Prader-Willi-like phenotypes: a systematic review of their chromosomal abnormalities.
Rocha, C F; Paiva, C L A
2014-03-31
Prader-Willi syndrome (PWS) is caused by the lack of expression of genes located on paternal chromosome 15q11-q13. This lack of gene expression may be due to a deletion in this chromosomal segment, to maternal uniparental disomy of chromosome 15, or to a defect in the imprinting center on 15q11-q13. PWS is characterized by hypotonia during the neonatal stage and in childhood, accompanied by a delay in neuropsychomotor development. Overeating, obesity, and mental deficiency arise later on. The syndrome has a clinical overlap with other diseases, which makes it difficult to accurately diagnose. The purpose of this article is to review the Prader-Willi-like phenotype in the scientific literature from 2000 to 2013, i.e., to review the cases of PWS caused by chromosomal abnormalities different from those found on chromosome 15. A search was carried out using the "National Center for Biotechnology Information" (www.pubmed.com) and "Scientific Electronic Library Online (www.scielo.br) databases and combinations of key words such as "Prader-Willi-like phenotype" and "Prader-Willi syndrome phenotype". Editorials, letters, reviews, and guidelines were excluded. Articles chosen contained descriptions of patients diagnosed with the PWS phenotype but who were negative for alterations on 15q11-q13. Our search found 643 articles about PWS, but only 14 of these matched with the Prader-Willi-like phenotype and with the selected years of publication (2000-2013). If two or more articles reported the same chromosomal alterations for Prader-Willi-like phenotype, the most recent was chosen. Twelve articles of 14 were case reports and 2 reported series of cases.
Isogenic transgenic homozygous fish induced by artificial parthenogenesis.
Nam, Y K; Cho, Y S; Kim, D S
2000-12-01
As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.
2013-01-01
Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that
1979-01-01
The degree of mechanical coupling of chromosomes to the spindles of Nephrotoma and Trimeratropis primary spermatocytes varies with the stage of meiosis and the birefringent retardation of the chromosomal fibers. In early prometaphase, before birefringent chromosomal fibers have formed, a bivalent can be displaced toward a spindle pole by a single, continuous pull with a microneedle. Resistance to poleward displacement increases with increased development of the chromosomal fibers, reaching a maximum at metaphase. At this stage kinetochores cannot be displaced greater than 1 micrometer toward either spindle pole, even by a force which is sufficient to displace the entire spindle within the cell. The abolition of birefringence with either colcemid or vinblastine results in the loss of chromosome-spindle attachment. In the absence of birefringent fibers a chromosome can be displaced anywhere within the cell. The photochemical inactivation of colcemid by irradiation with 366-nm light results in the reformation of birefringent chromosomal fibers and the concomitant re-establishment of chromosome attachment to the spindle. These results support the hypothesis that the birefringent chromosomal fibers anchor the chromosomes to the spindle and transmit the force for anaphase chromosome movement. PMID:479316
... chromosome has attached to another at the centromere. Inversions: A portion of the chromosome has broken off, ... individual and was not inherited from the parents. Inversion: A portion of the chromosome has broken off, ...
Kuefer, M U; Look, A T; Williams, D C; Valentine, V; Naeve, C W; Behm, F G; Mullersman, J E; Yoneda-Kato, N; Montgomery, K; Kucherlapati, R; Morris, S W
1996-07-15
A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, the MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal region frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements.
The gametocidal chromosome as a tool for chromosome manipulation in wheat.
Endo, T R
2007-01-01
Many alien chromosomes have been introduced into common wheat (the genus Triticum) from related wild species (the genus Aegilops). Some alien chromosomes have unique genes that secure their existence in the host by causing chromosome breakage in the gametes lacking them. Such chromosomes or genes, called gametocidal (Gc) chromosomes or Gc genes, are derived from different genomes (C, S, S(l) and M(g)) and belong to three different homoeologous groups 2, 3 and 4. The Gc genes of the C and M(g) genomes induce mild, or semi-lethal, chromosome mutations in euploid and alien addition lines of common wheat. Thus, induced chromosomal rearrangements have been identified and established in wheat stocks carrying deletions of wheat and alien (rye and barley) chromosomes or wheat-alien translocations. The gametocidal chromosomes isolated in wheat to date are reviewed here, focusing on their feature as a tool for chromosome manipulation.
A limited number of Y chromosome lineages is present in North American Holsteins.
Yue, Xiang-Peng; Dechow, Chad; Liu, Wan-Sheng
2015-04-01
Holsteins are the most numerous dairy cattle breed in North America and the breed has undergone intensive selection for improving milk production and conformation. Theoretically, this intensive selection could lead to a reduction of the effective population size and reduced genetic diversity. The objective of this study was to investigate the effective population size of the Holstein Y chromosome and the effects of limited Y chromosome lineages on male reproduction and the future of the breed. Paternal pedigree information of 62,897 Holstein bulls born between 1950 and 2013 in North America and 220,872 bulls evaluated by multiple-trait across-country genetic evaluations of Interbull (Uppsala, Sweden) were collected and analyzed. The results indicated that the number of Y chromosome lineages in Holsteins has undergone a dramatic decrease during the past 50 years because of artificial selection and the application of artificial insemination (AI) technology. All current Holstein AI bulls in North America are the descendants of only 2 ancestors (Hulleman and Neptune H) born in 1880. These 2 ancestral Y-lineages are continued through 3 dominant pedigrees from the 1960s; namely, Pawnee Farm Arlinda Chief, Round Oak Rag Apple Elevation, and Penstate Ivanhoe Star, with a contribution of 48.78, 51.06, and 0.16% to the Holstein bull population in the 2010s, respectively. The Y-lineage of Penstate Ivanhoe Star is almost eliminated from the breed. The genetic variations in the 2 ancestral Y-lineages were evaluated among 257 bulls by determining the copy number variations (CNV) of 3 Y-linked gene families: PRAMEY, HSFY, and ZNF280BY, which are spread along the majority (95%) of the bovine Y chromosome male-specific region (MSY). No significant difference was found between the 2 ancestral Y-lineages, although large CNV were observed within each lineage. This study suggests minimal genetic diversity on the Y chromosome in Holsteins and provides a starting point for investigating
A comparative study of retrotransposons in the centromeric regions of A and B chromosomes of maize.
Theuri, J; Phelps-Durr, T; Mathews, S; Birchler, J
2005-01-01
Bacterial Artificial Chromosomes (BACs) derived from the B chromosome, based on homology with the B specific sequence, were subcloned and sequenced. Analysis of DNA sequence data indicated the presence of 23 common retroelements, as well as novel sequences of B chromosome origin. Generally, where the same retrotransposon type was observed in both A and B chromosomes, there were more copies per unit of sequence in the B centromeric region (the major site of B repeat) than in the A centromere, except for Huck-1. Based on previous estimates of the age of the major burst of transposition into the maize genome, the oldest retrotransposons (Ji-6 and Tekay, approximately 5.0 and 5.2 million years ago, respectively) were found in the B centromere region only, while the next two oldest (Huck-1 and Opie-1) were found in both the A and B sequences. Phylogenetic analysis of Opie retroelements from both A and B centromeres indicated that some of the B Opie centromeric sequences share a more recent common ancestor with A Opie retroelements than they do with other B Opie centromeric sequences. These results imply that the supernumerary maize B chromosome has coexisted with the A chromosomes during that period of transposition. They also support the hypothesis that the B chromosome had its origins from A chromosome elements, or that alternative origins, such as being donated to the maize genome in a wide species cross, preceded six million years ago, because the spectrum of retrotransposons in the two chromosomes is quite similar.
2011-01-01
Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
ERIC Educational Resources Information Center
Borko, Harold
1985-01-01
Defines artificial intelligence (AI) and expert systems; describes library applications utilizing AI to automate creation of document representations, request formulations, and design and modify search strategies for information retrieval systems; discusses expert system development for information services; and reviews impact of these…
Plant chromosomes from end to end: telomeres, heterochromatin and centromeres.
Lamb, Jonathan C; Yu, Weichang; Han, Fangpu; Birchler, James A
2007-04-01
Recent evidence indicates that heterochromatin in plants is composed of heterogeneous sequences, which are usually composed of transposable elements or tandem repeat arrays. These arrays are associated with chromatin modifications that produce a closed configuration that limits transcription. Centromere sequences in plants are usually composed of tandem repeat arrays that are homogenized across the genome. Analysis of such arrays in closely related taxa suggests a rapid turnover of the repeat unit that is typical of a particular species. In addition, two lines of evidence for an epigenetic component of centromere specification have been reported, namely an example of a neocentromere formed over sequences without the typical repeat array and examples of centromere inactivation. Although the telomere repeat unit is quite prevalent in the plant kingdom, unusual repeats have been found in some families. Recently, it was demonstrated that the introduction of telomere sequences into plants cells causes truncation of the chromosomes, and that this technique can be used to produce artificial chromosome platforms.
Mills, W; Critcher, R; Lee, C; Farr, C J
1999-05-01
A linear mammalian artificial chromosome (MAC) will require at least three types of functional element: a centromere, two telomeres and origins of replication. As yet, our understanding of these elements, as well as many other aspects of structure and organization which may be critical for a fully functional mammalian chromosome, remains poor. As a way of defining these various requirements, minichromosome reagents are being developed and analysed. Approaches for minichromosome generation fall into two broad categories: de novo assembly from candidate DNA sequences, or the fragmentation of an existing chromosome to reduce it to a minimal size. Here we describe the generation of a human minichromosome using the latter, top-down, approach. A human X chromosome, present in a DT40-human microcell hybrid, has been manipulated using homologous recombination and the targeted seeding of a de novo telomere. This strategy has generated a linear approximately 2.4 Mb human X centromere-based minichromosome capped by two artificially seeded telomeres: one immediately flanking the centromeric alpha-satellite DNA and the other targeted to the zinc finger gene ZXDA in Xp11.21. The chromosome retains an alpha-satellite domain of approximately 1. 8 Mb, a small array of gamma-satellite repeat ( approximately 40 kb) and approximately 400 kb of Xp proximal DNA sequence. The mitotic stability of this minichromosome has been examined, both in DT40 and following transfer into hamster and human cell lines. In all three backgrounds, the minichromosome is retained efficiently, but in the human and hamster microcell hybrids its copy number is poorly regulated. This approach of engineering well-defined chromosome reagents will allow key questions in MAC development (such as whether a lower size limit exists) to be addressed. In addition, the 2.4 Mb minichromosome described here has potential to be developed as a vector for gene delivery.
USDA-ARS?s Scientific Manuscript database
Positional cloning in bread wheat is a tedious task due to its huge genome size (~17 Gbp) and polyploid character. BAC libraries represent an essential tool for positional cloning. However, wheat BAC libraries comprise more than million clones, which make their screening very laborious. Here we pres...
A new chromosome was born: comparative chromosome painting in Boechera.
Koch, Marcus A
2015-09-01
Comparative chromosome painting is a powerful tool to study the evolution of chromosomes and genomes. Analyzing karyotype evolution in cruciferous plants highlights the origin of aberrant chromosomes in apomictic Boechera and further establishes the cruciferous plants as important model system for our understanding of plant chromosome and genome evolution. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ruttanajit, Tida; Chanchamroen, Sujin; Cram, David S; Sawakwongpra, Kritchakorn; Suksalak, Wanwisa; Leng, Xue; Fan, Junmei; Wang, Li; Yao, Yuanqing; Quangkananurug, Wiwat
2016-02-01
Currently, our understanding of the nature and reproductive potential of blastocysts associated with trophectoderm (TE) lineage chromosomal mosaicism is limited. The objective of this study was to first validate copy number variation sequencing (CNV-Seq) for measuring the level of mosaicism and second, examine the nature and level of mosaicism in TE biopsies of patient's blastocysts. TE biopy samples were analysed by array comparative genomic hybridization (CGH) and CNV-Seq to discriminate between euploid, aneuploid and mosaic blastocysts. Using artificial models of TE mosaicism for five different chromosomes, CNV-Seq accurately and reproducibly quantitated mosaicism at levels of 50% and 20%. In a comparative 24-chromosome study of 49 blastocysts by array CGH and CNV-Seq, 43 blastocysts (87.8%) had a concordant diagnosis and 6 blastocysts (12.2%) were discordant. The discordance was attributed to low to medium levels of chromosomal mosaicism (30-70%) not detected by array CGH. In an expanded study of 399 blastocysts using CNV-Seq as the sole diagnostic method, the proportion of diploid-aneuploid mosaics (34, 8.5%) was significantly higher than aneuploid mosaics (18, 4.5%) (p < 0.02). Mosaicism is a significant chromosomal abnormality associated with the TE lineage of human blastocysts that can be reliably and accurately detected by CNV-Seq. © 2015 John Wiley & Sons, Ltd.
Nakano, Shogo; Motoyama, Tomoharu; Miyashita, Yurina; Ishizuka, Yuki; Matsuo, Naoya; Tokiwa, Hiroaki; Shinoda, Suguru; Asano, Yasuhisa; Ito, Sohei
2018-05-22
The expansion of protein sequence databases has enabled us to design artificial proteins by sequence-based design methods, such as full consensus design (FCD) and ancestral sequence reconstruction (ASR). Artificial proteins with enhanced activity levels compared with native ones can potentially be generated by such methods, but successful design is rare because preparing a sequence library by curating the database and selecting a method is difficult. Utilizing a curated library prepared by reducing conservation energies, we successfully designed two artificial L-threonine 3-dehydrogenase (SDR-TDH) with higher activity levels than native SDR-TDH, FcTDH-N1 and AncTDH, using FCD and ASR, respectively. The artificial SDR-TDHs had excellent thermal stability and NAD+ recognition compared to native SDR-TDH from Cupriavidus necator (CnTDH): the melting temperatures of FcTDH-N1 and AncTDH were about 10 and 5°C higher than CnTDH, respectively, and the dissociation constants toward NAD+ of FcTDH-N1 and AncTDH were two- and seven-fold lower than that of CnTDH, respectively. Enzymatic efficiency of the artificial SDR-TDHs were comparable to that of CnTDH. Crystal structures of FcTDH-N1 and AncTDH were determined at 2.8 and 2.1 Å resolution, respectively. Structural and MD simulation analysis of the SDR-TDHs indicated that only the flexibility at specific regions was changed, suggesting that multiple mutations introduced in the artificial SDR-TDHs altered their flexibility and thereby affected their enzymatic properties. Benchmark analysis of the SDR-TDHs indicated that both FCD and ASR can generate highly functional proteins if a curated library is prepared appropriately.
Y-chromosome evolution: emerging insights into processes of Y-chromosome degeneration.
Bachtrog, Doris
2013-02-01
The human Y chromosome is intriguing not only because it harbours the master-switch gene that determines gender but also because of its unusual evolutionary history. The Y chromosome evolved from an autosome, and its evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species and in plants have shed light on the current gene content of the Y chromosome, its origins and its long-term fate. Furthermore, comparative analysis of young and old Y chromosomes has given further insights into the evolutionary and molecular forces triggering Y-chromosome degeneration and into the evolutionary destiny of the Y chromosome.
Artificial specific binders directly recovered from chemically modified nucleic acid libraries.
Kasahara, Yuuya; Kuwahara, Masayasu
2012-01-01
Specific binders comprised of nucleic acids, that is, RNA/DNA aptamers, are attractive functional biopolymers owing to their potential broad application in medicine, food hygiene, environmental analysis, and biological research. Despite the large number of reports on selection of natural DNA/RNA aptamers, there are not many examples of direct screening of chemically modified nucleic acid aptamers. This is because of (i) the inferior efficiency and accuracy of polymerase reactions involving transcription/reverse-transcription of modified nucleotides compared with those of natural nucleotides, (ii) technical difficulties and additional time and effort required when using modified nucleic acid libraries, and (iii) ambiguous efficacies of chemical modifications in binding properties until recently; in contrast, the effects of chemical modifications on biostability are well studied using various nucleotide analogs. Although reports on the direct screening of a modified nucleic acid library remain in the minority, chemical modifications would be essential when further functional expansion of nucleic acid aptamers, in particular for medical and biological uses, is considered. This paper focuses on enzymatic production of chemically modified nucleic acids and their application to random screenings. In addition, recent advances and possible future research are also described.
Szinay, Dóra; Chang, Song-Bin; Khrustaleva, Ludmila; Peters, Sander; Schijlen, Elio; Bai, Yuling; Stiekema, Willem J; van Ham, Roeland C H J; de Jong, Hans; Klein Lankhorst, René M
2008-11-01
Within the framework of the International Solanaceae Genome Project, the genome of tomato (Solanum lycopersicum) is currently being sequenced. We follow a 'BAC-by-BAC' approach that aims to deliver high-quality sequences of the euchromatin part of the tomato genome. BACs are selected from various libraries of the tomato genome on the basis of markers from the F2.2000 linkage map. Prior to sequencing, we validated the precise physical location of the selected BACs on the chromosomes by five-colour high-resolution fluorescent in situ hybridization (FISH) mapping. This paper describes the strategies and results of cytogenetic mapping for chromosome 6 using 75 seed BACs for FISH on pachytene complements. The cytogenetic map obtained showed discrepancies between the actual chromosomal positions of these BACs and their markers on the linkage group. These discrepancies were most notable in the pericentromere heterochromatin, thus confirming previously described suppression of cross-over recombination in that region. In a so called pooled-BAC FISH, we hybridized all seed BACs simultaneously and found a few large gaps in the euchromatin parts of the long arm that are still devoid of seed BACs and are too large for coverage by expanding BAC contigs. Combining FISH with pooled BACs and newly recruited seed BACs will thus aid in efficient targeting of novel seed BACs into these areas. Finally, we established the occurrence of repetitive DNA in heterochromatin/euchromatin borders by combining BAC FISH with hybridization of a labelled repetitive DNA fraction (Cot-100). This strategy provides an excellent means to establish the borders between euchromatin and heterochromatin in this chromosome.
Undetected sex chromosome aneuploidy by chromosomal microarray.
Markus-Bustani, Keren; Yaron, Yuval; Goldstein, Myriam; Orr-Urtreger, Avi; Ben-Shachar, Shay
2012-11-01
We report on a case of a female fetus found to be mosaic for Turner syndrome (45,X) and trisomy X (47,XXX). Chromosomal microarray analysis (CMA) failed to detect the aneuploidy because of a normal average dosage of the X chromosome. This case represents an unusual instance in which CMA may not detect chromosomal aberrations. Such a possibility should be taken into consideration in similar cases where CMA is used in a clinical setting. © 2012 John Wiley & Sons, Ltd.
Molecular mapping of the Edwards syndrome phenotype to two noncontiguous regions on chromosome 18
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boghosian-Sell, L.; Mewar, R.; Harrison, W.
1994-09-01
In an effort to identify regions on chromosome 18 that may be critical in the appearance of the Edwards syndrome phenotype, the authors have analyzed six patients with partial duplication of chromosome 18. Four of the patients have duplications involving the distal half of 18q (18q21.1-qter) and are very mildly affected. The remaining two patients have most of 18q (18q12.1-qter) duplicated, are severely affected, and have been diagnosed with Edwards syndrome. The authors have employed FISH, using DNA probes from a chromosome 18-specific library, for the precise determination of the duplicated material in each of these patients. The clinical featuresmore » and the extent of the chromosomal duplication in these patients were compared with four previously reported partial trisomy 18 patients, to identify regions of chromosome 18 that may be responsible for certain clinical features of trisomy 18. The comparative analysis confirmed that there is no single region on 18q that is sufficient to produce the trisomy 18 phenotype and identified two regions on 18q that may work in conjunction to produce the Edwards syndrome phenotype. In addition, correlative analysis indicates that duplication of 18q12.3-q22.1 may be associated with more severe mental retardation in trisomy 18 individuals. 25 refs., 3 figs., 1 tab.« less
Chromosomes, conflict, and epigenetics: chromosomal speciation revisited.
Brown, Judith D; O'Neill, Rachel J
2010-01-01
Since Darwin first noted that the process of speciation was indeed the "mystery of mysteries," scientists have tried to develop testable models for the development of reproductive incompatibilities-the first step in the formation of a new species. Early theorists proposed that chromosome rearrangements were implicated in the process of reproductive isolation; however, the chromosomal speciation model has recently been questioned. In addition, recent data from hybrid model systems indicates that simple epistatic interactions, the Dobzhansky-Muller incompatibilities, are more complex. In fact, incompatibilities are quite broad, including interactions among heterochromatin, small RNAs, and distinct, epigenetically defined genomic regions such as the centromere. In this review, we will examine both classical and current models of chromosomal speciation and describe the "evolving" theory of genetic conflict, epigenetics, and chromosomal speciation.
Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko
2014-01-01
Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219
Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko
2014-01-01
Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuefer, M.U.; Valentine, V.; Behm, F.G.
A fusion gene between nucleophosmin (NPM) and myelodysplasia/myeloid leukemia factor 1 (MLF1) and myelodysplasia/myeloid leukemia factor 1 (MLF1) is formed by a recurrent t(3;5)(q25.1;q34) in myelodysplastic syndrome and acute myeloid leukemia. Here we report the identification of a novel gene, MLF2, which contains an open reading frame of 744 bp encoding a 248-amino-acid protein highly related to the previously identified MLF1 protein (63% similarity, 40% identity). In contrast to the tissue-restricted expression pattern of MLF1, and MLF2 messenger RNA is expressed ubiquitously. The MLF2 gene locus was mapped by fluorescence in situ hybridization to human chromosome 12p13, a chromosomal regionmore » frequently involved in translocations and deletions in acute leukemias of lymphoid or myeloid lineage. In a physical map of chromosome 12, MLF2 was found to reside on the yeast artificial chromosome clone 765b9. Southern blotting analysis of malignant cell DNAs prepared from a series of acute lymphoblastic leukemia cases with translocations involving chromosome arm 12p, as well as a group of acute myeloid leukemias with various cytogenetic abnormalities, failed to reveal MLF2 gene rearrangements. 19 refs., 2 figs.« less
Schmeisser, Falko; Weir, Jerry P
2007-01-01
Background Targeted mutagenesis of the herpesvirus genomes has been facilitated by the use of bacterial artificial chromosome (BAC) technology. Such modified genomes have potential uses in understanding viral pathogenesis, gene identification and characterization, and the development of new viral vectors and vaccines. We have previously described the construction of a herpes simplex virus 2 (HSV-2) BAC and the use of an allele replacement strategy to construct HSV-2 recombinants. While the BAC mutagenesis procedure is a powerful method to generate HSV-2 recombinants, particularly in the absence of selective marker in eukaryotic culture, the mutagenesis procedure is still difficult and cumbersome. Results Here we describe the incorporation of a phage lambda recombination system into an allele replacement vector. This strategy enables any DNA fragment containing the phage attL recombination sites to be efficiently inserted into the attR sites of the allele replacement vector using phage lambda clonase. We also describe how the incorporation of EGFP into the allele replacement vector can facilitate the selection of the desired cross-over recombinant BACs when the allele replacement reaction is a viral gene deletion. Finally, we incorporate the lambda phage recombination sites directly into an HSV-2 BAC vector for direct recombination of gene cassettes using the phage lambda clonase-driven recombination reaction. Conclusion Together, these improvements to the techniques of HSV BAC mutagenesis will facilitate the construction of recombinant herpes simplex viruses and viral vectors. PMID:17501993
The Precarious Prokaryotic Chromosome
2014-01-01
Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other “precarious” features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction. PMID:24633873
Intelligent Technologies in Library and Information Service Applications. ASIST Monograph Series.
ERIC Educational Resources Information Center
Lancaster, F. W.; Warner, Amy
The objective of this study was to gain enough familiarity with developments in artificial intelligence (AI) and related technologies to be able to advise the information service community on what can be applied today and what one might reasonably expect to be applicable to library and information services in the near future. The emphasis is on…
Carr, G D; Carr, R L
2000-10-01
We initiated a biosystematic study of a recently discovered population of Calycadenia pauciflora in order to evaluate its cytogenetic relationship to previously characterized chromosome races of that species. Cytogenetic analyses of six or more artificially produced individuals of each of the five possible interracial hybrid combinations indicated that the new race (designated Wurlitzer) is differentiated from the other races (Elegans, Healdsburg, Pauciflora, Ramulosa, and Tehama) by the equivalent of 2-4 reciprocal chromosome translocations and in one instance apparently a pericentric inversion. Mean pollen stainability in the hybrids ranged from 13 to 26%. The floral and vegetative features of the new race are very similar to those of races Pauciflora, Ramulosa, and Tehama of C. pauciflora. We ascribe the apparent lack of single-step cytogenetic events in the evolution of the races of C. pauciflora to one or more of the following: (1) (in some cases) the occurrence of saltational chromosome reorganization; (2) extinction of or failure to detect intermediate populations in C. pauciflora; and (3) an insufficient consideration of the possibility of the existence of intermediate races in the closely related species, C. fremontii. We conclude that the C. fremontii-C. pauciflora alliance is one of the most complex and potentially instructive examples of diploid chromosome evolution in plants.
Lee, Hee-Sheung; Lee, Nicholas C O; Kouprina, Natalay; Kim, Jung-Hyun; Kagansky, Alex; Bates, Susan; Trepel, Jane B; Pommier, Yves; Sackett, Dan; Larionov, Vladimir
2016-02-15
Whole chromosomal instability (CIN), manifested as unequal chromosome distribution during cell division, is a distinguishing feature of most cancer types. CIN is generally considered to drive tumorigenesis, but a threshold level exists whereby further increases in CIN frequency in fact hinder tumor growth. While this attribute is appealing for therapeutic exploitation, drugs that increase CIN beyond this therapeutic threshold are currently limited. In our previous work, we developed a quantitative assay for measuring CIN based on the use of a nonessential human artificial chromosome (HAC) carrying a constitutively expressed EGFP transgene. Here, we used this assay to rank 62 different anticancer drugs with respect to their effects on chromosome transmission fidelity. Drugs with various mechanisms of action, such as antimicrotubule activity, histone deacetylase inhibition, mitotic checkpoint inhibition, and targeting of DNA replication and damage responses, were included in the analysis. Ranking of the drugs based on their ability to induce HAC loss revealed that paclitaxel, gemcitabine, dactylolide, LMP400, talazoparib, olaparib, peloruside A, GW843682, VX-680, and cisplatin were the top 10 drugs demonstrating HAC loss at a high frequency. Therefore, identification of currently used compounds that greatly increase chromosome mis-segregation rates should expedite the development of new therapeutic strategies to target and leverage the CIN phenotype in cancer cells. ©2016 American Association for Cancer Research.
Y-chromosome microdeletions are not associated with SHOX haploinsufficiency.
Chianese, C; Lo Giacco, D; Tüttelmann, F; Ferlin, A; Ntostis, P; Vinci, S; Balercia, G; Ars, E; Ruiz-Castañé, E; Giglio, S; Forti, G; Kliesch, S; Krausz, C
2013-11-01
assess whether the SHOX duplications found in the two men with Y-chromosome microdeletions and a normal karyotype represent a neutral polymorphism or are actually associated with the presence of the microdeletion. Men suffering from infertility due to the presence of Y-chromosome microdeletions can resort to artificial reproductive technology (ART) to father their biological children. However, infertile couples must be aware of the risks implied and this makes genetic counseling a crucial step in the patient's management. This study does not confirm previous alarming data that showed an association between Y-chromosome microdeletions and SHOX haploinsufficiency. Our results imply that deletion carriers have no augmented risk of SHOX-related pathologies (short stature and skeletal anomalies) and indicate that there is no need for radical changes in genetic counseling of Yq microdeletion carriers attempting ART, since the only risk established so far for their male offspring remains impaired spermatogenesis. This work was supported by the Italian Ministry of University (grant PRIN 2010-2012 to C.K.), Tuscan Regional Health Research Program ('Progetto Salute 2009') to G.F., the Spanish Ministry of Health (grant FIS-11/02254) and the European Union 'Reprotrain' Marie Curie Network (project number: 289880 to C.K.). The authors declare that no conflicting interests exist.
Zhang, Fei; Bai, Fengwu; Zhao, Xinqing
2016-10-01
Trichoderma reesei Rut-C30 is a well-known cellulase producer, and improvement of its cellulase production is of great interest. An artificial zinc finger protein (AZFP) library is constructed for expression in T. reesei Rut-C30, and a mutant strain T. reesei U3 is selected based on its enhanced cellulase production. The U3 mutant shows a 55% rise in filter paper activity and 8.1-fold increased β-glucosidase activity, when compared to the native strain T. reesei Rut-C30. It is demonstrated that enhanced β-glucosidase activity was due to elevated transcription level of β-glucosidase gene in the U3 mutant. Moreover, significant elevation in transcription levels of several putative Azfp-U3 target genes is detected in the U3 mutant, including genes encoding hypothetical transcription factors and a putative glycoside hydrolase. Furthermore, U3 cellulase shows 115% higher glucose yield from pretreated corn stover, when compared to the cellulase of T. reesei Rut-C30. These results demonstrate that AZFP can be used to improve cellulase production in T. reesei Rut-C30. Our current work offers the establishment of an alternative strategy to develop fungal cell factories for improved production of high value industrial products. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polido, C A; Mantello, C C; Moraes, A P; Souza, A P; Forni-Martins, E R
2014-12-04
Aeschynomene falcata is an important forage species; however, because of low seed production, it is underutilized as forage species. Aeschynomene is a polyphyletic genus with a challenging taxonomic position. Two subgenera have been proposed, and it is suggested that Aeschynomene can be split in 2 genera. Thus, new markers, such as microsatellite sequences, are desirable for improving breeding programs for A. falcata. Based on transferability and in situ localization, these microsatellite sequences can be applied as chromosome markers in the genus Aeschynomene and closely related genera. Here, we report the first microsatellite library developed for this genus; 11 microsatellites were characterized, with observed and expected heterozygosities ranging from 0.0000 to 0.7143 and from 0.1287 to 0.8360, respectively. Polymorphic information content varied from 0.1167 to 0.7786. The departure from Hardy-Weinberg equilibrium may have resulted from frequent autogamy, which is characteristic of A. falcata. Of the 11 microsatellites, 9 loci were cross-amplified in A. brevipes and A. paniculata and 7 in Dalbergia nigra and Machaerium vestitum. Five of these 7 cross-amplified microsatellites were applied as probes during the in situ hybridization assay and 2 showed clear signals on A. falcata chromosomes, ensuring their viability as chromosome markers.
Artificial activation of toxin-antitoxin systems as an antibacterial strategy.
Williams, Julia J; Hergenrother, Paul J
2012-06-01
Toxin-antitoxin (TA) systems are unique modules that effect plasmid stabilization via post-segregational killing of the bacterial host. The genes encoding TA systems also exist on bacterial chromosomes, and it has been speculated that these are involved in a variety of cellular processes. Interest in TA systems has increased dramatically over the past 5 years as the ubiquitous nature of TA genes on bacterial genomes has been revealed. The exploitation of TA systems as an antibacterial strategy via artificial activation of the toxin has been proposed and has considerable potential; however, efforts in this area remain in the early stages and several major questions remain. This review investigates the tractability of targeting TA systems to kill bacteria, including fundamental requirements for success, recent advances, and challenges associated with artificial toxin activation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Repetitive telomeric sequences in chromosomal translocations involving chromosome 21
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qu, J.; Dallaire, L.; Fetni, R.
Telomeres perform key functions in maintaining chromosome integrity. In some structural rearrangements the structure and polymorphism in human telomeres may play a significant role. However, of all the telomeric and subtelomeric sequences, only the terminal TTAGGG repeats are believed essential for telomere function. During the course of a study on the role of telomere structure and polymorphism in chromosomal rearrangements observed in families referred for prenatal diagnosis, we studied three cases in which chromosome 21 was involved. Repetitive TTAGGG sequences for all human chromosomes were used as probes (Oncor). Case 1, a de novo cryptic translocation (2;21) was initially identifiedmore » as monosomy 21 in a child with psychomotor delay and mild dysmorphism. Using a cosmid probe specific for region 21q22.3 and whole chromosome 21 specific painting probe, the long arm of 21 was found on the short arm of chromosome 2 with an interstitial telomere at the breakpoint junction. All the cells were monosomic for 21pter{yields}q21. Case 2 is a familial (19;21) translocation. GTG-banding and FISH with a satellite probe showed no apparent loss of material at the end of either 19q or 21q, with an interstitial telomere at the fusion site of the two intact chromosomes. In case 3, a four generation reciprocal (20;21) translocation, there was no interstitial telomere. The persistence of an interstitial telomere is a relatively rare event which can now be observed with in situ hybridization. Its study may lead to a better understanding of the dynamics of translocations and of chromosome imbalance.« less
Chromosome translocations in turtles: a biomarker in a sentinel animal for ecological dosimetry.
Ulsh, B A; Mühlmann-Díaz, M C; Whicker, F W; Hinton, T G; Congdon, J D; Bedford, J S
2000-06-01
Nonhuman organisms are being exposed to ionizing radiations at radionuclide-contaminated sites around the world. Direct methods are seldom available for measuring biologically relevant doses received by these organisms. Here we extend biological dosimetry techniques, which are much better developed for humans and a few other mammalian species, to a nonmammalian species. Turtles were chosen because a long-lived animal would best serve the need for low-level, chronic exposure conditions. We chose the yellow-bellied slider turtle (Trachemys scripta), which is known to have a maximum life span of at least 22 years. As reported elsewhere, we first isolated an embryonic fibroblast cell line and constructed whole-chromosome-specific DNA libraries for chromosome 1 by microdissection and PCR. A FISH painting probe was prepared and used to establish a dose-response curve for ionizing radiation-induced chromosome interchange aberrations in turtle fibroblasts. This was compared to the dose response for human fibroblasts treated under similar conditions in our laboratory. With respect to induction of chromosome interchange aberrations, human fibroblasts were approximately 1.7 times more sensitive than the T. scripta fibroblasts. To the extent that symmetrical interchanges are persistent over long periods, this approach could eventually provide a measure of the integrated lifetime dose these organisms receive from radionuclides in their environment and give a measure of the extent of relevant genetic damage over that time.
Characterization of the OmyY1 region on the rainbow trout Y chromosome
Phillips, Ruth B.; DeKoning, Jenefer J.; Brunelli, Joseph P.; Faber-Hammond, Joshua J.; Hansen, John D.; Christensen, Kris A.; Renn, Suzy C.P.; Thorgaard, Gary H.
2013-01-01
We characterized the male-specific region on the Y chromosome of rainbow trout, which contains both sdY (the sex-determining gene) and the male-specific genetic marker, OmyY1. Several clones containing the OmyY1 marker were screened from a BAC library from a YY clonal line and found to be part of an 800 kb BAC contig. Using fluorescence in situ hybridization (FISH), these clones were localized to the end of the short arm of the Y chromosome in rainbow trout, with an additional signal on the end of the X chromosome in many cells. We sequenced a minimum tiling path of these clones using Illumina and 454 pyrosequencing. The region is rich in transposons and rDNA, but also appears to contain several single-copy protein-coding genes. Most of these genes are also found on the X chromosome; and in several cases sex-specific SNPs in these genes were identified between the male (YY) and female (XX) homozygous clonal lines. Additional genes were identified by hybridization of the BACs to the cGRASP salmonid 4x44K oligo microarray. By BLASTn evaluations using hypothetical transcripts of OmyY1-linked candidate genes as query against several EST databases, we conclude at least 12 of these candidate genes are likely functional, and expressed.
Complex structure of knob DNA on maize chromosome 9. Retrotransposon invasion into heterochromatin.
Ananiev, E V; Phillips, R L; Rines, H W
1998-01-01
The recovery of maize (Zea mays L.) chromosome addition lines of oat (Avena sativa L.) from oat x maize crosses enables us to analyze the structure and composition of specific regions, such as knobs, of individual maize chromosomes. A DNA hybridization blot panel of eight individual maize chromosome addition lines revealed that 180-bp repeats found in knobs are present in each of these maize chromosomes, but the copy number varies from approximately 100 to 25, 000. Cosmid clones with knob DNA segments were isolated from a genomic library of an oat-maize chromosome 9 addition line with the help of the 180-bp knob-associated repeated DNA sequence used as a probe. Cloned knob DNA segments revealed a complex organization in which blocks of tandemly arranged 180-bp repeating units are interrupted by insertions of other repeated DNA sequences, mostly represented by individual full size copies of retrotransposable elements. There is an obvious preference for the integration of retrotransposable elements into certain sites (hot spots) of the 180-bp repeat. Sequence microheterogeneity including point mutations and duplications was found in copies of 180-bp repeats. The 180-bp repeats within an array all had the same polarity. Restriction maps constructed for 23 cloned knob DNA fragments revealed the positions of polymorphic sites and sites of integration of insertion elements. Discovery of the interspersion of retrotransposable elements among blocks of tandem repeats in maize and some other organisms suggests that this pattern may be basic to heterochromatin organization for eukaryotes. PMID:9691055
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watson, J.M.; Spencer, J.A.; Graves, J.A.M.
1990-09-01
Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. The authors conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which ismore » G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.« less
USDA-ARS?s Scientific Manuscript database
Cotton is a world’s leading crop important to the world’s textile and energy industries, and a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction and extensive analysis of a binary bacterial artificial chromosome (BI...
Tanaka, K; Popp, S; Fischer, C; Van Kaick, G; Kamada, N; Cremer, T; Cremer, C
1996-07-01
Chromosomal translocations in peripheral lymphocytes of three healthy Hiroshima atomic (A)-bomb survivors, as well as three Thorotrast patients and two non-irradiated age-matched control persons from the German Thorotrast study were studied by two- and three-colour fluorescence in situ hybridization (chromosome painting) with various combinations of whole chromosome composite probes, including chromosomes 1, 2, 3, 4, 6, 7, 8, 9 and 12. Translocation frequencies detected by chromosome painting in cells of the A-bomb survivors were compared with results obtained by G-banding. A direct comparison was made, i.e. only those cells with simple translocations or complex aberrations detected by G-banding were taken into consideration which in principle could be detected also with the respective painting combination. The statistical analysis revealed no significant differences from a 1:1 relationship between the frequencies of aberrant cells obtained by both methods. The use of genomic translocation frequencies estimated from subsets of chromosomes for biological dosimetry is discussed in the light of evidence that chromosomes occupy distinct territories and are variably arranged in human lymphocyte nuclei. This territorial organization of interphase chromosomes implies that translocations will be restricted to chromatin located at the periphery of adjacent chromosome territories.
Skuse, David; Printzlau, Frida; Wolstencroft, Jeanne
2018-01-01
Sex chromosome aneuploidies comprise a relatively common group of chromosome disorders characterized by the loss or gain of one or more sex chromosomes. We discuss five of the better-known sex aneuploidies: Turner syndrome (XO), Klinefelter syndrome (XXY), trisomy X (XXX), XYY, and XXYY. Despite their prevalence in the general population, these disorders are underdiagnosed and the specific genetic mechanisms underlying their phenotypes are poorly understood. Although there is considerable variation between them in terms of associated functional impairment, each disorder has a characteristic physical, cognitive, and neurologic profile. The most common cause of sex chromosome aneuploidies is nondisjunction, which can occur during meiosis or during the early stages of postzygotic development. The loss or gain of genetic material can affect all daughter cells or it may be partial, leading to tissue mosaicism. In both typical and atypical sex chromosome karyotypes, there is random inactivation of all but one X chromosome. The mechanisms by which a phenotype results from sex chromosome aneuploidies are twofold: dosage imbalance arising from a small number of genes that escape inactivation, and their endocrinologic consequences. Copyright © 2018 Elsevier B.V. All rights reserved.
Verification and characterization of chromosome duplication in haploid maize.
de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S
2015-06-26
Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.
2010-01-01
Background The chromosome of Streptomyces has been shown to be unstable, frequently undergoing gross chromosomal rearrangements. However, the mechanisms underlying this phenomenon remain unclear, with previous studies focused on two chromosomal ends as targets for rearrangements. Here we investigated chromosomal instability of Streptomyces avermitilis, an important producer of avermectins, and characterized four gross chromosomal rearrangement events, including a major deletion in the central region. The present findings provide a valuable contribution to the mechanistic study of genetic instability in Streptomyces. Results Thirty randomly-selected "bald" mutants derived from the wild-type strain all contained gross chromosomal rearrangements of various types. One of the bald mutants, SA1-8, had the same linear chromosomal structure as the high avermectin-producing mutant 76-9. Chromosomes of both strains displayed at least three independent chromosomal rearrangements, including chromosomal arm replacement to form new 88-kb terminal inverted repeats (TIRs), and two major deletions. One of the deletions eliminated the 36-kb central region of the chromosome, but surprisingly did not affect viability of the cells. The other deletion (74-kb) was internal to the right chromosomal arm. The chromosome of another bald mutant, SA1-6, was circularized with deletions at both ends. No obvious homology was found in all fusion sequences. Generational stability analysis showed that the chromosomal structure of SA1-8 and SA1-6 was stable. Conclusions Various chromosomal rearrangements, including chromosomal arm replacement, interstitial deletions and chromosomal circularization, occurred in S. avermitilis by non-homologous recombination. The finding of an inner deletion involving in the central region of S. avermitilis chromosome suggests that the entire Streptomyces chromosome may be the target for rearrangements, which are not limited, as previously reported, to the two
The Y chromosome of the Atelidae family (Platyrrhini): study by chromosome microdissection.
Gifalli-Iughetti, C; Koiffmann, C P
2009-01-01
In order to study the intergeneric variability of the Y chromosome, we describe the hybridization of the Y chromosome of Brachytelesarachnoides, obtained by microdissection, to metaphases of Atelesbelzebuthmarginatus, Lagothrixlagothricha, and Alouatta male specimens. Brachytelesarachnoides (Atelinae) has 62 chromosomes and a very small Y chromosome. Our results showed that the Brachytelesarachnoides Y chromosome probe hybridized to Lagothrixlagothricha metaphases yielding one hybridization signal on only the tiny Y chromosome, and when hybridized with Atelesbelzebuthmarginatus metaphases it yielded one hybridization signal on two thirds of the small acrocentric Y chromosome. However, no hybridization signal was observed in Alouatta metaphases (subfamily Alouattinae), a closely related genus in the Atelidae family. Furthermore, our data support a close phylogenetic relationship among Brachyteles, Ateles, and Lagothrix and their placement in the Atelinae subfamily, but exclude Alouatta from this group indicating its placement as basal to this group. Copyright 2009 S. Karger AG, Basel.
America's Star Libraries: Top-Rated Libraries
ERIC Educational Resources Information Center
Lance, Keith Curry; Lyons, Ray
2009-01-01
"Library Journal"'s national rating of public libraries, the "LJ" Index of Public Library Service 2009, Round 2, identifies 258 "star" libraries. Created by Keith Curry Lance and Ray Lyons and based on 2007 data from the IMLS, it rates 7,268 public libraries. The top libraries in each group get five, four, or three stars. All included libraries,…
Cruts, M; Backhovens, H; Van Gassen, G; Theuns, J; Wang, S Y; Wehnert, A; van Duijn, C M; Karlsson, T; Hofman, A; Adolfsson, R
1995-10-13
Linkage analysis studies have indicated that the chromosome band 14q24.3 harbours a major gene for familial early-onset Alzheimer's disease (AD). Recently we localized the chromosome 14 AD gene (AD3) in the 6.4 cM interval between the markers D14S289 and D14S61. We mapped the gene encoding dihydrolipoyl succinyltransferase (DLST), the E2k component of human alpha-ketoglutarate dehydrogenase complex (KGDHC), in the AD3 candidate region using yeast artificial chromosomes (YACs). The DLST gene is a candidate for the AD3 gene since deficiencies in KGDHC activity have been observed in brain tissue and fibroblasts of AD patients. The 15 exons and the promoter region of the DLST gene were analysed for mutations in chromosome 14 linked AD cases and in two series of unrelated early-onset AD cases (onset age < 55 years). Sequence variations in intronic sequences (introns 3, 5 and 10) or silent mutations in exonic sequences (exons 8 and 14) were identified. However, no AD related mutations were observed, suggesting that the DLST gene is not the chromosome 14 AD3 gene.
Badenhorst, Daleen; Hillier, LaDeana W.; Literman, Robert; Montiel, Eugenia Elisabet; Radhakrishnan, Srihari; Shen, Yingjia; Minx, Patrick; Janes, Daniel E.; Warren, Wesley C.; Edwards, Scott V.; Valenzuela, Nicole
2015-01-01
Comparative genomics continues illuminating amniote genome evolution, but for many lineages our understanding remains incomplete. Here, we refine the assembly (CPI 3.0.3 NCBI AHGY00000000.2) and develop a cytogenetic map of the painted turtle (Chrysemys picta—CPI) genome, the first in turtles and in vertebrates with temperature-dependent sex determination. A comparison of turtle genomes with those of chicken, selected nonavian reptiles, and human revealed shared and novel genomic features, such as numerous chromosomal rearrangements. The largest conserved syntenic blocks between birds and turtles exist in four macrochromosomes, whereas rearrangements were evident in these and other chromosomes, disproving that turtles and birds retain fully conserved macrochromosomes for greater than 300 Myr. C-banding revealed large heterochromatic blocks in the centromeric region of only few chromosomes. The nucleolar-organizing region (NOR) mapped to a single CPI microchromosome, whereas in some turtles and lizards the NOR maps to nonhomologous sex-chromosomes, thus revealing independent translocations of the NOR in various reptilian lineages. There was no evidence for recent chromosomal fusions as interstitial telomeric-DNA was absent. Some repeat elements (CR1-like, Gypsy) were enriched in the centromeres of five chromosomes, whereas others were widespread in the CPI genome. Bacterial artificial chromosome (BAC) clones were hybridized to 18 of the 25 CPI chromosomes and anchored to a G-banded ideogram. Several CPI sex-determining genes mapped to five chromosomes, and homology was detected between yet other CPI autosomes and the globally nonhomologous sex chromosomes of chicken, other turtles, and squamates, underscoring the independent evolution of vertebrate sex-determining mechanisms. PMID:26108489
Synteny of human chromosomes 14 and 15 in the platyrrhines (Primates, Platyrrhini)
2009-01-01
In order to study the intra- and interspecific variability of the 14/15 association in Platyrrhini, we analyzed 15 species from 13 genera, including species that had not been described yet. The DNA libraries of human chromosomes 14 and 15 were hybridized to metaphases of Alouatta guariba clamitans, A. caraya, A. sara, Ateles paniscus chamek, Lagothrix lagothricha, Brachyteles arachnoides, Saguinus midas midas, Leontopithecus chrysomelas, Callimico goeldii, Callithrix sp., Cebus apella, Aotus nigriceps, Cacajao melanocephalus,Chiropotes satanas and Callicebus caligatus. The 14/15 hybridization pattern was present in 13 species, but not in Alouatta sara that showed a 14/15/14 pattern and Aotus nigriceps that showed a 15/14/15/14 pattern. In the majority of the species, the HSA 14 homologue retained synteny for the entire chromosome, whereas the HSA 15 homologue displayed fragmented segments. Within primates, the New World monkeys represent the taxon with the highest variability in chromosome number (2n = 16 to 62). The presence of the HSA 14/15 association in all species and subspecies studied herein confirms that this association is the ancestral condition for platyrrhines and that this association has been retained in most platyrrhines, despite the occurrence of extensive inter- and intrachromosomal rearrangements in this infraorder of Primates. PMID:21637455
Synteny of human chromosomes 14 and 15 in the platyrrhines (Primates, Platyrrhini).
Gifalli-Iughetti, Cristiani; Koiffmann, Célia P
2009-10-01
In order to study the intra- and interspecific variability of the 14/15 association in Platyrrhini, we analyzed 15 species from 13 genera, including species that had not been described yet. The DNA libraries of human chromosomes 14 and 15 were hybridized to metaphases of Alouatta guariba clamitans, A. caraya, A. sara, Ateles paniscus chamek, Lagothrix lagothricha, Brachyteles arachnoides, Saguinus midas midas, Leontopithecus chrysomelas, Callimico goeldii, Callithrix sp., Cebus apella, Aotus nigriceps, Cacajao melanocephalus,Chiropotes satanas and Callicebus caligatus. The 14/15 hybridization pattern was present in 13 species, but not in Alouatta sara that showed a 14/15/14 pattern and Aotus nigriceps that showed a 15/14/15/14 pattern. In the majority of the species, the HSA 14 homologue retained synteny for the entire chromosome, whereas the HSA 15 homologue displayed fragmented segments. Within primates, the New World monkeys represent the taxon with the highest variability in chromosome number (2n = 16 to 62). The presence of the HSA 14/15 association in all species and subspecies studied herein confirms that this association is the ancestral condition for platyrrhines and that this association has been retained in most platyrrhines, despite the occurrence of extensive inter- and intrachromosomal rearrangements in this infraorder of Primates.
Micromechanics of human mitotic chromosomes
NASA Astrophysics Data System (ADS)
Sun, Mingxuan; Kawamura, Ryo; Marko, John F.
2011-02-01
Eukaryote cells dramatically reorganize their long chromosomal DNAs to facilitate their physical segregation during mitosis. The internal organization of folded mitotic chromosomes remains a basic mystery of cell biology; its understanding would likely shed light on how chromosomes are separated from one another as well as into chromosome structure between cell divisions. We report biophysical experiments on single mitotic chromosomes from human cells, where we combine micromanipulation, nano-Newton-scale force measurement and biochemical treatments to study chromosome connectivity and topology. Results are in accord with previous experiments on amphibian chromosomes and support the 'chromatin network' model of mitotic chromosome structure. Prospects for studies of chromosome-organizing proteins using siRNA expression knockdowns, as well as for differential studies of chromosomes with and without mutations associated with genetic diseases, are also discussed.
Song, Beng-Kah; Nadarajah, Kalaivani; Romanov, Michael N; Ratnam, Wickneswari
2005-01-01
The construction of BAC-contig physical maps is an important step towards a partial or ultimate genome sequence analysis. Here, we describe our initial efforts to apply an overgo approach to screen a BAC library of the Malaysian wild rice species, Oryza rufipogon. Overgo design is based on repetitive element masking and sequence uniqueness, and uses short probes (approximately 40 bp), making this method highly efficient and specific. Pairs of 24-bp oligos that contain an 8-bp overlap were developed from the publicly available genomic sequences of the cultivated rice, O. sativa, to generate 20 overgo probes for a 1-Mb region that encompasses a yield enhancement QTL yld1.1 in O. rufipogon. The advantages of a high similarity in melting temperature, hybridization kinetics and specific activities of overgos further enabled a pooling strategy for library screening by filter hybridization. Two pools of ten overgos each were hybridized to high-density filters representing the O. rufipogon genomic BAC library. These screening tests succeeded in providing 69 PCR-verified positive hits from a total of 23,040 BAC clones of the entire O. rufipogon library. A minimal tilling path of clones was generated to contribute to a fully covered BAC-contig map of the targeted 1-Mb region. The developed protocol for overgo design based on O. sativa sequences as a comparative genomic framework, and the pooled overgo hybridization screening technique are suitable means for high-resolution physical mapping and the identification of BAC candidates for sequencing.
Ohnishi, Toshiyuki; Sakamoto, Kotaro; Asami-Odaka, Asano; Nakamura, Kimie; Shimizu, Ayako; Ito, Takashi; Asami, Taiji; Ohtaki, Tetsuya; Inooka, Hiroshi
2017-01-29
Tropomyosin receptor kinase B (TrkB) is a known receptor of brain-derived neurotrophic factor (BDNF). Because it plays a critical role in the regulation of neuronal development, maturation, survival, etc., TrkB is a good target for drugs against central nervous system diseases. In this study, we aimed to generate peptidic TrkB agonists by applying random peptide phage display technology. After the phage panning against recombinant Fc-fused TrkB (TrkB-Fc), agonistic phages were directly screened against TrkB-expressing HEK293 cells. Through subsequent screening of the first-hit BM17 peptide-derived focus library, we successfully obtained the BM17d99 peptide, which had no sequence similarity with BDNF but had TrkB-binding capacity. We then synthesized a dimeric BM17d99 analog peptide that could phosphorylate or activate TrkB by facilitating receptor homodimerization. Treatment of TrkB-expressing HEK293 cells with the dimeric BM17d99 analog peptide significantly induced the phosphorylation of TrkB, suggesting that homodimerization of TrkB was enhanced by the dimeric peptide. This report demonstrates that our approach is useful for the generation of artificial peptidic agonists of cell surface receptors. Copyright © 2016 Elsevier Inc. All rights reserved.
Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes.
Veyrunes, Frédéric; Waters, Paul D; Miethke, Pat; Rens, Willem; McMillan, Daniel; Alsop, Amber E; Grützner, Frank; Deakin, Janine E; Whittington, Camilla M; Schatzkamer, Kyriena; Kremitzki, Colin L; Graves, Tina; Ferguson-Smith, Malcolm A; Warren, Wes; Marshall Graves, Jennifer A
2008-06-01
In therian mammals (placentals and marsupials), sex is determined by an XX female: XY male system, in which a gene (SRY) on the Y affects male determination. There is no equivalent in other amniotes, although some taxa (notably birds and snakes) have differentiated sex chromosomes. Birds have a ZW female: ZZ male system with no homology with mammal sex chromosomes, in which dosage of a Z-borne gene (possibly DMRT1) affects male determination. As the most basal mammal group, the egg-laying monotremes are ideal for determining how the therian XY system evolved. The platypus has an extraordinary sex chromosome complex, in which five X and five Y chromosomes pair in a translocation chain of alternating X and Y chromosomes. We used physical mapping to identify genes on the pairing regions between adjacent X and Y chromosomes. Most significantly, comparative mapping shows that, contrary to earlier reports, there is no homology between the platypus and therian X chromosomes. Orthologs of genes in the conserved region of the human X (including SOX3, the gene from which SRY evolved) all map to platypus chromosome 6, which therefore represents the ancestral autosome from which the therian X and Y pair derived. Rather, the platypus X chromosomes have substantial homology with the bird Z chromosome (including DMRT1) and to segments syntenic with this region in the human genome. Thus, platypus sex chromosomes have strong homology with bird, but not to therian sex chromosomes, implying that the therian X and Y chromosomes (and the SRY gene) evolved from an autosomal pair after the divergence of monotremes only 166 million years ago. Therefore, the therian X and Y are more than 145 million years younger than previously thought.
López-Vallejo, Fabian; Nefzi, Adel; Bender, Andreas; Owen, John R.; Nabney, Ian T.; Houghten, Richard A.; Medina-Franco, Jose L.
2011-01-01
Combinatorial libraries continue to play a key role in drug discovery. To increase structural diversity, several experimental methods have been developed. However, limited efforts have been performed so far to quantify the diversity of the broadly used diversity-oriented synthetic (DOS) libraries. Herein we report a comprehensive characterization of 15 bis-diazacyclic combinatorial libraries obtained through libraries from libraries, which is a DOS approach. Using MACCS keys, radial and different pharmacophoric fingerprints as well as six molecular properties, it was demonstrated the increased structural and property diversity of the libraries from libraries over the individual libraries. Comparison of the libraries to existing drugs, NCI Diversity and the Molecular Libraries Small Molecule Repository revealed the structural uniqueness of the combinatorial libraries (mean similarity < 0.5 for any fingerprint representation). In particular, bis-cyclic thiourea libraries were the most structurally dissimilar to drugs retaining drug-like character in property space. This study represents the first comprehensive quantification of the diversity of libraries from libraries providing a solid quantitative approach to compare and contrast the diversity of DOS libraries with existing drugs or any other compound collection. PMID:21294850
Issues for bringing digital libraries into public use
NASA Technical Reports Server (NTRS)
Flater, David W.; Yesha, Yelena
1993-01-01
In much the same way that the field of artificial intelligence produced a cult which fervently believed that computers would soon think like human beings, the existence of electronic books has resurrected the paperless society as a utopian vision to some, an apocalyptic horror to others. In this essay we have attempted to provide realistic notions of what digital libraries are likely to become if they are a popular success. E-books are capable of subsuming most of the media we use today and have the potential for added functionality by being interactive. The environmental impact of having millions more computers will be offset to some degree, perhaps even exceeded, by the fact that televisions, stereos, VCR's, CD players, newspapers, magazines, and books will become part of the computer system or be made redundant. On the whole, large-scale use of digital libraries is likely to be a winning proposition. Whether or not this comes to pass depends on the directions taken by today's researchers and software developers. By involving the public, the effort being put into digital libraries can be leveraged into something which is big enough to make a real change for the better. If digital libraries remain the exclusive property of government, universities, and large research firms, then large parts of the world will remain without digital libraries for years to come, just as they have remained without digital phone service for far too long. If software companies try to scuttle the project by patenting crucial algorithms and using proprietary data formats, all of us will suffer. Let us reverse the errors of the past and create a truly open digital library system.
Vibrio chromosomes share common history.
Kirkup, Benjamin C; Chang, LeeAnn; Chang, Sarah; Gevers, Dirk; Polz, Martin F
2010-05-10
While most gamma proteobacteria have a single circular chromosome, Vibrionales have two circular chromosomes. Horizontal gene transfer is common among Vibrios, and in light of this genetic mobility, it is an open question to what extent the two chromosomes themselves share a common history since their formation. Single copy genes from each chromosome (142 genes from chromosome I and 42 genes from chromosome II) were identified from 19 sequenced Vibrionales genomes and their phylogenetic comparison suggests consistent phylogenies for each chromosome. Additionally, study of the gene organization and phylogeny of the respective origins of replication confirmed the shared history. Thus, while elements within the chromosomes may have experienced significant genetic mobility, the backbones share a common history. This allows conclusions based on multilocus sequence analysis (MLSA) for one chromosome to be applied equally to both chromosomes.
Stable chromosome condensation revealed by chromosome conformation capture
Eagen, Kyle P.; Hartl, Tom A.; Kornberg, Roger D.
2015-01-01
SUMMARY Chemical cross-linking and DNA sequencing have revealed regions of intra-chromosomal interaction, referred to as topologically associating domains (TADs), interspersed with regions of little or no interaction, in interphase nuclei. We find that TADs and the regions between them correspond with the bands and interbands of polytene chromosomes of Drosophila. We further establish the conservation of TADs between polytene and diploid cells of Drosophila. From direct measurements on light micrographs of polytene chromosomes, we then deduce the states of chromatin folding in the diploid cell nucleus. Two states of folding, fully extended fibers containing regulatory regions and promoters, and fibers condensed up to ten-fold containing coding regions of active genes, constitute the euchromatin of the nuclear interior. Chromatin fibers condensed up to 30-fold, containing coding regions of inactive genes, represent the heterochromatin of the nuclear periphery. A convergence of molecular analysis with direct observation thus reveals the architecture of interphase chromosomes. PMID:26544940
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trask, B.J.; Friedman, C.; Giorgi, D.
1994-09-01
We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much moremore » rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.« less
Evolving artificial metalloenzymes via random mutagenesis
NASA Astrophysics Data System (ADS)
Yang, Hao; Swartz, Alan M.; Park, Hyun June; Srivastava, Poonam; Ellis-Guardiola, Ken; Upp, David M.; Lee, Gihoon; Belsare, Ketaki; Gu, Yifan; Zhang, Chen; Moellering, Raymond E.; Lewis, Jared C.
2018-03-01
Random mutagenesis has the potential to optimize the efficiency and selectivity of protein catalysts without requiring detailed knowledge of protein structure; however, introducing synthetic metal cofactors complicates the expression and screening of enzyme libraries, and activity arising from free cofactor must be eliminated. Here we report an efficient platform to create and screen libraries of artificial metalloenzymes (ArMs) via random mutagenesis, which we use to evolve highly selective dirhodium cyclopropanases. Error-prone PCR and combinatorial codon mutagenesis enabled multiplexed analysis of random mutations, including at sites distal to the putative ArM active site that are difficult to identify using targeted mutagenesis approaches. Variants that exhibited significantly improved selectivity for each of the cyclopropane product enantiomers were identified, and higher activity than previously reported ArM cyclopropanases obtained via targeted mutagenesis was also observed. This improved selectivity carried over to other dirhodium-catalysed transformations, including N-H, S-H and Si-H insertion, demonstrating that ArMs evolved for one reaction can serve as starting points to evolve catalysts for others.
ERIC Educational Resources Information Center
Garfield, Eugene
2001-01-01
Traces the development of information retrieval/services and suggests that the creation of large digital libraries seems inevitable. Examines possibilities for increasing electronic access and the role of artificial intelligence. Highlights include: searching full text; sending full texts; selective dissemination of information (SDI) profiling and…
Livermore Big Artificial Neural Network Toolkit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Essen, Brian Van; Jacobs, Sam; Kim, Hyojin
2016-07-01
LBANN is a toolkit that is designed to train artificial neural networks efficiently on high performance computing architectures. It is optimized to take advantages of key High Performance Computing features to accelerate neural network training. Specifically it is optimized for low-latency, high bandwidth interconnects, node-local NVRAM, node-local GPU accelerators, and high bandwidth parallel file systems. It is built on top of the open source Elemental distributed-memory dense and spars-direct linear algebra and optimization library that is released under the BSD license. The algorithms contained within LBANN are drawn from the academic literature and implemented to work within a distributed-memory framework.
Pandey, Ravi S; Azad, Rajeev K
2016-03-01
Sex chromosomes have evolved from a pair of homologous autosomes which differentiated into sex determination systems, such as XY or ZW system, as a consequence of successive recombination suppression between the gametologous chromosomes. Identifying the regions of recombination suppression, namely, the "evolutionary strata", is central to understanding the history and dynamics of sex chromosome evolution. Evolution of sex chromosomes as a consequence of serial recombination suppressions is well-studied for mammals and birds, but not for plants, although 48 dioecious plants have already been reported. Only two plants Silene latifolia and papaya have been studied until now for the presence of evolutionary strata on their X chromosomes, made possible by the sequencing of sex-linked genes on both the X and Y chromosomes, which is a requirement of all current methods that determine stratum structure based on the comparison of gametologous sex chromosomes. To circumvent this limitation and detect strata even if only the sequence of sex chromosome in the homogametic sex (i.e. X or Z chromosome) is available, we have developed an integrated segmentation and clustering method. In application to gene sequences on the papaya X chromosome and protein-coding sequences on the S. latifolia X chromosome, our method could decipher all known evolutionary strata, as reported by previous studies. Our method, after validating on known strata on the papaya and S. latifolia X chromosome, was applied to the chromosome 19 of Populus trichocarpa, an incipient sex chromosome, deciphering two, yet unknown, evolutionary strata. In addition, we applied this approach to the recently sequenced sex chromosome V of the brown alga Ectocarpus sp. that has a haploid sex determination system (UV system) recovering the sex determining and pseudoautosomal regions, and then to the mating-type chromosomes of an anther-smut fungus Microbotryum lychnidis-dioicae predicting five strata in the non
Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.
Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W
2005-01-01
Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.
USDA-ARS?s Scientific Manuscript database
The chromosome painting is an efficient tool for chromosome research. However, plant chromosome painting is relatively underdeveloped. In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat-Thinopyrum intermedium addition line, and chromosomes of...
State of the art of geoscience libraries and information services
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pruett, N.J.
Geoscience libraries and geoscience information services are closely related. Both are trying to meet the needs of the geoscientists for information and data. Both are also being affected by many trends: increased availability of personal computers; decreased costs of machine readable storage; increased availability of maps in digital format (Pallatto, 1986); progress in graphic displays and in developing Geographic Information System, (GIS) (Kelly and Phillips, 1986); development in artificial intelligence; and the availability of new formats (e.g. CD-ROM). Some additional factors are at work at changing the role of libraries: libraries are coming to recognize the impossibility of collecting everythingmore » and the validity of Bradford's Law unobtrustive studies of library reference services have pointed out that only 50% of the questions are answered correctly it is clear that the number of databases is increasing although good figures for specifically geoscience databases are not available; lists of numeric database are beginning to appear; evaluative (as opposed to purely descriptive) reviews of available bibliographic databases are beginning to appear; more and more libraries are getting online catalogs and results of studies of users of online catalog are being used to improve catalog design; and research is raising consciousness about the value of; and research is raising consciousness about the value of information. All these trends are having or will have an effect on geoscience information.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko
1994-07-15
The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less
Fauth, E; Scherthan, H; Zankl, H
2000-11-01
Cultures of human blood lymphocytes from three subjects were incubated with the clastogen mitomycin C (MMC, 500 ng/ml) and the aneugen diethylstilboestrol (DES, 80 microM) 23 h before harvesting, to induce formation of micronuclei (MN) and numerical and structural alterations in metaphase chromosomes. We used fluorescence in situ hybridization (FISH) with painting probes for all human chromosomes to determine which chromosomes had contributed material to the induced MN. MMC treatment induced an approximately 18-fold increase in MN and led to a significant increase in hypodiploidy and structural chromosome aberrations in metaphase preparations. Undercondensation of pericentromeric heterochromatin of chromosomes 9 and 1 occurred in 20-75% of metaphases and FISH disclosed an abundance of material from these chromosomes in induced MN (62-69% from chromosome 9 and 7-12% from chromosome 1). DES treatment of lymphocytes induced a seven-fold increase in MN frequency and four-fold increase in the frequency of numerical aberrations; structural aberrations were not significantly increased. FISH analysis showed that material from all chromosomes was present in DES-induced MN, with material from chromosome 1 present in 16% of MN and material from each other chromosomes being present in 2-10% of MN. Material from chromosomes 14, 19 and 21 was significantly more frequent material from chromosome Y significantly less frequent in DES-treated cells than in controls. The findings of the MMC studies indicate that the heterochromatin block of chromosome 9 is a specific target for MMC-induced undercondensation, which induces a preferential occurrence of chromosome 9 material in MN. DES, in contrast, does not trigger heterochromatin decondensation and fails to induce such a significant appearance of material of particular chromosomes in MN.
America's Star Libraries, 2010: Top-Rated Libraries
ERIC Educational Resources Information Center
Lyons, Ray; Lance, Keith Curry
2010-01-01
The "LJ" Index of Public Library Service 2010, "Library Journal"'s national rating of public libraries, identifies 258 "star" libraries. Created by Ray Lyons and Keith Curry Lance, and based on 2008 data from the IMLS, it rates 7,407 public libraries. The top libraries in each group get five, four, or three stars. All included libraries, stars or…
ERIC Educational Resources Information Center
Robertson, Carol
2016-01-01
Learning about chromosomes is standard fare in biology classrooms today. However, students may find it difficult to understand the relationships among the "genome", "chromosomes", "genes", a "gene locus", and "alleles". In the simple activity described in this article, which follows the 5E approach…
Capturing Chromosome Conformation
NASA Astrophysics Data System (ADS)
Dekker, Job; Rippe, Karsten; Dekker, Martijn; Kleckner, Nancy
2002-02-01
We describe an approach to detect the frequency of interaction between any two genomic loci. Generation of a matrix of interaction frequencies between sites on the same or different chromosomes reveals their relative spatial disposition and provides information about the physical properties of the chromatin fiber. This methodology can be applied to the spatial organization of entire genomes in organisms from bacteria to human. Using the yeast Saccharomyces cerevisiae, we could confirm known qualitative features of chromosome organization within the nucleus and dynamic changes in that organization during meiosis. We also analyzed yeast chromosome III at the G1 stage of the cell cycle. We found that chromatin is highly flexible throughout. Furthermore, functionally distinct AT- and GC-rich domains were found to exhibit different conformations, and a population-average 3D model of chromosome III could be determined. Chromosome III emerges as a contorted ring.
Hyppa, Randy W.; Benko, Zsigmond; Misova, Ivana; Schleiffer, Alexander; Smith, Gerald R.; Gregan, Juraj
2016-01-01
To identify new proteins required for faithful meiotic chromosome segregation, we screened a Schizosaccharomyces pombe deletion mutant library and found that deletion of the dbl2 gene led to missegregation of chromosomes during meiosis. Analyses of both live and fixed cells showed that dbl2Δ mutant cells frequently failed to segregate homologous chromosomes to opposite poles during meiosis I. Removing Rec12 (Spo11 homolog) to eliminate meiotic DNA double-strand breaks (DSBs) suppressed the segregation defect in dbl2Δ cells, indicating that Dbl2 acts after the initiation of meiotic recombination. Analyses of DSBs and Holliday junctions revealed no significant defect in their formation or processing in dbl2Δ mutant cells, although some Rec12-dependent DNA joint molecules persisted late in meiosis. Failure to segregate chromosomes in the absence of Dbl2 correlated with persistent Rad51 foci, and deletion of rad51 or genes encoding Rad51 mediators also suppressed the segregation defect of dbl2Δ. Formation of foci of Fbh1, an F-box helicase that efficiently dismantles Rad51-DNA filaments, was impaired in dbl2Δ cells. Our results suggest that Dbl2 is a novel regulator of Fbh1 and thereby Rad51-dependent DSB repair required for proper meiotic chromosome segregation and viable sex cell formation. The wide conservation of these proteins suggests that our results apply to many species. PMID:27304859
Schalbetter, S. A.; Goloborodko, A.; Fudenberg, G.; Belton, J.-M.; Miles, C.; Yu, M.; Dekker, J.; Mirny, L.; Baxter, J.
2017-01-01
Structural Maintenance of Chromosomes (SMC) protein complexes are key determinants of chromosome conformation. Using Hi-C and polymer modeling, we study how cohesin and condensin, two deeply conserved SMC complexes, organize chromosomes in the budding yeast Saccharomyces cerevisiae. The canonical role of cohesin is to co-align sister chromatids whilst condensin generally compacts mitotic chromosomes. We find strikingly different roles for the two complexes in budding yeast mitosis. First, cohesin is responsible for compacting mitotic chromosome arms, independently of sister chromatid cohesion. Polymer simulations demonstrate this role can be fully accounted for through cis-looping of chromatin. Second, condensin is generally dispensable for compaction along chromosome arms. Instead it plays a targeted role compacting the rDNA proximal regions and promoting resolution of peri-centromeric regions. Our results argue that the conserved mechanism of SMC complexes is to form chromatin loops and that distinct SMC-dependent looping activities are selectively deployed to appropriately compact chromosomes. PMID:28825700
Chromosomal Mapping of Canine-Derived BAC Clones to the Red Fox and American Mink Genomes
Vorobieva, Nadegda V.; Beklemisheva, Violetta R.; Johnson, Jennifer L.; Temnykh, Svetlana V.; Yudkin, Dmitry V.; Trut, Lyudmila N.; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D.; Acland, Gregory M.; Graphodatsky, Alexander S.
2009-01-01
High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene–containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations. PMID:19546120
Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.
Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S
2009-01-01
High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.
USDA-ARS?s Scientific Manuscript database
To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...
Li, Na; Yuan, Kai; Yan, Feng; Huo, Yuda; Zhu, Tongge; Liu, Xing; Guo, Zhen; Yao, Xuebiao
2009-06-19
Mitotic chromosome movements are orchestrated by interactions between spindle microtubules and chromosomes. It is well known that kinetochore is the major site where microtubule-chromosome attachment occurs. However, the functions of other domains of chromosome such as chromosome periphery have remained elusive. Our previous studies show that PinX1 distributes to chromosome periphery and kinetochore during mitosis, and harbors the microtubule binding activity. Here we report that PinX1 interacts with Nucleolin, a chromosome periphery protein, through its C-termini. Deconvolution microscopic analyses show PinX1 mainly co-localizes with Nucleolin at chromosome periphery in prometaphase. Moreover, depletion of Nucleolin abolishes chromosome periphery localizations of PinX1, suggesting a functional interrelationship between PinX1 and Nucleolin. Importantly, repression of PinX1 and Nucleolin abrogates chromosome segregation in real-time mitosis, validating the functional importance of PinX1-Nucleolin interaction. We propose PinX1 is recruited to chromosome periphery by Nucleolin and a complex of PinX1 and Nucleolin is essential for faithful chromosome congression.
Benedetti, Sara; Uno, Narumi; Hoshiya, Hidetoshi; Ragazzi, Martina; Ferrari, Giulia; Kazuki, Yasuhiro; Moyle, Louise Anne; Tonlorenzi, Rossana; Lombardo, Angelo; Chaouch, Soraya; Mouly, Vincent; Moore, Marc; Popplewell, Linda; Kazuki, Kanako; Katoh, Motonobu; Naldini, Luigi; Dickson, George; Messina, Graziella; Oshimura, Mitsuo; Cossu, Giulio; Tedesco, Francesco Saverio
2018-02-01
Transferring large or multiple genes into primary human stem/progenitor cells is challenged by restrictions in vector capacity, and this hurdle limits the success of gene therapy. A paradigm is Duchenne muscular dystrophy (DMD), an incurable disorder caused by mutations in the largest human gene: dystrophin. The combination of large-capacity vectors, such as human artificial chromosomes (HACs), with stem/progenitor cells may overcome this limitation. We previously reported amelioration of the dystrophic phenotype in mice transplanted with murine muscle progenitors containing a HAC with the entire dystrophin locus (DYS-HAC). However, translation of this strategy to human muscle progenitors requires extension of their proliferative potential to withstand clonal cell expansion after HAC transfer. Here, we show that reversible cell immortalisation mediated by lentivirally delivered excisable hTERT and Bmi1 transgenes extended cell proliferation, enabling transfer of a novel DYS-HAC into DMD satellite cell-derived myoblasts and perivascular cell-derived mesoangioblasts. Genetically corrected cells maintained a stable karyotype, did not undergo tumorigenic transformation and retained their migration ability. Cells remained myogenic in vitro (spontaneously or upon MyoD induction) and engrafted murine skeletal muscle upon transplantation. Finally, we combined the aforementioned functions into a next-generation HAC capable of delivering reversible immortalisation, complete genetic correction, additional dystrophin expression, inducible differentiation and controllable cell death. This work establishes a novel platform for complex gene transfer into clinically relevant human muscle progenitors for DMD gene therapy. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Puttagunta, Radhika; Gordon, Laurie A.; Meyer, Gary E.; Kapfhamer, David; Lamerdin, Jane E.; Kantheti, Prameela; Portman, Kathleen M.; Chung, Wendy K.; Jenne, Dieter E.; Olsen, Anne S.; Burmeister, Margit
2000-01-01
A cosmid/bacterial artificial chromosome (BAC) contiguous (contig) map of human chromosome (HSA) 19p13.3 has been constructed, and over 50 genes have been localized to the contig. Genes and anonymous ESTs from ≈4000 kb of human 19p13.3 were placed on the central mouse chromosome 10 map by genetic mapping and pulsed-field gel electrophoresis (PFGE) analysis. A region of ∼2500 kb of HSA 19p13.3 is collinear to mouse chromosome (MMU) 10. In contrast, the adjacent ≈1200 kb are inverted. Two genes are located in a 50-kb region after the inversion on MMU 10, followed by a region of homology to mouse chromosome 17. The synteny breakpoint and one of the inversion breakpoints has been localized to sequenced regions in human <5 kb in size. Both breakpoints are rich in simple tandem repeats, including (TCTG)n, (CT)n, and (GTCTCT)n, suggesting that simple repeat sequences may be involved in chromosome breaks during evolution. The overall size of the region in mouse is smaller, although no large regions are missing. Comparing the physical maps to the genetic maps showed that in contrast to the higher-than-average rate of genetic recombination in gene-rich telomeric region on HSA 19p13.3, the average rate of recombination is lower than expected in the homologous mouse region. This might indicate that a hot spot of recombination may have been lost in mouse or gained in human during evolution, or that the position of sequences along the chromosome (telomeric compared to the middle of a chromosome) is important for recombination rates. PMID:10984455
Sotero-Caio, C G; Pieczarka, J C; Nagamachi, C Y; Gomes, A J B; Lira, T C; O'Brien, P C M; Ferguson-Smith, M A; Souza, M J; Santos, N
2011-01-01
Substantial effort has been made to elucidate karyotypic evolution of phyllostomid bats, mostly through comparisons of G-banding patterns. However, due to the limited number of G-bands in respective karyotypes and to the similarity of non-homologous bands, an accurate evolutionary history of chromosome segments remains questionable. This is the case for vampire bats (Desmodontinae). Despite several proposed homologies, banding data have not yet provided a detailed understanding of the chromosomal changes within vampire genera. We examined karyotype differentiation of the 3 species within this subfamily using whole chromosomal probes from Phyllostomus hastatus (Phyllostominae) and Carollia brevicauda (Carolliinae). Painting probes of P. hastatus respectively detected 22, 21 and 23 conserved segments in Diphylla ecaudata, Diaemus youngi, and Desmodus rotundus karyotypes, whereas 27, 27 and 28 were respectively detectedwith C. brevicauda paints. Based on the evolutionary relationships proposed by morphological and molecular data, we present probable chromosomal synapomorphies for vampire bats and propose chromosomes that were present in the common ancestor of the 5 genera analyzed. Karyotype comparisons allowed us to relate a number of conserved chromosomal segments among the 5 species, providing a broader database for understanding karyotype evolution in the family. 2010 S. Karger AG, Basel.
Y chromosome evolution: emerging insights into processes of Y chromosome degeneration
Bachtrog, Doris
2014-01-01
The human Y chromosome is intriguing not only because it harbours the master-switch gene determining gender but also because of its unusual evolutionary trajectory. Previously an autosome, Y chromosome evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species as well as in plants have shed light on the current gene content of the Y, its origins and its long-term fate. Comparative analysis of young and old Y chromosomes have given further insights into the evolutionary and molecular forces triggering Y degeneration and its evolutionary destiny. PMID:23329112
Jégu, Teddy; Aeby, Eric; Lee, Jeannie T
2017-06-01
Extensive 3D folding is required to package a genome into the tiny nuclear space, and this packaging must be compatible with proper gene expression. Thus, in the well-hierarchized nucleus, chromosomes occupy discrete territories and adopt specific 3D organizational structures that facilitate interactions between regulatory elements for gene expression. The mammalian X chromosome exemplifies this structure-function relationship. Recent studies have shown that, upon X-chromosome inactivation, active and inactive X chromosomes localize to different subnuclear positions and adopt distinct chromosomal architectures that reflect their activity states. Here, we review the roles of long non-coding RNAs, chromosomal organizational structures and the subnuclear localization of chromosomes as they relate to X-linked gene expression.
Losing Libraries, Saving Libraries
ERIC Educational Resources Information Center
Miller, Rebecca
2010-01-01
This summer, as public libraries continued to get budget hit after budget hit across the country, several readers asked for a comprehensive picture of the ravages of the recession on library service. In partnership with 2010 Movers & Shakers Laura Solomon and Mandy Knapp, Ohio librarians who bought the Losing Libraries domain name,…
Dan, Lu; Liu, Shen; Shang, Shengzhe; Zhang, Huihua; Zhang, Ran; Li, Ning
2018-04-20
Targeted gene modification is a novel intervention strategy to increase disease resistance more quickly than traditional animal breeding. Human lysozyme, a natural, non-specific immune factor, participates in innate immunity, exerts a wide range of antimicrobial activities against pathogens, and has immuneregulatory effects. Therefore, it is a candidate gene for improved disease resistance in animals. In this study, we successfully generated a transgenic mouse model by microinjecting a modified bacterial artificial chromosome containing a recombinant human lysozyme (rhLZ) gene into the pronuclei of fertilized mouse embryos. rhLZ was expressed in serum, liver, spleen, lung, kidney, stomach, small intestine, and large intestine but not in milk. rhLZ protein concentrations in the serum of transgenic mice ranged from 2.09 to 2.60 mg/l. To examine the effect of rhLZ on intestinal microbiota, total aerobes, total anaerobes, Clostridium, Enterococcus, Streptococcus, Salmonella, Escherichia coli, Staphylococcus, Bifidobacterium, and Lactobacillus were measured in the intestines of transgenic and wild type mice. Results showed that Bifidobacteria were significantly increased (p < 0.001), whereas Salmonella were significantly decreased (p < 0.001) in transgenic mice compared to wild type mice. Our study suggests that rhLZ expression is a potential strategy to increase animal disease resistance. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf
2009-01-30
Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpointmore » mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.« less
Salmonid Chromosome Evolution as Revealed by a Novel Method for Comparing RADseq Linkage Maps
Gosselin, Thierry; Normandeau, Eric; Lamothe, Manuel; Isabel, Nathalie; Audet, Céline; Bernatchez, Louis
2016-01-01
Whole genome duplication (WGD) can provide material for evolutionary innovation. Family Salmonidae is ideal for studying the effects of WGD as the ancestral salmonid underwent WGD relatively recently, ∼65 Ma, then rediploidized and diversified. Extensive synteny between homologous chromosome arms occurs in extant salmonids, but each species has both conserved and unique chromosome arm fusions and fissions. Assembly of large, outbred eukaryotic genomes can be difficult, but structural rearrangements within such taxa can be investigated using linkage maps. RAD sequencing provides unprecedented ability to generate high-density linkage maps for nonmodel species, but can result in low numbers of homologous markers between species due to phylogenetic distance or differences in library preparation. Here, we generate a high-density linkage map (3,826 markers) for the Salvelinus genera (Brook Charr S. fontinalis), and then identify corresponding chromosome arms among the other available salmonid high-density linkage maps, including six species of Oncorhynchus, and one species for each of Salmo, Coregonus, and the nonduplicated sister group for the salmonids, Northern Pike Esox lucius for identifying post-duplicated homeologs. To facilitate this process, we developed MapComp to identify identical and proximate (i.e. nearby) markers between linkage maps using a reference genome of a related species as an intermediate, increasing the number of comparable markers between linkage maps by 5-fold. This enabled a characterization of the most likely history of retained chromosomal rearrangements post-WGD, and several conserved chromosomal inversions. Analyses of RADseq-based linkage maps from other taxa will also benefit from MapComp, available at: https://github.com/enormandeau/mapcomp/ PMID:28173098
Chromosome jumping from D4S10 (G8) toward the Huntington disease gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richards, J.E.; Gilliam, T.C.; Cole, J.L.
1988-09-01
The gene for Huntington disease (HD) has been localized to the distal portion of the short arm of human chromosome 4 by linkage analysis. Currently, the two closest DNA markers are D4S10 (G8), located /approx/3 centimorgans centromeric to HD, and D4S43 (C4H), positioned 0-1.5 centimorgans from HD. In an effort to move closer to the HD gene, with the eventual goal of identifying the gene itself, the authors have applied the technique of chromosome jumping to this region. A 200-kilobase jumping library has been constructed, and a jump from D4S10 has been obtained and its approximate distance verified by pulsedmore » field gel electrophoresis. Two restriction fragment length polymorphisms have been identified at the jump locus, which is denoted D4S81. Linkage analysis of previously identified recombinants between D4S10 and HD or D4S10 and D4S43 shows that in two of five events the jump has crossed the recombination points. This unequivocally orients D4S10 and D4S81 on the chromosome, provides additional markers for HD, and suggests that recombination frequency in this region of chromosome 4 may be increased, so that the physical distance from D4S10 to HD may not be as large as originally suspected.« less
Murray, J D; McKay, G M; Sharman, G B
1979-06-01
The greater glider, currently but incorrectly known as Schoinobates volans, is widely distributed in forested regions in eastern Australia. All animals studied from six different localities had 20 autosomes but there were four chromosomally distinct populations. At Royal National Park, N.S.W., all female greater gliders studied had 22 chromosomes including two large submetacentric X chromosomes with subterminal secondary constrictions in their longer arms. This form of X chromosome occurred also at Bondo State Forest, Myall Lakes and Coff's Harbour, N.S.W., and at Eidsvold, Qld. At Coomooboolaroo, Qld, the X chromosome was also a large submetacentric but a secondary constriction occurred in the shorter arm. Two chromosomally distinct types apparently occur in Royal National Park, one with XY males as in all other populations, and one with XY1Y2 males. Y or Y1, but not Y2, chromosomes were eliminated from the bone marrow in all populations but were present in spermatogonia, primary spermatocytes and cultured fibroblasts. Animals from Bondo State Forest had three or more acrocentric or metacentric supernumerary chromosomes.
Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.
2012-01-01
Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002
Zaccaria, Alfonso; Valenti, Anna Maria; Donti, Emilio; Gozzetti, Alessandro; Ronconi, Sonia; Spedicato, Francesco
2007-04-01
Five Philadelphia chromosome positive (Ph+) chronic myeloid leukemia (CML) patients with additional chromosome abnormalities at diagnosis have been followed during Imatinib therapy. In all, the Ph chromosome disappeared, while the 5 cases, additional abnormalities [dup(1); del(5), +8 (2 patients) and +14] persisted in the subsequent studies, performed over a period of 11 to 49 months, either alone or together with a karyotypically normal cell population. This finding is consistent with a secondary origin of the Ph chromosome in these patients. It is still to early to evaluate the possible prognostic value of these additional abnormalities.
McQuade, L R
1985-01-01
Variations in diploid chromosome number, due to the presence of B chromosomes, are found within the distribution of P. v. volans. B chromosomes vary in number between one and eight per animal, are mitotically stable in various body tissues and, unlike the Y chromosome in male P. v. volans, are not eliminated from bone marrow cells. Animals possessing B chromosomes have a distinct distribution, and it appears that a stable equilibrium between the forces of B chromosome accumulation or elimination is operating in those populations possessing these chromosomes.
Dickson, Laura B.; Sharakhova, Maria V.; Timoshevskiy, Vladimir A.; Fleming, Karen L.; Caspary, Alex; Sylla, Massamba; Black, William C.
2016-01-01
Aedes aegypti, the primary vector of dengue, yellow fever and Zika flaviviruses, consists of at least two subspecies. Aedes aegypti (Aaa) is light in color, has pale scales on the first abdominal tergite, oviposits in artificial containers, and preferentially feeds on humans. Aedes aegypti formosus (Aaf), has a dark cuticle, is restricted to sub-Saharan Africa, has no pale scales on the first abdominal tergite and frequently oviposits in natural containers. Scale patterns correlate with cuticle color in East Africa but not in Senegal, West Africa where black cuticle mosquitoes display a continuum of scaling patterns and breed domestically indoors. An earlier laboratory study did not indicate any pre- or postzygotic barriers to gene flow between Aaa and Aaf in East Africa. However, similar attempts to construct F1 intercross families between Aaa laboratory strains and Senegal Ae. aegypti (SenAae) failed due to poor F1 oviposition and low F2 egg-to-adult survival. Insemination and assortative mating experiments failed to identify prezygotic mating barriers. Backcrosses were performed to test for postzygotic isolation patterns consistent with Haldane’s rule modified for species, like Aedes, that have an autosomal sex determining locus (SDL). Egg-pupal survival was predicted to be low in females mated to hybrid F1 males but average when a male mates with a hybrid F1 female. Survival was in fact significantly reduced when females mated to hybrid males but egg-pupal survival was significantly increased when males were mated to hybrid F1 females. These observations are therefore inconclusive with regards to Haldane’s rule. Basic cytogenetic analyses and Fluorescent In Situ Hybridization (FISH) experiments were performed to compare SenAae strains with the IB12 strain of Aaa that was used for genome sequencing and physical mapping. Some SenAae strains had longer chromosomes than IB12 and significantly different centromeric indices on chromosomes 1 and 3. DAPI staining
NASA Astrophysics Data System (ADS)
Sanchez, P.; Hinojosa, J.; Ruiz, R.
2005-06-01
Recently, neuromodeling methods of microwave devices have been developed. These methods are suitable for the model generation of novel devices. They allow fast and accurate simulations and optimizations. However, the development of libraries makes these methods to be a formidable task, since they require massive input-output data provided by an electromagnetic simulator or measurements and repeated artificial neural network (ANN) training. This paper presents a strategy reducing the cost of library development with the advantages of the neuromodeling methods: high accuracy, large range of geometrical and material parameters and reduced CPU time. The library models are developed from a set of base prior knowledge input (PKI) models, which take into account the characteristics common to all the models in the library, and high-level ANNs which give the library model outputs from base PKI models. This technique is illustrated for a microwave multiconductor tunable phase shifter using anisotropic substrates. Closed-form relationships have been developed and are presented in this paper. The results show good agreement with the expected ones.
Sotero-Caio, Cibele G; Volleth, Marianne; Gollahon, Lauren S; Fu, Beiyuan; Cheng, William; Ng, Bee L; Yang, Fengtang; Baker, Robert J
2013-12-26
New World leaf-nosed bats, Phyllostomidae, represent a lineage of Chiroptera marked by unprecedented morphological/ecological diversity and extensive intergeneric chromosomal reorganization. There are still disagreements regarding their systematic relationships due to morphological convergence among some groups. Their history of karyotypic evolution also remains to be documented. To better understand the evolutionary relationships within Phyllostomidae, we developed chromosome paints from the bat species Macrotus californicus. We tested the potential of these paints as phylogenetic tools by looking for chromosomal signatures in two lineages of nectarivorous phyllostomids whose independent origins have been statistically supported by molecular phylogenies. By examining the chromosomal homologies defined by chromosome painting among two representatives of the subfamily Glossophaginae (Glossophaga soricina and Anoura cultrata) and one species from the subfamily Lonchophyllinae (Lonchophylla concava), we found chromosomal correspondence in regions not previously detected by other comparative cytogenetic techniques. We proposed the corresponding human chromosomal segments for chromosomes of the investigated species and found two syntenic associations shared by G. soricina and A. cultrata. Comparative painting with whole chromosome-specific paints of M. californicus demonstrates an extensive chromosomal reorganization within the two lineages of nectarivorous phyllostomids, with a large number of chromosomes shared between M. californicus and G. soricina. We show that the evolution of nectar-feeding bats occurs mainly by reshuffling of chiropteran Evolutionarily Conserved Units (ECUs). Robertsonian fusions/fissions and inversions seem to be important modifiers of phyllostomid karyotypes, and autapomorphic character states are common within species. Macrotus californicus chromosome paints will be a valuable tool for documenting the pattern of karyotypic evolution within
Pokorná, Martina; Giovannotti, Massimo; Kratochvíl, Lukáš; Caputo, Vincenzo; Olmo, Ettore; Ferguson-Smith, Malcolm A; Rens, Willem
2012-08-01
In contrast to mammals, birds exhibit a slow rate of chromosomal evolution. It is not clear whether high chromosome conservation is an evolutionary novelty of birds or was inherited from an earlier avian ancestor. The evolutionary conservatism of macrochromosomes between birds and turtles supports the latter possibility; however, the rate of chromosomal evolution is largely unknown in other sauropsids. In squamates, we previously reported strong conservatism of the chromosomes syntenic with the avian Z, which could reflect a peculiarity of this part of the genome. The chromosome 1 of iguanians and snakes is largely syntenic with chromosomes 3, 5 and 7 of the avian ancestral karyotype. In this project, we used comparative chromosome painting to determine how widely this synteny is conserved across nine families covering most of the main lineages of Squamata. The results suggest that the association of the avian ancestral chromosomes 3, 5 and 7 can be dated back to at least the early Jurassic and could be an ancestral characteristic for Unidentata (Serpentes, Iguania, Anguimorpha, Laterata and Scinciformata). In Squamata chromosome conservatism therefore also holds for the parts of the genome which are homologous to bird autosomes, and following on from this, a slow rate of chromosomal evolution could be a common characteristic of all sauropsids. The large evolutionary stasis in chromosome organization in birds therefore seems to be inherited from their ancestors, and it is particularly striking in comparison with mammals, probably the only major tetrapod lineage with an increased rate of chromosomal rearrangements as a whole.
Basinko, Audrey; Giovannucci Uzielli, Maria Luisa; Scarselli, Gloria; Priolo, Manuela; Timpani, Giuseppina; De Braekeleer, Marc
2012-02-01
We report here a child with a ring chromosome 5 (r(5)) associated with facial dysmorphology and multiple congenital abnormalities. Fluorescent in situ hybridization (FISH) using bacterial artificial chromosome (BAC) clones was performed to determine the breakpoints involved in the r(5). The 5p deletion extended from 5p13.2-3 to 5pter and measured 34.61 Mb (range: 33.7-35.52 Mb) while the 5q deletion extended from 5q35.3 to 5qter and measured 2.44 Mb (range: 2.31-2.57 Mb). The patient presented signs such as microcephaly, hypertelorism, micrognathia and epicanthal folds, partially recalling those of a deletion of the short arm of chromosome 5 and the "cri-du-chat" syndrome. The most striking phenotypic features were the congenital heart abnormalities which have been frequently reported in deletions of the distal part of the long arm of chromosome 5 and in rings leading to a 5q35-5qter deletion. However, the NKX2-5 gene, which has been related to congenital heart defects, was not deleted in our patient, nor presumably to some other patients with 5q35.3-5qter deletion. We propose that VEGFR3, deleted in our patient, could be a candidate gene for the congenital heart abnormalities observed. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Badenhorst, Daleen; Hillier, LaDeana W; Literman, Robert; Montiel, Eugenia Elisabet; Radhakrishnan, Srihari; Shen, Yingjia; Minx, Patrick; Janes, Daniel E; Warren, Wesley C; Edwards, Scott V; Valenzuela, Nicole
2015-06-24
Comparative genomics continues illuminating amniote genome evolution, but for many lineages our understanding remains incomplete. Here, we refine the assembly (CPI 3.0.3 NCBI AHGY00000000.2) and develop a cytogenetic map of the painted turtle (Chrysemys picta-CPI) genome, the first in turtles and in vertebrates with temperature-dependent sex determination. A comparison of turtle genomes with those of chicken, selected nonavian reptiles, and human revealed shared and novel genomic features, such as numerous chromosomal rearrangements. The largest conserved syntenic blocks between birds and turtles exist in four macrochromosomes, whereas rearrangements were evident in these and other chromosomes, disproving that turtles and birds retain fully conserved macrochromosomes for greater than 300 Myr. C-banding revealed large heterochromatic blocks in the centromeric region of only few chromosomes. The nucleolar-organizing region (NOR) mapped to a single CPI microchromosome, whereas in some turtles and lizards the NOR maps to nonhomologous sex-chromosomes, thus revealing independent translocations of the NOR in various reptilian lineages. There was no evidence for recent chromosomal fusions as interstitial telomeric-DNA was absent. Some repeat elements (CR1-like, Gypsy) were enriched in the centromeres of five chromosomes, whereas others were widespread in the CPI genome. Bacterial artificial chromosome (BAC) clones were hybridized to 18 of the 25 CPI chromosomes and anchored to a G-banded ideogram. Several CPI sex-determining genes mapped to five chromosomes, and homology was detected between yet other CPI autosomes and the globally nonhomologous sex chromosomes of chicken, other turtles, and squamates, underscoring the independent evolution of vertebrate sex-determining mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Sequence, molecular properties, and chromosomal mapping of mouse lumican
NASA Technical Reports Server (NTRS)
Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)
1995-01-01
PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.
Segmental folding of chromosomes: A basis for structural and regulatory chromosomal neighborhoods?
Nora, Elphège P; Dekker, Job; Heard, Edith
2013-01-01
We discuss here a series of testable hypotheses concerning the role of chromosome folding into topologically associating domains (TADs). Several lines of evidence suggest that segmental packaging of chromosomal neighborhoods may underlie features of chromatin that span large domains, such as heterochromatin blocks, association with the nuclear lamina and replication timing. By defining which DNA elements preferentially contact each other, the segmentation of chromosomes into TADs may also underlie many properties of long-range transcriptional regulation. Several observations suggest that TADs can indeed provide a structural basis to regulatory landscapes, by controlling enhancer sharing and allocation. We also discuss how TADs may shape the evolution of chromosomes, by causing maintenance of synteny over large chromosomal segments. Finally we suggest a series of experiments to challenge these ideas and provide concrete examples illustrating how they could be practically applied. PMID:23832846
Application of artificial neural networks to identify equilibration in computer simulations
NASA Astrophysics Data System (ADS)
Leibowitz, Mitchell H.; Miller, Evan D.; Henry, Michael M.; Jankowski, Eric
2017-11-01
Determining which microstates generated by a thermodynamic simulation are representative of the ensemble for which sampling is desired is a ubiquitous, underspecified problem. Artificial neural networks are one type of machine learning algorithm that can provide a reproducible way to apply pattern recognition heuristics to underspecified problems. Here we use the open-source TensorFlow machine learning library and apply it to the problem of identifying which hypothetical observation sequences from a computer simulation are “equilibrated” and which are not. We generate training populations and test populations of observation sequences with embedded linear and exponential correlations. We train a two-neuron artificial network to distinguish the correlated and uncorrelated sequences. We find that this simple network is good enough for > 98% accuracy in identifying exponentially-decaying energy trajectories from molecular simulations.
ERIC Educational Resources Information Center
Journal of College Science Teaching, 2005
2005-01-01
Scientists have shown that a genetic element on one chromosome may direct gene activity on another. Howard Hughes Medical Institute (HHMI) researchers report that a multitasking master-control region appears to over-see both a set of its own genes and a related gene on a nearby chromosome. The findings reinforce the growing importance of location…
ERIC Educational Resources Information Center
Eberhart, George M., Comp.
This handbook contains articles, guidelines, and other information from the field of library science organized into the following chapters: (1) "Libraries," including some basic figures, academic libraries, public libraries, school libraries, special libraries, national libraries, state libraries, small libraries, facilities, the past, and the…
Krzywinski, Jaroslaw; Nusskern, Deborah R; Kern, Marcia K; Besansky, Nora J
2004-01-01
The karyotype of the African malaria mosquito Anopheles gambiae contains two pairs of autosomes and a pair of sex chromosomes. The Y chromosome, constituting approximately 10% of the genome, remains virtually unexplored, despite the recent completion of the A. gambiae genome project. Here we report the identification and characterization of Y chromosome sequences of total length approaching 150 kb. We developed 11 Y-specific PCR markers that consistently yielded male-specific products in specimens from both laboratory colony and natural populations. The markers are characterized by low sequence polymorphism in samples collected across Africa and by presence in more than one copy on the Y. Screening of the A. gambiae BAC library using these markers allowed detection of 90 Y-linked BAC clones. Analysis of the BAC sequences and other Y-derived fragments showed massive accumulation of a few transposable elements. Nevertheless, more complex sequences are apparently present on the Y; these include portions of an approximately 48-kb-long unmapped AAAB01008227 scaffold from the whole genome shotgun assembly. Anopheles Y appears not to harbor any of the genes identified in Drosophila Y. However, experiments suggest that one of the ORFs from the AAAB01008227 scaffold represents a fragment of a gene with male-specific expression. PMID:15082548
Ranz, José María; Casals, Ferran; Ruiz, Alfredo
2001-01-01
During the evolution of the genus Drosophila, the molecular organization of the major chromosomal elements has been repeatedly rearranged via the fixation of paracentric inversions. Little detailed information is available, however, on the extent and effect of these changes at the molecular level. In principle, a full description of the rate and pattern of change could reveal the limits, if any, to which the eukaryotic genome can accommodate reorganizations. We have constructed a high-density physical map of the largest chromosomal element in Drosophila repleta (chromosome 2) and compared the order and distances between the markers with those on the homologous chromosomal element (3R) in Drosophila melanogaster. The two species belong to different subgenera (Drosophila and Sophophora, respectively), which diverged 40–62 million years (Myr) ago and represent, thus, the farthest lineages within the Drosophila genus. The comparison reveals extensive reshuffling of gene order from centromere to telomere. Using a maximum likelihood method, we estimate that 114 ± 14 paracentric inversions have been fixed in this chromosomal element since the divergence of the two species, that is, 0.9–1.4 inversions fixed per Myr. Comparison with available rates of chromosomal evolution, taking into account genome size, indicates that the Drosophila genome shows the highest rate found so far in any eukaryote. Twenty-one small segments (23–599 kb) comprising at least two independent (nonoverlapping) markers appear to be conserved between D. melanogaster and D. repleta. These results are consistent with the random breakage model and do not provide significant evidence of functional constraint of any kind. They support the notion that the Drosophila genome is extraordinarily malleable and has a modular organization. The high rate of chromosomal change also suggests a very limited transferability of the positional information from the Drosophila genome to other insects. [The
Portela-Bens, Silvia; Merlo, Manuel Alejandro; Rodríguez, María Esther; Cross, Ismael; Manchado, Manuel; Kosyakova, Nadezda; Liehr, Thomas; Rebordinos, Laureana
2017-03-01
The evolution of genes related to sex and reproduction in fish shows high plasticity and, to date, the sex determination system has only been identified in a few species. Solea senegalensis has 42 chromosomes and an XX/XY chromosome system for sex determination, while related species show the ZZ/ZW system. Next-generation sequencing (NGS), multi-color fluorescence in situ hybridization (mFISH) techniques, and bioinformatics analysis have been carried out, with the objective of revealing new information about sex determination and reproduction in S. senegalensis. To that end, several bacterial artificial chromosome (BAC) clones that contain candidate genes involved in such processes (dmrt1, dmrt2, dmrt3, dmrt4, sox3, sox6, sox8, sox9, lh, cyp19a1a, amh, vasa, aqp3, and nanos3) were analyzed and compared with the same region in other related species. Synteny studies showed that the co-localization of dmrt1-dmrt2-drmt3 in the largest metacentric chromosome of S. senegalensis is coincident with that found in the Z chromosome of Cynoglossus semilaevis, which would potentially make this a sex proto-chromosome. Phylogenetic studies show the close proximity of S. senegalensis to Oryzias latipes, a species with an XX/XY system and a sex master gene. Comparative mapping provides evidence of the preferential association of these candidate genes in particular chromosome pairs. By using the NGS and mFISH techniques, it has been possible to obtain an integrated genetic map, which shows that 15 out of 21 chromosome pairs of S. senegalensis have at least one BAC clone. This result is important for distinguishing those chromosome pairs of S. senegalensis that are similar in shape and size. The mFISH analysis shows the following co-localizations in the same chromosomes: dmrt1-dmrt2-dmrt3, dmrt4-sox9-thrb, aqp3-sox8, cyp19a1a-fshb, igsf9b-sox3, and lysg-sox6.
Segmental folding of chromosomes: a basis for structural and regulatory chromosomal neighborhoods?
Nora, Elphège P; Dekker, Job; Heard, Edith
2013-09-01
We discuss here a series of testable hypotheses concerning the role of chromosome folding into topologically associating domains (TADs). Several lines of evidence suggest that segmental packaging of chromosomal neighborhoods may underlie features of chromatin that span large domains, such as heterochromatin blocks, association with the nuclear lamina and replication timing. By defining which DNA elements preferentially contact each other, the segmentation of chromosomes into TADs may also underlie many properties of long-range transcriptional regulation. Several observations suggest that TADs can indeed provide a structural basis to regulatory landscapes, by controlling enhancer sharing and allocation. We also discuss how TADs may shape the evolution of chromosomes, by causing maintenance of synteny over large chromosomal segments. Finally we suggest a series of experiments to challenge these ideas and provide concrete examples illustrating how they could be practically applied. © 2013 The Authors. Bioessays published by WILEY Periodicals, Inc.
X-Chromosome dosage compensation.
Meyer, Barbara J
2005-06-25
In mammals, flies, and worms, sex is determined by distinctive regulatory mechanisms that cause males (XO or XY) and females (XX) to differ in their dose of X chromosomes. In each species, an essential X chromosome-wide process called dosage compensation ensures that somatic cells of either sex express equal levels of X-linked gene products. The strategies used to achieve dosage compensation are diverse, but in all cases, specialized complexes are targeted specifically to the X chromosome(s) of only one sex to regulate transcript levels. In C. elegans, this sex-specific targeting of the dosage compensation complex (DCC) is controlled by the same developmental signal that establishes sex, the ratio of X chromosomes to sets of autosomes (X:A signal). Molecular components of this chromosome counting process have been defined. Following a common step of regulation, sex determination and dosage compensation are controlled by distinct genetic pathways. C. elegans dosage compensation is implemented by a protein complex that binds both X chromosomes of hermaphrodites to reduce transcript levels by one-half. The dosage compensation complex resembles the conserved 13S condensin complex required for both mitotic and meiotic chromosome resolution and condensation, implying the recruitment of ancient proteins to the new task of regulating gene expression. Within each C. elegans somatic cell, one of the DCC components also participates in the separate mitotic/meiotic condensin complex. Other DCC components play pivotal roles in regulating the number and distribution of crossovers during meiosis. The strategy by which C. elegans X chromosomes attract the condensin-like DCC is known. Small, well-dispersed X-recognition elements act as entry sites to recruit the dosage compensation complex and to nucleate spreading of the complex to X regions that lack recruitment sites. In this manner, a repressed chromatin state is spread in cis over short or long distances, thus establishing the
Mitotic chromosome condensation in vertebrates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vagnarelli, Paola, E-mail: P.Vagnarelli@ed.ac.uk
2012-07-15
Work from several laboratories over the past 10-15 years has revealed that, within the interphase nucleus, chromosomes are organized into spatially distinct territories [T. Cremer, C. Cremer, Chromosome territories, nuclear architecture and gene regulation in mammalian cells, Nat. Rev. Genet. 2 (2001) 292-301 and T. Cremer, M. Cremer, S. Dietzel, S. Muller, I. Solovei, S. Fakan, Chromosome territories-a functional nuclear landscape, Curr. Opin. Cell Biol. 18 (2006) 307-316]. The overall compaction level and intranuclear location varies as a function of gene density for both entire chromosomes [J.A. Croft, J.M. Bridger, S. Boyle, P. Perry, P. Teague,W.A. Bickmore, Differences in themore » localization and morphology of chromosomes in the human nucleus, J. Cell Biol. 145 (1999) 1119-1131] and specific chromosomal regions [N.L. Mahy, P.E. Perry, S. Gilchrist, R.A. Baldock, W.A. Bickmore, Spatial organization of active and inactive genes and noncoding DNA within chromosome territories, J. Cell Biol. 157 (2002) 579-589] (Fig. 1A, A'). In prophase, when cyclin B activity reaches a high threshold, chromosome condensation occurs followed by Nuclear Envelope Breakdown (NEB) [1]. At this point vertebrate chromosomes appear as compact structures harboring an attachment point for the spindle microtubules physically recognizable as a primary constriction where the two sister chromatids are held together. The transition from an unshaped interphase chromosome to the highly structured mitotic chromosome (compare Figs. 1A and B) has fascinated researchers for several decades now; however a definite picture of how this process is achieved and regulated is not yet in our hands and it will require more investigation to comprehend the complete process. From a biochemical point of view a vertebrate mitotic chromosomes is composed of DNA, histone proteins (60%) and non-histone proteins (40%) [6]. I will discuss below what is known to date on the contribution of these two different
Chromosome abnormalities in sperm of individuals with constitutional sex chromosomal abnormalities.
Ferlin, A; Garolla, A; Foresta, C
2005-01-01
The most common type of karyotype abnormality detected in infertile subjects is represented by Klinefelter's syndrome, and the most frequent non-chromosomal alteration is represented by Y chromosome long arm microdeletions. Here we report our experience and a review of the literature on sperm sex chromosome aneuploidies in these two conditions. Non mosaic 47,XXY Klinefelter patients (12 subjects) show a significantly lower percentage of normal Y-bearing sperm and slightly higher percentage of normal X-bearing sperm. Consistent with the hypothesis that 47,XXY germ cells may undergo and complete meiosis, aneuploidy rate for XX- and XY-disomies is also increased with respect to controls, whereas the percentage of YY-disomies is normal. Aneuploidy rates in men with mosaic 47,XXY/46,XY (11 subjects) are lower than those observed in men with non-mosaic Klinefelter's syndrome, and only the frequency of XY-disomic sperm is significantly higher with respect to controls. Although the great majority of children born by intracytoplasmic sperm injection from Klinefelter subjects are chromosomally normal, the risk of producing offspring with chromosome aneuploidies is significant. Men with Y chromosome microdeletions (14 subjects) showed a reduction of normal Y-bearing sperm, and an increase in nullisomic and XY-disomic sperm, suggesting an instability of the deleted Y chromosome causing its loss in germ cells, and meiotic alterations leading to XY non-disjunction. Intracytoplasmic injection of sperm from Y-deleted men will therefore transmit the deletion to male children, and therefore the spermatogenic impairment, but raises also concerns of generating 45,X and 47,XXY embryos. Copyright 2005 S. Karger AG, Basel.
Förster, D W; Mathias, M L; Britton-Davidian, J; Searle, J B
2013-01-01
Chromosome races of Mus musculus domesticus are characterised by particular sets of metacentric chromosomes formed by Robertsonian fusions and whole-arm reciprocal translocations. The Atlantic island of Madeira is inhabited by six chromosome races of house mice with 6–9 pairs of metacentric chromosomes. Three of these races are characterised by the metacentric 3.8 also found elsewhere in the distribution of M. m. domesticus, including Denmark and Spain. We investigated the possibility that metacentric 3.8 was introduced to Madeira during the initial colonisation, as this could have ‘seeded' the cascade of chromosomal mutation that is the basis of the extraordinary chromosomal radiation observed on the island. Variation at 24 microsatellite loci mapping to three different chromosomal regions (proximal, interstitial and distal) of mouse chromosomes 3 and 8 was investigated in 179 mice from Madeira, Denmark, Portugal, Spain, Italy and Scotland. Analyses of microsatellite loci closely linked to the centromeres of these chromosomes (‘proximal loci') do not support a common evolutionary origin of metacentric 3.8 among Madeiran, Danish and Spanish mouse populations. Our results suggest that Madeiran mice are genetically more similar to standard karyotype mice from Portugal than to metacentric mice from elsewhere. There is expected to be an interruption to gene flow between hybridising metacentric races on Madeira, particularly in the chromosomal regions close to the rearrangement breakpoints. Consistent with this, relating to differentiation involving chromosomes 3 and 8 on Madeira, we found greater genetic structure among races for proximal than interstitial or distal loci. PMID:23232832
... Chromosome Disorder Outreach, Inc is a non-profit organization. Founded, supported, and run by parents just like ... Chromosome Disorder Outreach, Inc, a 501c non-profit organization. CDO is a 501C3 non-profit organization. FL ...
Brinkmann, Ulrich; Vasmatzis, George; Lee, Byungkook; Yerushalmi, Noga; Essand, Magnus; Pastan, Ira
1998-01-01
We have used a combination of computerized database mining and experimental expression analyses to identify a gene that is preferentially expressed in normal male and female reproductive tissues, prostate, testis, fallopian tube, uterus, and placenta, as well as in prostate cancer, testicular cancer, and uterine cancer. This gene is located on the human X chromosome, and it is homologous to a family of genes encoding GAGE-like proteins. GAGE proteins are expressed in a variety of tumors and in testis. We designate the novel gene PAGE-1 because the expression pattern in the Cancer Genome Anatomy Project libraries indicates that it is predominantly expressed in normal and neoplastic prostate. Further database analysis indicates the presence of other genes with high homology to PAGE-1, which were found in cDNA libraries derived from testis, pooled libraries (with testis), and in a germ cell tumor library. The expression of PAGE-1 in normal and malignant prostate, testicular, and uterine tissues makes it a possible target for the diagnosis and possibly for the vaccine-based therapy of neoplasms of prostate, testis, and uterus. PMID:9724777
Brinkmann, U; Vasmatzis, G; Lee, B; Yerushalmi, N; Essand, M; Pastan, I
1998-09-01
We have used a combination of computerized database mining and experimental expression analyses to identify a gene that is preferentially expressed in normal male and female reproductive tissues, prostate, testis, fallopian tube, uterus, and placenta, as well as in prostate cancer, testicular cancer, and uterine cancer. This gene is located on the human X chromosome, and it is homologous to a family of genes encoding GAGE-like proteins. GAGE proteins are expressed in a variety of tumors and in testis. We designate the novel gene PAGE-1 because the expression pattern in the Cancer Genome Anatomy Project libraries indicates that it is predominantly expressed in normal and neoplastic prostate. Further database analysis indicates the presence of other genes with high homology to PAGE-1, which were found in cDNA libraries derived from testis, pooled libraries (with testis), and in a germ cell tumor library. The expression of PAGE-1 in normal and malignant prostate, testicular, and uterine tissues makes it a possible target for the diagnosis and possibly for the vaccine-based therapy of neoplasms of prostate, testis, and uterus.
Numerically abnormal chromosome constitutions in humans
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1993-12-31
Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.
Methods for chromosome-specific staining
Gray, J.W.; Pinkel, D.
1995-09-05
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.
Methods for chromosome-specific staining
Gray, Joe W.; Pinkel, Daniel
1995-01-01
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.
van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J
1998-06-01
DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vortkamp, A.; Gessler, M.; Le Paslier, D.
1994-08-01
Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.
Effect of Artificial Selection on Runs of Homozygosity in U.S. Holstein Cattle
Kim, Eui-Soo; Cole, John B.; Huson, Heather; Wiggans, George R.; Van Tassell, Curtis P.; Crooker, Brian A.; Liu, George; Da, Yang; Sonstegard, Tad S.
2013-01-01
The intensive selection programs for milk made possible by mass artificial insemination increased the similarity among the genomes of North American (NA) Holsteins tremendously since the 1960s. This migration of elite alleles has caused certain regions of the genome to have runs of homozygosity (ROH) occasionally spanning millions of continuous base pairs at a specific locus. In this study, genome signatures of artificial selection in NA Holsteins born between 1953 and 2008 were identified by comparing changes in ROH between three distinct groups under different selective pressure for milk production. The ROH regions were also used to estimate the inbreeding coefficients. The comparisons of genomic autozygosity between groups selected or unselected since 1964 for milk production revealed significant differences with respect to overall ROH frequency and distribution. These results indicate selection has increased overall autozygosity across the genome, whereas the autozygosity in an unselected line has not changed significantly across most of the chromosomes. In addition, ROH distribution was more variable across the genomes of selected animals in comparison to a more even ROH distribution for unselected animals. Further analysis of genome-wide autozygosity changes and the association between traits and haplotypes identified more than 40 genomic regions under selection on several chromosomes (Chr) including Chr 2, 7, 16 and 20. Many of these selection signatures corresponded to quantitative trait loci for milk, fat, and protein yield previously found in contemporary Holsteins. PMID:24348915
Origin of amphibian and avian chromosomes by fission, fusion, and retention of ancestral chromosomes
Voss, Stephen R.; Kump, D. Kevin; Putta, Srikrishna; Pauly, Nathan; Reynolds, Anna; Henry, Rema J.; Basa, Saritha; Walker, John A.; Smith, Jeramiah J.
2011-01-01
Amphibian genomes differ greatly in DNA content and chromosome size, morphology, and number. Investigations of this diversity are needed to identify mechanisms that have shaped the evolution of vertebrate genomes. We used comparative mapping to investigate the organization of genes in the Mexican axolotl (Ambystoma mexicanum), a species that presents relatively few chromosomes (n = 14) and a gigantic genome (>20 pg/N). We show extensive conservation of synteny between Ambystoma, chicken, and human, and a positive correlation between the length of conserved segments and genome size. Ambystoma segments are estimated to be four to 51 times longer than homologous human and chicken segments. Strikingly, genes demarking the structures of 28 chicken chromosomes are ordered among linkage groups defining the Ambystoma genome, and we show that these same chromosomal segments are also conserved in a distantly related anuran amphibian (Xenopus tropicalis). Using linkage relationships from the amphibian maps, we predict that three chicken chromosomes originated by fusion, nine to 14 originated by fission, and 12–17 evolved directly from ancestral tetrapod chromosomes. We further show that some ancestral segments were fused prior to the divergence of salamanders and anurans, while others fused independently and randomly as chromosome numbers were reduced in lineages leading to Ambystoma and Xenopus. The maintenance of gene order relationships between chromosomal segments that have greatly expanded and contracted in salamander and chicken genomes, respectively, suggests selection to maintain synteny relationships and/or extremely low rates of chromosomal rearrangement. Overall, the results demonstrate the value of data from diverse, amphibian genomes in studies of vertebrate genome evolution. PMID:21482624
ERIC Educational Resources Information Center
International Federation of Library Associations and Institutions, London (England).
Fifteen papers delivered for the Division of General Research Libraries at the 1992 International Federation of Library Associations and Institutions annual meeting are presented. These papers deal with national libraries, parliamentary (legislative) libraries, and university libraries. The papers are: (1) "Seeking Alternatives to National…
Majtánová, Zuzana; Choleva, Lukáš; Symonová, Radka; Ráb, Petr; Kotusz, Jan; Pekárik, Ladislav; Janko, Karel
2016-01-01
Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis). We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA). Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction. PMID:26808475
Majtánová, Zuzana; Choleva, Lukáš; Symonová, Radka; Ráb, Petr; Kotusz, Jan; Pekárik, Ladislav; Janko, Karel
2016-01-01
Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis). We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA). Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction.
Numerous Transitions of Sex Chromosomes in Diptera
Vicoso, Beatriz; Bachtrog, Doris
2015-01-01
Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa. PMID:25879221
Painting of fourth and chromosome-wide regulation of the 4th chromosome in Drosophila melanogaster.
Johansson, Anna-Mia; Stenberg, Per; Bernhardsson, Carolina; Larsson, Jan
2007-05-02
Drosophila melanogaster exhibits two expression-regulating systems that target whole, specific chromosomes: the dosage compensation system whereby the male-specific lethal complex doubles transcription of genes on the male X-chromosome and the chromosome 4-specific protein Painting of fourth, POF. POF is the first example of an autosome-specific protein and its presence raises the question of the universality of chromosome-specific regulation. Here we show that POF and heterochromatin protein 1 (HP1) are involved in the global regulation of the 4th chromosome. Contrary to previous conclusions, Pof is not essential for survival of diplo-4th karyotype flies. However, Pof is essential for survival of haplo-4th individuals and expression of chromosome 4 genes in diplo-4th individuals is decreased in the absence of Pof. Mapping of POF using chromatin immunoprecipitation suggested that it binds within genes. Furthermore, we show that POF binding is dependent on heterochromatin and that POF and HP1 bind interdependently to the 4th chromosome. We propose a balancing mechanism involving POF and HP1 that provides a feedback system for fine-tuning expression status of genes on the 4th chromosome.
Painting of fourth and chromosome-wide regulation of the 4th chromosome in Drosophila melanogaster
Johansson, Anna-Mia; Stenberg, Per; Bernhardsson, Carolina; Larsson, Jan
2007-01-01
Drosophila melanogaster exhibits two expression-regulating systems that target whole, specific chromosomes: the dosage compensation system whereby the male-specific lethal complex doubles transcription of genes on the male X-chromosome and the chromosome 4-specific protein Painting of fourth, POF. POF is the first example of an autosome-specific protein and its presence raises the question of the universality of chromosome-specific regulation. Here we show that POF and heterochromatin protein 1 (HP1) are involved in the global regulation of the 4th chromosome. Contrary to previous conclusions, Pof is not essential for survival of diplo-4th karyotype flies. However, Pof is essential for survival of haplo-4th individuals and expression of chromosome 4 genes in diplo-4th individuals is decreased in the absence of Pof. Mapping of POF using chromatin immunoprecipitation suggested that it binds within genes. Furthermore, we show that POF binding is dependent on heterochromatin and that POF and HP1 bind interdependently to the 4th chromosome. We propose a balancing mechanism involving POF and HP1 that provides a feedback system for fine-tuning expression status of genes on the 4th chromosome. PMID:17318176
Watanabe, Nobumoto; Sekine, Tomomi; Takagi, Masatoshi; Iwasaki, Jun-ichi; Imamoto, Naoko; Kawasaki, Hisashi; Osada, Hiroyuki
2009-01-23
Polo-like kinase 1 (Plk1) is one of the key regulators of mitotic cell division. In addition to an N-terminal protein kinase catalytic domain, Plk1 possesses a phosphopeptide binding domain named polo box domain (PBD) at its C terminus. PBD is postulated to be essential for Plk1 localization and substrate targeting. Here, we developed a high-throughput screening system to identify inhibitors of PBD-dependent binding and screened a chemical library. We isolated a benzotropolone-containing natural compound derived from nutgalls (purpurogallin (PPG)) that inhibited PBD-dependent binding in vitro and in vivo. PPG not only delayed the onset of mitosis but also prolonged the progression of mitosis in HeLa cells. Although apparently normal bipolar spindles were formed even in the presence of PPG, the perturbation of chromosome alignment at metaphase plates activated the spindle assembly checkpoint pathway. These results demonstrate the predominant role of PBD-dependent binding on smooth chromosome congression at metaphase.
Chromosomal Evolution in Chiroptera
Sotero-Caio, Cibele G.; Baker, Robert J.; Volleth, Marianne
2017-01-01
Chiroptera is the second largest order among mammals, with over 1300 species in 21 extant families. The group is extremely diverse in several aspects of its natural history, including dietary strategies, ecology, behavior and morphology. Bat genomes show ample chromosome diversity (from 2n = 14 to 62). As with other mammalian orders, Chiroptera is characterized by clades with low, moderate and extreme chromosomal change. In this article, we will discuss trends of karyotypic evolution within distinct bat lineages (especially Phyllostomidae, Hipposideridae and Rhinolophidae), focusing on two perspectives: evolution of genome architecture, modes of chromosomal evolution, and the use of chromosome data to resolve taxonomic problems. PMID:29027987
Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ
Gray, Joe W.; Weier, Heinz-Ulrich
1998-01-01
A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.
Y chromosome specific nucleic acid probe and method for identifying the Y chromosome in SITU
Gray, Joe W.; Weier, Heinz-Ulrich
1999-01-01
A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.
Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ
Gray, Joe W.; Weier, Heinz-Ulrich
2001-01-01
A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.
Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ
Gray, J.W.; Weier, H.U.
1998-11-24
A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.
Y chromosome specific nucleic acid probe and method for identifying the Y chromosome in SITU
Gray, J.W.; Weier, H.U.
1999-03-30
A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.
2013-01-01
Background New World leaf-nosed bats, Phyllostomidae, represent a lineage of Chiroptera marked by unprecedented morphological/ecological diversity and extensive intergeneric chromosomal reorganization. There are still disagreements regarding their systematic relationships due to morphological convergence among some groups. Their history of karyotypic evolution also remains to be documented. Results To better understand the evolutionary relationships within Phyllostomidae, we developed chromosome paints from the bat species Macrotus californicus. We tested the potential of these paints as phylogenetic tools by looking for chromosomal signatures in two lineages of nectarivorous phyllostomids whose independent origins have been statistically supported by molecular phylogenies. By examining the chromosomal homologies defined by chromosome painting among two representatives of the subfamily Glossophaginae (Glossophaga soricina and Anoura cultrata) and one species from the subfamily Lonchophyllinae (Lonchophylla concava), we found chromosomal correspondence in regions not previously detected by other comparative cytogenetic techniques. We proposed the corresponding human chromosomal segments for chromosomes of the investigated species and found two syntenic associations shared by G. soricina and A. cultrata. Conclusion Comparative painting with whole chromosome-specific paints of M. californicus demonstrates an extensive chromosomal reorganization within the two lineages of nectarivorous phyllostomids, with a large number of chromosomes shared between M. californicus and G. soricina. We show that the evolution of nectar-feeding bats occurs mainly by reshuffling of chiropteran Evolutionarily Conserved Units (ECUs). Robertsonian fusions/fissions and inversions seem to be important modifiers of phyllostomid karyotypes, and autapomorphic character states are common within species. Macrotus californicus chromosome paints will be a valuable tool for documenting the pattern of
Feng, Jiuhuan; Liu, Zhao; Cai, Xiwen; Jan, Chao-Chien
2013-01-01
Conventional karyotypes and various genetic linkage maps have been established in sunflower (Helianthus annuus L., 2n = 34). However, the relationship between linkage groups and individual chromosomes of sunflower remains unknown and has considerable relevance for the sunflower research community. Recently, a set of linkage group-specific bacterial /binary bacterial artificial chromosome (BAC/BIBAC) clones was identified from two complementary BAC and BIBAC libraries constructed for cultivated sunflower cv. HA89. In the present study, we used these linkage group-specific clones (∼100 kb in size) as probes to in situ hybridize to HA89 mitotic chromosomes at metaphase using the BAC- fluorescence in situ hybridization (FISH) technique. Because a characteristic of the sunflower genome is the abundance of repetitive DNA sequences, a high ratio of blocking DNA to probe DNA was applied to hybridization reactions to minimize the background noise. As a result, all sunflower chromosomes were anchored by one or two BAC/BIBAC clones with specific FISH signals. FISH analysis based on tandem repetitive sequences, such as rRNA genes, has been previously reported; however, the BAC-FISH technique developed here using restriction fragment length polymorphism (RFLP)−derived BAC/BIBAC clones as probes to apply genome-wide analysis is new for sunflower. As chromosome-specific cytogenetic markers, the selected BAC/BIBAC clones that encompass the 17 linkage groups provide a valuable tool for identifying sunflower cytogenetic stocks (such as trisomics) and tracking alien chromosomes in interspecific crosses. This work also demonstrates the potential of using a large-insert DNA library for the development of molecular cytogenetic resources. PMID:23316437
Biological dosimetry by interphase chromosome painting.
Durante, M; George, K; Yang, T C
1996-01-01
Both fluorescence in situ hybridization of metaphase spreads with whole-chromosome probes and premature chromosome condensation in interphase nuclei have been used in the past to estimate the radiation dose to lymphocytes. We combined these techniques to evaluate the feasibility of using painted interphase chromosomes for biodosimetry. Human peripheral lymphocytes were exposed to gamma rays and fused to mitotic Chinese hamster cells either immediately after irradiation or after 8 h incubation at 37 degrees C. Interphase or metaphase human chromosomes were hybridized with a composite probe specific for human chromosomes 3 and 4. The dose-response curve for fragment induction immediately after irradiation was linear; these results reflected breakage frequency in the total genome in terms of DNA content per chromosome. At 8 h after irradiation, the dose-response curve for chromosome interchanges, the prevalent aberration in interphase chromosomes, was linear-quadratic and similar to that observed for metaphase chromosomes. These results suggest that painting prematurely condensed chromosomes can be useful for biological dosimetry when blood samples are available shortly after the exposure, or when interphase cells are to be scored instead of mitotic cells.
Biological dosimetry by interphase chromosome painting
NASA Technical Reports Server (NTRS)
Durante, M.; George, K.; Yang, T. C.
1996-01-01
Both fluorescence in situ hybridization of metaphase spreads with whole-chromosome probes and premature chromosome condensation in interphase nuclei have been used in the past to estimate the radiation dose to lymphocytes. We combined these techniques to evaluate the feasibility of using painted interphase chromosomes for biodosimetry. Human peripheral lymphocytes were exposed to gamma rays and fused to mitotic Chinese hamster cells either immediately after irradiation or after 8 h incubation at 37 degrees C. Interphase or metaphase human chromosomes were hybridized with a composite probe specific for human chromosomes 3 and 4. The dose-response curve for fragment induction immediately after irradiation was linear; these results reflected breakage frequency in the total genome in terms of DNA content per chromosome. At 8 h after irradiation, the dose-response curve for chromosome interchanges, the prevalent aberration in interphase chromosomes, was linear-quadratic and similar to that observed for metaphase chromosomes. These results suggest that painting prematurely condensed chromosomes can be useful for biological dosimetry when blood samples are available shortly after the exposure, or when interphase cells are to be scored instead of mitotic cells.
Library Webmasters in Medium-Sized Academic Libraries
ERIC Educational Resources Information Center
Kneip, Jason
2007-01-01
Library webmasters in medium-sized academic libraries were surveyed about their educational backgrounds, job responsibilities, and training and experience levels in Web development. The article summarizes the findings of the survey with recommendations for libraries and library and information science programs. (Contains 7 tables, 5 figures,and 5…
Art Libraries Section. Special Libraries Division. Papers.
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on art libraries, librarianship, and documentation presented at the 1982 International Federation of Library Associations (IFLA) conference include: (1) "The Tyranny of Distance: Art Libraries in Canada," a description by Mary F. Williamson of Canada's regional art libraries which serve both art students and the general public;…
Mechanisms of Chromosome Congression during Mitosis
Maiato, Helder; Gomes, Ana Margarida; Sousa, Filipe; Barisic, Marin
2017-01-01
Chromosome congression during prometaphase culminates with the establishment of a metaphase plate, a hallmark of mitosis in metazoans. Classical views resulting from more than 100 years of research on this topic have attempted to explain chromosome congression based on the balance between opposing pulling and/or pushing forces that reach an equilibrium near the spindle equator. However, in mammalian cells, chromosome bi-orientation and force balance at kinetochores are not required for chromosome congression, whereas the mechanisms of chromosome congression are not necessarily involved in the maintenance of chromosome alignment after congression. Thus, chromosome congression and maintenance of alignment are determined by different principles. Moreover, it is now clear that not all chromosomes use the same mechanism for congressing to the spindle equator. Those chromosomes that are favorably positioned between both poles when the nuclear envelope breaks down use the so-called “direct congression” pathway in which chromosomes align after bi-orientation and the establishment of end-on kinetochore-microtubule attachments. This favors the balanced action of kinetochore pulling forces and polar ejection forces along chromosome arms that drive chromosome oscillatory movements during and after congression. The other pathway, which we call “peripheral congression”, is independent of end-on kinetochore microtubule-attachments and relies on the dominant and coordinated action of the kinetochore motors Dynein and Centromere Protein E (CENP-E) that mediate the lateral transport of peripheral chromosomes along microtubules, first towards the poles and subsequently towards the equator. How the opposite polarities of kinetochore motors are regulated in space and time to drive congression of peripheral chromosomes only now starts to be understood. This appears to be regulated by position-dependent phosphorylation of both Dynein and CENP-E and by spindle microtubule
Compositions for chromosome-specific staining
Gray, Joe W.; Pinkel, Daniel
1998-01-01
Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods are provided to disable the hybridization capacity of shared, high copy repetitive sequences and/or remove such sequences to provide for useful contrast. Still further methods are provided to produce chromosome-specific staining reagents which are made specific to the targeted chromosomal material, which can be one or more whole chromosomes, one or more regions on one or more chromosomes, subsets of chromosomes and/or the entire genome. Probes and test kits are provided for use in tumor cytogenetics, in the detection of disease related loci, in analysis of structural abnormalities, such as translocations, and for biological dosimetry. Further, methods and prenatal test kits are provided to stain targeted chromosomal material of fetal cells, including fetal cells obtained from maternal blood. Still further, the invention provides for automated means to detect and analyse chromosomal abnormalities.
Acrocentric chromosome associations in man.
Jacobs, P A; Mayer, M; Morton, N E
1976-01-01
Heterogeneity among chromosomes was found to be a highly significant source of variation for association proportions, while culture, slide, and observer were negligible sources of variation for association proportions although important for numbers of associations. The consequences of these results for tests of group differences are discussed. It seems evident that each pair of acrocentric chromosomes has its own characteristic probability of entering into association. This is presumably a combination of the probability for each individual member of the pair, a proposition easily tested utilizing acrocentric chromosomes carrying polymorphisms which allow each member of the pair to be individually recognized. A mathematical theory for pairwise satellite association was developed and shown to fit observations on banded chromosomes. While we found very significant heterogeneity among individuals in the frequency with which different chromosomes entered into associations, there was no significant evidence for preferential association between any particular chromosomes, either heterologous or homologous. This finding in our material of apparently random associations between different chromosomes is contrary to claims made by other investigators and should be tested on other material. No correlation was found between the phenotype of the chromosome, as judged by cytogenetic polymorphisms, and its probability of association. PMID:795295
Compositions for chromosome-specific staining
Gray, J.W.; Pinkel, D.
1998-05-26
Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. The methods produce staining patterns that can be tailored for specific cytogenetic analyses. The probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods are provided to disable the hybridization capacity of shared, high copy repetitive sequences and/or remove such sequences to provide for useful contrast. Still further methods are provided to produce chromosome-specific staining reagents which are made specific to the targeted chromosomal material, which can be one or more whole chromosomes, one or more regions on one or more chromosomes, subsets of chromosomes and/or the entire genome. Probes and test kits are provided for use in tumor cytogenetics, in the detection of disease related loci, in analysis of structural abnormalities, such as translocations, and for biological dosimetry. Methods and prenatal test kits are provided to stain targeted chromosomal material of fetal cells, including fetal cells obtained from maternal blood. The invention provides for automated means to detect and analyze chromosomal abnormalities. 17 figs.
Carvalho, Natalia D. M.; Carmo, Edson; Neves, Rogerio O.; Schneider, Carlos Henrique; Gross, Maria Claudia
2016-01-01
Abstract Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by Cot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by Cot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using Cot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, Cot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of Cot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position. PMID:27551343
Standards for Medical Library Technicians, Medical Library Association.
ERIC Educational Resources Information Center
Medical Library Association, Chicago, IL.
A medical library technician is a semiprofessional library employee whose duties require knowledge and skill based on a minimum of two years' general college education that includes library instruction beyond the clerical level. The medical library technician must have a practical knowledge of library functions and services, an understanding of…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duggan, D.J.; Baysal, B.E.; Gollin, S.M.
A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less
Sequential cloning of chromosomes
Lacks, S.A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.
Sequential cloning of chromosomes
Lacks, Sanford A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.
Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana
2016-07-18
Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis.
Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana
2016-01-01
Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis. PMID:27425629
Sequencing papaya X and Yh chromosomes reveals molecular basis of incipient sex chromosome evolution
Wang, Jianping; Na, Jong-Kuk; Yu, Qingyi; Gschwend, Andrea R.; Han, Jennifer; Zeng, Fanchang; Aryal, Rishi; VanBuren, Robert; Murray, Jan E.; Zhang, Wenli; Navajas-Pérez, Rafael; Feltus, F. Alex; Lemke, Cornelia; Tong, Eric J.; Chen, Cuixia; Man Wai, Ching; Singh, Ratnesh; Wang, Ming-Li; Min, Xiang Jia; Alam, Maqsudul; Charlesworth, Deborah; Moore, Paul H.; Jiang, Jiming; Paterson, Andrew H.; Ming, Ray
2012-01-01
Sex determination in papaya is controlled by a recently evolved XY chromosome pair, with two slightly different Y chromosomes controlling the development of males (Y) and hermaphrodites (Yh). To study the events of early sex chromosome evolution, we sequenced the hermaphrodite-specific region of the Yh chromosome (HSY) and its X counterpart, yielding an 8.1-megabase (Mb) HSY pseudomolecule, and a 3.5-Mb sequence for the corresponding X region. The HSY is larger than the X region, mostly due to retrotransposon insertions. The papaya HSY differs from the X region by two large-scale inversions, the first of which likely caused the recombination suppression between the X and Yh chromosomes, followed by numerous additional chromosomal rearrangements. Altogether, including the X and/or HSY regions, 124 transcription units were annotated, including 50 functional pairs present in both the X and HSY. Ten HSY genes had functional homologs elsewhere in the papaya autosomal regions, suggesting movement of genes onto the HSY, whereas the X region had none. Sequence divergence between 70 transcripts shared by the X and HSY revealed two evolutionary strata in the X chromosome, corresponding to the two inversions on the HSY, the older of which evolved about 7.0 million years ago. Gene content differences between the HSY and X are greatest in the older stratum, whereas the gene content and order of the collinear regions are identical. Our findings support theoretical models of early sex chromosome evolution. PMID:22869747
Wang, Jianping; Na, Jong-Kuk; Yu, Qingyi; Gschwend, Andrea R; Han, Jennifer; Zeng, Fanchang; Aryal, Rishi; VanBuren, Robert; Murray, Jan E; Zhang, Wenli; Navajas-Pérez, Rafael; Feltus, F Alex; Lemke, Cornelia; Tong, Eric J; Chen, Cuixia; Wai, Ching Man; Singh, Ratnesh; Wang, Ming-Li; Min, Xiang Jia; Alam, Maqsudul; Charlesworth, Deborah; Moore, Paul H; Jiang, Jiming; Paterson, Andrew H; Ming, Ray
2012-08-21
Sex determination in papaya is controlled by a recently evolved XY chromosome pair, with two slightly different Y chromosomes controlling the development of males (Y) and hermaphrodites (Y(h)). To study the events of early sex chromosome evolution, we sequenced the hermaphrodite-specific region of the Y(h) chromosome (HSY) and its X counterpart, yielding an 8.1-megabase (Mb) HSY pseudomolecule, and a 3.5-Mb sequence for the corresponding X region. The HSY is larger than the X region, mostly due to retrotransposon insertions. The papaya HSY differs from the X region by two large-scale inversions, the first of which likely caused the recombination suppression between the X and Y(h) chromosomes, followed by numerous additional chromosomal rearrangements. Altogether, including the X and/or HSY regions, 124 transcription units were annotated, including 50 functional pairs present in both the X and HSY. Ten HSY genes had functional homologs elsewhere in the papaya autosomal regions, suggesting movement of genes onto the HSY, whereas the X region had none. Sequence divergence between 70 transcripts shared by the X and HSY revealed two evolutionary strata in the X chromosome, corresponding to the two inversions on the HSY, the older of which evolved about 7.0 million years ago. Gene content differences between the HSY and X are greatest in the older stratum, whereas the gene content and order of the collinear regions are identical. Our findings support theoretical models of early sex chromosome evolution.
[Chromosome examination of missed abortion patients].
Hu, Haomei; Yang, Hua; Yin, Zhenhui; Zhao, Lu
2015-09-15
To investigate the relationship between the missed abortion and chromosome abnormality and guide the healthy birth. From June 2014 to April 2015 in Tianjin central hospital of gynecology and obstetrics, we examined venous blood from 90 missed abortion couples for chromosome karyotype by lymphocyte culture method and we also examined their chromosome karyotype of abortion villus samples by high-throughput sequencing technologies. Out of the 90 couples' blood chromosome examinations, 7 were abnormal, and the abnormal rate was 3.89%, including 3 cases reciprocal translocation, 2 cases robertsonian translocation and 2 cases inversion. Abortion villus samples from the same population were also checked, of which 85 cases succeeded, with the success rate of 94.4%. Among them, villi chromosome abnormalities were found in 50 cases, including 39 cases with abnormal chromosome numbers, 11 cases with abnormal chromosome structure, and the total abnormal rate was 58.8%. In addition, the villi chromosome abnormality rate of patients with recurrent missed abortion (≥2 times) and first missed abortion were 61.7% and 55.2%, respectively, and the difference was not significant (P>0.05). The villi chromosome abnormality rate of pregnant women with age≥35 years old was 71.1%, while the pregnant women with aged <35 years old was 45% (P<0.05). Chromosome abnormality is an important cause of missed abortion; villi chromosome abnormality rate has nothing to do with the number of missed abortion; pregnant woman with age≥35 years old is risk factor of the villi chromosome abnormality.
USDA-ARS?s Scientific Manuscript database
A chromosome specific recombinant inbred line (CS-B05shRIL) population was created from a cross of TM-1, the genetic standard line of Gossypium hirsutum L. and CS-B05sh, a previously released interspecific chromosome substitution line in which all of the chromosome pairs are genetically similar to T...
Welcome to the National Wetlands Research Center Library: Not Just Another Library-A Special Library
Broussard, Linda
2007-01-01
Libraries are grouped into four major types: public, school, academic, and special. The U.S. Geological Survey's (USGS) National Wetlands Research Center (NWRC) library is classified as a special library because it is sponsored by the Federal government, and the collections focus on a specific subject. The NWRC library is the only USGS library dedicated to wetland science. Library personnel offer expert research services to meet the informational needs of NWRC scientists, managers, and support personnel. The NWRC library participates in international cataloging and resource sharing, which allows libraries from throughout the world to borrow from its collections. This sharing facilitates the research of other governmental agencies, universities, and those interested in the study of wetlands.
ERIC Educational Resources Information Center
Gbadamosi, Belau Olatunde
2011-01-01
The paper examines the level of library automation and virtual library development in four academic libraries. A validated questionnaire was used to capture the responses from academic librarians of the libraries under study. The paper discovers that none of the four academic libraries is fully automated. The libraries make use of librarians with…
Liu, Chang
2017-01-01
The spatial organization of the genome in the nucleus is critical for many cellular processes. It has been broadly accepted that the packing of chromatin inside the nucleus is not random, but structured at several hierarchical levels. The Hi-C method combines Chromatin Conformation Capture and high-throughput sequencing, which allows interrogating genome-wide chromatin interactions. Depending on the sequencing depth, chromatin packing patterns derived from Hi-C experiments can be viewed on a chromosomal scale or at a local genic level. Here, I describe a protocol of plant in situ Hi-C library preparation, which covers procedures starting from tissue fixation to library amplification.
Salas, Lucas A; Koestler, Devin C; Butler, Rondi A; Hansen, Helen M; Wiencke, John K; Kelsey, Karl T; Christensen, Brock C
2018-05-29
Genome-wide methylation arrays are powerful tools for assessing cell composition of complex mixtures. We compare three approaches to select reference libraries for deconvoluting neutrophil, monocyte, B-lymphocyte, natural killer, and CD4+ and CD8+ T-cell fractions based on blood-derived DNA methylation signatures assayed using the Illumina HumanMethylationEPIC array. The IDOL algorithm identifies a library of 450 CpGs, resulting in an average R 2 = 99.2 across cell types when applied to EPIC methylation data collected on artificial mixtures constructed from the above cell types. Of the 450 CpGs, 69% are unique to EPIC. This library has the potential to reduce unintended technical differences across array platforms.
Gardiner, Jack; Schroeder, Steven; Polacco, Mary L.; Sanchez-Villeda, Hector; Fang, Zhiwei; Morgante, Michele; Landewe, Tim; Fengler, Kevin; Useche, Francisco; Hanafey, Michael; Tingey, Scott; Chou, Hugh; Wing, Rod; Soderlund, Carol; Coe, Edward H.
2004-01-01
Our goal is to construct a robust physical map for maize (Zea mays) comprehensively integrated with the genetic map. We have used a two-dimensional 24 × 24 overgo pooling strategy to anchor maize expressed sequence tagged (EST) unigenes to 165,888 bacterial artificial chromosomes (BACs) on high-density filters. A set of 70,716 public maize ESTs seeded derivation of 10,723 EST unigene assemblies. From these assemblies, 10,642 overgo sequences of 40 bp were applied as hybridization probes. BAC addresses were obtained for 9,371 overgo probes, representing an 88% success rate. More than 96% of the successful overgo probes identified two or more BACs, while 5% identified more than 50 BACs. The majority of BACs identified (79%) were hybridized with one or two overgos. A small number of BACs hybridized with eight or more overgos, suggesting that these BACs must be gene rich. Approximately 5,670 overgos identified BACs assembled within one contig, indicating that these probes are highly locus specific. A total of 1,795 megabases (Mb; 87%) of the total 2,050 Mb in BAC contigs were associated with one or more overgos, which are serving as sequence-tagged sites for single nucleotide polymorphism development. Overgo density ranged from less than one overgo per megabase to greater than 20 overgos per megabase. The majority of contigs (52%) hit by overgos contained three to nine overgos per megabase. Analysis of approximately 1,022 Mb of genetically anchored BAC contigs indicates that 9,003 of the total 13,900 overgo-contig sites are genetically anchored. Our results indicate overgos are a powerful approach for generating gene-specific hybridization probes that are facilitating the assembly of an integrated genetic and physical map for maize. PMID:15020742
Computational model for chromosomal instabilty
NASA Astrophysics Data System (ADS)
Zapperi, Stefano; Bertalan, Zsolt; Budrikis, Zoe; La Porta, Caterina
2015-03-01
Faithful segregation of genetic material during cell division requires alignment of the chromosomes between the spindle poles and attachment of their kinetochores to each of the poles. Failure of these complex dynamical processes leads to chromosomal instability (CIN), a characteristic feature of several diseases including cancer. While a multitude of biological factors regulating chromosome congression and bi-orientation have been identified, it is still unclear how they are integrated into a coherent picture. Here we address this issue by a three dimensional computational model of motor-driven chromosome congression and bi-orientation. Our model reveals that successful cell division requires control of the total number of microtubules: if this number is too small bi-orientation fails, while if it is too large not all the chromosomes are able to congress. The optimal number of microtubules predicted by our model compares well with early observations in mammalian cell spindles. Our results shed new light on the origin of several pathological conditions related to chromosomal instability.
Sex chromosomes in land plants.
Ming, Ray; Bendahmane, Abdelhafid; Renner, Susanne S
2011-01-01
Sex chromosomes in land plants can evolve as a consequence of close linkage between the two sex determination genes with complementary dominance required to establish stable dioecious populations, and they are found in at least 48 species across 20 families. The sex chromosomes in hepatics, mosses, and gymnosperms are morphologically heteromorphic. In angiosperms, heteromorphic sex chromosomes are found in at least 19 species from 4 families, while homomorphic sex chromosomes occur in 20 species from 13 families. The prevalence of the XY system found in 44 out of 48 species may reflect the predominance of the evolutionary pathway from gynodioecy towards dioecy. All dioecious species have the potential to evolve sex chromosomes, and reversions back from dioecy to various forms of monoecy, gynodioecy, or androdioecy have also occurred. Such reversals may occur especially during the early stages of sex chromosome evolution before the lethality of the YY (or WW) genotype is established.
Micromechanical study of mitotic chromosome structure
NASA Astrophysics Data System (ADS)
Marko, John
2011-03-01
Our group has developed micromanipulation techniques for study of the highly compacted mitotic form of chromosome found in eukaryote cells during cell division. Each metaphase chromosome contains two duplicate centimeter-long DNA molecules, folded up by proteins into cylindrical structures several microns in length. Native chromosomes display linear and reversible stretching behavior over a wide range of extensions (up to 5x native length for amphibian chromosomes), described by a Young modulus of about 300 Pa. Studies using DNA-cutting and protein-cutting enzymes have revealed that metaphase chromosomes behave as a network of chromatin fibers held together by protein-based isolated crosslinks. Our results are not consistent with the more classical model of loops of chromatin attached to a protein-based structural organizer or ``scaffold". In short, our experiments indicate that metaphase chromosomes can be considered to be ``gels" of chromatin; the stretching modulus of a whole chromosome is consistent with stretching of the chromatin fibers contained within it. Experiments using topoisomerases suggest that topological constraints may play an appreciable role in confining chromatin in the metaphase chromosome. Finally, recent experiments on human chromosomes will be reviewed, including results of experiments where chromosome-folding proteins are specifically depleted using siRNA methods. Supported by NSF-MCB-1022117, DMR-0715099, PHY-0852130, DMR-0520513, NCI 1U54CA143869-01 (NU-PS-OC), and the American Heart Association.
Harper, John; Phillips, Dylan; Thomas, Ann; Gasior, Dagmara; Evans, Caron; Powell, Wayne; King, Julie; King, Ian; Jenkins, Glyn; Armstead, Ian
2018-04-09
Supernumerary 'B' chromosomes are non-essential components of the genome present in a range of plant and animal species-including many grasses. Within diploid and polyploid ryegrass and fescue species, including the forage grass perennial ryegrass (Lolium perenne L.), the presence of B chromosomes has been reported as influencing both chromosome pairing and chiasma frequencies. In this study, the effects of the presence/absence of B chromosomes on genetic recombination has been investigated through generating DArT (Diversity Arrays Technology) marker genetic maps for six perennial ryegrass diploid populations, the pollen parents of which contained either two B or zero B chromosomes. Through genetic and cytological analyses of these progeny and their parents, we have identified that, while overall cytological estimates of chiasma frequencies were significantly lower in pollen mother cells with two B chromosomes as compared with zero B chromosomes, the recombination frequencies within some marker intervals were actually increased, particularly for marker intervals in lower recombination regions of chromosomes, namely pericentromeric regions. Thus, in perennial ryegrass, the presence of two B chromosomes redistributed patterns of meiotic recombination in pollen mother cells in ways which could increase the range of allelic variation available to plant breeders.
Non-random Mis-segregation of Human Chromosomes.
Worrall, Joseph Thomas; Tamura, Naoka; Mazzagatti, Alice; Shaikh, Nadeem; van Lingen, Tineke; Bakker, Bjorn; Spierings, Diana Carolina Johanna; Vladimirou, Elina; Foijer, Floris; McClelland, Sarah Elizabeth
2018-06-12
A common assumption is that human chromosomes carry equal chances of mis-segregation during compromised cell division. Human chromosomes vary in multiple parameters that might generate bias, but technological limitations have precluded a comprehensive analysis of chromosome-specific aneuploidy. Here, by imaging specific centromeres coupled with high-throughput single-cell analysis as well as single-cell sequencing, we show that aneuploidy occurs non-randomly following common treatments to elevate chromosome mis-segregation. Temporary spindle disruption leads to elevated mis-segregation and aneuploidy of a subset of chromosomes, particularly affecting chromosomes 1 and 2. Unexpectedly, we find that a period of mitotic delay weakens centromeric cohesion and promotes chromosome mis-segregation and that chromosomes 1 and 2 are particularly prone to suffer cohesion fatigue. Our findings demonstrate that inherent properties of individual chromosomes can bias chromosome mis-segregation and aneuploidy rates, with implications for studies on aneuploidy in human disease. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Lee, Hee-Sheung; Lee, Nicholas C O; Grimes, Brenda R; Samoshkin, Alexander; Kononenko, Artem V; Bansal, Ruchi; Masumoto, Hiroshi; Earnshaw, William C; Kouprina, Natalay; Larionov, Vladimir
2013-05-22
Aneuploidy is a feature of most cancer cells that is often accompanied by an elevated rate of chromosome mis-segregation termed chromosome instability (CIN). While CIN can act as a driver of cancer genome evolution and tumor progression, recent findings point to the existence of a threshold level beyond which CIN becomes a barrier to tumor growth and therefore can be exploited therapeutically. Drugs known to increase CIN beyond the therapeutic threshold are currently few in number, and the clinical promise of targeting the CIN phenotype warrants new screening efforts. However, none of the existing methods, including the in vitro micronuclei (MNi) assay, developed to quantify CIN, is entirely satisfactory. We have developed a new assay for measuring CIN. This quantitative assay for chromosome mis-segregation is based on the use of a non-essential human artificial chromosome (HAC) carrying a constitutively expressed EGFP transgene. Thus, cells that inherit the HAC display green fluorescence, while cells lacking the HAC do not. This allows the measurement of HAC loss rate by routine flow cytometry. Using the HAC-based chromosome loss assay, we have analyzed several well-known anti-mitotic, spindle-targeting compounds, all of which have been reported to induce micronuclei formation and chromosome loss. For each drug, the rate of HAC loss was accurately measured by flow cytometry as a proportion of non-fluorescent cells in the cell population which was verified by FISH analysis. Based on our estimates, despite their similar cytotoxicity, the analyzed drugs affect the rates of HAC mis-segregation during mitotic divisions differently. The highest rate of HAC mis-segregation was observed for the microtubule-stabilizing drugs, taxol and peloruside A. Thus, this new and simple assay allows for a quick and efficient screen of hundreds of drugs to identify those affecting chromosome mis-segregation. It also allows ranking of compounds with the same or similar mechanism of
HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis.
Phillips, Carolyn M; Wong, Chihunt; Bhalla, Needhi; Carlton, Peter M; Weiser, Pinky; Meneely, Philip M; Dernburg, Abby F
2005-12-16
The him-8 gene is essential for proper meiotic segregation of the X chromosomes in C. elegans. Here we show that loss of him-8 function causes profound X chromosome-specific defects in homolog pairing and synapsis. him-8 encodes a C2H2 zinc-finger protein that is expressed during meiosis and concentrates at a site on the X chromosome known as the meiotic pairing center (PC). A role for HIM-8 in PC function is supported by genetic interactions between PC lesions and him-8 mutations. HIM-8 bound chromosome sites associate with the nuclear envelope (NE) throughout meiotic prophase. Surprisingly, a point mutation in him-8 that retains both chromosome binding and NE localization fails to stabilize pairing or promote synapsis. These observations indicate that stabilization of homolog pairing is an active process in which the tethering of chromosome sites to the NE may be necessary but is not sufficient.
Chromosomal rearrangements and karyotype evolution in carnivores revealed by chromosome painting
Nie, W; Wang, J; Su, W; Wang, D; Tanomtong, A; Perelman, P L; Graphodatsky, A S; Yang, F
2012-01-01
Chromosomal evolution in carnivores has been revisited extensively using cross-species chromosome painting. Painting probes derived from flow-sorted chromosomes of the domestic dog, which has one of the most rearranged karyotypes in mammals and the highest dipoid number (2n=78) in carnivores, are a powerful tool in detecting both evolutionary intra- and inter-chromosomal rearrangements. However, only a few comparative maps have been established between dog and other non-Canidae species. Here, we extended cross-species painting with dog probes to seven more species representing six carnivore families: Eurasian lynx (Lynx lynx), the stone marten (Martes foina), the small Indian civet (Viverricula indica), the Asian palm civet (Paradoxurus hermaphrodites), Javan mongoose (Hepestes javanicas), the raccoon (Procyon lotor) and the giant panda (Ailuropoda melanoleuca). The numbers and positions of intra-chromosomal rearrangements were found to differ among these carnivore species. A comparative map between human and stone marten, and a map among the Yangtze finless porpoise (Neophocaena phocaenoides asiaeorientalis), stone marten and human were also established to facilitate outgroup comparison and to integrate comparative maps between stone marten and other carnivores with such maps between human and other species. These comparative maps give further insight into genome evolution and karyotype phylogenetic relationships among carnivores, and will facilitate the transfer of gene mapping data from human, domestic dog and cat to other species. PMID:22086079
Statistics for X-chromosome associations.
Özbek, Umut; Lin, Hui-Min; Lin, Yan; Weeks, Daniel E; Chen, Wei; Shaffer, John R; Purcell, Shaun M; Feingold, Eleanor
2018-06-13
In a genome-wide association study (GWAS), association between genotype and phenotype at autosomal loci is generally tested by regression models. However, X-chromosome data are often excluded from published analyses of autosomes because of the difference between males and females in number of X chromosomes. Failure to analyze X-chromosome data at all is obviously less than ideal, and can lead to missed discoveries. Even when X-chromosome data are included, they are often analyzed with suboptimal statistics. Several mathematically sensible statistics for X-chromosome association have been proposed. The optimality of these statistics, however, is based on very specific simple genetic models. In addition, while previous simulation studies of these statistics have been informative, they have focused on single-marker tests and have not considered the types of error that occur even under the null hypothesis when the entire X chromosome is scanned. In this study, we comprehensively tested several X-chromosome association statistics using simulation studies that include the entire chromosome. We also considered a wide range of trait models for sex differences and phenotypic effects of X inactivation. We found that models that do not incorporate a sex effect can have large type I error in some cases. We also found that many of the best statistics perform well even when there are modest deviations, such as trait variance differences between the sexes or small sex differences in allele frequencies, from assumptions. © 2018 WILEY PERIODICALS, INC.
Nacheva, E P; Gribble, S; Andrews, K; Wienberg, J; Grace, C D
2000-10-15
We report the application of multi-color fluorescence in situ hydribidization (FISH) for bone marrow metaphase cell analysis of hematological malignancies using a sub-set of the human karyotype for chromosome painting. A combination of chromosome probes labeled with three haptens enabled the construction of a "painting probe" which detects seven different chromosomes. The probe was used to screen three chronic myeloid leukemia (CML) derived cell lines and ten CML patient bone marrow samples for aberrations, additional to the Ph rearrangement, that are associated with the onset of blast crisis of CML. This approach was shown to identify karyotype changes commonly seen by conventional karyotyping, and in addition revealed chromosome changes unresolved or undetected by conventional cytogenetic analysis. The seven-color painting probe provides a useful, fast, and reliable complementary tool for chromosome analysis, especially in cases with poor chromosome morphology. This is a simple approach, since the probes can be displayed in a standard red/green/blue format accessible to standard fluorescence microscopes and image-processing software. The proposed approach using panels of locus-specific probes as well as chromosome paints will be useful in all diagnostic routine environments where analysis is directed towards screening for genetic rearrangements and/or specific patterns of chromosome involvement with diagnostic/prognostic value.
Rustenholz, Camille; Choulet, Frédéric; Laugier, Christel; Safár, Jan; Simková, Hana; Dolezel, Jaroslav; Magni, Federica; Scalabrin, Simone; Cattonaro, Federica; Vautrin, Sonia; Bellec, Arnaud; Bergès, Hélène; Feuillet, Catherine; Paux, Etienne
2011-12-01
To improve our understanding of the organization and regulation of the wheat (Triticum aestivum) gene space, we established a transcription map of a wheat chromosome (3B) by hybridizing a newly developed wheat expression microarray with bacterial artificial chromosome pools from a new version of the 3B physical map as well as with cDNA probes derived from 15 RNA samples. Mapping data for almost 3,000 genes showed that the gene space spans the whole chromosome 3B with a 2-fold increase of gene density toward the telomeres due to an increase in the number of genes in islands. Comparative analyses with rice (Oryza sativa) and Brachypodium distachyon revealed that these gene islands are composed mainly of genes likely originating from interchromosomal gene duplications. Gene Ontology and expression profile analyses for the 3,000 genes located along the chromosome revealed that the gene islands are enriched significantly in genes sharing the same function or expression profile, thereby suggesting that genes in islands acquired shared regulation during evolution. Only a small fraction of these clusters of cofunctional and coexpressed genes was conserved with rice and B. distachyon, indicating a recent origin. Finally, genes with the same expression profiles in remote islands (coregulation islands) were identified suggesting long-distance regulation of gene expression along the chromosomes in wheat.
Partial hexasomy of chromosome 15.
Huang, Bing; Bartley, James
2003-09-01
Marker chromosomes originating from chromosome 15, often referred to as inv dup(15), is the most common marker chromosome found in humans. The large marker 15 that contains the Prader-Willi syndrome (PWS)/Angelman syndrome (AS) chromosome region is usually associated with an abnormal phenotype of moderate to severe mental retardation, seizures, poor motor coordination, behavioral problems, and mild dysmorphic features. We report here an infant boy with two copies of the large inv dup(15). A 10-day-old infant was found to have infantile spasms, microcephaly, hypotonia, and lethargy. Lymphocyte chromosome analysis revealed a 48,XY, +2mar karyotype. Fluorescence in situ hybridization with probes rRNA, D15Z4, D15S11, and GABRB3 demonstrated that both markers were chromosome 15 in origin and contained the Prader-Willi/Angelman syndrome chromosome region. Therefore, this patient is hexasomic for the PWS/AS region. The phenotype of this patient does not appear to be significantly more severe than patients with one copy of the large inv dup(15) at birth, however, follow-up evaluation of the patient at 21 months of age shows that this patient has frequent and severe seizure activity, severe bilateral hearing loss, and cortical blindness. Copyright 2003 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lanyi, A.; Li, B.F.; Li, S.
1994-09-01
X-linked lymphoproliferative disease (XLP) is characterized by a marked vulnerability in Epstein-Barr virus (EBV) infection. Infection of XLP patients with EBV invariably results in fatal mononucleosis, agammaglobulinemia or B-cell lymphoma. The XLP gene lies within a 10 cM region in Xq25 between DXS42 and DXS10. Initial chromosome studies revealed an interstitial, cytogenetically visible deletion in Xq25 in one XLP family (43-004). We estimated the size of the Xq25 deletion by dual laser flow karyotyping to involve 2% of the X chromosome, or approximately 3 Mbp of DNA sequences. To further delineate the deletion we performed a series of pulsed fieldmore » gel electrophoresis (PFGE) analyses which showed that DXS6 and DXS100, two Xq25-specific markers, are missing from 45-004 DNA. Five yeast artificial chromosomes (YACs) from a chromosome X specific YAC library containing sequences deleted in patient`s 43-004 DNA were isolated. These five YACs did not overlap, and their end fragments were used to screen the CEPH MegaYAC library. Seven YACs were isolated from the CEPH MegaYAC library. They could be arranged into a contig which spans between DXS6 and DXS100. The contig contains a minimum of 2.5 Mbp of human DNA. A total of 12 YAC end clone, lambda subclones and STS probes have been used to order clones within the contig. These reagents were also used in Southern blot and patients showed interstitial deletions in Xq25. The size of these deletions range between 0.5 and 2.5 Mbp. The shortest deletion probably represents the critical region for the XLP gene.« less
Chromosome Connections: Compelling Clues to Common Ancestry
ERIC Educational Resources Information Center
Flammer, Larry
2013-01-01
Students compare banding patterns on hominid chromosomes and see striking evidence of their common ancestry. To test this, human chromosome no. 2 is matched with two shorter chimpanzee chromosomes, leading to the hypothesis that human chromosome 2 resulted from the fusion of the two shorter chromosomes. Students test that hypothesis by looking for…
Carvalho, Natalia D M; Carmo, Edson; Neves, Rogerio O; Schneider, Carlos Henrique; Gross, Maria Claudia
2016-01-01
Differences in heterochromatin distribution patterns and its composition were observed in Amazonian teiid species. Studies have shown repetitive DNA harbors heterochromatic blocks which are located in centromeric and telomeric regions in Ameiva ameiva (Linnaeus, 1758), Kentropyx calcarata (Spix, 1825), Kentropyx pelviceps (Cope, 1868), and Tupinambis teguixin (Linnaeus, 1758). In Cnemidophorus sp.1, repetitive DNA has multiple signals along all chromosomes. The aim of this study was to characterize moderately and highly repetitive DNA sequences by C ot1-DNA from Ameiva ameiva and Cnemidophorus sp.1 genomes through cloning and DNA sequencing, as well as mapping them chromosomally to better understand its organization and genome dynamics. The results of sequencing of DNA libraries obtained by C ot1-DNA showed that different microsatellites, transposons, retrotransposons, and some gene families also comprise the fraction of repetitive DNA in the teiid species. FISH using C ot1-DNA probes isolated from both Ameiva ameiva and Cnemidophorus sp.1 showed these sequences mainly located in heterochromatic centromeric, and telomeric regions in Ameiva ameiva, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin chromosomes, indicating they play structural and functional roles in the genome of these species. In Cnemidophorus sp.1, C ot1-DNA probe isolated from Ameiva ameiva had multiple interstitial signals on chromosomes, whereas mapping of C ot1-DNA isolated from the Ameiva ameiva and Cnemidophorus sp.1 highlighted centromeric regions of some chromosomes. Thus, the data obtained showed that many repetitive DNA classes are part of the genome of Ameiva ameiva, Cnemidophorus sp.1, Kentroyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin, and these sequences are shared among the analyzed teiid species, but they were not always allocated at the same chromosome position.
Method for obtaining chromosome painting probes
Lucas, Joe N.
2000-01-01
A method is provided for determining a clastogenic signature of a sample of chromosomes by quantifying a frequency of a first type of chromosome aberration present in the sample; quantifying a frequency of a second, different type of chromosome aberration present in the sample; and comparing the frequency of the first type of chromosome aberration to the frequency of the second type of chromosome aberration. A method is also provided for using that clastogenic signature to identify a clastogenic agent or dosage to which the cells were exposed.
Sex chromosome abnormalities and psychiatric diseases
Zhang, Xinzhu; Yang, Jian; Li, Yuhong; Ma, Xin; Li, Rena
2017-01-01
Excesses of sex chromosome abnormalities in patients with psychiatric diseases have recently been observed. It remains unclear whether sex chromosome abnormalities are related to sex differences in some psychiatric diseases. While studies showed evidence of susceptibility loci over many sex chromosomal regions related to various mental diseases, others demonstrated that the sex chromosome aneuploidies may be the key to exploring the pathogenesis of psychiatric disease. In this review, we will outline the current evidence on the interaction of sex chromosome abnormalities with schizophrenia, autism, ADHD and mood disorders. PMID:27992373
Zickler, D; Leblon, G; Haedens, V; Collard, A; Thuriaux, P
1984-01-01
Reconstruction of serially sectioned zygotene and pachytene nuclei has allowed, by measuring the lengths of synaptonemal complexes, an assignment of the 7 linkage (LG) groups to the 7 chromosomes in the fungus Sordaria macrospora. The 7 LG have been established using 19 mutants showing low second division segregation frequencies. Eight chromosomal rearrangements mapped on the 7 LG were used to identify the chromosomes involved. The following one to one assignment of the 7 LG to specific chromosomes was obtained: LG a: chromosome (chr) 1, LG b: chr5, LG c: chr6, LG d: chr7, LG e: chr4, LG f: chr3 and LG g: chr2 (the chromosome carrying the nucleolus organizer region).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warburton, P.E.; Gosden, J.; Lawson, D.
1996-04-15
Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize andmore » spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.« less
Comparative physical mapping between wheat chromosome arm 2BL and rice chromosome 4.
Lee, Tong Geon; Lee, Yong Jin; Kim, Dae Yeon; Seo, Yong Weon
2010-12-01
Physical maps of chromosomes provide a framework for organizing and integrating diverse genetic information. DNA microarrays are a valuable technique for physical mapping and can also be used to facilitate the discovery of single feature polymorphisms (SFPs). Wheat chromosome arm 2BL was physically mapped using a Wheat Genome Array onto near-isogenic lines (NILs) with the aid of wheat-rice synteny and mapped wheat EST information. Using high variance probe set (HVP) analysis, 314 HVPs constituting genes present on 2BL were identified. The 314 HVPs were grouped into 3 categories: HVPs that match only rice chromosome 4 (298 HVPs), those that match only wheat ESTs mapped on 2BL (1), and those that match both rice chromosome 4 and wheat ESTs mapped on 2BL (15). All HVPs were converted into gene sets, which represented either unique rice gene models or mapped wheat ESTs that matched identified HVPs. Comparative physical maps were constructed for 16 wheat gene sets and 271 rice gene sets. Of the 271 rice gene sets, 257 were mapped to the 18-35 Mb regions on rice chromosome 4. Based on HVP analysis and sequence similarity between the gene models in the rice chromosomes and mapped wheat ESTs, the outermost rice gene model that limits the translocation breakpoint to orthologous regions was identified.
Identifying homomorphic sex chromosomes from wild-caught adults with limited genomic resources.
Brelsford, Alan; Lavanchy, Guillaume; Sermier, Roberto; Rausch, Anna; Perrin, Nicolas
2017-07-01
We demonstrate a genotyping-by-sequencing approach to identify homomorphic sex chromosomes and their homolog in a distantly related reference genome, based on noninvasive sampling of wild-caught individuals, in the moor frog Rana arvalis. Double-digest RADseq libraries were generated using buccal swabs from 30 males and 21 females from the same population. Search for sex-limited markers from the unfiltered data set (411 446 RAD tags) was more successful than searches from a filtered data set (33 073 RAD tags) for markers showing sex differences in heterozygosity or in allele frequencies. Altogether, we obtained 292 putatively sex-linked RAD loci, 98% of which point to male heterogamety. We could map 15 of them to the Xenopus tropicalis genome, all but one on chromosome pair 1, which seems regularly co-opted for sex determination among amphibians. The most efficient mapping strategy was a three-step hierarchical approach, where R. arvalis reads were first mapped to a low-coverage genome of Rana temporaria (17 My divergence), then the R. temporaria scaffolds to the Nanorana parkeri genome (90 My divergence), and finally the N. parkeri scaffolds to the X. tropicalis genome (210 My). We validated our conclusions with PCR primers amplifying part of Dmrt1, a candidate sex determination gene mapping to chromosome 1: a sex-diagnostic allele was present in all 30 males but in none of the 21 females. Our approach is likely to be productive in many situations where biological samples and/or genomic resources are limited. © 2016 John Wiley & Sons Ltd.
The importance of having two X chromosomes
Arnold, Arthur P.; Reue, Karen; Eghbali, Mansoureh; Vilain, Eric; Chen, Xuqi; Ghahramani, Negar; Itoh, Yuichiro; Li, Jingyuan; Link, Jenny C.; Ngun, Tuck; Williams-Burris, Shayna M.
2016-01-01
Historically, it was thought that the number of X chromosomes plays little role in causing sex differences in traits. Recently, selected mouse models have been used increasingly to compare mice with the same type of gonad but with one versus two copies of the X chromosome. Study of these models demonstrates that mice with one X chromosome can be strikingly different from those with two X chromosomes, when the differences are not attributable to confounding group differences in gonadal hormones. The number of X chromosomes affects adiposity and metabolic disease, cardiovascular ischaemia/reperfusion injury and behaviour. The effects of X chromosome number are likely the result of inherent differences in expression of X genes that escape inactivation, and are therefore expressed from both X chromosomes in XX mice, resulting in a higher level of expression when two X chromosomes are present. The effects of X chromosome number contribute to sex differences in disease phenotypes, and may explain some features of X chromosome aneuploidies such as in Turner and Klinefelter syndromes. PMID:26833834
National Libraries Section. General Research Libraries Division. Papers.
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on national library services and activities, which were presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The National Library of China in its Gradual Application of Modern Technology," a discussion by Zhu Nan and Zhu Yan (China) of microform usage and library automation; (2)…
Asia, Saba; Vaziri Nasab, Hamed; Sabbaghian, Marjan; Kalantari, Hamid; Zari Moradi, Shabnam; Gourabi, Hamid; Mohseni Meybodi, Anahita
2014-01-01
Complex chromosomal rearrangements (CCRs) are rare events involving more than two chromosomes and over two breakpoints. They are usually associated with infertility or sub fertility in male carriers. Here we report a novel case of a CCR in a 30-year-old oligoasthenosperm man with a history of varicocelectomy, normal testes size and normal endocrinology profile referred for chromosome analysis to the Genetics unit of Royan Reproductive Biomedicine Research Center. Chromosomal analysis was performed using peripheral blood lymphocyte cultures and analyzed by GTG banding. Additional tests such as C-banding and multicolor fluorescence in situ hybridization (FISH) procedure for each of the involved chromosomes were performed to determine the patterns of the segregations. Y chromosome microdeletions in the azoospermia factor (AZF) region were analyzed with multiplex polymerase chain reaction. To identify the history and origin of this CCR, all the family members were analyzed. No micro deletion in Y chromosome was detected. The same de novo reciprocal exchange was also found in his monozygous twin brother. The other siblings and parents were normal. CCRs are associated with male infertility as a result of spermatogenic disruption due to complex meiotic configurations and the production of chromosomally abnormal sperms. These chromosomal rearrangements might have an influence on decreasing the number of sperms. PMID:24611143
Schmid, Michael; Steinlein, Claus
2018-01-01
A detailed cytogenetic study on the leaf litter frog Eleutherodactylus johnstonei from 14 different Caribbean islands and the mainlands of Venezuela and Guyana revealed the existence of multimorphic XY♂/XX♀ sex chromosomes 14. Their male sex determination and development depends either on the presence of 2 telocentric chromosomes 14 (XtYt), or on 1 submetacentric chromosome 14 (Xsm) plus 1 telocentric chromosome 14 (Yt), or on the presence of 2 submetacentric chromosomes 14 (XsmYsm). The female sex determination and development requires either the presence of 2 telocentric chromosomes 14 (XtXt) or 2 submetacentric chromosomes 14 (XsmXsm). In all individuals analyzed, the sex chromosomes 14 carry a prominent nucleolus organizer region in their long arms. An explanation is given for the origin of the (XtYt)♂, (XsmYt)♂, (XsmYsm)♂, (XtXt)♀, and (XsmXsm)♀ in the different populations of E. johnstonei. Furthermore, the present study gives detailed data on the chromosome banding patterns, in situ hybridization experiments, and the genome size of E. johnstonei. © 2018 S. Karger AG, Basel.
Artificial intelligence support for scientific model-building
NASA Technical Reports Server (NTRS)
Keller, Richard M.
1992-01-01
Scientific model-building can be a time-intensive and painstaking process, often involving the development of large and complex computer programs. Despite the effort involved, scientific models cannot easily be distributed and shared with other scientists. In general, implemented scientific models are complex, idiosyncratic, and difficult for anyone but the original scientific development team to understand. We believe that artificial intelligence techniques can facilitate both the model-building and model-sharing process. In this paper, we overview our effort to build a scientific modeling software tool that aids the scientist in developing and using models. This tool includes an interactive intelligent graphical interface, a high-level domain specific modeling language, a library of physics equations and experimental datasets, and a suite of data display facilities.
Discovery of Supernumerary B Chromosomes in Drosophila melanogaster
Bauerly, Elisabeth; Hughes, Stacie E.; Vietti, Dana R.; Miller, Danny E.; McDowell, William; Hawley, R. Scott
2014-01-01
B chromosomes are small, heterochromatic chromosomes that are transmitted in a non-Mendelian manner. We have identified a stock of Drosophila melanogaster that recently (within the last decade) acquired an average of 10 B chromosomes per fly. These B chromosomes are transmitted by both males and females and can be maintained for multiple generations in a wild-type genetic background despite the fact that they cause high levels of 4th chromosome meiotic nondisjunction in females. Most curiously, these B chromosomes are mitotically unstable, suggesting either the absence of critical chromosomal sites or the inability of the meiotic or mitotic systems to cope with many additional chromosomes. These B chromosomes also contain centromeres and are primarily composed of the heterochromatic AATAT satellite sequence. Although the AATAT sequence comprises the majority of the 4th chromosome heterochromatin, the B chromosomes lack most, if not all, 4th chromosome euchromatin. Presumably as a consequence of their heterochromatic content, these B chromosomes significantly modify position-effect variegation in two separate reporter systems, acting as enhancers of variegation in one case and suppressors in the other. The identification of B chromosomes in a genetically tractable organism like D. melanogaster will facilitate studies of chromosome evolution and the analysis of the mechanisms by which meiotic and mitotic processes cope with additional chromosomes. PMID:24478336
Chromosome diversity and similarity within the Actinomycetales.
Kirby, Ralph
2011-06-01
Many chromosomes from Actinomycetales, an order within the Actinobacteria, have been sequenced over the last 10 years and the pace is increasing. This group of Gram-positive and high G+C% bacteria is economically and medically important. However, this group of organisms also is just about the only order in the kingdom Bacteria to have a relatively high proportion of linear chromosomes. Chromosome topology varies within the order according to the genera. Streptomyces, Kitasatospora and Rhodococcus, at least as chromosome sequencing stands at present, have a very high proportion of linear chromosomes, whereas most other genera seem to have circular chromosomes. This review examines chromosome topology across the Actinomycetales and how this affects our concepts of chromosome evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Serrano, Érica Alves; Utsunomia, Ricardo; Scudeller, Patrícia Sobrinho; Oliveira, Claudio; Foresti, Fausto
2017-01-01
B chromosomes are apparently dispensable components found in the genomes of many species that are mainly composed of repetitive DNA sequences. Among the numerous questions concerning B chromosomes, the origin of these elements has been widely studied. To date, supernumerary chromosomes have been identified in approximately 60 species of fish, including species of the genus Characidium Reinhardt, 1867 in which these elements appear to have independently originated. In this study, we used molecular cytogenetic techniques to investigate the origin of B chromosomes in a population of Characidium alipioi Travassos, 1955 and determine their relationship with the extra chromosomes of other species of the genus. The results showed that the B chromosomes of Characidium alipioi had an intraspecific origin, apparently originated independently in relation to the B chromosomes of Characidium gomesi Travassos, 1956 Characidium pterostictum Gomes, 1947 and Characidium oiticicai Travassos, 1967, since they do not share specific DNA sequences, as well as their possible ancestral chromosomes and belong to different phylogenetic clades. The shared sequences between the supernumerary chromosomes and the autosommal sm pair indicate the origin of these chromosomes.
Pampalona, J; Soler, D; Genescà, A; Tusell, L
2010-01-05
The cytokinesis-block micronucleus assay has emerged as a biomarker of chromosome damage relevant to cancer. Although it was initially developed to measure micronuclei, it is also useful for measuring nucleoplasmic bridges and nuclear buds. Abnormal nuclear morphologies are frequently observed in malignant tissues and short-term tumour cell cultures. Changes in chromosome structure and number resulting from chromosome instability are important factors in oncogenesis. Telomeres have become key players in the initiation of chromosome instability related to carcinogenesis by means of breakage-fusion-bridge cycles. To better understand the connection between telomere dysfunction and the appearance of abnormal nuclear morphologies, we have characterised the presence of micronuclei, nucleoplasmic bridges and nuclear buds in human mammary primary epithelial cells. These cells can proliferate beyond the Hayflick limit by spontaneously losing expression of the p16(INK4a) protein. Progressive telomere shortening leads to the loss of the capping function, and the appearance of end-to-end chromosome fusions that can enter into breakage-fusion-bridge cycles generating massive chromosomal instability. In human mammary epithelial cells, different types of abnormal nuclear morphologies were observed, however only nucleoplasmatic bridges and buds increased significantly with population doublings. Fluorescent in situ hybridisation using centromeric and painting specific probes for chromosomes with eroded telomeres has revealed that these chromosomes are preferentially included in the different types of abnormal nuclear morphologies observed, thus reflecting their common origin. Accordingly, real-time imaging of cell divisions enabled us to determine that anaphase bridge resolution was mainly through chromatin breakage and the formation of symmetric buds in daughter nuclei. Few micronuclei emerged in this cell system thus validating the scoring of nucleoplasmic bridges and nuclear
2010 Library of the Year: Columbus Metropolitan Library
ERIC Educational Resources Information Center
Berry, John N., III
2010-01-01
This article features Columbus Metropolitan Library (CML), winner of the Gale/"Library Journal" Library of the Year Award 2010. CML, comprised of an operations center and 21 branches, serves the 847,376 people who inhabit a large portion of Franklin County in central Ohio. It is an independent library with its own taxing district. CML…
Machiela, Mitchell J; Zhou, Weiyin; Karlins, Eric; Sampson, Joshua N; Freedman, Neal D; Yang, Qi; Hicks, Belynda; Dagnall, Casey; Hautman, Christopher; Jacobs, Kevin B; Abnet, Christian C; Aldrich, Melinda C; Amos, Christopher; Amundadottir, Laufey T; Arslan, Alan A; Beane-Freeman, Laura E; Berndt, Sonja I; Black, Amanda; Blot, William J; Bock, Cathryn H; Bracci, Paige M; Brinton, Louise A; Bueno-de-Mesquita, H Bas; Burdett, Laurie; Buring, Julie E; Butler, Mary A; Canzian, Federico; Carreón, Tania; Chaffee, Kari G; Chang, I-Shou; Chatterjee, Nilanjan; Chen, Chu; Chen, Constance; Chen, Kexin; Chung, Charles C; Cook, Linda S; Crous Bou, Marta; Cullen, Michael; Davis, Faith G; De Vivo, Immaculata; Ding, Ti; Doherty, Jennifer; Duell, Eric J; Epstein, Caroline G; Fan, Jin-Hu; Figueroa, Jonine D; Fraumeni, Joseph F; Friedenreich, Christine M; Fuchs, Charles S; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M; Garcia-Closas, Montserrat; Gaudet, Mia M; Gaziano, J Michael; Giles, Graham G; Gillanders, Elizabeth M; Giovannucci, Edward L; Goldin, Lynn; Goldstein, Alisa M; Haiman, Christopher A; Hallmans, Goran; Hankinson, Susan E; Harris, Curtis C; Henriksson, Roger; Holly, Elizabeth A; Hong, Yun-Chul; Hoover, Robert N; Hsiung, Chao A; Hu, Nan; Hu, Wei; Hunter, David J; Hutchinson, Amy; Jenab, Mazda; Johansen, Christoffer; Khaw, Kay-Tee; Kim, Hee Nam; Kim, Yeul Hong; Kim, Young Tae; Klein, Alison P; Klein, Robert; Koh, Woon-Puay; Kolonel, Laurence N; Kooperberg, Charles; Kraft, Peter; Krogh, Vittorio; Kurtz, Robert C; LaCroix, Andrea; Lan, Qing; Landi, Maria Teresa; Marchand, Loic Le; Li, Donghui; Liang, Xiaolin; Liao, Linda M; Lin, Dongxin; Liu, Jianjun; Lissowska, Jolanta; Lu, Lingeng; Magliocco, Anthony M; Malats, Nuria; Matsuo, Keitaro; McNeill, Lorna H; McWilliams, Robert R; Melin, Beatrice S; Mirabello, Lisa; Moore, Lee; Olson, Sara H; Orlow, Irene; Park, Jae Yong; Patiño-Garcia, Ana; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M; Pooler, Loreall; Prescott, Jennifer; Prokunina-Olsson, Ludmila; Purdue, Mark P; Qiao, You-Lin; Rajaraman, Preetha; Real, Francisco X; Riboli, Elio; Risch, Harvey A; Rodriguez-Santiago, Benjamin; Ruder, Avima M; Savage, Sharon A; Schumacher, Fredrick; Schwartz, Ann G; Schwartz, Kendra L; Seow, Adeline; Wendy Setiawan, Veronica; Severi, Gianluca; Shen, Hongbing; Sheng, Xin; Shin, Min-Ho; Shu, Xiao-Ou; Silverman, Debra T; Spitz, Margaret R; Stevens, Victoria L; Stolzenberg-Solomon, Rachael; Stram, Daniel; Tang, Ze-Zhong; Taylor, Philip R; Teras, Lauren R; Tobias, Geoffrey S; Van Den Berg, David; Visvanathan, Kala; Wacholder, Sholom; Wang, Jiu-Cun; Wang, Zhaoming; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K; Wolpin, Brian M; Wong, Maria Pik; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S; Xia, Lucy; Yang, Hannah P; Yang, Pan-Chyr; Yu, Kai; Zanetti, Krista A; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Ziegler, Regina G; Perez-Jurado, Luis A; Caporaso, Neil E; Rothman, Nathaniel; Tucker, Margaret; Dean, Michael C; Yeager, Meredith; Chanock, Stephen J
2016-06-13
To investigate large structural clonal mosaicism of chromosome X, we analysed the SNP microarray intensity data of 38,303 women from cancer genome-wide association studies (20,878 cases and 17,425 controls) and detected 124 mosaic X events >2 Mb in 97 (0.25%) women. Here we show rates for X-chromosome mosaicism are four times higher than mean autosomal rates; X mosaic events more often include the entire chromosome and participants with X events more likely harbour autosomal mosaic events. X mosaicism frequency increases with age (0.11% in 50-year olds; 0.45% in 75-year olds), as reported for Y and autosomes. Methylation array analyses of 33 women with X mosaicism indicate events preferentially involve the inactive X chromosome. Our results provide further evidence that the sex chromosomes undergo mosaic events more frequently than autosomes, which could have implications for understanding the underlying mechanisms of mosaic events and their possible contribution to risk for chronic diseases.
Female chromosome X mosaicism is age-related and preferentially affects the inactivated X chromosome
Machiela, Mitchell J.; Zhou, Weiyin; Karlins, Eric; Sampson, Joshua N.; Freedman, Neal D.; Yang, Qi; Hicks, Belynda; Dagnall, Casey; Hautman, Christopher; Jacobs, Kevin B.; Abnet, Christian C.; Aldrich, Melinda C.; Amos, Christopher; Amundadottir, Laufey T.; Arslan, Alan A.; Beane-Freeman, Laura E.; Berndt, Sonja I.; Black, Amanda; Blot, William J.; Bock, Cathryn H.; Bracci, Paige M.; Brinton, Louise A.; Bueno-de-Mesquita, H Bas; Burdett, Laurie; Buring, Julie E.; Butler, Mary A.; Canzian, Federico; Carreón, Tania; Chaffee, Kari G.; Chang, I-Shou; Chatterjee, Nilanjan; Chen, Chu; Chen, Constance; Chen, Kexin; Chung, Charles C.; Cook, Linda S.; Crous Bou, Marta; Cullen, Michael; Davis, Faith G.; De Vivo, Immaculata; Ding, Ti; Doherty, Jennifer; Duell, Eric J.; Epstein, Caroline G.; Fan, Jin-Hu; Figueroa, Jonine D.; Fraumeni, Joseph F.; Friedenreich, Christine M.; Fuchs, Charles S.; Gallinger, Steven; Gao, Yu-Tang; Gapstur, Susan M.; Garcia-Closas, Montserrat; Gaudet, Mia M.; Gaziano, J. Michael; Giles, Graham G.; Gillanders, Elizabeth M.; Giovannucci, Edward L.; Goldin, Lynn; Goldstein, Alisa M.; Haiman, Christopher A.; Hallmans, Goran; Hankinson, Susan E.; Harris, Curtis C.; Henriksson, Roger; Holly, Elizabeth A.; Hong, Yun-Chul; Hoover, Robert N.; Hsiung, Chao A.; Hu, Nan; Hu, Wei; Hunter, David J.; Hutchinson, Amy; Jenab, Mazda; Johansen, Christoffer; Khaw, Kay-Tee; Kim, Hee Nam; Kim, Yeul Hong; Kim, Young Tae; Klein, Alison P.; Klein, Robert; Koh, Woon-Puay; Kolonel, Laurence N.; Kooperberg, Charles; Kraft, Peter; Krogh, Vittorio; Kurtz, Robert C.; LaCroix, Andrea; Lan, Qing; Landi, Maria Teresa; Marchand, Loic Le; Li, Donghui; Liang, Xiaolin; Liao, Linda M.; Lin, Dongxin; Liu, Jianjun; Lissowska, Jolanta; Lu, Lingeng; Magliocco, Anthony M.; Malats, Nuria; Matsuo, Keitaro; McNeill, Lorna H.; McWilliams, Robert R.; Melin, Beatrice S.; Mirabello, Lisa; Moore, Lee; Olson, Sara H.; Orlow, Irene; Park, Jae Yong; Patiño-Garcia, Ana; Peplonska, Beata; Peters, Ulrike; Petersen, Gloria M.; Pooler, Loreall; Prescott, Jennifer; Prokunina-Olsson, Ludmila; Purdue, Mark P.; Qiao, You-Lin; Rajaraman, Preetha; Real, Francisco X.; Riboli, Elio; Risch, Harvey A.; Rodriguez-Santiago, Benjamin; Ruder, Avima M.; Savage, Sharon A.; Schumacher, Fredrick; Schwartz, Ann G.; Schwartz, Kendra L.; Seow, Adeline; Wendy Setiawan, Veronica; Severi, Gianluca; Shen, Hongbing; Sheng, Xin; Shin, Min-Ho; Shu, Xiao-Ou; Silverman, Debra T.; Spitz, Margaret R.; Stevens, Victoria L.; Stolzenberg-Solomon, Rachael; Stram, Daniel; Tang, Ze-Zhong; Taylor, Philip R.; Teras, Lauren R.; Tobias, Geoffrey S.; Van Den Berg, David; Visvanathan, Kala; Wacholder, Sholom; Wang, Jiu-Cun; Wang, Zhaoming; Wentzensen, Nicolas; Wheeler, William; White, Emily; Wiencke, John K.; Wolpin, Brian M.; Wong, Maria Pik; Wu, Chen; Wu, Tangchun; Wu, Xifeng; Wu, Yi-Long; Wunder, Jay S.; Xia, Lucy; Yang, Hannah P.; Yang, Pan-Chyr; Yu, Kai; Zanetti, Krista A.; Zeleniuch-Jacquotte, Anne; Zheng, Wei; Zhou, Baosen; Ziegler, Regina G.; Perez-Jurado, Luis A.; Caporaso, Neil E.; Rothman, Nathaniel; Tucker, Margaret; Dean, Michael C.; Yeager, Meredith; Chanock, Stephen J.
2016-01-01
To investigate large structural clonal mosaicism of chromosome X, we analysed the SNP microarray intensity data of 38,303 women from cancer genome-wide association studies (20,878 cases and 17,425 controls) and detected 124 mosaic X events >2 Mb in 97 (0.25%) women. Here we show rates for X-chromosome mosaicism are four times higher than mean autosomal rates; X mosaic events more often include the entire chromosome and participants with X events more likely harbour autosomal mosaic events. X mosaicism frequency increases with age (0.11% in 50-year olds; 0.45% in 75-year olds), as reported for Y and autosomes. Methylation array analyses of 33 women with X mosaicism indicate events preferentially involve the inactive X chromosome. Our results provide further evidence that the sex chromosomes undergo mosaic events more frequently than autosomes, which could have implications for understanding the underlying mechanisms of mosaic events and their possible contribution to risk for chronic diseases. PMID:27291797
E-library Implementation in Library University of Riau
NASA Astrophysics Data System (ADS)
Yuhelmi; Rismayeti
2017-12-01
This research aims to see how the e-book implementation in Library University of Riau and the obstacle in its implementation. In the Globalization era, digital libraries should be developed or else it will decrease the readers’ interest, with the recent advanced technology, digital libraries are one of the learning tools that can be used to finding an information through the internet access, hence digital libraries or commonly known as E-Library is really helping the students and academic community in finding information. The methods that used in this research is Observation, Interview, and Literature Study. The respondents in this research are the staff who involved in the process of digitization in Library University of Riau. The result of this research shows that implementation of e-library in Library University of Riau is already filled the user needs for now, although there is obstacle faced just like technical problems for example the internet connection speed and the technical problem to convert the format from Microsoft Word .doc to Adobe.pdf
Automated clinical system for chromosome analysis
NASA Technical Reports Server (NTRS)
Castleman, K. R.; Friedan, H. J.; Johnson, E. T.; Rennie, P. A.; Wall, R. J. (Inventor)
1978-01-01
An automatic chromosome analysis system is provided wherein a suitably prepared slide with chromosome spreads thereon is placed on the stage of an automated microscope. The automated microscope stage is computer operated to move the slide to enable detection of chromosome spreads on the slide. The X and Y location of each chromosome spread that is detected is stored. The computer measures the chromosomes in a spread, classifies them by group or by type and also prepares a digital karyotype image. The computer system can also prepare a patient report summarizing the result of the analysis and listing suspected abnormalities.
Dandy-Walker syndrome and chromosomal abnormalities.
Imataka, George; Yamanouchi, Hideo; Arisaka, Osamu
2007-12-01
Dandy-Walker syndrome (DWS) is a brain malformation of unknown etiology, but several reports have been published indicating that there is a causal relationship to various types of chromosomal abnormalities and malformation syndromes. In the present article, we present a bibliographical survey of several previously issued reports on chromosomal abnormalities associated with DWS, including our case of DWS found in trisomy 18. There are various types of chromosomal abnormalities associated with DWS; most of them are reported in chromosome 3, 9, 13 and 18. We also summarize some other chromosomal abnormalities and various congenital malformation syndromes.
Mechanisms of X Chromosome Dosage Compensation
Ercan, Sevinç
2015-01-01
In many animals, males have one X and females have two X chromosomes. The difference in X chromosome dosage between the two sexes is compensated by mechanisms that regulate X chromosome transcription. Recent advances in genomic techniques have provided new insights into the molecular mechanisms of X chromosome dosage compensation. In this review, I summarize our current understanding of dosage imbalance in general, and then review the molecular mechanisms of X chromosome dosage compensation with an emphasis on the parallels and differences between the three well-studied model systems, M. musculus, D. melanogaster and C. elegans. PMID:25628761
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
The 12 papers in this compilation focus on the activities of general research libraries, i.e., national, parliamentary, and university libraries: (1) "Commercial and Revenue Raising Activities in National Libraries" (Maurice Line & Peter Scott, New Zealand); (2) "The End of All and Forever--On the Acquisition Policies of…
USDA-ARS?s Scientific Manuscript database
The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...
Cuadrado, A; Jouve, N
2007-01-01
Two simple sequence repeats (SSRs), AG and AC, were mapped directly in the metaphase chromosomes of man and barley (Hordeum vulgare L.), and in the metaphase and polytene chromosomes of Drosophila melanogaster. To this end, synthetic oligonucleotides corresponding to (AG)(12) and (AC)(8) were labelled by the random primer technique and used as probes in fluorescent in situ hybridisation (FISH) under high stringency and strict washing conditions. The distribution and intensity of the signals for the repeat sequences were found to be characteristic of the chromosomes and genomes of the three species analysed. The AC repeat sites were uniformly dispersed along the euchromatic segments of all three genomes; in fact, they were largely excluded from the heterochromatin. The Drosophila genome showed a high density of AC sequences on the X chromosome in both mitotic and polytene nuclei. In contrast, the AG repeats were associated with the euchromatic regions of the polytene chromosomes (and in high density on the X chromosome), but were only seen in specific heterochromatic regions in the mitotic chromosomes of all three species. In Drosophila, the AG repeats were exclusively distributed on the tips of the Y chromosome and near the centromere on both arms of chromosome 2. In barley and man, AG repeats were associated with the centromeres (of all chromosomes) and nucleolar organizer regions, respectively. The conserved chromosome distribution of AC within and between these three phylogenetically distant species, and the association of AG in specific chromosome regions with structural or functional properties, suggests that long clusters of these repeats may have some, as yet unknown, role. Copyright (c) 2007 S. Karger AG, Basel.
ERIC Educational Resources Information Center
Pappas, Marjorie L.
2004-01-01
Virtual libraries are becoming more and more common. Most states have a virtual library. A growing number of public libraries have a virtual presence on the Web. Virtual libraries are a growing addition to school library media collections. The next logical step would be personal virtual libraries. A personal virtual library (PVL) is a collection…
Positional cloning of the chromosome 14 Alzheimer`s disease locus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clark, R.F.; Korenblat, K.M.; Goate, A.M.
1994-09-01
Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less
ERIC Educational Resources Information Center
Merrill, Alex
2011-01-01
This article discusses possible future directions for academic libraries in the post Web/Library 2.0 world. These possible directions include areas such as data literacy, linked data sets, and opportunities for libraries in support of digital humanities. The author provides a brief sketch of the background information regarding the topics and…
Abnormal chromosome complement resulting from a familial inversion of chromosome 2.
Richter, S; Lockwood, B; Lockwood, D; Allanson, J
1989-01-01
It has been suggested that pericentric inversions of chromosome 2 increase the risk for spontaneous abortion but do not increase the risk for unbalanced recombinant offspring. We report our experience of a familial pericentric inversion of chromosome 2 resulting in two unbalanced recombinant offspring. Both subjects have 46,XX,rec(2),dup q,inv(2)(p25q35). Images PMID:2479747
ERIC Educational Resources Information Center
Lyons, Ray; Lance, Keith Curry
2009-01-01
"Library Journal"'s new national rating of public libraries, the "LJ" Index of Public Library Service, identifies 256 "star" libraries. It rates 7,115 public libraries. The top libraries in each group get five, four, or three Michelin guide-like stars. All included libraries, stars or not, can use their scores to learn from their peers and improve…
Tandem mass spectrometry spectral libraries and library searching.
Deutsch, Eric W
2011-01-01
Spectral library searching in the field of proteomics has been gaining visibility and use in the last few years, primarily due to the expansion of public proteomics data repositories and the large spectral libraries that can be generated from them. Spectral library searching has several advantages over conventional sequence searching: it is generally much faster, and has higher specificity and sensitivity. The speed increase is primarily, due to having a smaller, fully indexable search space of real spectra that are known to be observable. The increase in specificity and sensitivity is primarily due to the ability of a search engine to utilize the known intensities of the fragment ions, rather than just comparing with theoretical spectra as is done with sequence searching. The main disadvantage of spectral library searching is that one can only identify peptide ions that have been seen before and are stored in the spectral library. In this chapter, an overview of spectral library searching and the libraries currently available are presented.
Spatial organization of bacterial chromosomes
Wang, Xindan; Rudner, David Z.
2014-01-01
Bacterial chromosomes are organized in stereotypical patterns that are faithfully and robustly regenerated in daughter cells. Two distinct spatial patterns were described almost a decade ago in our most tractable model organisms. In recent years, analysis of chromosome organization in a larger and more diverse set of bacteria and a deeper characterization of chromosome dynamics in the original model systems have provided a broader and more complete picture of both chromosome organization and the activities that generate the observed spatial patterns. Here, we summarize these different patterns highlighting similarities and differences and discuss the protein factors that help establish and maintain them. PMID:25460798
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on university and other research libraries, presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The Impact of Technology on Users of Academic and Research Libraries," in which C. Lee Jones (United States) focuses on the impact of technical advances in computing and…
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on network activity among university and other general research libraries and information centers presented at the 1982 International Federation of Library Associations (IFLA) conference include: (1) "The Principles of the Relationship Between National and University Library Collections as a Basis for a Network" by K. W. Humphreys (United…
Novel insights into mitotic chromosome condensation
Piskadlo, Ewa; Oliveira, Raquel A.
2016-01-01
The fidelity of mitosis is essential for life, and successful completion of this process relies on drastic changes in chromosome organization at the onset of nuclear division. The mechanisms that govern chromosome compaction at every cell division cycle are still far from full comprehension, yet recent studies provide novel insights into this problem, challenging classical views on mitotic chromosome assembly. Here, we briefly introduce various models for chromosome assembly and known factors involved in the condensation process (e.g. condensin complexes and topoisomerase II). We will then focus on a few selected studies that have recently brought novel insights into the mysterious way chromosomes are condensed during nuclear division. PMID:27508072
Chromosome chains and platypus sex: kinky connections.
Ashley, Terry
2005-07-01
Mammal sex determination depends on an XY chromosome system, a gene for testis development and a means of activating the X chromosome. The duckbill platypus challenges these dogmas.(1,2) Gutzner et al.(1) find no recognizable SRY sequence and question whether the mammalian X was even the original sex chromosome in the platypus. Instead they suggest that the original platypus sex chromosomes were derived from the ZW chromosome system of birds and reptiles. Unraveling the puzzles of sex determination and dosage compensation in the platypus has been complicated by the fact that it has a surplus of sex chromosomes. Rather than a single X and Y chromosome, the male platypus has five Xs and five Ys. Copyright (c) 2005 Wiley Periodicals, Inc.
Kadoya, Ryosuke; Chattoraj, Dhruba K
2012-01-01
Vibrio cholerae has two chromosomes (chrI and chrII) whose replication and segregation are under different genetic controls. The region covering the replication origin of chrI resembles that of the Escherichia coli chromosome, and both origins are under control of the highly conserved initiator, DnaA. The origin region of chrII resembles that of plasmids that have iterated initiator-binding sites (iterons) and is under control of the chrII-specific initiator, RctB. Both chrI and chrII encode chromosome-specific orthologs of plasmid partitioning proteins, ParA and ParB. Here, we have interfered with chrII replication, segregation, or both, using extra copies of sites that titrate RctB or ParB. Under these conditions, replication and segregation of chrI remain unaffected for at least 1 cell cycle. In this respect, chrI behaves similarly to the E. coli chromosome when plasmid maintenance is disturbed in the same cell. Apparently, no checkpoint exists to block cell division before the crippled chromosome is lost by a failure to replicate or to segregate. Whether blocking chrI replication can affect chrII replication remains to be tested. Chromosome replication, chromosome segregation, and cell division are the three main events of the cell cycle. They occur in an orderly fashion once per cell cycle. How the sequence of events is controlled is only beginning to be answered in bacteria. The finding of bacteria that possess more than one chromosome raises the important question: how are different chromosomes coordinated in their replication and segregation? It appears that in the evolution of the two-chromosome genome of V. cholerae, either the secondary chromosome adapted to the main chromosome to ensure its maintenance or it is maintained independently, as are bacterial plasmids. An understanding of chromosome coordination is expected to bear on the evolutionary process of chromosome acquisition and on the efficacy of possible strategies for selective elimination of a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ferrari, S.; Finelli, P.; Rocchi, M.
The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less
Kinoshita, Yusuke; Kamitani, Hideki; Mamun, Mahabub Hasan; Wasita, Brian; Kazuki, Yasuhiro; Hiratsuka, Masaharu; Oshimura, Mitsuo; Watanabe, Takashi
2010-05-01
Mesenchymal stem cells (MSCs) have been expected to become useful gene delivery vehicles against human malignant gliomas when coupled with an appropriate vector system, because they migrate towards the lesion. Human artificial chromosomes (HACs) are non-integrating vectors with several advantages for gene therapy, namely, no limitations on the size and number of genes that can be inserted. We investigated the migration of human immortalized MSCs bearing a HAC vector containing the herpes simplex virus thymidine kinase gene (HAC-tk-hiMSCs) towards malignant gliomas in vivo. Red fluorescence protein-labeled human glioblastoma HTB14 cells were implanted into a subcortical region in nude mice. Four days later, green fluorescence protein-labeled HAC-tk-hiMSCs were injected into a contralateral subcortical region (the HTB14/HAC-tk-hiMSC injection model). Tropism to the glioma mass and the route of migration were visualized by fluorescence microscopy and immunohistochemical staining. HAC-tk-hiMSCs began to migrate toward the HTB14 glioma area via the corpus callosum on day 4, and gathered around the HTB14 glioma mass on day 7. To test whether the delivered gene could effectively treat glioblastoma in vivo, HTB14/HAC-tk-hiMSC injected mice were treated with ganciclovir (GCV) or PBS. The HTB14 glioma mass was significantly reduced by GCV treatment in mice injected with HAC-tk-hiMSCs. It was confirmed that gene delivery by our HAC-hiMSC system was effective after migration of MSCs to the glioma mass in vivo. Therefore, MSCs containing HACs carrying an anticancer gene or genes may provide a new tool for the treatment of malignant gliomas and possibly of other tumor types.
Helleu, Quentin; Gérard, Pierre R.; Montchamp-Moreau, Catherine
2015-01-01
Sex chromosome drivers are selfish elements that subvert Mendel's first law of segregation and therefore are overrepresented among the products of meiosis. The sex-biased progeny produced then fuels an extended genetic conflict between the driver and the rest of the genome. Many examples of sex chromosome drive are known, but the occurrence of this phenomenon is probably largely underestimated because of the difficulty to detect it. Remarkably, nearly all sex chromosome drivers are found in two clades, Rodentia and Diptera. Although very little is known about the molecular and cellular mechanisms of drive, epigenetic processes such as chromatin regulation could be involved in many instances. Yet, its evolutionary consequences are far-reaching, from the evolution of mating systems and sex determination to the emergence of new species. PMID:25524548
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dowd, M.A.; Gaulden, M.E.; Proctor, B.L.
1986-01-01
Embryos of the grasshopper Chortophaga viridifasciata were exposed in vitro to formaldehyde (FA), as formalin, at concentrations ranging from 10/sup -8/ M (0.0003 ppm) to 10/sup -3/ M (30 ppm) at 38/sup 0/C. A low frequency of distinct acentric chromosome fragments was observed in the neuroblasts after 1 hr exposure to 7.5 x 10/sup -4/ or 10/sup -3/ M FA plus 3 hr recovery, but not at lower concentrations, even with 4 hr exposure. Neuroblasts with sticky chromosomes were observed at 10/sup -4/, 7.5 x 10/sup -4/, and 10/sup -3/ M FA, the percent of cells with slight, moderate, ormore » severe stickiness varying with FA concentrations. Fragments were associated with the sticky chromosomes. It is concluded that the distinct acentric fragments induced by FA result from breakage at a single sticky point (slight stickiness) between separating sister chromatids. The chromosome effects observed probably result from the action of daughter products that are formed by the interaction of FA with culture medium components, especially the fetal calf serum.« less
USDA-ARS?s Scientific Manuscript database
The Marek’s disease virus (MDV) MEQ gene is essential for the T-cell lymphocytic infiltration of nerves and other organs seen in chickens with Marek’s disease (MD). In an earlier study, researchers used an overlapping cosmid clone library of MDV and demonstrated that deleting MEQ resulted in an exce...
Melo, Silvana; Utsunomia, Ricardo; Penitente, Manolo; Sobrinho-Scudeler, Patrícia Elda; Porto-Foresti, Fábio; Oliveira, Claudio; Foresti, Fausto; Dergam, Jorge Abdala
2017-01-01
Abstract Within the genus Prochilodus Agassiz, 1829, five species are known to carry B chromosomes, i.e. chromosomes beyond the usual diploid number that have been traditionally considered as accessory for the genome. Chromosome microdissection and mapping of repetitive DNA sequences are effective tools to assess the DNA content and allow a better understanding about the origin and composition of these elements in an array of species. In this study, a novel characterization of B chromosomes in Prochilodus costatus Valenciennes, 1850 (2n=54) was reported for the first time and their sequence complementarity with the supernumerary chromosomes observed in Prochilodus lineatus (Valenciennes, 1836) and Prochilodus argenteus Agassiz, 1829 was investigated. The hybridization patterns obtained with chromosome painting using the micro B probe of P. costatus and the satDNA SATH1 mapping made it possible to assume homology of sequences between the B chromosomes of these congeneric species. Our results suggest that the origin of B chromosomes in the genus Prochilodus is a phylogenetically old event. PMID:28919971
Nabeshima, Kentaro; Mlynarczyk-Evans, Susanna; Villeneuve, Anne M
2011-08-01
During early meiotic prophase, a nucleus-wide reorganization leads to sorting of chromosomes into homologous pairs and to establishing associations between homologous chromosomes along their entire lengths. Here, we investigate global features of chromosome organization during this process, using a chromosome painting method in whole-mount Caenorhabditis elegans gonads that enables visualization of whole chromosomes along their entire lengths in the context of preserved 3D nuclear architecture. First, we show that neither spatial proximity of premeiotic chromosome territories nor chromosome-specific timing is a major factor driving homolog pairing. Second, we show that synaptonemal complex-independent associations can support full lengthwise juxtaposition of homologous chromosomes. Third, we reveal a prominent elongation of chromosome territories during meiotic prophase that initiates prior to homolog association and alignment. Mutant analysis indicates that chromosome movement mediated by association of chromosome pairing centers (PCs) with mobile patches of the nuclear envelope (NE)-spanning SUN-1/ZYG-12 protein complexes is not the primary driver of territory elongation. Moreover, we identify new roles for the X chromosome PC (X-PC) and X-PC binding protein HIM-8 in promoting elongation of X chromosome territories, separable from their role(s) in mediating local stabilization of pairing and association of X chromosomes with mobile SUN-1/ZYG-12 patches. Further, we present evidence that HIM-8 functions both at and outside of PCs to mediate chromosome territory elongation. These and other data support a model in which synapsis-independent elongation of chromosome territories, driven by PC binding proteins, enables lengthwise juxtaposition of chromosomes, thereby facilitating assessment of their suitability as potential pairing partners.
Academic Library-State Library Agency Relationships: The Pennsylvania Needs Assessment.
ERIC Educational Resources Information Center
Townley, Charles T.; And Others
1988-01-01
Discusses the interdependency between academic libraries and state library agencies, and describes a survey which assessed the needs of Pennsylvania's academic libraries that could be addressed by state library agencies. The needs discussed include advocacy of academic libraries, linked systems protocols, telecommunications, and new technologies.…
Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S
1999-10-06
The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.
ERIC Educational Resources Information Center
Drake, Miriam A.
In fall 1984, the Georgia Institute of Technology administration and library staff began planning for Library 2000, a project aimed at creating a showcase library to demonstrate the application of the latest information technology in an academic and research environment. The purposes of Library 2000 include: increasing awareness of students,…
Origin and domestication of papaya Yh chromosome
USDA-ARS?s Scientific Manuscript database
Sex in papaya is controlled by a pair of nascent sex chromosomes. Females are XX, and two slightly different Y chromosomes distinguish males (XY) and hermaphrodites (XYh). The hermaphrodite-specific region of the Yh chromosome (HSY) and its X chromosome counterpart were sequenced and analyzed previo...
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on government libraries, public libraries, and research libraries presented at the 1984 IFLA general conference include: (1) "Library Services for Research" (Maria S. Pla de Menendez, Colombia); (2) "Interlibrary Loans, Present and Future: A Consideration for Academic Library Management" (Geoffrey G. Allen, Australia);…
Wheeler, Bayly S; Anderson, Erika; Frøkjær-Jensen, Christian; Bian, Qian; Jorgensen, Erik; Meyer, Barbara J
2016-01-01
Changes in chromosome number impair fitness by disrupting the balance of gene expression. Here we analyze mechanisms to compensate for changes in gene dose that accompanied the evolution of sex chromosomes from autosomes. Using single-copy transgenes integrated throughout the Caenorhabditis elegans genome, we show that expression of all X-linked transgenes is balanced between XX hermaphrodites and XO males. However, proximity of a dosage compensation complex (DCC) binding site (rex site) is neither necessary to repress X-linked transgenes nor sufficient to repress transgenes on autosomes. Thus, X is broadly permissive for dosage compensation, and the DCC acts via a chromosome-wide mechanism to balance transcription between sexes. In contrast, no analogous X-chromosome-wide mechanism balances transcription between X and autosomes: expression of compensated hermaphrodite X-linked transgenes is half that of autosomal transgenes. Furthermore, our results argue against an X-chromosome dosage compensation model contingent upon rex-directed positioning of X relative to the nuclear periphery. DOI: http://dx.doi.org/10.7554/eLife.17365.001 PMID:27572259
Screening and selection of artificial riboswitches.
Harbaugh, Svetlana V; Martin, Jennifer; Weinstein, Jenna; Ingram, Grant; Kelley-Loughnane, Nancy
2018-05-17
Synthetic riboswitches are engineered to regulate gene expression in response to a variety of non-endogenous small molecules, and a challenge to select this engineered response requires robust screening tools. A new synthetic riboswitch can be created by linking an in vitro-selected aptamer library with a randomized expression platform followed by in vivo selection and screening. In order to determine response to analyte, we developed a dual-color reporter comprising elements of the E. coli fimbriae phase variation system: recombinase FimE controlled by a synthetic riboswitch and an invertible DNA segment (fimS) containing a constitutively active promoter placed between two fluorescent protein genes. Without an analyte, the fluorescent reporter constitutively expressed green fluorescent protein (GFPa1). Addition of the analyte initiated translation of fimE causing unidirectional inversion of the fimS segment and constitutive expression of red fluorescent protein (mKate2). The dual color reporter system can be used to select and to optimize artificial riboswitches in E. coli cells. In this work, the enriched library of aptamers incorporated into the riboswitch architecture reduces the sequence search space by offering a higher percentage of potential ligand binders. The study was designed to produce structure switching aptamers, a necessary feature for riboswitch function and efficiently quantify this function using the dual color reporter system. Copyright © 2018. Published by Elsevier Inc.
Chromosome engineering of Escherichia coli for constitutive production of salvianic acid A.
Zhou, Liang; Ding, Qi; Jiang, Guo-Zhen; Liu, Zhen-Ning; Wang, Hai-Yan; Zhao, Guang-Rong
2017-05-16
Salvianic acid A (SAA), a valuable natural product from herbal plant Salvia miltiorrhiza, exhibits excellent antioxidant activities on food industries and efficacious therapeutic potential on cardiovascular diseases. Recently, production of SAA in engineered Escherichia coli was established via the artificial biosynthetic pathway of SAA on the multiple plasmids in our previous work. However, the plasmid-mediated system required to supplement expensive inducers and antibiotics during the fermentation process, restricting scale-up production of SAA. Microbial cell factory would be an attractive approach for constitutive production of SAA by chromosome engineering. The limited enzymatic reactions in SAA biosynthetic pathway from glucose were grouped into three modules, which were sequentially integrated into chromosome of engineered E. coli by λ Red homologous recombination method. With starting strain E. coli BAK5, in which the ptsG, pykF, pykA, pheA and tyrR genes were previously deleted, chassis strain BAK11 was constructed for constitutive production of precursor L-tyrosine by replacing the 17.7-kb mao-paa cluster with module 1 (P lacUV5 -aroG fbr -tyrA fbr -aroE) and the lacI gene with module 2 (P trc -glk-tktA-ppsA). The synthetic 5tacs promoter demonstrated the optimal strength to drive the expression of hpaBC-d-ldh Y52A in module 3, which then was inserted at the position between nupG and speC on the chromosome of strain BAK11. The final strain BKD13 produced 5.6 g/L of SAA by fed-batch fermentation in 60 h from glucose without any antibiotics and inducers supplemented. The plasmid-free and inducer-free strain for SAA production was developed by targeted integration of the constitutive expression of SAA biosynthetic genes into E. coli chromosome. Our work provides the industrial potential for constitutive production of SAA by the indel microbial cell factory and also sets an example of further producing other valuable natural and unnatural products.
Matsubara, Kazumi; Tarui, Hiroshi; Toriba, Michihisa; Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Agata, Kiyokazu; Matsuda, Yoichi
2006-01-01
All snake species exhibit genetic sex determination with the ZZ/ZW type of sex chromosomes. To investigate the origin and evolution of snake sex chromosomes, we constructed, by FISH, a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 109 cDNA clones. Eleven of the 109 clones were localized to the Z chromosome. All human and chicken homologues of the snake Z-linked genes were located on autosomes, suggesting that the sex chromosomes of snakes, mammals, and birds were all derived from different autosomal pairs of the common ancestor. We mapped the 11 Z-linked genes of E. quadrivirgata to chromosomes of two other species, the Burmese python (Python molurus bivittatus) and the habu (Trimeresurus flavoviridis), to investigate the process of W chromosome differentiation. All and 3 of the 11 clones were localized to both the Z and W chromosomes in P. molurus and E. quadrivirgata, respectively, whereas no cDNA clones were mapped to the W chromosome in T. flavoviridis. Comparative mapping revealed that the sex chromosomes are only slightly differentiated in P. molurus, whereas they are fully differentiated in T. flavoviridis, and E. quadrivirgata is at a transitional stage of sex-chromosome differentiation. The differentiation of sex chromosomes was probably initiated from the distal region on the short arm of the protosex chromosome of the common ancestor, and then deletion and heterochromatization progressed on the sex-specific chromosome from the phylogenetically primitive boids to the more advanced viperids. PMID:17110446
ERIC Educational Resources Information Center
International Federation of Library Associations and Institutions, London (England).
Twelve papers delivered at a joint meeting at the International Federation of Library Associations and Institutions annual meeting of the Children's Libraries, Public Libraries, and Libraries for the Blind sections of the Division of Libraries Serving the General Public are presented. Most of the papers deal with library services to children, but…
Updating the maize karyotype by chromosome DNA sizing.
Silva, Jéssica Coutinho; Carvalho, Carlos Roberto; Clarindo, Wellington Ronildo
2018-01-01
The karyotype is a basic concept regarding the genome, fundamentally described by the number and morphological features of all chromosomes. Chromosome class, centromeric index, intra- and interchromosomal asymmetry index, and constriction localization are important in clinical, systematic and evolutionary approaches. In spite of the advances in karyotype characterization made over the last years, new data about the chromosomes can be generated from quantitative methods, such as image cytometry. Therefore, using Zea mays L., this study aimed to update the species' karyotype by supplementing information on chromosome DNA sizing. After adjustment of the procedures, chromosome morphometry and class as well as knob localization enabled describing the Z. mays karyotype. In addition, applying image cytometry, DNA sizing was unprecedentedly measured for the arms and satellite of all chromosomes. This way, unambiguous identification of the chromosome pairs, and hence the assembly of 51 karyograms, were only possible after the DNA sizing of each chromosome, their arms and satellite portions. These accurate, quantitative and reproducible data also enabled determining the distribution and variation of DNA content in each chromosome. From this, a correlation between DNA amount and total chromosome length evidenced that the mean DNA content of chromosome 9 was higher than that of chromosome 8. The chromosomal DNA sizing updated the Z. mays karyotype, providing insights into its dynamic genome with regards to the organization of the ten chromosomes and their respective portions. Considering the results and the relevance of cytogenetics in the current scenario of comparative sequencing and genomics, chromosomal DNA sizing should be incorporated as an additional parameter for karyotype definition. Based on this study, it can be affirmed that cytogenetic approaches go beyond the simple morphological description of chromosomes.
Bacterial chromosome organization and segregation
Badrinarayanan, Anjana; Le, Tung BK; Laub, Michael T
2016-01-01
If fully stretched out, a typical bacterial chromosome would be nearly one millimeter long, or approximately 1000 times the length of a cell. Not only must cells massively compact their genetic material, but they must also organize their DNA in a manner that is compatible with a range of cellular processes, including DNA replication, DNA repair, homologous recombination, and horizontal gene transfer. Recent work, driven in part by technological advances, has begun to reveal the general principles of chromosome organization in bacteria. Here, drawing on studies of many different organisms, we review the emerging picture of how bacterial chromosomes are structured at multiple length-scales, highlighting the functions of various DNA-binding proteins and impact of physical forces. Additionally, we discuss the spatial dynamics of chromosomes, particularly during their segregation to daughter cells. Although there has been tremendous progress, we also highlight gaps that remain in understanding chromosome organization and segregation. PMID:26566111
ERIC Educational Resources Information Center
BCEL Newsletter for the Business Community, 1986
1986-01-01
Paradoxically, for reasons both philosophical and practical, public libraries are uniquely positioned to assist the 72 million Americans who, by virtue of being illiterate or marginally literate, are not ordinarily library users. A formal link between libraries and literacy can be traced back to the 1920s when the American Library Association…
ERIC Educational Resources Information Center
Manley, Will; And Others
1989-01-01
The innovative designs of three libraries are described: the Tempe (Arizona) Public Library, which emphasizes services for children and students; an underground library at Park College, Missouri; and a public library located in the Vancouver (Washington) Mall. The fourth article describes the work going on to restore the Los Angeles (California)…
Y-chromosome polymorphism: Possible largest Y chromosome in man?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murthy, D.S.K.; Al-Awadi, S.A.; Bastaki, L.
The role of variations (inversions/deletion or duplication) in the heterochromatin in gonadal development and function, reproductive fitness, and malignant disease has been extensively studied. However, the causal-relationship of large Y (Yqh+) and repeated fetal loss has not been established unequivocally. An Arab couple (?Bedouin origin) with a history of repeated abortions were investigated. Karyotype analysis of the husband showed a very large Y chromosome, confirmed by GTG-, QFQ- and CBG-banding techniques. C-banding showed discontinuous distribution of the heterochromatin blocks separated by pale bands. The origin of the large heterochromatin segment could be due to tandem duplication of the Yq regionmore » or translocation (Yq:Yq). No other relatives (males) of the propositus have been available for investigation. Polymorphism of the Y chromosome could be attributed to evolutionary changes from an ancestral type, either by deletion or duplication of the heterochromatin segment. More detailed studies on isolated, aboriginal/tribal human populations will enable us to better understand the significance of the Y chromosome polymorphism.« less
αRep A3: A Versatile Artificial Scaffold for Metalloenzyme Design.
Di Meo, Thibault; Ghattas, Wadih; Herrero, Christian; Velours, Christophe; Minard, Philippe; Mahy, Jean-Pierre; Ricoux, Rémy; Urvoas, Agathe
2017-07-26
αRep refers to a new family of artificial proteins based on a thermostable α-helical repeated motif. One of its members, αRep A3, forms a stable homo-dimer with a wide cleft that is able to accommodate metal complexes and thus appears to be suitable for generating new artificial biocatalysts. Based on the crystal structure of αRep A3, two positions (F119 and Y26) were chosen, and independently changed into cysteine residues. A phenanthroline ligand was covalently attached to the unique cysteine residue of each protein variant, and the corresponding biohybrids were purified and characterized. Once mutated and coupled to phenanthroline, the protein remained folded and dimeric. Copper(II) was specifically bound by the two biohybrids with two different binding modes. Furthermore, the holo-biohybrid A3F119NPH was found to be capable of enantioselectively catalyzing Diels-Alder (D-A) cycloadditions with up to 62 % ee. This study validates the choice of the αRep A3 dimer as a protein scaffold and provides a promising new route for the design and production of new enantioselective biohybrids based on entirely artificial proteins obtained from a highly diverse library. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chromosome Segregation Is Biased by Kinetochore Size.
Drpic, Danica; Almeida, Ana C; Aguiar, Paulo; Renda, Fioranna; Damas, Joana; Lewin, Harris A; Larkin, Denis M; Khodjakov, Alexey; Maiato, Helder
2018-05-07
Chromosome missegregation during mitosis or meiosis is a hallmark of cancer and the main cause of prenatal death in humans. The gain or loss of specific chromosomes is thought to be random, with cell viability being essentially determined by selection. Several established pathways including centrosome amplification, sister-chromatid cohesion defects, or a compromised spindle assembly checkpoint can lead to chromosome missegregation. However, how specific intrinsic features of the kinetochore-the critical chromosomal interface with spindle microtubules-impact chromosome segregation remains poorly understood. Here we used the unique cytological attributes of female Indian muntjac, the mammal with the lowest known chromosome number (2n = 6), to characterize and track individual chromosomes with distinct kinetochore size throughout mitosis. We show that centromere and kinetochore functional layers scale proportionally with centromere size. Measurement of intra-kinetochore distances, serial-section electron microscopy, and RNAi against key kinetochore proteins confirmed a standard structural and functional organization of the Indian muntjac kinetochores and revealed that microtubule binding capacity scales with kinetochore size. Surprisingly, we found that chromosome segregation in this species is not random. Chromosomes with larger kinetochores bi-oriented more efficiently and showed a 2-fold bias to congress to the equator in a motor-independent manner. Despite robust correction mechanisms during unperturbed mitosis, chromosomes with larger kinetochores were also strongly biased to establish erroneous merotelic attachments and missegregate during anaphase. This bias was impervious to the experimental attenuation of polar ejection forces on chromosome arms by RNAi against the chromokinesin Kif4a. Thus, kinetochore size is an important determinant of chromosome segregation fidelity. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Library Science Education: A New Role for Academic Libraries
ERIC Educational Resources Information Center
Wesley, Threasa L.
2018-01-01
Many individuals working in library and information organizations do not hold a master of library science (MLS) degree or other specialized library science credential. Recognizing that this professional gap could be addressed by diversified educational opportunities, the W. Frank Steely Library at Northern Kentucky University in Highland Heights…
A 1.5-Mb cosmid contig of the CMT1A duplication/HNPP deletion critical region in 17p11.2-p12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murakami, Tatsufumi; Lupski, J.R.
1996-05-15
Charcot-Marie-Tooth disease type 1A (CMT1A) is associated with a 1.5-Mb tandem duplication in chromosome 17p11.2-p12, and hereditary neuropathy with liability to pressure palsies (HNPP) is associated with a 1.5-Mb deletion at this locus. Both diseases appear to result from an altered copy number of the peripheral myelin protein-22 gene, PMP22, which maps within the critical region. To identify additional genes and characterize chromosomal elements, a 1.5-Mb cosmid contig of the CMT1A duplication/HNPP deletion critical region was assembled using a yeast artificial chromosome (YAC)-based isolation and binning strategy. Whole YAC probes were used for screening a high-density arrayed chromosome 17-specific cosmidmore » library. Selected cosmids were spotted on dot blots and assigned to bins defined by YACs. This binning of cosmids facilitated the subsequent fingerprint analysis. The 1.5-Mb region was covered by 137 cosmids with a minimum overlap set of 52 cosmids assigned to 17 bins and 9 contigs. 20 refs., 2 figs.« less
Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stadler, H.S.; Padanilam, B.J.; Solursh, M.
1992-12-01
A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less
Exceptional complex chromosomal rearrangements in three generations.
Kartapradja, Hannie; Marzuki, Nanis Sacharina; Pertile, Mark D; Francis, David; Suciati, Lita Putri; Anggaratri, Helena Woro; Ambarwati, Debby Dwi; Idris, Firman Prathama; Lesmana, Harry; Trimarsanto, Hidayat; Paramayuda, Chrysantine; Harahap, Alida Roswita
2015-01-01
We report an exceptional complex chromosomal rearrangement (CCR) found in three individuals in a family that involves 4 chromosomes with 5 breakpoints. The CCR was ascertained in a phenotypically abnormal newborn with additional chromosomal material on the short arm of chromosome 4. Maternal karyotyping indicated that the mother carried an apparently balanced CCR involving chromosomes 4, 6, 11, and 18. Maternal transmission of the derivative chromosome 4 resulted in partial trisomy for chromosomes 6q and 18q and a partial monosomy of chromosome 4p in the proband. Further family studies found that the maternal grandmother carried the same apparently balanced CCR as the proband's mother, which was confirmed using the whole chromosome painting (WCP) FISH. High resolution whole genome microarray analysis of DNA from the proband's mother found no evidence for copy number imbalance in the vicinity of the CCR translocation breakpoints, or elsewhere in the genome, providing evidence that the mother's and grandmother's CCRs were balanced at a molecular level. This structural rearrangement can be categorized as an exceptional CCR due to its complexity and is a rare example of an exceptional CCR being transmitted in balanced and/or unbalanced form across three generations.
Intranuclear DNA density affects chromosome condensation in metazoans
Hara, Yuki; Iwabuchi, Mari; Ohsumi, Keita; Kimura, Akatsuki
2013-01-01
Chromosome condensation is critical for accurate inheritance of genetic information. The degree of condensation, which is reflected in the size of the condensed chromosomes during mitosis, is not constant. It is differentially regulated in embryonic and somatic cells. In addition to the developmentally programmed regulation of chromosome condensation, there may be adaptive regulation based on spatial parameters such as genomic length or cell size. We propose that chromosome condensation is affected by a spatial parameter called the chromosome amount per nuclear space, or “intranuclear DNA density.” Using Caenorhabditis elegans embryos, we show that condensed chromosome sizes vary during early embryogenesis. Of importance, changing DNA content to haploid or polyploid changes the condensed chromosome size, even at the same developmental stage. Condensed chromosome size correlates with interphase nuclear size. Finally, a reduction in nuclear size in a cell-free system from Xenopus laevis eggs resulted in reduced condensed chromosome sizes. These data support the hypothesis that intranuclear DNA density regulates chromosome condensation. This suggests an adaptive mode of chromosome condensation regulation in metazoans. PMID:23783035
Public Libraries Section. Libraries Serving General Public Division. Papers.
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Papers on public libraries, which were presented at the 1983 International Federation of Library Associations (IFLA) conference, include: (1) "The Role of Public Libraries in Developing Countries with Particular Reference to the Gambia" by Sally P. C. N'Jie (The Gambia); (2) "Public Libraries in the Federal Republic of Germany…
Library Law Handbook: State Laws Relating to Michigan Libraries. 1993 Edition.
ERIC Educational Resources Information Center
Michigan Library, Lansing.
This document is a compilation of state laws relating to Michigan libraries, intended as a tool for library managers and as an expression of continued commitment to strengthening library services throughout the state. It reprints legislation directly related to libraries of all levels, including: library networks; regional libraries: district…
Chromosome painting - principles, strategies and scope.
Sharma, A K; Sharma, A
2001-01-01
Chromosome Painting is emerging as a powerful tool in the exact localization of different gene sequences of chromosomes at the microscopic level. It is principally based on molecular hybridization in situ with sequence specific probes on chromosomes. Different strategies have been adopted for the preparation of probes, hybridization and visualization. The impact of this method lies in identification of genes for desired characters in the chromosomes, including those of genetic disorders, in cancer research, in transgenesis and in studies on biodiversity and evolution.
Assignment of the human PAX4 gene to chromosome band 7q32 by fluorescence in situ hybridization.
Tamura, T; Izumikawa, Y; Kishino, T; Soejima, H; Jinno, Y; Niikawa, N
1994-01-01
Of the nine known members of a human paired box-containing gene family (Pax), only PAX4 has not been precisely localized. We screened a cosmid library of human genomic DNA using polymerase chain reaction products for PAX4 as a probe and isolated three positive cosmid clones. Sequence analysis revealed that at least two of them had exon-like sequences and showed extensive homology to Pax-4 in the mouse. These two cosmid clones were mapped to human chromosome band 7q32 by fluorescence in situ hybridization.
ERIC Educational Resources Information Center
Foskett, D. J.
The Special Library is distinguished from other libraries as being a library serving a particular group of readers, who have an existence as a group outside of their readership of the library, and whose members direct at least some of their activities towards a common purpose. Thus, the special librarian's first and major responsibility is to know…
Fluorescence imaging of chromosomal DNA using click chemistry
NASA Astrophysics Data System (ADS)
Ishizuka, Takumi; Liu, Hong Shan; Ito, Kenichiro; Xu, Yan
2016-09-01
Chromosome visualization is essential for chromosome analysis and genetic diagnostics. Here, we developed a click chemistry approach for multicolor imaging of chromosomal DNA instead of the traditional dye method. We first demonstrated that the commercially available reagents allow for the multicolor staining of chromosomes. We then prepared two pro-fluorophore moieties that served as light-up reporters to stain chromosomal DNA based on click reaction and visualized the clear chromosomes in multicolor. We applied this strategy in fluorescence in situ hybridization (FISH) and identified, with high sensitivity and specificity, telomere DNA at the end of the chromosome. We further extended this approach to observe several basic stages of cell division. We found that the click reaction enables direct visualization of the chromosome behavior in cell division. These results suggest that the technique can be broadly used for imaging chromosomes and may serve as a new approach for chromosome analysis and genetic diagnostics.
Library of the Year 2008: Laramie County Library System, Wyoming--The Impact Library
ERIC Educational Resources Information Center
Berry, John N., III
2008-01-01
This article features Laramie County Library System (LCLS) of Cheyenne, Wyoming, which is named as Gale/"Library Journal" 2008 Library of the Year. It is not just strong, effective publicity or the fine new building or even a staff built around its ability to connect with the people, although all of those things add to the impact of…
Updating the maize karyotype by chromosome DNA sizing
2018-01-01
The karyotype is a basic concept regarding the genome, fundamentally described by the number and morphological features of all chromosomes. Chromosome class, centromeric index, intra- and interchromosomal asymmetry index, and constriction localization are important in clinical, systematic and evolutionary approaches. In spite of the advances in karyotype characterization made over the last years, new data about the chromosomes can be generated from quantitative methods, such as image cytometry. Therefore, using Zea mays L., this study aimed to update the species’ karyotype by supplementing information on chromosome DNA sizing. After adjustment of the procedures, chromosome morphometry and class as well as knob localization enabled describing the Z. mays karyotype. In addition, applying image cytometry, DNA sizing was unprecedentedly measured for the arms and satellite of all chromosomes. This way, unambiguous identification of the chromosome pairs, and hence the assembly of 51 karyograms, were only possible after the DNA sizing of each chromosome, their arms and satellite portions. These accurate, quantitative and reproducible data also enabled determining the distribution and variation of DNA content in each chromosome. From this, a correlation between DNA amount and total chromosome length evidenced that the mean DNA content of chromosome 9 was higher than that of chromosome 8. The chromosomal DNA sizing updated the Z. mays karyotype, providing insights into its dynamic genome with regards to the organization of the ten chromosomes and their respective portions. Considering the results and the relevance of cytogenetics in the current scenario of comparative sequencing and genomics, chromosomal DNA sizing should be incorporated as an additional parameter for karyotype definition. Based on this study, it can be affirmed that cytogenetic approaches go beyond the simple morphological description of chromosomes. PMID:29293613
Helleu, Quentin; Gérard, Pierre R; Montchamp-Moreau, Catherine
2014-12-18
Sex chromosome drivers are selfish elements that subvert Mendel's first law of segregation and therefore are overrepresented among the products of meiosis. The sex-biased progeny produced then fuels an extended genetic conflict between the driver and the rest of the genome. Many examples of sex chromosome drive are known, but the occurrence of this phenomenon is probably largely underestimated because of the difficulty to detect it. Remarkably, nearly all sex chromosome drivers are found in two clades, Rodentia and Diptera. Although very little is known about the molecular and cellular mechanisms of drive, epigenetic processes such as chromatin regulation could be involved in many instances. Yet, its evolutionary consequences are far-reaching, from the evolution of mating systems and sex determination to the emergence of new species. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.
Huang, D; Wu, W; Lu, L
2004-05-01
Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.
Adhikari, Badri; Trieu, Tuan; Cheng, Jianlin
2016-11-07
Reconstructing three-dimensional structures of chromosomes is useful for visualizing their shapes in a cell and interpreting their function. In this work, we reconstruct chromosomal structures from Hi-C data by translating contact counts in Hi-C data into Euclidean distances between chromosomal regions and then satisfying these distances using a structure reconstruction method rigorously tested in the field of protein structure determination. We first evaluate the robustness of the overall reconstruction algorithm on noisy simulated data at various levels of noise by comparing with some of the state-of-the-art reconstruction methods. Then, using simulated data, we validate that Spearman's rank correlation coefficient between pairwise distances in the reconstructed chromosomal structures and the experimental chromosomal contact counts can be used to find optimum conversion rules for transforming interaction frequencies to wish distances. This strategy is then applied to real Hi-C data at chromosome level for optimal transformation of interaction frequencies to wish distances and for ranking and selecting structures. The chromosomal structures reconstructed from a real-world human Hi-C dataset by our method were validated by the known two-compartment feature of the human chromosome organization. We also show that our method is robust with respect to the change of the granularity of Hi-C data, and consistently produces similar structures at different chromosomal resolutions. Chromosome3D is a robust method of reconstructing chromosome three-dimensional models using distance restraints obtained from Hi-C interaction frequency data. It is available as a web application and as an open source tool at http://sysbio.rnet.missouri.edu/chromosome3d/ .
Whitmore Library: A New Concept of Public Library Services.
ERIC Educational Resources Information Center
Schuurman, Guy
Until 1972, library services in Salt Lake County consisted of a group of branch libraries with nearly identical collections for recreational reading. Because the needs of the community had become more complex, a new regional library was built to coordinate library operations and establish new services. Among the innovations in public library…
MDS/AML del(11)(q14) Share Common Morphological Features Despite Different Chromosomal Breakpoints.
Dambruoso, Irene; Invernizzi, Rosangela; Boni, Marina; Zappatore, Rita; Giardini, Ilaria; Cavigliano, Maria Paola; Rocca, Barbara; Calvello, Celeste; Bastia, Raffaella; Caresana, Marilena; Pasi, Francesca; Nano, Rosanna; Bernasconi, Paolo
2017-02-01
In myelodysplatic syndromes and acute myeloid leukemia (MDS/AML) deletion of the 11q14 region is a rare chromosomal defect (incidence: 0.6-1.0%), included within the intermediate risk criteria by the International Prognostic Scoring System. No fluorescence in situ hybridization (FISH) study has yet been performed to identify a common breakpoint region (CBR). In our study through FISH with bacterial artificial chromosomes and commercial probes, we analyzed seven patients with MDS/AML harboring 11q14 deletion on conventional cytogenetic analysis. FISH revealed deletions in five patients and amplifications in two. Three patients with deletion carried a CBR, two had a deletion involving a more centromeric breakpoint. These five patients exhibited multilineage dysplasia, blast cells with large round nuclei, loose chromatin, small and abundant nucleoli, and vacuolated cytoplasm with very thin Auer bodies. In conclusion, the morphological features which occur independently of the extent of the deletion are of multilineage dysplasia in MDS and leukemic blasts strongly reactive to peroxidase in AML; despite the variable size of the deleted area, some patients harbor a CBR. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Kato, Akio
2006-11-14
The invention provides methods for chromosome doubling in plants. The technique overcomes the low yields of doubled progeny associated with the use of prior techniques for doubling chromosomes in plants such as grasses. The technique can be used in large scale applications and has been demonstrated to be highly effective in maize. Following treatment in accordance with the invention, plants remain amenable to self fertilization, thereby allowing the efficient isolation of doubled progeny plants.
Library Subject Guides: A Case Study of Evidence-Informed Library Development
ERIC Educational Resources Information Center
Wakeham, Maurice; Roberts, Angharad; Shelley, Jane; Wells, Paul
2012-01-01
This paper describes the process whereby a university library investigated the value of its subject guides to its users. A literature review and surveys of library staff, library users and other libraries were carried out. Existing library subject guides and those of other higher education libraries were evaluated. The project team reported…
Zushi, Hideki; Murata, Chie; Mizushima, Shusei; Nishida, Chizuko; Kuroiwa, Asato
2017-12-01
X chromosome inactivation (XCI) is an essential mechanism to compensate gene dosage in mammals. Here, we show that XCI has evolved differently in two species of the genus Tokudaia. The Amami spiny rat, Tokudaia osimensis, has a single X chromosome in males and females (XO/XO). By contrast, the Okinawa spiny rat, Tokudaia muenninki, has XX/XY sex chromosomes like most mammals, although the X chromosome has acquired a neo-X region by fusion with an autosome. BAC clones containing the XIST gene, which produces the long non-coding RNA XIST required for XCI, were obtained by screening of T. osimensis and T. muenninki BAC libraries. Each clone was mapped to the homologous region of the X inactivation center in the X chromosome of the two species by BAC-FISH. XIST RNAs were expressed in T. muenninki females, whereas no expression was observed in T. osimensis. The sequence of the XIST RNA was compared with that of mouse, showing that the XIST gene is highly conserved in T. muenninki. XIST RNAs were localized to the ancestral X region (Xq), to the heterochromatic region (pericentromeric region), and partially to the neo-X region (Xp). The hybridization pattern correlated with LINE-1 accumulation in Xq but not in Xp. Dosage of genes located on the neo-X chromosome was not compensated, suggesting that the neo-X region is in an early state of XCI. By contrast, many mutations were observed in the XIST gene of T. osimensis, indicating its loss of function in the XO/XO species.
Introduction of new genetic markers on human chromosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Satoh, Hitoshi; Barrett, J.C.; Oshimura, Mitsuo
1991-03-01
The purpose of this study was to use DNA transfection and microcell chromosome transfer techniques to engineer a human chromosome containing multiple biochemical markers for which selectable growth conditions exist. The starting chromosome was a t(X;3)(3pter{yields}3p12::Xq26{yields}Xpter) chromosome from a reciprocal translocation in the normal human fibroblast cell line GM0439. This chromosome was transferred to a HPRT (hypoxanthine phosphoribosyltransferase)-deficient mouse A9 cell line by microcell fusion and selected under growth conditions for the HPRT gene on the human t(X;3) chromosome. A resultant HAT-resistant cell line (A9(GM0439)-1) contained a single human t(X;3) chromosome. These results demonstrate that microcell chromosome transfer can bemore » used to select chromosomes containing multiple markers.« less
NOAA Photo Library - Treasures of the Library
NOAA Photo Library Banner Takes you to the Top Page Takes you to the About this Site page. Takes Collections page. Takes you to the search page. Takes you to the Links page. treasures of the noaa library The "Treasures of the Library" album and collection has been developed to share images from rare
Hess, Oswald; Meyer, Günther F.
1963-01-01
The nuclei of growing spermatocytes in Drosophila hydei and D. neohydei are characterized by the appearance of phase-specific, paired, loop-shaped structures thought to be similar to the loops in lampbrush chromosomes of amphibian oocytes. In X/O-males of D. hydei spermatogenesis is completely blocked before the first maturation division. No spermatozoa are formed in such testes. In the nuclei of X/O-spermatocytes, paired loop formations are absent. This shows the dependence of these chromosomal functional structures upon the Y chromosome. The basis of this dependence could be shown through an investigation of males with two Y chromosomes. All loop pairs are present in duplicate in XYY males. This proves that the intranuclear formations are structural modifications of the Y chromosome itself. These functional structures are species-specific and characteristically different in Drosophila hydei and D. neohydei. Reciprocal species crosses and a backcross showed that the spermatocyte nuclei of all hybrid males possess the functional structures corresponding to the species which donated the Y chromosome. This shows that the morphological character of the functional structures is also determined by the Y chromosome. PMID:13954225
Chromosomal intrachanges induced by swift iron ions
NASA Astrophysics Data System (ADS)
Horstmann, M.; Durante, M.; Johannes, C.; Obe, G.
We measured the induction of structural aberrations in human chromosome 5 induced by iron ions using the novel technique of multicolor banding in situ hybridization (mBAND). Human lymphocytes isolated from whole blood were exposed in vitro to 500 MeV/n (LET = 200 keV/μm, doses 1 or 4 Gy) Fe nuclei at the HIMAC accelerator in Chiba (Japan). Chromosomes were prematurely condensed by calyculin A after 48 h in culture and slides were painted by mBAND. We found a frequency of 0.11 and 0.57 residual breakpoints per chromosome 5 after 1 and 4 Gy Fe-ions, respectively. Inter-chromosomal exchanges were the prevalent aberration type measured at both doses, followed by terminal deletions, and by intra-chromosomal exchanges. Among intra-chromosomal exchanges, intra-arm events were more frequent than inter-arm, but a significant number of intra-changes was associated to inter-changes involving the same chromosome after 4 Gy of iron ions. These events show that the complexity of chromosomal exchanges induced by heavy ions can be higher than expected by previous FISH studies.
Replication profile of Saccharomyces cerevisiae chromosome VI.
Friedman, K L; Brewer, B J; Fangman, W L
1997-11-01
An understanding of the replication programme at the genome level will require the identification and characterization of origins of replication through large, contiguous regions of DNA. As a step toward this goal, origin efficiencies and replication times were determined for 10 ARSs spanning most of the 270 kilobase (kb) chromosome VI of Saccharomyces cerevisiae. Chromosome VI shows a wide variation in the percentage of cell cycles in which different replication origins are utilized. Most of the origins are activated in only a fraction of cells, suggesting that the pattern of origin usage on chromosome VI varies greatly within the cell population. The replication times of fragments containing chromosome VI origins show a temporal pattern that has been recognized on other chromosomes--the telomeres replicate late in S phase, while the central region of the chromosome replicates early. As demonstrated here for chromosome VI, analysis of the direction of replication fork movement along a chromosome and determination of replication time by measuring a period of hemimethylation may provide an efficient means of surveying origin activity over large regions of the genome.
Genetic conflict and sex chromosome evolution
Meiklejohn, Colin D; Tao, Yun
2009-01-01
Chromosomal sex determination systems create the opportunity for the evolution of selfish genetic elements that increase the transmission of one sex chromosome at the expense of its homolog. Because such selfish elements on sex chromosomes can reduce fertility and distort the sex ratio of progeny, unlinked suppressors are expected to evolve, bringing different regions of the genome into conflict over the meiotic transmission of the sex chromosomes. Here we argue that recurrent genetic conflict over sex chromosome transmission is an important evolutionary force that has shaped a wide range of seemingly disparate phenomena including the epigenetic regulation of genes expressed in the germline, the distribution of genes in the genome, and the evolution of hybrid sterility between species. PMID:19931208
Kwon, So Yeun; Lee, Hwan Young; Kim, Eun Hye; Lee, Eun Young; Shin, Kyoung-Jin
2016-11-01
Next-generation sequencing (NGS) can produce massively parallel sequencing (MPS) data for many targeted regions with a high depth of coverage, suggesting its successful application to the amplicons of forensic genetic markers. In the present study, we evaluated the practical utility of MPS in Y-chromosome short tandem repeat (Y-STR) analysis using a multiplex polymerase chain reaction (PCR) system. The multiplex PCR system simultaneously amplified 24 Y-chromosomal markers, including the PowerPlex ® Y23 loci (DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS481, DYS533, DYS549, DYS570, DYS576, DYS635, DYS643, and YGATAH4) and the M175 marker with the small-sized amplicons ranging from 85 to 253bp. The barcoded libraries for the amplicons of the 24 Y-chromosomal markers were produced using a simplified PCR-based library preparation method and successfully sequenced using MPS on a MiSeq ® System with samples from 250 unrelated Korean males. The genotyping concordance between MPS and the capillary electrophoresis (CE) method, as well as the sequence structure of the 23 Y-STRs, were investigated. Three samples exhibited discordance between the MPS and CE results at DYS385, DYS439, and DYS576. There were 12 Y-STR loci that showed sequence variations in the alleles by a fragment size determination, and the most varied alleles occurred in DYS389II with a different sequence structure in the repeat region. The largest increase in gene diversity between the CE and MPS results was in DYS437 at +34.41%. Single nucleotide polymorphisms (SNPs), insertions, and deletions (indels) were observed in the flanking regions of DYS481, DYS576, and DYS385, respectively. Stutter and noise ratios of the 23 Y-STRs using the developed MPS system were also investigated. Based on these results, the MPS analysis system used in this study could facilitate the investigation into the sequences of the 23 Y-STRs in forensic
[Artificial Intelligence in Drug Discovery].
Fujiwara, Takeshi; Kamada, Mayumi; Okuno, Yasushi
2018-04-01
According to the increase of data generated from analytical instruments, application of artificial intelligence(AI)technology in medical field is indispensable. In particular, practical application of AI technology is strongly required in "genomic medicine" and "genomic drug discovery" that conduct medical practice and novel drug development based on individual genomic information. In our laboratory, we have been developing a database to integrate genome data and clinical information obtained by clinical genome analysis and a computational support system for clinical interpretation of variants using AI. In addition, with the aim of creating new therapeutic targets in genomic drug discovery, we have been also working on the development of a binding affinity prediction system for mutated proteins and drugs by molecular dynamics simulation using supercomputer "Kei". We also have tackled for problems in a drug virtual screening. Our developed AI technology has successfully generated virtual compound library, and deep learning method has enabled us to predict interaction between compound and target protein.
Chandra, H. Sharat; Heistekamp, Nora C.; Hungerford, Alice; Morrissette, Jennifer J.D.; Nowell, Peter C.; Rowley, Janet D.; Testa, Joseph R.
2011-01-01
This report summarizes highlights of the ‘Philadelphia Chromosome Symposium: Past, Present and Future’, held September 28, 2010, to commemorate the 50th anniversary of the discovery of the Philadelphia chromosome. The symposium sessions included presentations by investigators who made seminal contributions concerning the discovery and molecular characterization of the Ph chromosome and others who developed a highly successful therapy based on the specific molecular alteration observed in chronic myelogenous leukemia. Additional presentations highlighted future opportunities for the design of molecularly targeted therapies for various types of cancer. Also included here are reminiscences connected with the discovery of the Ph chromosome by David Hungerford and Peter Nowell, the discovery that the abnormality arises from a chromosomal translocation, by Janet Rowley, and the cloning of the 9;22 translocation breakpoints by Nora Heisterkamp, John Groffen and colleagues. PMID:21536234
Nabeshima, Kentaro; Mlynarczyk-Evans, Susanna; Villeneuve, Anne M.
2011-01-01
During early meiotic prophase, a nucleus-wide reorganization leads to sorting of chromosomes into homologous pairs and to establishing associations between homologous chromosomes along their entire lengths. Here, we investigate global features of chromosome organization during this process, using a chromosome painting method in whole-mount Caenorhabditis elegans gonads that enables visualization of whole chromosomes along their entire lengths in the context of preserved 3D nuclear architecture. First, we show that neither spatial proximity of premeiotic chromosome territories nor chromosome-specific timing is a major factor driving homolog pairing. Second, we show that synaptonemal complex-independent associations can support full lengthwise juxtaposition of homologous chromosomes. Third, we reveal a prominent elongation of chromosome territories during meiotic prophase that initiates prior to homolog association and alignment. Mutant analysis indicates that chromosome movement mediated by association of chromosome pairing centers (PCs) with mobile patches of the nuclear envelope (NE)–spanning SUN-1/ZYG-12 protein complexes is not the primary driver of territory elongation. Moreover, we identify new roles for the X chromosome PC (X-PC) and X-PC binding protein HIM-8 in promoting elongation of X chromosome territories, separable from their role(s) in mediating local stabilization of pairing and association of X chromosomes with mobile SUN-1/ZYG-12 patches. Further, we present evidence that HIM-8 functions both at and outside of PCs to mediate chromosome territory elongation. These and other data support a model in which synapsis-independent elongation of chromosome territories, driven by PC binding proteins, enables lengthwise juxtaposition of chromosomes, thereby facilitating assessment of their suitability as potential pairing partners. PMID:21876678
ERIC Educational Resources Information Center
International Federation of Library Associations, The Hague (Netherlands).
Twenty-one papers from the Division of Special Libraries are included in this collection: "Information Systems Planning as a Tool of Developing Library Work: The Case of Statistics Library" (Heli Myllys); "The Libraries of the French Central Government Departments and the Administrative Library of the City of Paris" (French and English versions;…
Cremer, Thomas; Cremer, Marion
2010-01-01
Chromosome territories (CTs) constitute a major feature of nuclear architecture. In a brief statement, the possible contribution of nuclear architecture studies to the field of epigenomics is considered, followed by a historical account of the CT concept and the final compelling experimental evidence of a territorial organization of chromosomes in all eukaryotes studied to date. Present knowledge of nonrandom CT arrangements, of the internal CT architecture, and of structural interactions with other CTs is provided as well as the dynamics of CT arrangements during cell cycle and postmitotic terminal differentiation. The article concludes with a discussion of open questions and new experimental strategies to answer them. PMID:20300217
Chromosome heteromorphism quantified by high-resolution bivariate flow karyotyping.
Trask, B; van den Engh, G; Mayall, B; Gray, J W
1989-01-01
Maternal and paternal homologues of many chromosome types can be differentiated on the basis of their peak position in Hoechst 33258 versus chromomycin A3 bivariate flow karyotypes. We demonstrate here the magnitude of DNA content differences among normal chromosomes of the same type. Significant peak-position differences between homologues were observed for an average of four chromosome types in each of the karyotypes of 98 different individuals. The frequency of individuals with differences in homologue peak positions varied among chromosome types: e.g., chromosome 15, 61%; chromosome 3, 4%. Flow karyotypes of 33 unrelated individuals were compared to determine the range of peak position among normal chromosomes. Chromosomes Y, 21, 22, 15, 16, 13, 14, and 19 were most heteromorphic, and chromosomes 2-8 and X were least heteromorphic. The largest chromosome 21 was 45% larger than the smallest 21 chromosome observed. The base composition of the variable regions differed among chromosome types. DNA contents of chromosome variants determined from flow karyotypes were closely correlated to measurements of DNA content made of gallocyanin chrome alum-stained metaphase chromosomes on slides. Fluorescence in situ hybridization with chromosome-specific repetitive sequences indicated that variability in their copy number is partly responsible for peak-position variability in some chromosomes. Heteromorphic chromosomes are identified for which parental flow karyotype information will be essential if de novo rearrangements resulting in small DNA content changes are to be detected with flow karyotyping. Images Figure 5 PMID:2479266
Chromosome I duplications in Caenorhabditis elegans
DOE Office of Scientific and Technical Information (OSTI.GOV)
McKim, K.S.; Rose, A.M.
1990-01-01
We have isolated and characterized 76 duplications of chromosome I in the genome of Caenorhabditis elegans. The region studied is the 20 map unit left half of the chromosome. Sixty-two duplications were induced with gamma radiation and 14 arose spontaneously. The latter class was apparently the result of spontaneous breaks within the parental duplication. The majority of duplications behave as if they are free. Three duplications are attached to identifiable sequences from other chromosomes. The duplication breakpoints have been mapped by complementation analysis relative to genes on chromosome I. Nineteen duplication breakpoints and seven deficiency breakpoints divide the left halfmore » of the chromosome into 24 regions. We have studied the relationship between duplication size and segregational stability. While size is an important determinant of mitotic stability, it is not the only one. We observed clear exceptions to a size-stability correlation. In addition to size, duplication stability may be influenced by specific sequences or chromosome structure. The majority of the duplications were stable enough to be powerful tools for gene mapping. Therefore the duplications described here will be useful in the genetic characterization of chromosome I and the techniques we have developed can be adapted to other regions of the genome.« less
Chromosome speciation: Humans, Drosophila, and mosquitoes
Ayala, Francisco J.; Coluzzi, Mario
2005-01-01
Chromosome rearrangements (such as inversions, fusions, and fissions) may play significant roles in the speciation between parapatric (contiguous) or partly sympatric (geographically overlapping) populations. According to the “hybrid-dysfunction” model, speciation occurs because hybrids with heterozygous chromosome rearrangements produce dysfunctional gametes and thus have low reproductive fitness. Natural selection will, therefore, promote mutations that reduce the probability of intercrossing between populations carrying different rearrangements and thus promote their reproductive isolation. This model encounters a disabling difficulty: namely, how to account for the spread in a population of a chromosome rearrangement after it first arises as a mutation in a single individual. The “suppressed-recombination” model of speciation points out that chromosome rearrangements act as a genetic filter between populations. Mutations associated with the rearranged chromosomes cannot flow from one to another population, whereas genetic exchange will freely occur between colinear chromosomes. Mutations adaptive to local conditions will, therefore, accumulate differentially in the protected chromosome regions so that parapatric or partially sympatric populations will genetically differentiate, eventually evolving into different species. The speciation model of suppressed recombination has recently been tested by gene and DNA sequence comparisons between humans and chimpanzees, between Drosophila species, and between species related to Anopheles gambiae, the vector of malignant malaria in Africa. PMID:15851677
Charlesworth, Deborah
2016-04-29
Although individuals in most flowering plant species, and in many haploid plants, have both sex functions, dioecious species-in which individuals have either male or female functions only-are scattered across many taxonomic groups, and many species have genetic sex determination. Among these, some have visibly heteromorphic sex chromosomes, and molecular genetic studies are starting to uncover sex-linked markers in others, showing that they too have fully sex-linked regions that are either too small or are located in chromosomes that are too small to be cytologically detectable from lack of pairing, lack of visible crossovers, or accumulation of heterochromatin. Detailed study is revealing that, like animal sex chromosomes, plant sex-linked regions show evidence for accumulation of repetitive sequences and genetic degeneration. Estimating when recombination stopped confirms the view that many plants have young sex-linked regions, making plants of great interest for studying the timescale of these changes.
Degeneration of the Y chromosome in evolutionary aging models
NASA Astrophysics Data System (ADS)
Lobo, M. P.; Onody, R. N.
2005-06-01
The Y chromosomes are genetically degenerated and do not recombine with their matching partners X. Recombination of XX pairs is pointed out as the key factor for the Y chromosome degeneration. However, there is an additional evolutionary force driving sex-chromosomes evolution. Here we show this mechanism by means of two different evolutionary models, in which sex chromosomes with non-recombining XX and XY pairs of chromosomes is considered. Our results show three curious effects. First, we observed that even when both XX and XY pairs of chromosomes do not recombine, the Y chromosomes still degenerate. Second, the accumulation of mutations on Y chromosomes followed a completely different pattern then those accumulated on X chromosomes. And third, the models may differ with respect to sexual proportion. These findings suggest that a more primeval mechanism rules the evolution of Y chromosomes due exclusively to the sex-chromosomes asymmetry itself, i.e., the fact that Y chromosomes never experience female bodies. Over aeons, natural selection favored X chromosomes spontaneously, even if at the very beginning of evolution, both XX and XY pairs of chromosomes did not recombine.
The B chromosomes in Brachycome.
Leach, C R; Houben, A; Timmis, J N
2004-01-01
This review presents a historical account of studies of B chromosomes in the genus Brachycome Cass. (synonym: Brachyscome) from the earliest cytological investigations carried out in the late 1960s though to the most recent molecular analyses. Molecular analyses provide insights into the origin and evolution of the B chromosomes (Bs) of Brachycome dichromosomatica, a species which has Bs of two different sizes. The larger Bs are somatically stable whereas the smaller, or micro, Bs are somatically unstable. Both B types contain clusters of ribosomal RNA genes that have been shown unequivocally to be inactive in the case of the larger Bs. The large Bs carry a family of tandem repeat sequences (Bd49) that are located mainly at the centromere. Multiple copies of sequences related to this repeat are present on the A chromosomes (As) of related species, whereas only a few copies exist in the A chromosomes of B. dichromosomatica. The micro Bs share DNA sequences with the As and the larger Bs, and they also have B-specific repeats (Bdm29 and Bdm54). In some cases repeat sequences on the micro Bs have been shown to occur as clusters on the A chromosomes in a proportion of individuals within a population. It is clear that none of these B types originated by simple excision of segments from the A chromosomes. Copyright 2004 S. Karger AG, Basel
Methods and compositions for chromosome-specific staining
Gray, Joe W.; Pinkel, Daniel
2003-07-22
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.
Characterizing the chromosomes of the platypus (Ornithorhynchus anatinus).
McMillan, Daniel; Miethke, Pat; Alsop, Amber E; Rens, Willem; O'Brien, Patricia; Trifonov, Vladimir; Veyrunes, Frederic; Schatzkamer, Kyriena; Kremitzki, Colin L; Graves, Tina; Warren, Wesley; Grützner, Frank; Ferguson-Smith, Malcolm A; Graves, Jennifer A Marshall
2007-01-01
Like the unique platypus itself, the platypus genome is extraordinary because of its complex sex chromosome system, and is controversial because of difficulties in identification of small autosomes and sex chromosomes. A 6-fold shotgun sequence of the platypus genome is now available and is being assembled with the help of physical mapping. It is therefore essential to characterize the chromosomes and resolve the ambiguities and inconsistencies in identifying autosomes and sex chromosomes. We have used chromosome paints and DAPI banding to identify and classify pairs of autosomes and sex chromosomes. We have established an agreed nomenclature and identified anchor BAC clones for each chromosome that will ensure unambiguous gene localizations.
Artificially Expanded Genetic Information Systems for New Aptamer Technologies.
Biondi, Elisa; Benner, Steven A
2018-05-09
Directed evolution was first applied to diverse libraries of DNA and RNA molecules a quarter century ago in the hope of gaining technology that would allow the creation of receptors, ligands, and catalysts on demand. Despite isolated successes, the outputs of this technology have been somewhat disappointing, perhaps because the four building blocks of standard DNA and RNA have too little functionality to have versatile binding properties, and offer too little information density to fold unambiguously. This review covers the recent literature that seeks to create an improved platform to support laboratory Darwinism, one based on an artificially expanded genetic information system (AEGIS) that adds independently replicating nucleotide “letters” to the evolving “alphabet”.
Function of the Sex Chromosomes in Mammalian Fertility
Heard, Edith; Turner, James
2011-01-01
The sex chromosomes play a highly specialized role in germ cell development in mammals, being enriched in genes expressed in the testis and ovary. Sex chromosome abnormalities (e.g., Klinefelter [XXY] and Turner [XO] syndrome) constitute the largest class of chromosome abnormalities and the commonest genetic cause of infertility in humans. Understanding how sex-gene expression is regulated is therefore critical to our understanding of human reproduction. Here, we describe how the expression of sex-linked genes varies during germ cell development; in females, the inactive X chromosome is reactivated before meiosis, whereas in males the X and Y chromosomes are inactivated at this stage. We discuss the epigenetics of sex chromosome inactivation and how this process has influenced the gene content of the mammalian X and Y chromosomes. We also present working models for how perturbations in sex chromosome inactivation or reactivation result in subfertility in the major classes of sex chromosome abnormalities. PMID:21730045
Topology, structures, and energy landscapes of human chromosomes
Zhang, Bin; Wolynes, Peter G.
2015-01-01
Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward “ideal” chromosome structures that represent hierarchical fibrils of fibrils. PMID:25918364
Conservation of sex chromosomes in lacertid lizards.
Rovatsos, Michail; Vukić, Jasna; Altmanová, Marie; Johnson Pokorná, Martina; Moravec, Jiří; Kratochvíl, Lukáš
2016-07-01
Sex chromosomes are believed to be stable in endotherms, but young and evolutionary unstable in most ectothermic vertebrates. Within lacertids, the widely radiated lizard group, sex chromosomes have been reported to vary in morphology and heterochromatinization, which may suggest turnovers during the evolution of the group. We compared the partial gene content of the Z-specific part of sex chromosomes across major lineages of lacertids and discovered a strong evolutionary stability of sex chromosomes. We can conclude that the common ancestor of lacertids, living around 70 million years ago (Mya), already had the same highly differentiated sex chromosomes. Molecular data demonstrating an evolutionary conservation of sex chromosomes have also been documented for iguanas and caenophidian snakes. It seems that differences in the evolutionary conservation of sex chromosomes in vertebrates do not reflect the distinction between endotherms and ectotherms, but rather between amniotes and anamniotes, or generally, the differences in the life history of particular lineages. © 2016 John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Pappas, Marjorie L.
2003-01-01
Virtual library? Electronic library? Digital library? Online information network? These all apply to the growing number of Web-based resource collections managed by consortiums of state library entities. Some, like "INFOhio" and "KYVL" ("Kentucky Virtual Library"), have been available for a few years, but others are just starting. Searching for…
Gabrieli, Paolo; Gomulski, Ludvik M.; Bonomi, Angelica; Siciliano, Paolo; Scolari, Francesca; Franz, Gerald; Jessup, Andrew; Malacrida, Anna R.; Gasperi, Giuliano
2011-01-01
Background Diptera have an extraordinary variety of sex determination mechanisms, and Drosophila melanogaster is the paradigm for this group. However, the Drosophila sex determination pathway is only partially conserved and the family Tephritidae affords an interesting example. The tephritid Y chromosome is postulated to be necessary to determine male development. Characterization of Y sequences, apart from elucidating the nature of the male determining factor, is also important to understand the evolutionary history of sex chromosomes within the Tephritidae. We studied the Y sequences from the olive fly, Bactrocera oleae. Its Y chromosome is minute and highly heterochromatic, and displays high heteromorphism with the X chromosome. Methodology/Principal Findings A combined Representational Difference Analysis (RDA) and fluorescence in-situ hybridization (FISH) approach was used to investigate the Y chromosome to derive information on its sequence content. The Y chromosome is strewn with repetitive DNA sequences, the majority of which are also interdispersed in the pericentromeric regions of the autosomes. The Y chromosome appears to have accumulated small and large repetitive interchromosomal duplications. The large interchromosomal duplications harbour an importin-4-like gene fragment. Apart from these importin-4-like sequences, the other Y repetitive sequences are not shared with the X chromosome, suggesting molecular differentiation of these two chromosomes. Moreover, as the identified Y sequences were not detected on the Y chromosomes of closely related tephritids, we can infer divergence in the repetitive nature of their sequence contents. Conclusions/Significance The identification of Y-linked sequences may tell us much about the repetitive nature, the origin and the evolution of Y chromosomes. We hypothesize how these repetitive sequences accumulated and were maintained on the Y chromosome during its evolutionary history. Our data reinforce the idea that the
Flow cytogenetics and chromosome sorting.
Cram, L S
1990-06-01
This review of flow cytogenetics and chromosome sorting provides an overview of general information in the field and describes recent developments in more detail. From the early developments of chromosome analysis involving single parameter or one color analysis to the latest developments in slit scanning of single chromosomes in a flow stream, the field has progressed rapidly and most importantly has served as an important enabling technology for the human genome project. Technological innovations that advanced flow cytogenetics are described and referenced. Applications in basic cell biology, molecular biology, and clinical investigations are presented. The necessary characteristics for large number chromosome sorting are highlighted. References to recent review articles are provided as a starting point for locating individual references that provide more detail. Specific references are provided for recent developments.
ERIC Educational Resources Information Center
Library Journal, 1985
1985-01-01
This special supplement to "Library Journal" and "School Library Journal" includes articles on technological dependency, promise of computers for reluctant readers, copyright and database downloading, access to neighborhood of Mister Rogers, library acquisitions, circulating personal computers, "microcomputeritis,"…
X Chromosome Control of Meiotic Chromosome Synapsis in Mouse Inter-Subspecific Hybrids
Bhattacharyya, Tanmoy; Reifova, Radka; Gregorova, Sona; Simecek, Petr; Gergelits, Vaclav; Mistrik, Martin; Martincova, Iva; Pialek, Jaroslav; Forejt, Jiri
2014-01-01
Hybrid sterility (HS) belongs to reproductive isolation barriers that safeguard the integrity of species in statu nascendi. Although hybrid sterility occurs almost universally among animal and plant species, most of our current knowledge comes from the classical genetic studies on Drosophila interspecific crosses or introgressions. With the house mouse subspecies Mus m. musculus and Mus m. domesticus as a model, new research tools have become available for studies of the molecular mechanisms and genetic networks underlying HS. Here we used QTL analysis and intersubspecific chromosome substitution strains to identify a 4.7 Mb critical region on Chromosome X (Chr X) harboring the Hstx2 HS locus, which causes asymmetrical spermatogenic arrest in reciprocal intersubspecific F1 hybrids. Subsequently, we mapped autosomal loci on Chrs 3, 9 and 13 that can abolish this asymmetry. Combination of immunofluorescent visualization of the proteins of synaptonemal complexes with whole-chromosome DNA FISH on pachytene spreads revealed that heterosubspecific, unlike consubspecific, homologous chromosomes are predisposed to asynapsis in F1 hybrid male and female meiosis. The asynapsis is under the trans- control of Hstx2 and Hst1/Prdm9 hybrid sterility genes in pachynemas of male but not female hybrids. The finding concurred with the fertility of intersubpecific F1 hybrid females homozygous for the Hstx2Mmm allele and resolved the apparent conflict with the dominance theory of Haldane's rule. We propose that meiotic asynapsis in intersubspecific hybrids is a consequence of cis-acting mismatch between homologous chromosomes modulated by the trans-acting Hstx2 and Prdm9 hybrid male sterility genes. PMID:24516397
X chromosome control of meiotic chromosome synapsis in mouse inter-subspecific hybrids.
Bhattacharyya, Tanmoy; Reifova, Radka; Gregorova, Sona; Simecek, Petr; Gergelits, Vaclav; Mistrik, Martin; Martincova, Iva; Pialek, Jaroslav; Forejt, Jiri
2014-02-01
Hybrid sterility (HS) belongs to reproductive isolation barriers that safeguard the integrity of species in statu nascendi. Although hybrid sterility occurs almost universally among animal and plant species, most of our current knowledge comes from the classical genetic studies on Drosophila interspecific crosses or introgressions. With the house mouse subspecies Mus m. musculus and Mus m. domesticus as a model, new research tools have become available for studies of the molecular mechanisms and genetic networks underlying HS. Here we used QTL analysis and intersubspecific chromosome substitution strains to identify a 4.7 Mb critical region on Chromosome X (Chr X) harboring the Hstx2 HS locus, which causes asymmetrical spermatogenic arrest in reciprocal intersubspecific F1 hybrids. Subsequently, we mapped autosomal loci on Chrs 3, 9 and 13 that can abolish this asymmetry. Combination of immunofluorescent visualization of the proteins of synaptonemal complexes with whole-chromosome DNA FISH on pachytene spreads revealed that heterosubspecific, unlike consubspecific, homologous chromosomes are predisposed to asynapsis in F1 hybrid male and female meiosis. The asynapsis is under the trans- control of Hstx2 and Hst1/Prdm9 hybrid sterility genes in pachynemas of male but not female hybrids. The finding concurred with the fertility of intersubpecific F1 hybrid females homozygous for the Hstx2(Mmm) allele and resolved the apparent conflict with the dominance theory of Haldane's rule. We propose that meiotic asynapsis in intersubspecific hybrids is a consequence of cis-acting mismatch between homologous chromosomes modulated by the trans-acting Hstx2 and Prdm9 hybrid male sterility genes.
Scaffolds for Artificial miRNA Expression in Animal Cells.
Calloni, Raquel; Bonatto, Diego
2015-10-01
Artificial miRNAs (amiRNAs) are molecules that have been developed to promote gene silencing in a similar manner to naturally occurring miRNAs. amiRNAs are generally constructed by replacing the mature miRNA sequence in the pre-miRNA stem-loop with a sequence targeting a gene of interest. These molecules offer an interesting alternative to silencing approaches that are based on shRNAs and siRNAs because they present the same efficiency as these options and are less cytotoxic. amiRNAs have mostly been applied to gene knockdown in plants; they have been examined to a lesser extent in animal cells. Therefore, this article reviews the amiRNAs that have been developed for animal cells and focuses on the miRNA scaffolds that can already be applied to construct the artificial counterparts, as well as on the different approaches that have been described to promote amiRNA expression and silencing efficiency. Furthermore, the availability of amiRNA libraries and other tools that can be used to design and construct these molecules is briefly discussed, along with an overview of the therapeutic applications for which amiRNAs have already been evaluated.
Chromosome Variations And Human Behavior
ERIC Educational Resources Information Center
Soudek, D.
1974-01-01
Article focused on the science of cytogenetics, which studied the transmission of the units of heredity called chromosomes, and considered the advantage of proper diagnosis of genetic diseases, treated on the chromosomal level. (Author/RK)
The Chromosome 18 Clinical Resource Center.
Cody, Jannine D; Hasi-Zogaj, Minire; Heard, Patricia; Hill, Annice; Rupert, David; Sebold, Courtney; Soileau, Bridgette; Hale, Daniel E
2018-05-01
The Chromosome 18 Clinical Research Center has created a pediatrician-friendly virtual resource center for managing patients with chromosome 18 abnormalities. To date, children with rare chromosome abnormalities have been cared for either symptomatically or palliatively as a reaction to the presenting medical problems. As we enter an era of genomic-informed medicine, we can provide children, even those with individually unique chromosome abnormalities, with proactive medical care and management based on the most contemporary data on their specific genomic change. It is problematic for practicing physicians to obtain and use the emerging data on specific genes because this information is derived from diverse sources (e.g., animal studies, case reports, in vitro explorations) and is often published in sources that are not easily accessible in the clinical setting. The Chromosome 18 Clinical Resource Center remedies this challenging problem by curating and synthesizing the data with clinical implications. The data are collected from our database of over 26 years of natural history and medical data from over 650 individuals with chromosome 18 abnormalities. The resulting management guides and video presentations are a first edition of this collated data specifically oriented to guide clinicians toward the optimization of care for each child. The chromosome 18 data and guides also serve as models for an approach to the management of any individual with a rare chromosome abnormality of which there are over 1,300 born every year in the US alone. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Law Libraries as Special Libraries: An Educational Model.
ERIC Educational Resources Information Center
Hazelton, Penny A.
1993-01-01
Summarizes the history of the law library profession and the development of the educational model for law librarians in light of the particular demands and needs of corporate and law firm libraries. Guidelines of the American Association of Law Libraries for graduate programs in law librarianship are discussed. (Contains 17 references.) (LRW)
ERIC Educational Resources Information Center
Goodgion, Laurel; And Others
1986-01-01
Eight articles in special supplement to "Library Journal" and "School Library Journal" cover a computer program called "Byte into Books"; microcomputers and the small library; creating databases with students; online searching with a microcomputer; quality automation software; Meckler Publishing Company's…
ERIC Educational Resources Information Center
Library Computing, 1985
1985-01-01
Special supplement to "Library Journal" and "School Library Journal" covers topics of interest to school, public, academic, and special libraries planning for automation: microcomputer use, readings in automation, online searching, databases of microcomputer software, public access to microcomputers, circulation, creating a…