Science.gov

Sample records for arv drug patents

  1. Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.

    PubMed

    Satyanarayana, Kanikaram; Srivastava, Sadhana

    2010-01-01

    The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable

  2. Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.

    PubMed

    Satyanarayana, Kanikaram; Srivastava, Sadhana

    2010-01-19

    The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable

  3. Drug resistance, patent resistance: Indian pharmaceuticals and the impact of a new patent regime.

    PubMed

    Halliburton, M

    2009-01-01

    This article highlights potential public health effects of India's Patents Act of 2005, which was implemented to conform to the requirements of the World Trade Organisation's Trade-Related Aspects of Intellectual Property Agreement (TRIPS), a new legal regime that will likely have a significant impact on access to HIV/AIDS medications in much of the world. This new patent law may play a role in keeping new antiretroviral (ARV) medications, including improved first-line medications and second-line drugs that are being developed for first-line drug resistant HIV, financially out of reach for many people living with HIV/AIDS in poor countries. India's drug industry, which had thrived under earlier patent laws that protected processes but not products in the case of medications, had brought down the price of ARV drugs in South Asia and Africa by more than 90%. While most existing drugs are grandfathered under the new patent laws, newer ARV medications may be barred from manufacture by Indian companies. This article analyses the effects of the coming together of this new legal regime, the global political economy and emerging resistance to HIV/AIDS medications, and evaluates efforts to mitigate the negative public health effects of the new patent laws.

  4. Nanoparticle-Based ARV Drug Combinations for Synergistic Inhibition of Cell-Free and Cell-Cell HIV Transmission.

    PubMed

    Jiang, Yonghou; Cao, Shijie; Bright, Danielle K; Bever, Alaina M; Blakney, Anna K; Suydam, Ian T; Woodrow, Kim A

    2015-12-01

    Nanocarrier-based drug delivery systems are playing an emerging role in human immunodeficiency virus (HIV) chemoprophylaxis and treatment due to their ability to alter the pharmacokinetics and improve the therapeutic index of various antiretroviral (ARV) drug compounds used alone and in combination. Although several nanocarriers have been described for combination delivery of ARV drugs, measurement of drug-drug activities facilitated by the use of these nanotechnology platforms has not been fully investigated for topical prevention. Here, we show that physicochemically diverse ARV drugs can be encapsulated within polymeric nanoparticles to deliver multidrug combinations that provide potent HIV chemoprophylaxis in relevant models of cell-free, cell-cell, and mucosal tissue infection. In contrast to existing approaches that coformulate ARV drug combinations together in a single nanocarrier, we prepared single-drug-loaded nanoparticles that were subsequently combined upon administration. ARV drug-nanoparticles were prepared using emulsion-solvent evaporation techniques to incorporate maraviroc (MVC), etravirine (ETR), and raltegravir (RAL) into poly(lactic-co-glycolic acid) (PLGA) nanoparticles. We compared the antiviral potency of the free and formulated drug combinations for all pairwise and triple drug combinations against both cell-free and cell-associated HIV-1 infection in vitro. The efficacy of ARV-drug nanoparticle combinations was also assessed in a macaque cervicovaginal explant model using a chimeric simian-human immunodeficiency virus (SHIV) containing the reverse transcriptase (RT) of HIV-1. We observed that our ARV-NPs maintained potent HIV inhibition and were more effective when used in combinations. In particular, ARV-NP combinations involving ETR-NP exhibited significantly higher antiviral potency and dose-reduction against both cell-free and cell-associated HIV-1 BaL infection in vitro. Furthermore, ARV-NP combinations that showed large dose

  5. Can drug patents be morally justified?

    PubMed

    Sterckx, Sigrid

    2005-01-01

    This paper offers a few elements of an answer to the question to what extent drug patents can be morally justified. Justifications based on natural rights, distributive justice and utilitarian arguments are discussed and criticized. The author recognizes the potential of the patents to benefit society but argues that the system is currently evolving in the wrong direction, particularly in the field of drugs. More than a third of the world's population has no access to essential drugs. The working of the patent system is an important determinant of access to drugs. This paper argues that drug patents are not easily justified and that the 'architecture' of the patent system should be rethought in view of its mission of benefiting society.

  6. [The patents game. Generic and biosimilar drugs].

    PubMed

    Villamañán, E; González, D; Armada, E; Ruano, M; Álvarez-Sala, R; Herrero, A

    2016-01-01

    The protection provided by patents on medicines has a limited duration. The expiry of patents expiration allows copies of the drugs to be released, competing with original. At first, they were identical to the original, known as generic drugs, but in recent years, due to the marketing of biological therapies and the expiry of many of their patents, biosimilar drugs have also emerged. These are not exact copies of the original, but, like generic drugs, biosimilar drugs have to demonstrate equivalence to the reference drugs in quality, safety and efficacy. Nevertheless, despite their importance and contribution to sustainability of health system, doctors are sometimes unaware of differences between them, and their impact in terms of clinical and economic effects. An attempt is made to review and clarify certain aspects often unknown by physicians, despite their involvement in their use. PMID:26542789

  7. [The patents game. Generic and biosimilar drugs].

    PubMed

    Villamañán, E; González, D; Armada, E; Ruano, M; Álvarez-Sala, R; Herrero, A

    2016-01-01

    The protection provided by patents on medicines has a limited duration. The expiry of patents expiration allows copies of the drugs to be released, competing with original. At first, they were identical to the original, known as generic drugs, but in recent years, due to the marketing of biological therapies and the expiry of many of their patents, biosimilar drugs have also emerged. These are not exact copies of the original, but, like generic drugs, biosimilar drugs have to demonstrate equivalence to the reference drugs in quality, safety and efficacy. Nevertheless, despite their importance and contribution to sustainability of health system, doctors are sometimes unaware of differences between them, and their impact in terms of clinical and economic effects. An attempt is made to review and clarify certain aspects often unknown by physicians, despite their involvement in their use.

  8. Drug repurposing and the prior art patents of competitors.

    PubMed

    Sternitzke, Christian

    2014-12-01

    Drug repurposing (i.e., finding novel indications for established substances) has received increasing attention in industry recently. One challenge of repositioned drugs is obtaining effective patent protection, especially if the 'novel' indications have already been claimed by competitors within the same drug class. Here, I report the case of patents relating to phosphodiesterase type 5 (PDE5) inhibitors. Patentees of later-filed patents on novel indications (even when they could not observe prior patenting of their direct competitors) filed patents for which patent examiners did not see the prior-filed patents of the competitors as relevant prior art, whereas these follower patent applications often failed because of other reasons.

  9. Drug patents and intellectual property rights.

    PubMed

    Raj, Gerard Marshall; Priyadarshini, Rekha; Mathaiyan, Jayanthi

    2015-04-01

    Inquisitive scientists are untiring and relentless in the hard work they perform day in and day out. In this pursuit, a researcher has to exercise their intellectual expertise in its entirety. Eventually, all credit of the invention is vested with the inventor who has the right of control over their intellectual creation. Likewise, pharmaceutical companies spend extravagantly in successfully introducing a novel drug from hundreds and thousands of lead compounds. Hence, it is a prerogative for every company to protect its innovative products from unauthorized duplication. Certainly, "patents" are the sole custodians of these products of medical intelligence - the drugs! This review focuses on the various intricacies of the drug patent system all over the world with special emphasis on India, Europe, and the United States. A note on other intellectual properties such as copyrights, trademarks, and designs is also added. PMID:25640303

  10. Drug patents and intellectual property rights.

    PubMed

    Raj, Gerard Marshall; Priyadarshini, Rekha; Mathaiyan, Jayanthi

    2015-04-01

    Inquisitive scientists are untiring and relentless in the hard work they perform day in and day out. In this pursuit, a researcher has to exercise their intellectual expertise in its entirety. Eventually, all credit of the invention is vested with the inventor who has the right of control over their intellectual creation. Likewise, pharmaceutical companies spend extravagantly in successfully introducing a novel drug from hundreds and thousands of lead compounds. Hence, it is a prerogative for every company to protect its innovative products from unauthorized duplication. Certainly, "patents" are the sole custodians of these products of medical intelligence - the drugs! This review focuses on the various intricacies of the drug patent system all over the world with special emphasis on India, Europe, and the United States. A note on other intellectual properties such as copyrights, trademarks, and designs is also added.

  11. Understanding the Impact of Hazardous and Harmful Use of Alcohol and/or Other Drugs on ARV Adherence and Disease Progression

    PubMed Central

    Kader, Rehana; Govender, Rajen; Seedat, Soraya; Koch, John Randy; Parry, Charles

    2015-01-01

    The objective of this study was to understand the impact of hazardous and harmful use of alcohol and/or other drugs on ARV adherence and disease progression among HIV patients. A cross-sectional study design was used. A total of 1503 patients attending HIV clinics in Cape Town, South Africa were screened for problematic substance use. A sub-sample of 607 patients (303 patients who screened positive for problematic substance use and 304 who did not) participated in this study. Hazardous or harmful alcohol use and problematic drug use predicted missing and stopping ARVs which, in turn, was associated with a decrease in CD4 counts and more rapid HIV-disease progression and poorer health outcomes in people living with HIV/AIDS (PLWHA). The findings of this study underscore the need for an integrated approach to managing substance-use disorders in PLWHA. PMID:25933422

  12. Competitive intelligence and patent analysis in drug discovery.

    PubMed

    Grandjean, Nicolas; Charpiot, Brigitte; Pena, Carlos Andres; Peitsch, Manuel C

    2005-01-01

    Patents are a major source of information in drug discovery and, when properly processed and analyzed, can yield a wealth of information on competitors activities, R&D trends, emerging fields, collaborations, among others. This review discusses the current state-of-the-art in textual data analysis and exploration methods as applied to patent analysis.:

  13. Fair drug prices and the patent system.

    PubMed

    Resnik, David B

    2004-06-01

    This paper uses John Rawls' theory of justice to defend the patent system against charges that it has an unfair effect on access to medications,from the perspective of national and international justice. The paper argues that the patent system is fair in a national context because it respects intellectual property rights and it benefits the least advantaged members of society by providing incentives for inventors, investors, and entrepreneurs. The paper also argues that the patent system is fair in an international context, provided that developed nations take steps to help disease-stricken countries secure internal justice. Fairness in a national or international context also requires that the patent system should include emergency exceptions to deal with short-term inequities.

  14. 37 CFR 1.775 - Calculation of patent term extension for a human drug, antibiotic drug or human biological product.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... extension for a human drug, antibiotic drug or human biological product. 1.775 Section 1.775 Patents... Review § 1.775 Calculation of patent term extension for a human drug, antibiotic drug or human biological product. (a) If a determination is made pursuant to § 1.750 that a patent for a human drug,...

  15. 37 CFR 1.775 - Calculation of patent term extension for a human drug, antibiotic drug or human biological product.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... extension for a human drug, antibiotic drug or human biological product. 1.775 Section 1.775 Patents... Review § 1.775 Calculation of patent term extension for a human drug, antibiotic drug or human biological product. (a) If a determination is made pursuant to § 1.750 that a patent for a human drug,...

  16. 37 CFR 1.775 - Calculation of patent term extension for a human drug, antibiotic drug or human biological product.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... extension for a human drug, antibiotic drug or human biological product. 1.775 Section 1.775 Patents... Review § 1.775 Calculation of patent term extension for a human drug, antibiotic drug or human biological product. (a) If a determination is made pursuant to § 1.750 that a patent for a human drug,...

  17. 37 CFR 1.775 - Calculation of patent term extension for a human drug, antibiotic drug or human biological product.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... extension for a human drug, antibiotic drug or human biological product. 1.775 Section 1.775 Patents... Review § 1.775 Calculation of patent term extension for a human drug, antibiotic drug or human biological product. (a) If a determination is made pursuant to § 1.750 that a patent for a human drug,...

  18. 37 CFR 1.775 - Calculation of patent term extension for a human drug, antibiotic drug or human biological product.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... extension for a human drug, antibiotic drug or human biological product. 1.775 Section 1.775 Patents... Review § 1.775 Calculation of patent term extension for a human drug, antibiotic drug or human biological product. (a) If a determination is made pursuant to § 1.750 that a patent for a human drug,...

  19. 'Government Patent Use': A Legal Approach To Reducing Drug Spending.

    PubMed

    Kapczynski, Amy; Kesselheim, Aaron S

    2016-05-01

    The high cost of patent-protected brand-name drugs can strain budgets and curb the widespread use of new medicines. An example is the case of direct-acting antiviral drugs for the treatment of hepatitis C. While prices for these drugs have come down in recent months, they still create barriers to treatment. Additionally, prescribing restrictions imposed by insurers put patients at increased risk of medical complications and contribute to transmission of the hepatitis C virus. We propose that the federal government invoke its power under an existing "government patent use" law to reduce excessive prices for important patent-protected medicines. Using this law would permit the government to procure generic versions of patented drugs and in exchange pay the patent-holding companies reasonable royalties to compensate them for research and development. This would allow patients in federal programs, and perhaps beyond, to be treated with inexpensive generic medicines according to clinical need-meaning that many more patients could be reached for no more, and perhaps far less, money than is currently spent. Another benefit would be a reduction in the opportunity for companies to extract monopoly profits that far exceed their risk-adjusted costs of research and development. PMID:27140984

  20. 'Government Patent Use': A Legal Approach To Reducing Drug Spending.

    PubMed

    Kapczynski, Amy; Kesselheim, Aaron S

    2016-05-01

    The high cost of patent-protected brand-name drugs can strain budgets and curb the widespread use of new medicines. An example is the case of direct-acting antiviral drugs for the treatment of hepatitis C. While prices for these drugs have come down in recent months, they still create barriers to treatment. Additionally, prescribing restrictions imposed by insurers put patients at increased risk of medical complications and contribute to transmission of the hepatitis C virus. We propose that the federal government invoke its power under an existing "government patent use" law to reduce excessive prices for important patent-protected medicines. Using this law would permit the government to procure generic versions of patented drugs and in exchange pay the patent-holding companies reasonable royalties to compensate them for research and development. This would allow patients in federal programs, and perhaps beyond, to be treated with inexpensive generic medicines according to clinical need-meaning that many more patients could be reached for no more, and perhaps far less, money than is currently spent. Another benefit would be a reduction in the opportunity for companies to extract monopoly profits that far exceed their risk-adjusted costs of research and development.

  1. Detection of AR-V7 mRNA in whole blood may not predict the effectiveness of novel endocrine drugs for castration-resistant prostate cancer

    PubMed Central

    Takeuchi, Takumi; Okuno, Yumiko; Hattori-Kato, Mami; Zaitsu, Masayoshi; Mikami, Koji

    2016-01-01

    A splice variant of androgen receptor (AR), AR-V7, lacks in androgen-binding portion and leads to aggressive cancer characteristics. Reverse transcription-polymerase chain reactions (PCRs) and subsequent nested PCRs for the amplification of AR-V7 and prostate-specific antigen (PSA) transcripts were done for whole blood of patients with prostate cancer and male controls. With primary reverse transcription PCRs, AR-V7 and PSA were detected in 4.5% and 4.7% of prostate cancer, respectively. With nested PCRs, AR-V7 messenger RNA (mRNA) was positive in 43.8% of castration-sensitive prostate cancer and 48.1% of castration-resistant prostate cancer (CRPC), while PSA mRNA was positive in 6.3% of castration-sensitive prostate cancer and 18.5% of CRPC. Whole-blood samples of controls showed AR-V7 mRNA expression by nested PCR. Based on multivariate analysis, expression of AR-V7 mRNA in whole blood was not significantly correlated with clinical parameters and PSA mRNA in blood, while univariate analysis showed a correlation between AR-V7 mRNA and metastasis at initial diagnosis. Detection of AR-V7 mRNA did not predict the reduction of serum PSA in patients with CRPC following abiraterone and enzalutamide administration. In conclusion, AR-V7 mRNA expression in normal hematopoietic cells may have annihilated the manifestation of aggressiveness of prostate cancer and the prediction of the effectiveness of abiraterone and enzalutamide by the assessment of AR-V7 mRNA in blood. PMID:26870716

  2. Detection of AR-V7 mRNA in whole blood may not predict the effectiveness of novel endocrine drugs for castration-resistant prostate cancer.

    PubMed

    Takeuchi, Takumi; Okuno, Yumiko; Hattori-Kato, Mami; Zaitsu, Masayoshi; Mikami, Koji

    2016-01-01

    A splice variant of androgen receptor (AR), AR-V7, lacks in androgen-binding portion and leads to aggressive cancer characteristics. Reverse transcription-polymerase chain reactions (PCRs) and subsequent nested PCRs for the amplification of AR-V7 and prostate-specific antigen (PSA) transcripts were done for whole blood of patients with prostate cancer and male controls. With primary reverse transcription PCRs, AR-V7 and PSA were detected in 4.5% and 4.7% of prostate cancer, respectively. With nested PCRs, AR-V7 messenger RNA (mRNA) was positive in 43.8% of castration-sensitive prostate cancer and 48.1% of castration-resistant prostate cancer (CRPC), while PSA mRNA was positive in 6.3% of castration-sensitive prostate cancer and 18.5% of CRPC. Whole-blood samples of controls showed AR-V7 mRNA expression by nested PCR. Based on multivariate analysis, expression of AR-V7 mRNA in whole blood was not significantly correlated with clinical parameters and PSA mRNA in blood, while univariate analysis showed a correlation between AR-V7 mRNA and metastasis at initial diagnosis. Detection of AR-V7 mRNA did not predict the reduction of serum PSA in patients with CRPC following abiraterone and enzalutamide administration. In conclusion, AR-V7 mRNA expression in normal hematopoietic cells may have annihilated the manifestation of aggressiveness of prostate cancer and the prediction of the effectiveness of abiraterone and enzalutamide by the assessment of AR-V7 mRNA in blood.

  3. Drug patent expirations and the speed of generic entry.

    PubMed Central

    Bae, J P

    1997-01-01

    OBJECTIVE: Using recent data, to analyze the generic drug entry phenomenon to determine the factors that influence the speed and likelihood of generic drug entries. DATA SOURCES: Data for 81 drugs that have lost patent between 1987 and 1994. Patent and exclusive marketing rights expiration dates: Food and Drug Administration's (FDA) Approved Drug Products with Therapeutic Equivalent Evaluations (1986-1989). Generic entry dates: FDA Drug and Device Product Approvals (Jan. 1987-Dec. 1994). Numbers of pending generic applications: FDA Office of Generic Drugs Quantitative Report-ANDAs and AADAs (Nov. 1990-Jan. 1993). Sales revenue: Pharmaceutical Data Services, Walsh-America. STUDY DESIGN: This study appropriately recognizes generic entry as a survival problem, and uses a proportional hazard method for analysis. PRINCIPAL FINDINGS: (1) There is a negative relationship between an innovative drug's sales revenue and the time to generic entry. (2) Entries of generics tend to be slower for drugs that have either very few or a very large number of competing brands in the marketplace. (3) The time to generic entry increased overall between 1987 and 1994. (4) Drugs that primarily treat chronic symptoms tend to enter faster than the types of drugs that primarily treat acute illnesses. CONCLUSIONS: The analysis shows that the generic industry is targeting large-revenue products and chronic drug markets. Entry of a generic drug is influenced by the existing branded substitutes in the marketplace. Surprisingly, the generic drug entry process has slowed despite many changes that would facilitate entry. PMID:9108806

  4. Arv1 lipid transporter function is conserved between pathogenic and nonpathogenic fungi

    PubMed Central

    Gallo-Ebert, Christina; McCourt, Paula C.; Donigan, Melissa; Villasmil, Michelle L.; Chen, WeiWei; Pandya, Devanshi; Franco, Judith; Romano, Desiree; Chadwick, Sean; Gygax, Scott; Nickels, Joseph T.

    2011-01-01

    The lipid transporter Arv1 regulates sterol trafficking, and glycosylphosphatidylinositol and sphingolipid biosyntheses in Saccharomyces cerevisiae. ScArv1 contains an Arv1 homology domain (AHD) that is conserved at the amino acid level in the pathogenic fungal species, Candida albicans and Candida glabrata. Here we show S. cerevisiae cells lacking Arv1 are highly susceptible to antifungal drugs. In the presence of drug, Scarv1 cells are unable to induce ERG gene expression, have an altered pleiotrophic drug response, and are defective in multi-drug resistance efflux pump expression. All phenotypes are remediated by ectopic expression of CaARV1 or CgARV1. The AHDs of these pathogenic fungi are required for specific drug tolerance, demonstrating conservation of function. In order to understand how Arv1 regulates antifungal susceptibility, we examined sterol trafficking. CaARV1/CgARV1 expression suppressed the sterol trafficking defect of Scarv1 cells. Finally, we show that C. albicans arv1/arv1 cells are avirulent using a BALB/c disseminated mouse model. We suggest that overall cell survival in response to antifungal treatment requires the lipid transporter function of Arv1. PMID:22142782

  5. Human embryonic and induced pluripotent stem cells in cardiovascular drug discovery: patents and patented uses.

    PubMed

    Ivashchenko, Christine Y

    2011-09-01

    Human embryonic stem cells, hES, and the recently created human induced pluripotent stem cells, hiPS, have a multitude of uses in cardiovascular drug discovery with a significant patent coverage for most applications. The research involving hiPS and hES cells may be subdivided into two main areas: one utilizing undifferentiated cells, and the other using hES and hiPS for in vitro differentiation of mature cell types. Both areas are of use in basic discovery, high throughput screening, and toxicology research. A number of methods have been developed to differentiate stem cells to mature cardiac cell types and to obtain pure populations of cardiomyocytes. This review will discuss three major aspects of stem cell patent landscape: 1) patents pertaining to the basic methodology of obtaining hES and hiPS cells, 2) patents pertaining to the methods of hiPS and hES differentiation to cardiovascular cell types, and 3) patents concerned with the applied uses of differentiated cardiac cells.

  6. Bioengineered bugs, drugs and contentious issues in patenting

    PubMed Central

    2010-01-01

    Bioengineered bugs, as is the scope of this journal, have great potential in various practical applications. A corollary to bringing useful products to the market is that such products need protection from copying by other people or businesses. Such government-sponsored protections are legally enforced through a patent, copyright or trademark/trade secret system commonly known as intellectual property rights. A condition for obtaining a patent is that the invention must not be disclosed to public either through seminars, informal public disclosures or publications in journals, although in the United States, there is a one year grace period that is allowed to obtain a patent after public disclosure. This article describes my personal experience in obtaining a patent in 1980 on a genetically manipulated bacterium designed for oil spill cleanup. This patent application went through a series of court cases that finally ended up in the Supreme Court of the United States. I also mention a similar contentious legal issue that is on the horizon and that the readers of Bioengineered Bugs should be aware of. Finally, I have taken the opportunity to describe my current efforts to bring to the market some unique potential multi-disease-targeting candidate drugs from Pseudomonas aeruginosa and gonococci/meningococci that, if found non-toxic and efficacious in humans, will revolutionize the drug industry. To ensure their marketability, we are trying to develop a patent portfolio that will ensure that they will be legally protected and such protections will be broad-based and enforceable. PMID:21327122

  7. Arv1 lipid transporter function is conserved between pathogenic and nonpathogenic fungi.

    PubMed

    Gallo-Ebert, Christina; McCourt, Paula C; Donigan, Melissa; Villasmil, Michelle L; Chen, WeiWei; Pandya, Devanshi; Franco, Judith; Romano, Desiree; Chadwick, Sean G; Gygax, Scott E; Nickels, Joseph T

    2012-02-01

    The lipid transporter Arv1 regulates sterol trafficking, and glycosylphosphatidylinositol and sphingolipid biosyntheses in Saccharomyces cerevisiae. ScArv1 contains an Arv1 homology domain (AHD) that is conserved at the amino acid level in the pathogenic fungal species, Candida albicans and Candida glabrata. Here we show S. cerevisiae cells lacking Arv1 are highly susceptible to antifungal drugs. In the presence of drug, Scarv1 cells are unable to induce ERG gene expression, have an altered pleiotrophic drug response, and are defective in multi-drug resistance efflux pump expression. All phenotypes are remediated by ectopic expression of CaARV1 or CgARV1. The AHDs of these pathogenic fungi are required for specific drug tolerance, demonstrating conservation of function. In order to understand how Arv1 regulates antifungal susceptibility, we examined sterol trafficking. CaARV1/CgARV1 expression suppressed the sterol trafficking defect of Scarv1 cells. Finally, we show that C. albicansarv1/arv1 cells are avirulent using a BALB/c disseminated mouse model. We suggest that overall cell survival in response to antifungal treatment requires the lipid transporter function of Arv1.

  8. Scope of claim coverage in patents of fufang Chinese herbal drugs: Substitution of ingredients.

    PubMed

    Wang, Xinsheng; Tian, Jiaher; Chan, Albert Wai-Kit

    2011-01-01

    Herbal ingredients in a Chinese fufang prescription are often replaced by one or several other herbal combinations. As there have been very few Chinese herbal patent infringement cases, it is still unclear how the Doctrine of Equivalents should be applied to determine the scope of 'equivalents' in Chinese fufang prescriptions. Case law principles from cases in other technical areas such as chemical patents and biological drug patents can be borrowed to ascertain a precise scope of a fufang patent. This article summarizes and discusses several chemical and biopharmaceutical patent cases. In cases where a certain herbal ingredient is substituted by another herb or a combination of herbs, accused infringers are likely to relate herbal drug patents to chemical drug patents with strict interpretation whereas patent owners may take advantage of the liberal application of Doctrine of Equivalence in biopharmaceutical patents by analogizing the complex nature of herbal drugs with biological drugs. Therefore, consideration should be given to the purpose of an ingredient in a patent, the qualities when combined with the other ingredients and the intended function. The scope of equivalents also depends on the stage of the prior art. Moreover, it is desirable to disclose any potential substitutes when drafting the application. Claims should be drafted in such a way that all foreseeable modifications are encompassed for the protection of the patent owner's intellectual property. PMID:21854570

  9. Mapping lifecycle management activities for blockbuster drugs in Japan based on drug approvals and patent term extensions.

    PubMed

    Yamanaka, Takayuki; Kano, Shingo

    2016-02-01

    Drug lifecycle management (LCM), which entails acquiring drug approvals and patent protections, contributes to maximizing drug discovery investment returns. In a previous survey, a comparative analysis between Japan and the USA indicated that a unique patent term extension system has an important role in Japanese drug LCM. Therefore, in this survey, we focused on drug approvals and patent term extensions, and found that the LCM for blockbuster drugs in Japan can be categorized into three types (drug approval-oriented LCM, patent term extension-oriented LCM, and inactive-type LCM), of which the first two have been implemented recently. Here, we suggest a strategy for selecting a suitable LCM approach among these three types based on the prospects for drug improvements.

  10. Current drug patenting for retinal diseases: beyond VEGF inhibitors.

    PubMed

    Mucke, Hermann A M; Mucke, Peter M

    2010-01-01

    An analysis of patent applications that address strategies for the pharmacological treatment of retinal diseases that are not directly related to VEGF inhibition, published under the PCT during the 18-month period from January 2008 to June 2009, is presented. The largest number of therapeutic patent applications focused on attempts to correct visual cycle dysfunctions, complement overactivation or beta-amyloid deposition in drusen to control age-related macular degeneration (AMD). Biomarker-based and genetic diagnostic modalities that assess AMD risk were also frequently claimed in the patent applications, and have become a significant factor in patenting for ocular disorders. The fields of both visual cycle therapy and AMD biomarkers were dominated by non-corporate patent assignees. Diabetic retinopathy has not received as much attention from inventors compared with AMD; retinopathy of prematurity remains a field in which little specific patenting occurs.

  11. A review of recent patents on the ASICs as a key drug target.

    PubMed

    Santos, Priscila L; Guimarães, Adriana G; Barreto, Rosana S S; Serafini, Mairim R; Quintans, Jullyana S S; Quintans-Júnior, Lucindo J

    2015-01-01

    Acid-sensing ion channels (ASICs) are scattered various cells of human body. Drugs like amiloride has demonstrated nonspecific antagonism ASICs. Toxins, such as Psalmotoxin-1, have been used in animal models. There are no drugs available in the market whose action mechanism acts through these channels. We revised all patents relating to pharmaceutical formulations of applicability in ASICs. Drugs acting as antagonist in ASIC1 or ASIC3 channels seem to be the most promising targets. Patent data have suggested a variety of approaches for selective ASICs drugs, such as neuroprotective and analgesic. Studies analysis suggested that ASICs are promising targets for new drugs.

  12. Biomarkers and biometric measures of adherence to use of ARV-based vaginal rings

    PubMed Central

    Stalter, Randy M; Moench, Thomas R; MacQueen, Kathleen M; Tolley, Elizabeth E; Owen, Derek H

    2016-01-01

    Introduction Poor adherence to product use has been observed in recent trials of antiretroviral (ARV)-based oral and vaginal gel HIV prevention products, resulting in an inability to determine product efficacy. The delivery of microbicides through vaginal rings is widely perceived as a way to achieve better adherence but vaginal rings do not eliminate the adherence challenges exhibited in clinical trials. Improved objective measures of adherence are needed as new ARV-based vaginal ring products enter the clinical trial stage. Methods To identify technologies that have potential future application for vaginal ring adherence measurement, a comprehensive literature search was conducted that covered a number of biomedical and public health databases, including PubMed, Embase, POPLINE and the Web of Science. Published patents and patent applications were also searched. Technical experts were also consulted to gather more information and help evaluate identified technologies. Approaches were evaluated as to feasibility of development and clinical trial implementation, cost and technical strength. Results Numerous approaches were identified through our landscape analysis and classified as either point measures or cumulative measures of vaginal ring adherence. Point measurements are those that give a measure of adherence at a particular point in time. Cumulative measures attempt to measure ring adherence over a period of time. Discussion Approaches that require modifications to an existing ring product are at a significant disadvantage, as this will likely introduce additional regulatory barriers to the development process and increase manufacturing costs. From the point of view of clinical trial implementation, desirable attributes would be high acceptance by trial participants, and little or no additional time or training requirements on the part of participants or clinic staff. We have identified four promising approaches as being high priority for further development

  13. The effect of pharmaceutical patent term length on research and development and drug expenditures in Canada.

    PubMed

    Grootendorst, Paul; Matteo, Livio Di

    2007-02-01

    While pharmaceutical patent terms have increased in Canada, increases in patented drug spending have been mitigated by price controls and retrenchment of public prescription drug subsidy programs. We estimate the net effects of these offsetting policies on domestic pharmaceutical R&D expenditures and also provide an upper-bound estimate on the effects of these policies on Canadian pharmaceutical spending over the period 1988-2002. We estimate that R&D spending increased by $4.4 billion (1997 dollars). Drug spending increased by $3.9 billion at most and, quite likely, by much less. Cutbacks to public drug subsidies and the introduction of price controls likely mitigated drug spending growth. In cost-benefit terms, we suspect that the patent extension policies have been beneficial to Canada.

  14. Patent issues in drug development: perspectives of a pharmaceutical scientist-attorney.

    PubMed

    Melethil, Srikumaran

    2005-10-27

    The major purpose of this article is to emphasize the need for pharmaceutical scientists to have a better understanding of patent fundamentals. This need is illustrated by analyses of key scientific and legal issues that arose during recent patent infringement cases involving Prozac, Prilosec, and Buspar. Economic incentives for drug discovery and development clash with societal needs for low-cost pharmaceuticals in the United States and all over the world. The Hatch-Waxman Act of 1984 was enacted to promote public health by balancing the interests of brand name and generic companies. Patent protection, which provides a monopoly for a limited time, is aimed to provide such incentives. Creation of patents requires the interaction between scientists and lawyers, an endeavor made difficult by the differing intellectual spheres of their respective disciplines. Therefore, in the first place, a thorough understanding of patent fundamentals among pharmaceutical scientists will help them work more efficiently with patent attorneys. Second, it will enable them to appreciate the strengths and weaknesses of individual patents, which is critical in developing strategies amidst the ongoing patent tug-of-war between brand-name and generic companies.

  15. A brief literature and patent review of nanosuspensions to a final drug product.

    PubMed

    Chin, William Wei Lim; Parmentier, Johannes; Widzinski, Michael; Tan, En Hui; Gokhale, Rajeev

    2014-10-01

    Particle size reduction can be used for enhancing the dissolution of poorly water-soluble drugs in order to enhance bioavailability. In nanosuspensions, the particle size of the drug is reduced to nanometer size. Nanosuspensions after downstream processing into drug products have successfully shown its impact on formulation design, the augmentation of product life cycle, patent life, and therapeutic efficacy. Formulation considerations for the nanosuspension formulation, its processing into a solid form, and aspects of material characterization are discussed. Technology assessments and feasibility of upstream processes for nanoparticle creation, and subsequently transformation into a drug product via the downstream processes have been reviewed. This paper aims to bridge formulation and process considerations along with patent reviews and may provide further insight into understanding the science and the white space. An analysis of current patent outlook and future trends is described to fully understand the limitations and opportunities in intellectual property generation.

  16. Streptokinase-A Drug for Thrombolytic Therapy: A Patent Review.

    PubMed

    Kunamneni, Adinarayana; Durvasula, Ravi

    2014-01-01

    Accumulation of fibrin in blood vessels significantly increases thrombosis, leading to myocardial infraction and other cardiovascular diseases. Microbial enzymes are one option for curing this pathological condition. Fibrinolytic enzymes such as urokinase (UK), tissue type plasminogen activator (t-PA) and streptokinase (SK) attracted much attention for thrombolytic therapy. Among them SK is preferable in low-resource settings because it is cost-effective. Therefore, the purpose of this review is to summarize recent patents related to the occurrence, mechanism of action, physico-chemical properties, cloning and expression, production, structure, immunogenicity, chemical modification, in vivo application and clinical trials of SK. This patent review considers the properties and characteristics of SK that make it a preferred agent for thrombolytic therapy. PMID:26497671

  17. Compulsory patent licensing and local drug manufacturing capacity in Africa.

    PubMed

    Owoeye, Olasupo Ayodeji

    2014-03-01

    Africa has the highest disease burden in the world and continues to depend on pharmaceutical imports to meet public health needs. As Asian manufacturers of generic medicines begin to operate under a more protectionist intellectual property regime, their ability to manufacture medicines at prices that are affordable to poorer countries is becoming more circumscribed. The Doha Declaration on the TRIPS Agreement and Public Health gives member states of the World Trade Organization (WTO) the right to adopt legislation permitting the use of patented material without authorization by the patent holder, a provision known as "compulsory licensing". For African countries to take full advantage of compulsory licensing they must develop substantial local manufacturing capacity. Because building manufacturing capacity in each African country is daunting and almost illusory, an African free trade area should be developed to serve as a platform not only for the free movement of goods made pursuant to compulsory licences, but also for an economic or financial collaboration towards the development of strong pharmaceutical manufacturing capacity in the continent. Most countries in Africa are in the United Nations list of least developed countries, and this allows them, under WTO law, to refuse to grant patents for pharmaceuticals until 2021. Thus, there is a compelling need for African countries to collaborate to build strong pharmaceutical manufacturing capacity in the continent now, while the current flexibilities in international intellectual property law offer considerable benefits.

  18. Compulsory patent licensing and local drug manufacturing capacity in Africa

    PubMed Central

    2014-01-01

    Abstract Africa has the highest disease burden in the world and continues to depend on pharmaceutical imports to meet public health needs. As Asian manufacturers of generic medicines begin to operate under a more protectionist intellectual property regime, their ability to manufacture medicines at prices that are affordable to poorer countries is becoming more circumscribed. The Doha Declaration on the TRIPS Agreement and Public Health gives member states of the World Trade Organization (WTO) the right to adopt legislation permitting the use of patented material without authorization by the patent holder, a provision known as “compulsory licensing”. For African countries to take full advantage of compulsory licensing they must develop substantial local manufacturing capacity. Because building manufacturing capacity in each African country is daunting and almost illusory, an African free trade area should be developed to serve as a platform not only for the free movement of goods made pursuant to compulsory licences, but also for an economic or financial collaboration towards the development of strong pharmaceutical manufacturing capacity in the continent. Most countries in Africa are in the United Nations list of least developed countries, and this allows them, under WTO law, to refuse to grant patents for pharmaceuticals until 2021. Thus, there is a compelling need for African countries to collaborate to build strong pharmaceutical manufacturing capacity in the continent now, while the current flexibilities in international intellectual property law offer considerable benefits. PMID:24700981

  19. Compulsory patent licensing and local drug manufacturing capacity in Africa.

    PubMed

    Owoeye, Olasupo Ayodeji

    2014-03-01

    Africa has the highest disease burden in the world and continues to depend on pharmaceutical imports to meet public health needs. As Asian manufacturers of generic medicines begin to operate under a more protectionist intellectual property regime, their ability to manufacture medicines at prices that are affordable to poorer countries is becoming more circumscribed. The Doha Declaration on the TRIPS Agreement and Public Health gives member states of the World Trade Organization (WTO) the right to adopt legislation permitting the use of patented material without authorization by the patent holder, a provision known as "compulsory licensing". For African countries to take full advantage of compulsory licensing they must develop substantial local manufacturing capacity. Because building manufacturing capacity in each African country is daunting and almost illusory, an African free trade area should be developed to serve as a platform not only for the free movement of goods made pursuant to compulsory licences, but also for an economic or financial collaboration towards the development of strong pharmaceutical manufacturing capacity in the continent. Most countries in Africa are in the United Nations list of least developed countries, and this allows them, under WTO law, to refuse to grant patents for pharmaceuticals until 2021. Thus, there is a compelling need for African countries to collaborate to build strong pharmaceutical manufacturing capacity in the continent now, while the current flexibilities in international intellectual property law offer considerable benefits. PMID:24700981

  20. Therapy Of XDR TB with thioridazine a drug beyond patent protection but eligible for patent "as new use".

    PubMed

    Amaral, Leonard; Molnar, Joseph

    2010-06-01

    Mycobacterium tuberculosis that is resistant to Isoniazid (INH) and Rifampin (Rif) and hence, multi-drug resistant (MDR) has progressed to extensive drug resistant (XDR) status. XDR strains of Mycobacterium tuberculosis (XDR Mtb) are resistant, in addition to INH and Rif, to any fluoroquinolone, streptomycin and to any of the injectable anti-TB drugs kanamycin, amikacin and capreomycin. Therapy of the XDR TB patient, even under the best conditions, is problematic and at least 20% of XDR TB patients die within one year after diagnosis. Mortality among XDR TB patients co-infected with HIV or presenting with AIDS is considerably higher reaching levels of 80% or higher. Drugs that are to prove effective against XDR Mtb must be able to reach the organism at the site where it mainly resides-the pulmonary macrophage. However, experience tells us that no matter how effective a drug may be, it will be followed by resistance. We have been able to demonstrate that thioridazine, a neuroleptic in safe use for over forty years, enhances the killing of phagocytosed Mycobacterium tuberculosis regardless of its antibiotic susceptibility profile and cure the mouse of a Mycobacterium tuberculosis pulmonary infection. Most recently, others have employed our studies for the therapy of the XDR TB patient with thioridazine and cured 10 out of 12 XDR TB patients of an XDR Mtb infection. Although thioridazine is beyond patent protection, its use for the therapy of XDR TB is new and therefore, a patent may be sought for "use as an anti-XDR TB agent".

  1. Off-patent drugs at brand-name prices: a puzzle for policymakers

    PubMed Central

    Tallapragada, Naren P.

    2016-01-01

    In August 2015, Turing Pharmaceuticals acquired the marketing rights to Daraprim (pyrimethamine), a drug used to treat parasitic infections like malaria and toxoplasmosis. Soon after, Turing caused an uproar when it announced that it would raise the price per tablet of Daraprim from \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$\\rm{\\$ 13.50\\ to\\ \\$ 750}$\\end{document}, a 5500% price hike for a drug that has been on the market for over 60 years and off patent since the 1970s. Old, off-patent drugs are becoming increasingly expensive; Daraprim is the archetypal example. Turing had the power to set a high price for Daraprim because the drug's limited patient population, the absence of competing manufacturers, and a lack of therapeutic alternatives all created an effective monopoly. Similar forces have driven up the prices of other off-patent drugs that treat diseases as diverse as heart failure and multi-drug-resistant tuberculosis. Thus, policymakers will have to consider how the high cost of off-patent drugs impacts public health as well as public spending. In this Note I outline the extent of the high-cost off-patent drug problem, drawing special attention to the problem's negative effects on both health outcomes and government budgets. After discussing some of the problem's underlying causes, I present several solutions to the problem that policymakers could consider, with a focus on proposals like reference pricing and expanded compounding that have received relatively little media attention. PMID:27774247

  2. Topical liposome drugs to come: what the patent literature tells us. A review.

    PubMed

    Korting, H C; Blecher, P; Schäfer-Korting, M; Wendel, A

    1991-12-01

    Drug-containing liposomes for topical use in dermatology have been devised during the last 10 years. Most recently the clinical superiority to a conventional gel of a topical glucocorticosteroid liposome preparation for eczema has been demonstrated. To get more insight from what may be expected from future liposome preparations for topical treatment, the pertinent patent literature has been reviewed.

  3. Mutations in yeast ARV1 alter intracellular sterol distribution and are complemented by human ARV1.

    PubMed

    Tinkelenberg, A H; Liu, Y; Alcantara, F; Khan, S; Guo, Z; Bard, M; Sturley, S L

    2000-12-29

    Intracellular cholesterol redistribution between membranes and its subsequent esterification are critical aspects of lipid homeostasis that prevent free sterol toxicity. To identify genes that mediate sterol trafficking, we screened for yeast mutants that were inviable in the absence of sterol esterification. Mutations in the novel gene, ARV1, render cells dependent on sterol esterification for growth, nystatin-sensitive, temperature-sensitive, and anaerobically inviable. Cells lacking Arv1p display altered intracellular sterol distribution and are defective in sterol uptake, consistent with a role for Arv1p in trafficking sterol into the plasma membrane. Human ARV1, a predicted sequence ortholog of yeast ARV1, complements the defects associated with deletion of the yeast gene. The genes are predicted to encode transmembrane proteins with potential zinc-binding motifs. We propose that ARV1 is a novel mediator of eukaryotic sterol homeostasis.

  4. Pharmacogenetic & Pharmacokinetic Biomarker for Efavirenz Based ARV and Rifampicin Based Anti-TB Drug Induced Liver Injury in TB-HIV Infected Patients

    PubMed Central

    Yimer, Getnet; Ueda, Nobuhisa; Habtewold, Abiy; Amogne, Wondwossen; Suda, Akira; Riedel, Klaus-Dieter; Burhenne, Jürgen; Aderaye, Getachew; Lindquist, Lars; Makonnen, Eyasu; Aklillu, Eleni

    2011-01-01

    Background Implication of pharmacogenetic variations and efavirenz pharmacokinetics in concomitant efavirenz based antiviral therapy and anti-tubercular drug induced liver injury (DILI) has not been yet studied. We performed a prospective case-control association study to identify the incidence, pharmacogenetic, pharmacokinetic and biochemical predictors for anti-tubercular and antiretroviral drugs induced liver injury (DILI) in HIV and tuberculosis (TB) co-infected patients. Methods and Findings Newly diagnosed treatment naïve TB-HIV co-infected patients (n = 353) were enrolled to receive efavirenz based ART and rifampicin based anti-TB therapy, and assessed clinically and biochemically for DILI up to 56 weeks. Quantification of plasma efavirenz and 8-hydroxyefaviernz levels and genotyping for NAT2, CYP2B6, CYP3A5, ABCB1, UGT2B7 and SLCO1B1 genes were done. The incidence of DILI and identification of predictors was evaluated using survival analysis and the Cox Proportional Hazards Model. The incidence of DILI was 30.0%, or 14.5 per 1000 person-week, and that of severe was 18.4%, or 7.49 per 1000 person-week. A statistically significant association of DILI with being of the female sex (p = 0.001), higher plasma efavirenz level (p = 0.009), efavirenz/8-hydroxyefavirenz ratio (p = 0.036), baseline AST (p = 0.022), ALT (p = 0.014), lower hemoglobin (p = 0.008), and serum albumin (p = 0.007), NAT2 slow-acetylator genotype (p = 0.039) and ABCB1 3435TT genotype (p = 0.001). Conclusion We report high incidence of anti-tubercular and antiretroviral DILI in Ethiopian patients. Between patient variability in systemic efavirenz exposure and pharmacogenetic variations in NAT2, CYP2B6 and ABCB1 genes determines susceptibility to DILI in TB-HIV co-infected patients. Close monitoring of plasma efavirenz level and liver enzymes during early therapy and/or genotyping practice in HIV clinics is recommended for early identification of patients

  5. Recent Techniques and Patents on Solid Lipid Nanoparticles as Novel Carrier for Drug Delivery.

    PubMed

    Khatak, Sunil; Dureja, Harish

    2015-01-01

    The various approaches have been utilized in the treatment of a variety of diseases by applying drug delivery system such as polymeric nanoparticles, self-emulsifying delivery systems, liposomes, microemulsions and micellar solutions. Recently, solid lipid nanoparticles (SLNs), nanostructured lipid carriers (NLCs) and lipid-drug conjugates (LDCs) have been exploited as a carrier of lipophilic and hydrophilic/amphiphilic substances for invasive and non-invasive routes of delivery. SLNs are colloidal drug carrier system and are like nanoemulsion, however, the lipid content in SLNs is solid in nature. These novel type of lipid nanoparticles with solid matrix offers to develop new prototype therapeutics in drug delivery, which could be used for controlled release, drug targeting, gene therapy, physical and chemical stability and site-specific drug delivery and thereby attracted the research groups worldwide. This manuscript overviews the recent patents, advantages, formulation techniques, stability aspects and applications of SLNs. PMID:27009132

  6. Pharmaceutical Equivalence of Distributed Generic Antiretroviral (ARV) in Asian Settings: The Cross-Sectional Surveillance Study – PEDA Study

    PubMed Central

    Thammajaruk, Narukjaporn; Pussadee, Kanitta; Riyaten, Prakit; Kerr, Stephen; Avihingsanon, Anchalee; Phanuphak, Praphan; Ruxrungtham, Kiat

    2016-01-01

    Objectives Ensuring that medicines meet quality standards is mandatory for ensuring safety and efficacy. There have been occasional reports of substandard generic medicines, especially in resource-limiting settings where policies to control quality may be less rigorous. As HIV treatment in Thailand depends mostly on affordable generic antiretrovirals (ARV), we performed quality assurance testing of several generic ARV available from different sources in Thailand and a source from Vietnam. Methods We sampled Tenofovir 300mg, Efavirenz 600mg and Lopinavir/ritonavir 200/50mg from 10 primary hospitals randomly selected from those participating in the National AIDS Program, 2 non-government organization ARV clinics, and 3 private drug stores. Quality of ARV was analyzed by blinded investigators at the Faculty of Pharmaceutical Science, Chulalongkorn University. The analysis included an identification test for drug molecules, a chemical composition assay to quantitate the active ingredients, a uniformity of mass test and a dissolution test to assess in-vitro drug release. Comparisons were made against the standards described in the WHO international pharmacopeia. Results A total of 42 batches of ARV from 15 sources were sampled from January–March 2015. Among those generics, 23, 17, 1, and 1 were Thai-made, Indian-made, Vietnamese-made and Chinese-made, respectively. All sampled products, regardless of manufacturers or sources, met the International Pharmacopeia standards for composition assay, mass uniformity and dissolution. Although local regulations restrict ARV supply to hospitals and clinics, samples of ARV could be bought from private drug stores even without formal prescription. Conclusion Sampled generic ARVs distributed within Thailand and 1 Vietnamese pharmacy showed consistent quality. However some products were illegally supplied without prescription, highlighting the importance of dispensing ARV for treatment or prevention in facilities where continuity

  7. Fixed-Dose Combination Drug Approvals, Patents and Market Exclusivities Compared to Single Active Ingredient Pharmaceuticals

    PubMed Central

    Hao, Jing; Rodriguez-Monguio, Rosa; Seoane-Vazquez, Enrique

    2015-01-01

    Introduction Fixed-dose combinations (FDC) contain two or more active ingredients. The effective patent and exclusivity life of FDC compared to single active ingredient has not been assessed. Objectives Trends in FDA approved FDC in the period 1980–2012 and time lag between approval of FDC and single active ingredients in the combination were assessed, and the effective patent and exclusivity life of FDC was compared with their single active ingredients. Materials and Methods New molecular entities (NMEs), new therapeutic biologics license applications (BLAs) and FDC data were collected from the FDA Orange Book and Drugs@FDA. Analysis included FDC containing one or more NMEs or BLAs at first FDA approval (NMEs-FDC) and only already marketed drugs (Non-NMEs-FDC). Descriptive, Kruskal-Wallis and Wilcoxon Rank Sum analyses were performed. Results During the study period, the FDA approved 28 NMEs-FDC (3.5% of NMEs) and 117 non-NMEs-FDC. FDC approvals increased from 12 in the 1980s to 59 in the 2000s. Non-NMEs-FDC entered the market at a median of 5.43 years (interquartile range 1.74, 10.31) after first FDA approval of single active ingredients in the combination. The Non-NMEs-FDC entered the market at a median of 2.33 years (-7.55, 2.39) before approval of generic single active ingredient. Non-NME-FDC added a median of 9.70 (2.75, 16.24) years to the patent and exclusivity life of the single active ingredients in the combination. Conclusion FDC approvals significantly increased over the last twenty years. Pharmaceutical companies market FDC drugs shortly before the generic versions of the single ingredients enter the market extending the patent and exclusivity life of drugs included in the combination. PMID:26469277

  8. Pricing and reimbursement of in-patent drugs in seven European countries: a comparative analysis.

    PubMed

    Garattini, Livio; Cornago, Dante; De Compadri, Paola

    2007-08-01

    The main objective of this comparative analysis was to assess regulations applied by EU governments to reward potentially innovative drugs. We focused on the pharmaceutical policy for in-patent drugs in seven EU countries: Belgium, France, Germany, Italy, the Netherlands, Spain, and the UK. A common scheme was applied to all seven countries: first, pricing and reimbursement procedures for new and innovative drugs were investigated; secondly, we focused on the use in the regulatory process of economic evaluations. The analysis involved reviewing the literature and interviewing a selected panel of local experts in each country. According to our comparative analysis, a first sensible step might be to classify active ingredients as those addressing neglected pathologies and those for diseases that are already successfully treated, thus offering more limited therapeutic gains by definition. A reasonable solution to reward real innovation could be to admit a premium price for very innovative drugs according to their estimated cost-effectiveness. New drugs with modest improvement could be grouped in therapeutic clusters and submitted to a common reference price, despite patent expiration. Such a "dual approach" could be a sensible compromise to restrict pharmaceutical expenditure while at the same time rewarding companies that invest in high-risk basic research.

  9. International patenting in ophthalmology: An analysis of its structure and relevance for the development of drugs and diagnostics

    PubMed Central

    Mucke, Hermann AM; Mucke, Peter; Mucke, Eva

    2009-01-01

    While investigative ophthalmologists access peer-reviewed journals as part of their daily routine, and while they regularly visit scientific congresses, they rarely peruse patent documents as an information source. Among the reasons for this negligence are the incompatibility of patent search algorithms with those known from journal databases, a legalistic and frequently redundant language, and misconceptions about the nature of the patenting system. Here we present key data and analyses from the ophthalmology module of a patent database system that we are developing to address some of these problems. We show that international patent applications consistently reflect developer interest in the ocular drug and diagnostics field; that they are technically focused lead indicators of developments that frequently feature in peer-reviewed patenting only much later; and that patenting targets are well aligned with the unmet therapeutic needs of populations in industrialized countries. Most applications (74%–78% in years since 2006) are supported with experimental data, and most (on average, 80%–90%) faced at least one objection to patentability during their initial stage of examination. In contrast to the peer-reviewed scenery that is highly diverse, the corresponding patenting arena shows a pronounced focus on the United States. PMID:19668552

  10. Anti-retroviral (ARV) rationing schemes in developing countries: a review article on strategies and ethical issues related to the successes and failures of ARV programmes.

    PubMed

    Nsimba, Stephen E D

    2009-08-01

    When a patient receives a counterfeit drug, he/she becomes a victim of fraud medicine and is put at risk of developing adverse effects from unwanted medication that is not prescribed. These individuals health also becomes compromised because they are cheated of both successful treatment regimens and economically. Indeed counterfeit drugs pose many threats to society; not only to the individual in terms of the health side effects experienced, but also to the public in terms of trade relations, economic implications, and the effects on global pandemics. Apart from the pharmaceutical aspect in producing substandard drugs, there area also climatic or environmental factors as well as patients and economic factors. All these need to be addressed when considering any proper rationing strategy for antiretroviral drugs (ARVs) in sub-Saharan countries. Short of that, there is a great danger that the shelf life of ARV will be soon lost and once resistance comes in we will be in big problems.

  11. A review of recent patents on the protozoan parasite HSP90 as a drug target.

    PubMed

    Angel, Sergio O; Matrajt, Mariana; Echeverria, Pablo C

    2013-04-01

    Diseases caused by protozoan parasites are still an important health problem. These parasites can cause a wide spectrum of diseases, some of which are severe and have high morbidity or mortality if untreated. Since they are still uncontrolled, it is important to find novel drug targets and develop new therapies to decrease their remarkable social and economic impact on human societies. In the past years, human HSP90 has become an interesting drug target that has led to a large number of investigations both at state organizations and pharmaceutical companies, followed by clinical trials. The finding that HSP90 has important biological roles in some protozoan parasites like Plasmodium spp, Toxoplasma gondii and trypanosomatids has allowed the expansion of the results obtained in human cancer to these infections. This review summarizes the latest important findings showing protozoan HSP90 as a drug target and presents three patents targeting T. gondii, P. falciparum and trypanosomatids HSP90.

  12. Click chemistry patents and their impact on drug discovery and chemical biology.

    PubMed

    Xu, Hua; Jones, Lyn H

    2015-01-01

    First introduced by K Barry Sharpless in 2001, the term 'click chemistry' soon became a widely used description of chemical reactions that proceed rapidly, cleanly and in a manner that is often compatible with aqueous solutions. Click chemistry is frequently employed throughout the process of drug discovery, and greatly helps advance research programs in the pharmaceutical industry. It facilitates library synthesis to support medicinal chemistry optimization, helps identify the targets and off-targets of drug candidates, and can facilitate the determination of drug efficacy in clinical trials. In the last decade, a large number of patent applications covering the various types and utilities of click chemistry have been filed. In this review, we provide the first analysis of click chemistry applications.

  13. Nanosuspension Technology For Poorly Soluble Drugs: Recent Researches, Advances and Patents.

    PubMed

    Agarwal, Vijay; Bajpai, Meenakshi

    2015-01-01

    Nowadays, in pharmaceutical industries, the attention on nanosized materials is growing gradually due to their wide applications in drug delivery systems. Recently, out of different nanosize systems, nanosuspension system has undergone a lot of interest in such a way to rectify the solubility and bioavailability problem due to their technical simplicity and cost-effectiveness property compared to other colloidal systems. Nanosuspension technology has proven that it can be a superior substitute over alternative approaches, which are available for enhancing the bioavailability of different drugs having low solubility. Since today, nanosuspensions have been greatly evolved for a huge number of drugs and also investigated for their potential applications. The various unique features make the nanosuspension to enable their utilization in numerous dosage forms and given through different routes, including parenteral, oral, topical, peroral, ocular and pulmonary routes. A large number of products grounded in nanosuspension technology are present in the market, and some are on the way. In fact, the number of such types of products is much more in comparison of other nanotechnologies based products. Additionally, the different preparation methods used to prepare the nanosuspensions are also well- established and patented. This article reviews the recent research, advances in formulation and their approaches related to nanosuspensions with emphasis given on different patents related to nanosuspension methods.

  14. Modified alginate beads for mucoadhesive drug delivery system: an updated review of patents.

    PubMed

    Swain, Suryakanta; Behera, Aurobinda; Beg, Sarwar; Patra, Chinam N; Dinda, Subash C; Sruti, Jammula; Rao, Muddana E B

    2012-12-01

    Pharmaceutical research and inventions are increasingly developed for the design of an ideal dosage regimen in drug therapy of many diseases, which attains therapeutic concentration of drug in plasma and maintains it constant for the entire duration of treatment and also minimizes the side effects. Recent trends in pharmaceutical technology indicated that mucoadhesive micro particle and modified alginate beads as drug delivery system especially suitable for achieving delivery of drug in a predetermined rate locally or systemically for a prolonged period of time. The release of drug from microparticle depends on a variety of factors including carrier used to form the micro particle and amount of drug contained in them. The main aim of the present review is to explain the various theories, mechanisms, advanced mucoadhesive polymers, various delivery approaches, methodologies for developing a mucoadhesive micro-particle and modified alginate beads formulation, in vitro, ex vivo and in vivo characterization. Apart from this, an innovative test method that is biacore is highlighted in this review to measure the mucoadhesive strength. This review is also briefly explained about the updated patenting system for the development of micro-particle and modified alginate beads as drug delivery system.

  15. Rapid deployment of electronic medical records for ARV rollout in rural Rwanda.

    PubMed

    Allen, Christian; Manyika, Patrick; Jazayeri, Darius; Rich, Michael; Lesh, Neal; Fraser, Hamish

    2006-01-01

    While most people with AIDS do not yet have access to anti-retroviral drugs (ARVs), large ARV treatment programs are being rolled out in many areas in Sub-Saharan Africa. ARV programs have substantial data management needs, which electronic medical record systems (EMRs) are helping to address. While most sophisticated EMRs in low-income regions are in large cities, where infrastructure and staffing needs are more easily met, Partners In Health (PIH) has pioneered web-based EMRs for HIV and TB treatment in rural areas. The HIV-EMR, developed in Haiti [1], was de-ployed in two Rwandan health districts starting in Au-gust 2005. The addition of new features and adaptation to local needs is happening concurrently with the rapid scale-up and evolution of the medical program itself.

  16. Ethics of ARV based prevention: treatment-as-prevention and PrEP.

    PubMed

    Haire, Bridget; Kaldor, John M

    2013-08-01

    Published data show that new HIV prevention strategies including treatment-as-prevention and pre-exposure prophylaxis (PrEP) using oral antiretroviral drugs (ARVs) are highly, but not completely, effective if regimens are taken as directed. Consequently, their implementation may challenge norms around HIV prevention. Specific concerns include the potential for ARV-based prevention to reframe responsibility, erode beneficial sexual norms and waste resources. This paper explores what rights claims uninfected people can make for access to ARVs for prevention, and whether moral claims justify the provision of ARV therapy to those who do not yet clinically require treatment as a way of reducing HIV transmission risk. An ethical analysis was conducted of the two strategies, PrEP and treatment-as-prevention, using a public health stewardship model developed by the Nuffield Bioethics Council to consider and compare the application of PrEP and treatment-as-prevention strategies. We found that treating the person with HIV rather than the uninfected person offers advantages in settings where there are limited opportunities to access care. A treatment-as-prevention strategy that places all the emphasis upon the positive person's adherence however carries a disproportionate burden of responsibility. PrEP remains an important option for receptive partners who face increased biological vulnerability. We conclude that the use of ARV for prevention is ethically justified, despite imperfect global to drugs for those in clinical need. The determination of which ARV-based HIV prevention strategy is ethically preferable is complex and must take into account both public health and interpersonal considerations. PMID:23594312

  17. Applicability, Commercial Utility and Recent Patents on Starch and Starch Derivative as Pharmaceutical Drug Delivery Carrier.

    PubMed

    Pandey, Shreya; Malviya, Rishabha; Sharma, Pramod K

    2015-01-01

    Natural polymers are widely utilized in pharmaceutical and food industries. Starch, a major carbohydrate is a staple food in human and animal diets which is simply extractable from various sources, like potato, maize, corn, wheat, etc. It is widely used as a raw material in various food and non food industries as well as in paper, textile and other industries. This article summarizes the starch and modification of starch and to produce a novel molecule with various applications in industries including number of advances in pharmaceutical industry. The unique characteristics of starch and their modified form can be successfully used as drug delivery carriers in various pharmaceutical preparations. It is widely used as controlled and sustained release polymer, tablet disintegrant, drug delivery carrier, plasma volume expander and also finds its applicability in bone tissue engineering and in artificial red cells. It also includes the patents related to starch and modified starch based products and their commercial utility. PMID:26205680

  18. Wnt Drug Discovery: Weaving Through the Screens, Patents and Clinical Trials.

    PubMed

    Lu, Benjamin; Green, Brooke A; Farr, Jacqueline M; Lopes, Flávia C M; Van Raay, Terence J

    2016-01-01

    The Wnt signaling pathway is intricately involved in many aspects of development and is the root cause of an increasing number of diseases. For example, colorectal cancer is the second leading cause of death in the industrialized world and aberration of Wnt signaling within the colonic stem cell is the cause of more than 90% of these cancers. Despite our advances in successfully targeting other pathways, such as Human Epidermal Growth Factor Receptor 2 (HER2), there are no clinically relevant therapies available for Wnt-related diseases. Here, we investigated where research activities are focused with respect to Wnt signaling modulators by searching the United States Patent and Trade Office (USPTO) for patents and patent applications related to Wnt modulators and compared this to clinical trials focusing on Wnt modulation. We found that while the transition of intellectual property surrounding the Wnt ligand-receptor interface to clinical trials is robust, this is not true for specific inhibitors of β-catenin, which is constitutively active in many cancers. Considering the ubiquitous use of the synthetic T-cell Factor/Lymphoid Enhancer Factor (TCF/Lef) reporter system and its success in identifying novel modulators in vitro, we speculate that this model of drug discovery does not capture the complexity of in vivo Wnt signaling that may be required if we are to successfully target the Wnt pathway in the clinic. Notwithstanding, increasingly more complex models are being developed, which may not be high throughput, but more pragmatic in our pursuit to control Wnt signaling. PMID:27598201

  19. Wnt Drug Discovery: Weaving Through the Screens, Patents and Clinical Trials

    PubMed Central

    Lu, Benjamin; Green, Brooke A.; Farr, Jacqueline M.; Lopes, Flávia C.M.; Van Raay, Terence J.

    2016-01-01

    The Wnt signaling pathway is intricately involved in many aspects of development and is the root cause of an increasing number of diseases. For example, colorectal cancer is the second leading cause of death in the industrialized world and aberration of Wnt signaling within the colonic stem cell is the cause of more than 90% of these cancers. Despite our advances in successfully targeting other pathways, such as Human Epidermal Growth Factor Receptor 2 (HER2), there are no clinically relevant therapies available for Wnt-related diseases. Here, we investigated where research activities are focused with respect to Wnt signaling modulators by searching the United States Patent and Trade Office (USPTO) for patents and patent applications related to Wnt modulators and compared this to clinical trials focusing on Wnt modulation. We found that while the transition of intellectual property surrounding the Wnt ligand-receptor interface to clinical trials is robust, this is not true for specific inhibitors of β-catenin, which is constitutively active in many cancers. Considering the ubiquitous use of the synthetic T-cell Factor/Lymphoid Enhancer Factor (TCF/Lef) reporter system and its success in identifying novel modulators in vitro, we speculate that this model of drug discovery does not capture the complexity of in vivo Wnt signaling that may be required if we are to successfully target the Wnt pathway in the clinic. Notwithstanding, increasingly more complex models are being developed, which may not be high throughput, but more pragmatic in our pursuit to control Wnt signaling. PMID:27598201

  20. Implications of patent pools on innovation regarding antiretrovirals.

    PubMed

    Noehrenberg, Eric

    2010-01-19

    Patent pools have been promoted as an innovative means of promoting the production of fixed-dose combination antiretroviral medicines (ARVs), which can be particularly appropriate for resource-poor settings. An important question, however, is what are the implications of patent pools on innovation for creating new and improved antiretrovirals. Indeed, given the continuing mutation of HIV and growing resistance to existing treatments, continued innovation in ARV development is vital for addressing these challenges. Would patent pools be a hindrance or rather a stimulus for further innovation? This question is particularly relevant in light of UNITAID's initiative to create a patent pool for ARV development, focusing on pediatric formulations and new combinations, by the end of 2009. In this article, the author argues that a voluntary and well-designed patent pool, involving both innovative and generic manufacturers, focused on developing fixed-dose combinations for resource-poor markets with the greatest need, could actually stimulate increased innovation to meet these needs. Indeed, by bringing together the major ARV producers worldwide to collaborate on developing products which will meet the needs of the poorest, an ARV patent pool could create significant public health benefits. UNITAID has taken the lead in designing and implementing such a pool and UNITAID's experience will have important lessons for policy-makers in the future.

  1. Off-patent drugs in Italy. A short-sighted view?

    PubMed

    Garattini, Livio; Ghislandi, Simone

    2006-03-01

    The new Italian policy to off-patent products, although similar to recent reforms in other European countries, seems to use some interesting instruments and has achieved significant results in the past 2 years. In particular, the prices of branded products have been reduced for all active ingredients where a generic version is available. However, this strategy may raise some problems in the longer term. Our analysis identified two open issues that might limit the long-term sustainability of the present scheme: the limited diffusion of generics and the reallocation of demand. The first stems from the new regulatory schemes which equate generics to branded off-patent products and exploit their presence only to cut prices. The second is favored by tough price competition that induces large companies to divert demand towards more profitable "me-too drugs." Solutions exist, but they are not easy to apply because so many difficulties arise when certain aspects of a long-standing equilibrium are modified.

  2. "ARVs" as sickness and medicine: examining children's knowledge and experience in the HIV era in urban Zambia.

    PubMed

    Hunleth, Jean

    2013-01-01

    Since the roll out of no cost antiretroviral drugs (ARVs) in health centers in Zambia in 2004, the number of Zambians receiving treatment has substantially increased. While research has addressed adult responses to ARVs in Zambia and elsewhere, there is little known about how children experience and respond to the presence of treatment in their communities and households. The increasing acknowledgment that children provide care and treatment support to people with HIV in their households demands a better understanding of children's knowledge of HIV and ARVs. To examine children's ARV knowledge, this article focuses on three children's workshops carried out with 38 children ages 8-12, who participated in a yearlong ethnographic study in 2007 and 2008. All children lived in a low-income and heavily HIV-affected residential area in Lusaka, and many children lived with parents or guardians who had HIV. Findings suggest that, when the children discussed ARVs, they made two intersecting points: (1) local conditions make living with HIV, even while on antiretroviral therapy (ART), difficult; and (2) children face particular challenges, concerns, and insecurities when caring for and living with the ill. Children's discussions about ARVs offer a deeper understanding of experiences of HIV and childhood in a disproportionately HIV-affected and low-resource area. Such insights might productively inform future programming and research aimed at assisting children and adults. PMID:23256500

  3. Yeast cells lacking the ARV1 gene harbor defects in sphingolipid metabolism. Complementation by human ARV1.

    PubMed

    Swain, Evelyn; Stukey, Joseph; McDonough, Virginia; Germann, Melody; Liu, Ying; Sturley, Stephen L; Nickels, Joseph T

    2002-09-27

    arv1Delta mutant cells have an altered sterol distribution within cell membranes (Tinkelenberg, A.H., Liu, Y., Alcantara, F., Khan, S., Guo, Z., Bard, M., and Sturley, S. L. (2000) J. Biol. Chem. 275, 40667-40670), and thus it has been suggested that Arv1p may be involved in the trafficking of sterol in the yeast Saccharomyces cerevisiae and also in humans. Here we present data showing that arv1Delta mutants also harbor defects in sphingolipid metabolism. [(3)H]inositol and [(3)H]dihydrosphingosine radiolabeling studies demonstrated that mutant cells had reduced rates of biosynthesis and lower steady-state levels of complex sphingolipids while accumulating certain hydroxylated ceramide species. Phospholipid radiolabeling studies showed that arv1Delta cells harbored defects in the rates of biosynthesis and steady-state levels of phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and phosphatidylglycerol. Neutral lipid radiolabeling studies indicated that the rate of biosynthesis and steady-state levels of sterol ester were increased in arv1Delta cells. Moreover, these same studies demonstrated that arv1Delta cells had decreased rates of biosynthesis and steady-state levels of total fatty acid and fatty acid alcohols. Gas chromatography/mass spectrometry analyses examining different fatty acid species showed that arv1Delta cells had decreased levels of C18:1 fatty acid. Additional gas chromatography/mass spectrometry analyses determining the levels of various molecular sterol species in arv1Delta cells showed that mutant cells accumulated early sterol intermediates. Using fluorescence microscopy we found that GFP-Arv1p localizes to the endoplasmic reticulum and Golgi. Interestingly, the heterologous expression of the human ARV1 cDNA suppressed the sphingolipid metabolic defects of arv1Delta cells. We hypothesize that in eukaryotic cells, Arv1p functions in the sphingolipid metabolic pathway perhaps as a transporter of ceramides between the endoplasmic

  4. A decade of targets and patented drugs for chemotherapy of Chagas disease.

    PubMed

    Duschak, Vilma G

    2011-09-01

    Chagas disease, a parasitic infection typically spread by triatomine bugs, affects millions of people throughout Latin America. Current chemotherapy based on the nitroaromatic compounds, benzonidazole and nifurtimox provides unsatisfactory results and suffers from considerable side effects. Therefore, there is still an urgent need for new drugs to treat this neglected disease. During the last decade, the advances and understanding in the biology and biochemistry of Trypanosoma cruzi have allowed the identification of multiple new targets for Chagas' disease chemotherapy. Among the most promising targets for antiparasitic drugs are: cruzipain, the main cysteine protease of T. cruzi, essential for parasite survival and proliferation in mammalian host; ergosterol biosynthesis pathway; trypanothione synthesis and thiol-dependant redox metabolism. Specific enzymes of the glycolytic, pentose phosphate, polyisoprenoid (farnesylpyrophosphate synthase) and other particular biosynthetic pathways as well as enzymes from purine salvage (hypoxanthine-guanine phosphoribosyl-transferase, dihydrofolate reductase) have also been intensively studied in T. cruzi. In particular, trypanocidal agents that target the validated biochemical pathways of the parasite including cysteine proteinase inhibitors and inhibitors capable to block ergosterol biosynthesis are currently in the pipeline. Among the latter, posaconazole and ravuconazole, are planned to enter in clinical trials for trypanocidal chemotherapy in the near future. This review will summarize advances on antichagasic agents directed to specific parasite targets such as metabolic pathways or specific enzymes. Related patents filed and issued from 2000 to 2010 claiming inhibitors for specific parasite targets will be also discussed. Among them, the most represented were those related with cysteine proteinase inhibitors. PMID:21824073

  5. Research and Development of Hepatitis B Drugs: An Analysis Based on Technology Flows Measured by Patent Citations

    PubMed Central

    Wan, Jian-bo; He, Chengwei; Hu, Yuanjia

    2016-01-01

    Despite the existence of available therapies, the Hepatitis B virus infection continues to be one of the most serious threats to human health, especially in developing countries such as China and India. To shed light on the improvement of current therapies and development of novel anti-HBV drugs, we thoroughly investigated 212 US patents of anti-HBV drugs and analyzed the technology flow in research and development of anti-HBV drugs based on data from IMS LifeCycle databases. Moreover, utilizing the patent citation method, which is an effective indicator of technology flow, we constructed patent citation network models and performed network analysis in order to reveal the features of different technology clusters. As a result, we identified the stagnant status of anti-HBV drug development and pointed the way for development of domestic pharmaceuticals in developing countries. We also discussed about therapeutic vaccines as the potential next generation therapy for HBV infection. Lastly, we depicted the cooperation between entities and found that novel forms of cooperation added diversity to the conventional form of cooperation within the pharmaceutical industry. In summary, our study provides inspiring insights for investors, policy makers, researchers, and other readers interested in anti-HBV drug development. PMID:27727319

  6. Complementation analysis reveals a potential role of human ARV1 in GPI anchor biosynthesis.

    PubMed

    Ikeda, Atsuko; Kajiwara, Kentaro; Iwamoto, Kunihiko; Makino, Asami; Kobayashi, Toshihide; Mizuta, Keiko; Funato, Kouichi

    2016-02-01

    ARV1 is involved in regulating lipid homeostasis but also in the biosynthesis of glycosylphosphatidylinositol (GPI) in Saccharomyces cerevisiae. Here, we examined whether human ARV1 can complement the role of yeast ARV1 in GPI biosynthesis. Overexpression of human ARV1 could rescue the phenotypes associated with GPI anchor synthesis defect in the yeast arv1Δ mutant. The results suggest that Arv1 function in GPI biosynthesis may be conserved in all eukaryotes, from yeast to humans.

  7. A guide to drug discovery. Protecting your inventions: the patent system.

    PubMed

    Webber, Philip M

    2003-10-01

    Whether you work for a multi-national pharmaceutical company, a biotech start-up or a university, a knowledge of the patent system is essential for understanding how best to protect the fruits of your research. The aim of this article is to give an overview of what a patent is, how you might get one and the rights that a patent confers. PMID:14526385

  8. Lipid-based nanocarriers for drug delivery and targeting: a patent survey of methods of production and characterization.

    PubMed

    Carbone, Claudia; Cupri, Sarha; Leonardi, Antonio; Puglisi, Giovanni; Pignatello, Rosario

    2013-09-01

    Among the colloidal vectors proposed for the controlled delivery and targeting of drugs and other biologically active compounds, lipid-based nanocarriers are acquiring an increasing role due to a number of peculiar technological and physical features. Solid lipid nanoparticles, lipid nanocapsules, nanostructured lipid carriers, and drug-lipid conjugates are all examples of how it can be possible to combine the properties of the more acknowledged liposomal systems, such as biocompatibility and biodegradability, with the stability and compositional flexibility, distinctive of polymeric nanosystems. This article introduces recent patents, filed in years 2007-2013, that deal with novel or amended methods of production of the various types of lipid-based nanocarriers. Although a significant gap still remains between basic research and patenting activity in this field, many of the proposed methods can attain an industrial value. Furthermore, the critical analysis of these patents further supports the position that a general revision of patenting systems at an international level would be necessary for nanosized pharmaceutical systems. PMID:24237173

  9. Evolution of Antiretroviral Drug Costs in Brazil in the Context of Free and Universal Access to AIDS Treatment

    PubMed Central

    Nunn, Amy S; Fonseca, Elize M; Bastos, Francisco I; Gruskin, Sofia; Salomon, Joshua A

    2007-01-01

    Background Little is known about the long-term drug costs associated with treating AIDS in developing countries. Brazil's AIDS treatment program has been cited widely as the developing world's largest and most successful AIDS treatment program. The program guarantees free access to highly active antiretroviral therapy (HAART) for all people living with HIV/AIDS in need of treatment. Brazil produces non-patented generic antiretroviral drugs (ARVs), procures many patented ARVs with negotiated price reductions, and recently issued a compulsory license to import one patented ARV. In this study, we investigate the drivers of recent ARV cost trends in Brazil through analysis of drug-specific prices and expenditures between 2001 and 2005. Methods and Findings We compared Brazil's ARV prices to those in other low- and middle-income countries. We analyzed trends in drug expenditures for HAART in Brazil from 2001 to 2005 on the basis of cost data disaggregated by each ARV purchased by the Brazilian program. We decomposed the overall changes in expenditures to compare the relative impacts of changes in drug prices and drug purchase quantities. We also estimated the excess costs attributable to the difference between prices for generics in Brazil and the lowest global prices for these drugs. Finally, we estimated the savings attributable to Brazil's reduced prices for patented drugs. Negotiated drug prices in Brazil are lowest for patented ARVs for which generic competition is emerging. In recent years, the prices for efavirenz and lopinavir–ritonavir (lopinavir/r) have been lower in Brazil than in other middle-income countries. In contrast, the price of tenofovir is US$200 higher per patient per year than that reported in other middle-income countries. Despite precipitous price declines for four patented ARVs, total Brazilian drug expenditures doubled, to reach US$414 million in 2005. We find that the major driver of cost increases was increased purchase quantities of six

  10. Antiretroviral Drug Use in a Cohort of HIV-Uninfected Women in the United States: HIV Prevention Trials Network 064

    PubMed Central

    Chen, Iris; Clarke, William; Ou, San-San; Marzinke, Mark A.; Breaud, Autumn; Emel, Lynda M.; Wang, Jing; Hughes, James P.; Richardson, Paul; Haley, Danielle F.; Lucas, Jonathan; Rompalo, Anne; Justman, Jessica E.; Hodder, Sally L.; Eshleman, Susan H.

    2015-01-01

    Antiretroviral (ARV) drug use was analyzed in HIV-uninfected women in an observational cohort study conducted in 10 urban and periurban communities in the United States with high rates of poverty and HIV infection. Plasma samples collected in 2009–2010 were tested for the presence of 16 ARV drugs. ARV drugs were detected in samples from 39 (2%) of 1,806 participants: 27/181 (15%) in Baltimore, MD and 12/179 (7%) in Bronx, NY. The ARV drugs detected included different combinations of non-nucleoside reverse transcriptase inhibitors and protease inhibitors (1–4 drugs/sample). These data were analyzed in the context of self-reported data on ARV drug use. None of the 39 women who had ARV drugs detected reported ARV drug use at any study visit. Further research is needed to evaluate ARV drug use by HIV-uninfected individuals. PMID:26445283

  11. The Demand for Antiretroviral Drugs in the Illicit Marketplace: Implications for HIV Disease Management Among Vulnerable Populations.

    PubMed

    Tsuyuki, Kiyomi; Surratt, Hilary L; Levi-Minzi, Maria A; O'Grady, Catherine L; Kurtz, Steven P

    2015-05-01

    The diversion of antiretroviral medications (ARVs) has implications for the integrity and success of HIV care, however little is known about the ARV illicit market. This paper aimed to identify the motivations for buying illicit ARVs and to describe market dynamics. Semi-structured interviews (n = 44) were conducted with substance-involved individuals living with HIV who have a history of purchasing ARVs on the street. Grounded theory was used to code and analyze interviews. Motivations for buying ARVs on the illicit market were: to repurchase ARVs after having diverted them for money or drugs; having limited access or low quality health care; to replace lost or ruined ARVs; and to buy a back-up stock of ARVs. This study identified various structural barriers to HIV treatment and ARV adherence that incentivized ARV diversion. Findings highlight the need to improve patient-provider relationships, ensure continuity of care, and integrate services to engage and retain high-needs populations.

  12. The Demand for Antiretroviral Drugs in the Illicit Marketplace: Implications for HIV disease management among vulnerable populations

    PubMed Central

    Tsuyuki, Kiyomi; Surratt, Hilary L.; Levi-Minzi, Maria A.; O’Grady, Catherine L.; Kurtz, Steven P.

    2014-01-01

    The diversion of antiretroviral medications (ARVs) has implications for the integrity and success of HIV care, however little is known about the ARV illicit market. This paper aimed to identify the motivations for buying illicit ARVs and to describe market dynamics. Semi-structured interviews (n=44) were conducted with substance-involved individuals living with HIV with a history of purchasing ARVs on the street. Grounded theory was used to code and analyze interviews. Motivations for buying ARVs on the illicit market were: to repurchase ARVs after having diverted them for money or drugs; having limited access or low quality health care; to replace lost or ruined ARVs; and to buy a back-up stock of ARVs. This study identified various structural barriers to HIV treatment and ARV adherence that incentivized ARV diversion. Findings highlight the need to improve patient-provider relationships, ensure continuity of care, and integrate services to engage and retain high-needs populations. PMID:25092512

  13. The Demand for Antiretroviral Drugs in the Illicit Marketplace: Implications for HIV Disease Management Among Vulnerable Populations.

    PubMed

    Tsuyuki, Kiyomi; Surratt, Hilary L; Levi-Minzi, Maria A; O'Grady, Catherine L; Kurtz, Steven P

    2015-05-01

    The diversion of antiretroviral medications (ARVs) has implications for the integrity and success of HIV care, however little is known about the ARV illicit market. This paper aimed to identify the motivations for buying illicit ARVs and to describe market dynamics. Semi-structured interviews (n = 44) were conducted with substance-involved individuals living with HIV who have a history of purchasing ARVs on the street. Grounded theory was used to code and analyze interviews. Motivations for buying ARVs on the illicit market were: to repurchase ARVs after having diverted them for money or drugs; having limited access or low quality health care; to replace lost or ruined ARVs; and to buy a back-up stock of ARVs. This study identified various structural barriers to HIV treatment and ARV adherence that incentivized ARV diversion. Findings highlight the need to improve patient-provider relationships, ensure continuity of care, and integrate services to engage and retain high-needs populations. PMID:25092512

  14. Determination of the membrane topology of Arv1 and the requirement of the ER luminal region for Arv1 function in Saccharomyces cerevisiae.

    PubMed

    Villasmil, Michelle L; Nickels, Joseph T

    2011-09-01

    In Saccharomyces cerevisiae, ARV1 encodes a 321 amino acid transmembrane protein localized to the endoplasmic reticulum (ER) and Golgi. It has been shown previously that arv1 cells harbor defects in sphingolipid and glycosylphosphatidylinositol biosyntheses, and may harbor sterol trafficking defects. Using C-terminal fusion to Suc2-His4, we determined the orientation of full-length Arv1 in the ER membrane. Once membrane topology was determined, we used this information and truncation analysis to establish the minimum protein length required for Arv1 function and phenotypic suppression. By understanding the topology of Arv1 we can now further analyze its putative lipid and glycosylphosphatidylinositol intermediate transport activities.

  15. PEDF as an anticancer drug and new treatment methods following the discovery of its receptors: A patent perspective

    PubMed Central

    Manalo, Katrina B.; Choong, Peter F.M.; Becerra, S. Patricia; Dass, Crispin R.

    2014-01-01

    Background Traditional forms of cancer therapy, which includes chemotherapy, have largely been overhauled due to the significant degree of toxicity they pose to normal, otherwise healthy tissue. It is hoped that use of biological agents, most of which are endogenously present in the body, will lead to safer treatment outcomes, without sacrificing efficacy. Objective The finding that PEDF, a naturally-occurring protein, was a potent angiogenesis inhibitor became the basis for studying the role of PEDF in tumours that are highly resistant to chemotherapy. The determination of the direct role of PEDF against cancer paved the way for understanding and developing PEDF as a novel drug. This review focuses on the patent applications behind testing the anticancer therapeutic effect of PEDF via its receptors as an antiangiogenic agent and as a direct anticancer agent. Conclusions The majority of the PEDF patents describe its and/or its fragments’ antiangiogenic ability and the usage of recombinant vectors as the mode of treatment delivery. PEDF’s therapeutic potential against different diseases and the discovery of its receptors opens possibilities for improving PEDF-based peptide design and drug delivery modes. PMID:21204726

  16. AUSTRALIAN COMPETITION AND CONSUMER COMMISSION v PFIZER: EVERGREENING AND MARKET POWER AS A BLOCKBUSTER DRUG GOES OFF PATENT.

    PubMed

    Faunce, Thomas

    2015-06-01

    In Australian Competition and Consumer Commission v Pfizer Australia Pty Ltd [2015] FCA 113, the ACCC alleged that Pfizer's "Project LEAP" involved a scheme to lock pharmacists into substituting its generic version of the high sales volume anti-cholesterol drug, patent-expired atorvastatin (Lipitor), which took advantage of a substantial degree of market power for a purpose proscribed by s 46(1)(c) of the Competition and Consumer Act 2010 (Cth). The ACCC also claimed that Pfizer's actions constituted a course of exclusive dealing pursuant to s 47(1)(d) and (e) for the proscribed purpose of lessening competition. Flick J in the Federal Court of Australia, in a judgment heavy with quotations but sparse in reasoning, dismissed the ACCC's Amended Originating Application alleging abuse of market power and ordered the ACCC to pay Pfizer's costs. The ACCC has now appealed the decision. This column explores this case in the context of Pfizer's broader strategies to preserve its income globally from this high sales volume drug in the period following its patent expiration.

  17. Software Patents.

    ERIC Educational Resources Information Center

    Burke, Edmund B.

    1994-01-01

    Outlines basic patent law information that pertains to computer software programs. Topics addressed include protection in other countries; how to obtain patents; kinds of patents; duration; classes of patentable subject matter, including machines and processes; patentability searches; experimental use prior to obtaining a patent; and patent…

  18. Making tenofovir accessible in the brazilian public health system: patent conflicts and generic production.

    PubMed

    Veras, Juliana

    2014-08-01

    In May 2011, the Brazilian Ministry of Health announced the distribution of the first batch of locally produced generic tenofovir disoproxil fumarate (TDF) to support its program of universal and free access for the treatment of HIV/AIDS. The inclusion of TDF in the public health program illustrates what has been considered the 'Brazilian model' of HIV/AIDS response, as it illustrates the current phase of the Brazilian pharmaceutical economy. Brazil is known for having managed to control the expansion of HIV/AIDS through a unique initiative combining the public health and the industrial production of generics. But, if at first local manufacturers could freely copy ARVs and produce cheaper generic versions that were delivered to the Ministry of Health, since the country started to grant patents on drugs in 1996, the sustainability of this policy has been challenged by the high cost of patented second-line HIV/AIDS treatments. In order to assure continuity of the local production of ARVs, and keep the program of public health alive, Brazilians are now forced to deal with conflicts of drugs' intellectual property rights in order to open the path to generic production. This article aims to describe the experiences surrounding TDF in Brazil and the unprecedented conflicts and challenges it has brought for our different interviewees. Blurring the frontier between the public and the private, the TDF case was driven at the same time by an ethic of drug access and regulation of drug quality, which has inspired Brazilians to intervene and transform the world they live in.

  19. Making tenofovir accessible in the brazilian public health system: patent conflicts and generic production.

    PubMed

    Veras, Juliana

    2014-08-01

    In May 2011, the Brazilian Ministry of Health announced the distribution of the first batch of locally produced generic tenofovir disoproxil fumarate (TDF) to support its program of universal and free access for the treatment of HIV/AIDS. The inclusion of TDF in the public health program illustrates what has been considered the 'Brazilian model' of HIV/AIDS response, as it illustrates the current phase of the Brazilian pharmaceutical economy. Brazil is known for having managed to control the expansion of HIV/AIDS through a unique initiative combining the public health and the industrial production of generics. But, if at first local manufacturers could freely copy ARVs and produce cheaper generic versions that were delivered to the Ministry of Health, since the country started to grant patents on drugs in 1996, the sustainability of this policy has been challenged by the high cost of patented second-line HIV/AIDS treatments. In order to assure continuity of the local production of ARVs, and keep the program of public health alive, Brazilians are now forced to deal with conflicts of drugs' intellectual property rights in order to open the path to generic production. This article aims to describe the experiences surrounding TDF in Brazil and the unprecedented conflicts and challenges it has brought for our different interviewees. Blurring the frontier between the public and the private, the TDF case was driven at the same time by an ethic of drug access and regulation of drug quality, which has inspired Brazilians to intervene and transform the world they live in. PMID:24889312

  20. Driving a decade of change: HIV/AIDS, patents and access to medicines for all.

    PubMed

    Hoen, Ellen 't; Berger, Jonathan; Calmy, Alexandra; Moon, Suerie

    2011-03-27

    Since 2000, access to antiretroviral drugs to treat HIV infection has dramatically increased to reach more than five million people in developing countries. Essential to this achievement was the dramatic reduction in antiretroviral prices, a result of global political mobilization that cleared the way for competitive production of generic versions of widely patented medicines.Global trade rules agreed upon in 1994 required many developing countries to begin offering patents on medicines for the first time. Government and civil society reaction to expected increases in drug prices precipitated a series of events challenging these rules, culminating in the 2001 World Trade Organization's Doha Declaration on the Agreement on Trade-Related Aspects of Intellectual Property Rights and Public Health. The Declaration affirmed that patent rules should be interpreted and implemented to protect public health and to promote access to medicines for all. Since Doha, more than 60 low- and middle-income countries have procured generic versions of patented medicines on a large scale.Despite these changes, however, a "treatment timebomb" awaits. First, increasing numbers of people need access to newer antiretrovirals, but treatment costs are rising since new ARVs are likely to be more widely patented in developing countries. Second, policy space to produce or import generic versions of patented medicines is shrinking in some developing countries. Third, funding for medicines is falling far short of needs. Expanded use of the existing flexibilities in patent law and new models to address the second wave of the access to medicines crisis are required.One promising new mechanism is the UNITAID-supported Medicines Patent Pool, which seeks to facilitate access to patents to enable competitive generic medicines production and the development of improved products. Such innovative approaches are possible today due to the previous decade of AIDS activism. However, the Pool is just one of a

  1. Driving a decade of change: HIV/AIDS, patents and access to medicines for all

    PubMed Central

    2011-01-01

    Since 2000, access to antiretroviral drugs to treat HIV infection has dramatically increased to reach more than five million people in developing countries. Essential to this achievement was the dramatic reduction in antiretroviral prices, a result of global political mobilization that cleared the way for competitive production of generic versions of widely patented medicines. Global trade rules agreed upon in 1994 required many developing countries to begin offering patents on medicines for the first time. Government and civil society reaction to expected increases in drug prices precipitated a series of events challenging these rules, culminating in the 2001 World Trade Organization's Doha Declaration on the Agreement on Trade-Related Aspects of Intellectual Property Rights and Public Health. The Declaration affirmed that patent rules should be interpreted and implemented to protect public health and to promote access to medicines for all. Since Doha, more than 60 low- and middle-income countries have procured generic versions of patented medicines on a large scale. Despite these changes, however, a "treatment timebomb" awaits. First, increasing numbers of people need access to newer antiretrovirals, but treatment costs are rising since new ARVs are likely to be more widely patented in developing countries. Second, policy space to produce or import generic versions of patented medicines is shrinking in some developing countries. Third, funding for medicines is falling far short of needs. Expanded use of the existing flexibilities in patent law and new models to address the second wave of the access to medicines crisis are required. One promising new mechanism is the UNITAID-supported Medicines Patent Pool, which seeks to facilitate access to patents to enable competitive generic medicines production and the development of improved products. Such innovative approaches are possible today due to the previous decade of AIDS activism. However, the Pool is just one of

  2. The mechanism by which the phenothiazine thioridazine contributes to cure problematic drug-resistant forms of pulmonary tuberculosis: recent patents for "new use".

    PubMed

    Amaral, Leonard; Martins, Ana; Spengler, Gabriella; Hunyadi, Attila; Molnar, Joseph

    2013-12-01

    At this moment, over half million patients suffer from multi-drug resistant tuberculosis (MDR-TB) according to the data from the WHO. A large majority is terminally ill with essentially incurable pulmonary tuberculosis. This herein mini-review provides the experimental and observational evidence that a specific phenothiazine, thioridazine, will contribute to cure any form of drug-resistant tuberculosis. This antipsychotic agent is no longer under patent protection for its initial use. The reader is informed on the recent developments in patenting this compound for "new use" with a special emphasis on the aspects of drug-resistance. Given that economic motivation can stimulate the use of this drug as an antitubercular agent, future prospects are also discussed. PMID:24320229

  3. Advances in recent patent and clinical trial drug development for Alzheimer’s disease

    PubMed Central

    Liu, Haibin; Wang, Lirong; Su, Weiwei; Xie, Xiang-Qun

    2015-01-01

    Alzheimer’s disease (AD) is a progressive neurodegenerative disease, involving a large number of genes, proteins and their complex interactions. Currently, no effective therapeutic agents are available to either stop or reverse the progression of this disease, likely due to its polygenic nature. The complicated pathophysiology of AD remains unresolved. Although it has been hypothesized that the amyloid β cascade and the hyper-phosphorylated tau protein may be primarily involved, other mechanisms, such as oxidative stress, deficiency of central cholinergic neurotransmitter, mitochondrial dysfunction and inflammation have also been implicated. The main focus of this review is to document current therapeutic agents in clinical trials and patented candidate compounds under development based on their main mechanisms of action. It also discusses the relationship between the recent understanding of key targets and the development of potential therapeutic agents for the treatment of AD. PMID:25291315

  4. Production of antiretroviral drugs in middle- and low-income countries.

    PubMed

    Pinheiro, Eloan dos Santos; Brüning, Karin; Macedo, M Fernanda; Siani, Antonio C

    2014-01-01

    This review outlines the main issues concerning the production of antiretroviral (ARV) drugs in middle- and low-income countries and the relevant political, legal and technical requirements for supporting such production. The requirements for efficient local production, including the manufacture of generic and branded products and public demand, have been considered from economic, market and socio-political perspectives. A steady and consistent government policy is crucial to success. Additional crucial factors in establishing local production are adequate infrastructure, qualified human resources in technical and managerial areas, and production-distribution logistics systems. The creation or strengthening of a national drug regulatory agency is a basic requirement. Production of ARVs relies on the structure of the international market for active pharmaceutical ingredients (APIs), which are highly monopolized for inclusion in branded or patented drugs, or are concentrated in a few Asian generic companies. Countries seeking to begin local production must develop strategies to overcome the various barriers. For instance, sub-Saharan African countries may benefit from developing multilateral health agreements with neighbouring countries. Such agreements are recommended and should be complemented by technology transfers, especially for the manufacture of APIs. Achieving a production level that is sustainable in the long term is crucial to maintaining patients' access to ARVs.

  5. Patents and nanomedicine.

    PubMed

    Bawa, Raj

    2007-06-01

    Big pharma's business model, which relies on a few blockbusters to generate profits, is clearly broken. Patent expiration on numerous blockbusters in recent years is already altering the drug landscape. Drug companies are also facing other challenges that necessitate development and implementation of novel R&D strategies, including those that focus on nanotechnology and miniaturization. Clearly, there is enormous excitement and expectation regarding nanomedicine's potential impact. However, securing valid and defensible patent protection will be critical. Although early forecasts for nanomedicine commercialization are encouraging, there are numerous bottlenecks as well. One of the major hurdles is an emerging thicket of patent claims, resulting primarily from patent proliferation as well as continued issuance of surprisingly broad patents by the US Patent and Trademark Office (PTO). Adding to this confusion is the fact that the US National Nanotechnology Initiative's widely cited definition of nanotechnology is inaccurate and irrelevant from a nanomedicine perspective. It is also the cause of the inadequate patent classification system that was recently unveiled by the PTO. All of this is creating a chaotic, tangled patent landscape in various sectors of nanomedicine where the competing players are unsure of the validity and enforceability of numerous issued patents. If this trend continues, it could stifle competition and limit access to some inventions. Therefore, reforms are urgently needed at the PTO to address problems ranging from poor patent quality and questionable examination practices to inadequate search capabilities, rising attrition, poor employee morale and a skyrocketing patent application backlog. Only a robust patent system will stimulate the development of commercially viable nanomedicine products that can drastically improve a patient's quality of life and reduce healthcare costs. PMID:17716180

  6. Patents and nanomedicine.

    PubMed

    Bawa, Raj

    2007-06-01

    Big pharma's business model, which relies on a few blockbusters to generate profits, is clearly broken. Patent expiration on numerous blockbusters in recent years is already altering the drug landscape. Drug companies are also facing other challenges that necessitate development and implementation of novel R&D strategies, including those that focus on nanotechnology and miniaturization. Clearly, there is enormous excitement and expectation regarding nanomedicine's potential impact. However, securing valid and defensible patent protection will be critical. Although early forecasts for nanomedicine commercialization are encouraging, there are numerous bottlenecks as well. One of the major hurdles is an emerging thicket of patent claims, resulting primarily from patent proliferation as well as continued issuance of surprisingly broad patents by the US Patent and Trademark Office (PTO). Adding to this confusion is the fact that the US National Nanotechnology Initiative's widely cited definition of nanotechnology is inaccurate and irrelevant from a nanomedicine perspective. It is also the cause of the inadequate patent classification system that was recently unveiled by the PTO. All of this is creating a chaotic, tangled patent landscape in various sectors of nanomedicine where the competing players are unsure of the validity and enforceability of numerous issued patents. If this trend continues, it could stifle competition and limit access to some inventions. Therefore, reforms are urgently needed at the PTO to address problems ranging from poor patent quality and questionable examination practices to inadequate search capabilities, rising attrition, poor employee morale and a skyrocketing patent application backlog. Only a robust patent system will stimulate the development of commercially viable nanomedicine products that can drastically improve a patient's quality of life and reduce healthcare costs.

  7. A method to manage and share anti-retroviral (ARV) therapy information of human immunodeficiency virus (HIV) patients in Vietnam.

    PubMed

    Nguyen, Phung Anh; Syed-Abdul, Shabbir; Minamareddy, Priti; Lee, Peisan; Ngo, Thuy Dieu; Iqbal, Usman; Nguyen, Phuong Hoang; Jian, Wen-Shan; Li, Yu-Chuan Jack

    2013-08-01

    Management of antiretroviral (ARV) drug and HIV patients data is an important component of Vietnam Administration of HIV/AIDS Control (VAAC) Department and hospitals/health care units when people often travel in other places of Vietnam; therefore, it would lead to a number of medical errors in treatment as well as patients do not adhere to ARV therapy. In this paper, we describe a system that manages and shares antiretroviral therapy information of 4438 HIV patients in three healthcare centers in Hanoi capital of Vietnam. The overall design considerations, architecture and the integration of centralized database and decentralized management for the system are also presented. The findings from this study can serve as a guide to consider in the implementation model of health care to manage and share information of patients not only in HIV infection, but also in the other chronic and non-communicable diseases.

  8. Antiretroviral drug use and HIV drug resistance among HIV-infected Black men who have sex with men: HIV Prevention Trials Network 061

    PubMed Central

    Chen, Iris; Connor, Matthew B.; Clarke, William; Marzinke, Mark A.; Cummings, Vanessa; Breaud, Autumn; Fogel, Jessica M.; Laeyendecker, Oliver; Fields, Sheldon D.; Donnell, Deborah; Griffith, Sam; Scott, Hyman M.; Shoptaw, Steven; del Rio, Carlos; Magnus, Manya; Mannheimer, Sharon; Wheeler, Darrell P.; Mayer, Kenneth H.; Koblin, Beryl A.; Eshleman, Susan H.

    2015-01-01

    BACKGROUND HPTN 061 enrolled Black men who have sex with men in the United States. Some men with low/undetectable HIV RNA had unusual patterns of antiretroviral (ARV) drug use or had drugs detected in the absence of viral suppression. This report includes a comprehensive analysis of ARV drug use and drug resistance among men in HPTN 061 who were not virally suppressed. METHODS The analysis included 169 men who had viral loads >400 copies/mL at enrollment, including three with acute infection and 13 with recent infection. By self-report, 88 were previously diagnosed, including 31 in care; 137 men reported no ARV drug use. Samples from these 169 men and 23 seroconverters were analyzed with HIV genotyping and ARV drug assays. RESULTS Forty-eight (28%) of the 169 men had ≥1 drug resistance mutation (DRM); 19 (11%) had multi-class resistance. Sixty men (36%) had ≥1 ARV drug detected, 42 (70%) of whom reported no ARV drug use. Nine (23%) of 39 newly-infected men had ≥1 DRM; 10 had ≥1 ARV drug detected. Unusual patterns of ARV drugs were detected more frequently in newly-diagnosed men than previously-diagnosed men. The rate of transmitted drug resistance (TDR) was 23% based on HIV genotyping and self-reported ARV drug use, but was 12% after adjusting for ARV drug detection. CONCLUSIONS Many men in HPTN 061 had drug-resistant HIV and many were at risk of acquiring additional DRMs. ARV drug testing revealed unusual patterns of ARV drug use and provided a more accurate estimate of TDR. PMID:25861015

  9. Trends in Nanopharmaceutical Patents

    PubMed Central

    Antunes, Adelaide; Fierro, Iolanda; Guerrante, Rafaela; Mendes, Flavia; Alencar, Maria Simone de M.

    2013-01-01

    Investment in nanotechnology is now a given constant by governments, research centers and companies in both more developed countries and emerging markets. Due to their characteristics, such as high stability, ability to enable antigen identification on specific cells in the human body and controlling the release of drugs and, therefore, improving therapies, nanoparticles have been the subject of research and patent applications in the pharmaceutical field. According to the Organization for Economic Co-operation and Development (OCDE), patent data can be used as a source of information in order to measure science and technology activities. Thereby, this paper presents an analysis based on patent documents related to nanotechnology in the pharmaceutical sector. As a result, the analysis of patents demonstrate primarily that nanobiotechnology attracts high levels of R&D investments, including nanoparticle-based chemotherapeutic agents/drugs, monoclonal antibody nanoparticle complexes and their role in drug delivery or contrast agents with non-toxic effects. PMID:23535336

  10. Dual Therapy Treatment Strategies for the Management of Patients Infected with HIV: A Systematic Review of Current Evidence in ARV-Naive or ARV-Experienced, Virologically Suppressed Patients

    PubMed Central

    Baril, Jean-Guy; Angel, Jonathan B.; Gill, M. John; Gathe, Joseph; Cahn, Pedro; van Wyk, Jean; Walmsley, Sharon

    2016-01-01

    Objective We reviewed the current literature regarding antiretroviral (ARV)-sparing therapy strategies to determine whether these novel regimens can be considered appropriate alternatives to standard regimens for the initial treatment of ARV-naive patients or as switch therapy for those patients with virologically suppressed HIV infection. Methods A search for studies related to HIV dual therapy published from January 2000 through April 2014 was performed using Biosis, Derwent Drug File, Embase, International Pharmaceutical Abstracts, Medline, Pascal, SciSearch, and TOXNET databases; seven major trial registries, and the abstracts of major conferences. Using predetermined criteria for inclusion, an expert review committee critically reviewed and qualitatively evaluated all identified trials for efficacy and safety results and potential limitations. Results Sixteen studies of dual therapy regimens were critiqued for the ARV-naive population. Studies of a protease inhibitor/ritonavir in combination with the integrase inhibitor raltegravir or the nucleoside reverse transcriptase inhibitor lamivudine provided the most definitive evidence supporting a role for dual therapy. In particular, lopinavir/ritonavir or darunavir/ritonavir combined with raltegravir and lopinavir/ritonavir combined with lamivudine demonstrated noninferiority to standard of care triple therapy after 48 weeks of treatment. Thirteen trials were critiqued in ARV-experienced, virologically suppressed patients. The virologic efficacy outcomes were mixed. Although overall data regarding toxicity are limited, when compared with standard triple therapy, certain dual therapy regimens may offer advantages in renal function, bone mineral density, and limb fat changes; however, some dual combinations may elevate lipid or bilirubin levels. Conclusions The potential benefits of dual therapy regimens include reduced toxicity, improved tolerability and adherence, and reduced cost. Although the data reviewed here

  11. Patent protection strategies

    PubMed Central

    Gupta, Himanshu; Kumar, Suresh; Roy, Saroj Kumar; Gaud, R. S.

    2010-01-01

    It is widely recognized that the pharmaceutical industry faces serious financial challenges. Large numbers of blockbuster drugs are losing patent protection and going generic. The pipeline of new drugs is too sparse to fill the gap and generate a platform for future growth. Moreover, many of the new products are biologics with much narrower target patient populations and comparatively higher prices relative to traditional pharmaceuticals. So now the time has come for pharmaceutical scientists to have a better understanding of patent fundamentals. This need is illustrated by analyses of key scientific and legal issues that arose during recent patent infringement cases involving Prozac, Prilosec, and Buspar. Facing this scenario, the pharmaceutical industry has moved to accelerate drug development process and to adopt at the same time different strategies to extend the life time of the patent monopoly to provide the economic incentives and utilizing it for drug discovery and development. This review covers the need of patent protection and various strategies to extend the patent. PMID:21814422

  12. Deletion of murine Arv1 results in a lean phenotype with increased energy expenditure

    PubMed Central

    Lagor, W R; Tong, F; Jarrett, K E; Lin, W; Conlon, D M; Smith, M; Wang, M Y; Yenilmez, B O; McCoy, M G; Fields, D W; O'Neill, S M; Gupta, R; Kumaravel, A; Redon, V; Ahima, R S; Sturley, S L; Billheimer, J T; Rader, D J

    2015-01-01

    Background: ACAT-related enzyme 2 required for viability 1 (ARV1) is a putative lipid transporter of the endoplasmic reticulum that is conserved across eukaryotic species. The ARV1 protein contains a conserved N-terminal cytosolic zinc ribbon motif known as the ARV1 homology domain, followed by multiple transmembrane regions anchoring it in the ER. Deletion of ARV1 in yeast results in defective sterol trafficking, aberrant lipid synthesis, ER stress, membrane disorganization and hypersensitivity to fatty acids (FAs). We sought to investigate the role of Arv1 in mammalian lipid metabolism. Methods: Homologous recombination was used to disrupt the Arv1 gene in mice. Animals were examined for alterations in lipid and lipoprotein levels, body weight, body composition, glucose tolerance and energy expenditure. Results: Global loss of Arv1 significantly decreased total cholesterol and high-density lipoprotein cholesterol levels in the plasma. Arv1 knockout mice exhibited a dramatic lean phenotype, with major reductions in white adipose tissue (WAT) mass and body weight on a chow diet. This loss of WAT is accompanied by improved glucose tolerance, higher adiponectin levels, increased energy expenditure and greater rates of whole-body FA oxidation. Conclusions: This work identifies Arv1 as an important player in mammalian lipid metabolism and whole-body energy homeostasis. PMID:26479315

  13. Patent urachus repair - slideshow

    MedlinePlus

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Contact Us Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent urachus repair - series—Normal anatomy URL of this ...

  14. A Repurposing Approach Identifies Off-Patent Drugs with Fungicidal Cryptococcal Activity, a Common Structural Chemotype, and Pharmacological Properties Relevant to the Treatment of Cryptococcosis

    PubMed Central

    Butts, Arielle; DiDone, Louis; Koselny, Kristy; Baxter, Bonnie K.; Chabrier-Rosello, Yeissa; Wellington, Melanie

    2013-01-01

    New, more accessible therapies for cryptococcosis represent an unmet clinical need of global importance. We took a repurposing approach to identify previously developed drugs with fungicidal activity toward Cryptococcus neoformans, using a high-throughput screening assay designed to detect drugs that directly kill fungi. From a set of 1,120 off-patent medications and bioactive molecules, we identified 31 drugs/molecules with fungicidal activity, including 15 drugs for which direct antifungal activity had not previously been reported. A significant portion of the drugs are orally bioavailable and cross the blood-brain barrier, features key to the development of a widely applicable anticryptococcal agent. Structural analysis of this set revealed a common chemotype consisting of a hydrophobic moiety linked to a basic amine, features that are common to drugs that cross the blood-brain barrier and access the phagolysosome, two important niches of C. neoformans. Consistent with their fungicidal activity, the set contains eight drugs that are either additive or synergistic in combination with fluconazole. Importantly, we identified two drugs, amiodarone and thioridazine, with activity against intraphagocytic C. neoformans. Finally, the set of drugs is also enriched for molecules that inhibit calmodulin, and we have confirmed that seven drugs directly bind C. neoformans calmodulin, providing a molecular target that may contribute to the mechanism of antifungal activity. Taken together, these studies provide a foundation for the optimization of the antifungal properties of a set of pharmacologically attractive scaffolds for the development of novel anticryptococcal therapies. PMID:23243064

  15. The Impact of HIV/AIDS and ARV Treatment on Worker Absenteeism: Implications for African Firms

    ERIC Educational Resources Information Center

    Habyarimana, James; Mbakile, Bekezela; Pop-Eleches, Cristian

    2010-01-01

    We characterize medium and long-run labor market impacts of HIV/AIDS and ARV treatment using unique panel data of worker absenteeism and information from an AIDS treatment program at a large mining firm in Botswana. We present robust evidence of an inverse-V shaped pattern in worker absenteeism around the time of ARV treatment inception.…

  16. Projected Uptake of New Antiretroviral (ARV) Medicines in Adults in Low- and Middle-Income Countries: A Forecast Analysis 2015-2025

    PubMed Central

    Gupta, Aastha; Juneja, Sandeep; Vitoria, Marco; Habiyambere, Vincent; Nguimfack, Boniface Dongmo; Doherty, Meg; Low-Beer, Daniel

    2016-01-01

    With anti-retroviral treatment (ART) scale-up set to continue over the next few years it is of key importance that manufacturers and planners in low- and middle-income countries (LMICs) hardest hit by the HIV/AIDS pandemic are able to anticipate and respond to future changes to treatment regimens, generics pipeline and demand, in order to secure continued access to all ARV medicines required. We did a forecast analysis, using secondary WHO and UNAIDS data sources, to estimate the number of people living with HIV (PLHIV) and the market share and demand for a range of new and existing ARV drugs in LMICs up to 2025. UNAIDS estimates 24.7 million person-years of ART in 2020 and 28.5 million person-years of ART in 2025 (24.3 million on first-line treatment, 3.5 million on second-line treatment, and 0.6 million on third-line treatment). Our analysis showed that TAF and DTG will be major players in the ART regimen by 2025, with 8 million and 15 million patients using these ARVs respectively. However, as safety and efficacy of dolutegravir (DTG) and tenofovir alafenamide (TAF) during pregnancy and among TB/HIV co-infected patients using rifampicin is still under debate, and ART scale-up is predicted to increase considerably, there also remains a clear need for continuous supplies of existing ARVs including TDF and EFV, which 16 million and 10 million patients—respectively—are predicted to be using in 2025. It will be important to ensure that the existing capacities of generics manufacturers, which are geared towards ARVs of higher doses (such as TDF 300mg and EFV 600mg), will not be adversely impacted due to the introduction of lower dose ARVs such as TAF 25mg and DTG 50mg. With increased access to viral load testing, more patients would be using protease inhibitors containing regimens in second-line, with 1 million patients on LPV/r and 2.3 million on ATV/r by 2025. However, it will remain important to continue monitoring the evolution of ARV market in LMICs to

  17. Parenteral patent drug S/GSK1265744 has the potential to be an effective agent in pre-exposure prophylaxis against HIV infection.

    PubMed

    Taha, Huda; Morgan, James; Das, Archik; Das, Satyajit

    2013-12-01

    The continuing HIV epidemic has driven advancements in antiretroviral therapy. New therapeutic targets have been identified over the past years, one of which has been the Integrase enzyme. This is responsible for integrating HIV pro-DNA into the host cell genome and has proved a successful drug target. Efforts have also been made to improve the pharmacokinetic parameters of current drug therapy and utilise these techniques in maximising drug therapeutic effect whilst minimising adverse events. An exciting example of new technologies is that of nanotechnology where drugs can be specifically targeted to certain tissues and drug delivery can be improved by utilising biological molecules and structures. Pre-exposure prophylaxis is also an area of much interest currently both on an individual and population level. Compliance is however a major issue with daily medication to prevent HIV acquisition as has been demonstrated with contraceptive agents. However if long acting compounds can be developed, compliance can be improved. The patent drug currently being developed through nanotechnology as an analogue of Dolutegravir, GSK1265744 LAP (Long Acting Parenteral) has shown promise as a Long Acting Integrase Inhibitor with potential action both as a therapeutic agent but also in pre-exposure prophylaxis. The favourable pharmacokinetic profile and therapeutic efficacy in comparison to other compounds of the same class demonstrate it to be a promising advance. However given current limitations in study material, further randomised studies with long term follow up are required to fully evaluate the value of the patent drug GSK1265744 LAP in action in both seropositive and seronegative individuals.

  18. 75 FR 34749 - Determination of Regulatory Review Period for Purposes of Patent Extension; BYSTOLIC; U.S. Patent...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-18

    ... Patent Extension; BYSTOLIC; U.S. Patent Nos. 5,759,580 and 6,545,040 AGENCY: Food and Drug Administration... has made the determination because of the submission of applications to the Director of Patents and Trademarks, Department of Commerce, for the extension of a patent which claims that human drug...

  19. Canada's Patented Medicines (Notice of Compliance) Proceedings and Intellectual Property.

    PubMed

    Bian, Henry; McCourt, Conor

    2015-06-01

    Canada's Patent Register is a tool created by the Patented Medicines (Notice of Compliance) Regulations to help innovators protect their inventions relating to pharmaceuticals. This tool exists at the intersection between the intellectual property and drug approval regimes. By listing a patent on the Patent Register, an innovator can prevent a generic manufacturer from entering the marketplace rather than having to wait for his or her patent to be infringed. This article provides information on the requirements for listing a patent on the Patent Register and an overview of how the Patent Medicines (Notice of Compliance) Regulations affect the drug approval process. PMID:25573772

  20. Patenting nanotechnology.

    PubMed

    Lemley, Mark A

    2005-11-01

    Universities and companies are rushing to the patent office in record numbers to patent nanotechnology inventions. This rush to the patent office is so significant that many law firms have established nanotechnology practice groups and the U.S. Patent and Trademark Office has now created a new technology class designed to track nanotechnology products. Three big differences between the emerging science of nanotechnology and other inventions make the role of patents more significant in this arena than elsewhere. First, this is almost the first new field in a century in which the basic ideas are being patented at the outset. In many of the most important fields of invention over the past century--computer hardware, software, the Internet, even biotechnology--the basic building blocks of the field were either unpatented or the patents were made available to all users by government regulation. In others, patents were delayed by interferences for so long that the industry developed free from their influence. In nanotechnology, by contrast, companies and universities alike are patenting early and often. A second factor distinguishing nanotechnology is its unique cross-industry structure. Unlike other new industries, in which the patentees are largely actual or at least potential participants in the market, a significant number of nanotechnology patentees will own rights not just in the industry in which they participate, but in other industries as well. This overlap may significantly affect their incentives to license the patents. Finally, a large number of the basic nanotechnology patents have been issued to universities, which have become far more active in patenting in the last twenty-five years. While universities have no direct incentive to restrict competition, their interests may or may not align with the optimal implementation of building-block nanotechnology inventions. The result is a nascent market in which a patent thicket is in theory a serious risk. Whether

  1. Measuring performance in off-patent drug markets: a methodological framework and empirical evidence from twelve EU Member States.

    PubMed

    Kanavos, Panos

    2014-11-01

    This paper develops a methodological framework to help evaluate the performance of generic pharmaceutical policies post-patent expiry or after loss of exclusivity in non-tendering settings, comprising five indicators (generic availability, time delay to and speed of generic entry, number of generic competitors, price developments, and generic volume share evolution) and proposes a series of metrics to evaluate performance. The paper subsequently tests this framework across twelve EU Member States (MS) by using IMS data on 101 patent expired molecules over the 1998-2010 period. Results indicate that significant variation exists in generic market entry, price competition and generic penetration across the study countries. Size of a geographical market is not a predictor of generic market entry intensity or price decline. Regardless of geographic or product market size, many off patent molecules lack generic competitors two years after loss of exclusivity. The ranges in each of the five proposed indicators suggest, first, that there are numerous factors--including institutional ones--contributing to the success of generic entry, price decline and market penetration and, second, MS should seek a combination of supply and demand-side policies in order to maximise cost-savings from generics. Overall, there seems to be considerable potential for faster generic entry, uptake and greater generic competition, particularly for molecules at the lower end of the market. PMID:25201433

  2. Long-term efficacy and toxicity of abacavir/lamivudine/nevirapine compared to the most prescribed ARV regimens before 2013 in a French Nationwide Cohort Study.

    PubMed

    de Boissieu, Paul; Dramé, Moustapha; Raffi, François; Cabie, André; Poizot-Martin, Isabelle; Cotte, Laurent; Garraffo, Rodolphe; Delobel, Pierre; Huleux, Thomas; Rey, David; Bani-Sadr, Firouzé

    2016-09-01

    Data on the long-term efficacy and safety of abacavir/lamivudine (ABC/3TC) and nevirapine (NVP) are scarce. This combination has the advantage of simplifying treatment and improving long-term tolerance. The aim of this study was to compare the rate of any discontinuation of antiretroviral (ARV) regimen because of virologic failure (VF), and/or adverse drug reaction (ADR) among patients receiving stable ARV regimens for at least 6 months.ABC/3TC/NVP was compared to ABC/3TC with either ritonavir-boosted darunavir (DRV/r) or ritonavir-boosted atazanavir (ATV/r), unboosted ATV, or tenofovir/emtricitabine (TDF/FTC) with either one of the following: ATV/r, unboosted ATV, DRV/r, efavirenz (EFV), or NVP, in the French prospective multicenter Dat'AIDS cohort.The study enrolled 16,511 patients treated with following ARV regimens: ABC/3TC/NVP (n = 1089), TDF/FTC/NVP (n = 1542), ABC/3TC/DRV/r (n = 1065), ABC/3TC/ATV/r (n = 1847), ABC/3TC/ATV (n = 563), TDF/FTC/ATV/r (n = 3519), TDF/FTC/DRV/r (n = 2767), TDF/FTC/ATV (n = 419), and TDF/FTC/EFV (n = 3700). Mean follow-up was 36 ± 24 months. Patients treated with ABC/3TC/NVP received this regimen as a switch regimen in 97% of cases. By multivariable analysis, the risk of treatment discontinuation due to VF was similar between ABC/3TC/NVP and other ARV regimens, except for TDF/FTC/ATV and ABC/3TC/ATV, which were associated with a higher risk of treatment interruption due to VF (hazard ratio [HR] 1.99; 95% confidence interval [CI] 1.29-3.06 and HR 2.19; 95% CI 1.51-3.18, respectively). Treatment discontinuation due to ADR was lowest with the ABC/3TC/NVP regimen. Other ARV regimens were associated with a 1.80- to 3.19-fold increase in the risk of treatment discontinuation due to ADR (P < 0.0001 for all comparisons).ABC/3TC/NVP as a simplification regimen is a long-term effective regimen with lower discontinuation due to long-term toxicity compared with other standard ARV regimens. PMID

  3. CUDC-101, a Novel Inhibitor of Full-Length Androgen Receptor (flAR) and Androgen Receptor Variant 7 (AR-V7) Activity: Mechanism of Action and In Vivo Efficacy.

    PubMed

    Sun, Huiying; Mediwala, Sanjay N; Szafran, Adam T; Mancini, Michael A; Marcelli, Marco

    2016-06-01

    Castration-resistant prostate cancer (CRPC) is an androgen receptor (AR)-dependent disease expected to cause the death of more than 27,000 Americans in 2015. There are only a few available treatments for CRPC, making the discovery of new drugs an urgent need. We report that CUDC-101 (an inhibitor od HER2/NEU, EGFR and HDAC) inhibits both the full length AR (flAR) and the AR variant AR-V7. This observation prompted experiments to discover which of the known activities of CUDC-101 is responsible for the inhibition of flAR/AR-V7 signaling. We used pharmacologic and genetic approaches, and found that the effect of CUDC-101 on flAR and AR-V7 was duplicated only by other HDAC inhibitors, or by silencing the HDAC isoforms HDAC5 and HDAC10. We observed that CUDC-101 treatment or AR-V7 silencing by RNAi equally reduced transcription of the AR-V7 target gene, PSA, without affecting viability of 22Rv1 cells. However, when cellular proliferation was used as an end point, CUDC-101 was more effective than AR-V7 silencing, raising the prospect that CUDC-101 has additional targets beside AR-V7. In support of this, we found that CUDC-101 increased the expression of the cyclin-dependent kinase inhibitor p21, and decreased that of the oncogene HER2/NEU. To determine if CUDC-101 reduces growth in a xenograft model of prostate cancer, this drug was given for 14 days to castrated male SCID mice inoculated with 22Rv1 cells. Compared to vehicle, CUDC-101 reduced xenograft growth in a statistically significant way, and without macroscopic side effects. These studies demonstrate that CUDC-101 inhibits wtAR and AR-V7 activity and growth of 22Rv1 cells in vitro and in vivo. These effects result from the ability of CUDC-101 to target not only HDAC signaling, which was associated with decreased flAR and AR-V7 activity, but multiple additional oncogenic pathways. These observations raise the possibility that treatment of CRPC may be achieved by using similarly multi-targeted approaches.

  4. Patent controversies and court cases

    PubMed Central

    Fialho, Arsenio M.; Chakrabarty, Ananda M.

    2012-01-01

    Patents are issued essentially by all countries on inventions that are deemed novel, non-obvious, clearly described and of significant utility or industrial application. The only exceptions to patenting an invention are abstract ideas, laws of nature and natural phenomena, although the exceptions vary depending on countries where moral, public order or human rights considerations are also taken into account. Although patent laws are updated over decades, the rapid progress of science creates situations that the patent laws on the book cannot address, leading to contentious legal issues. This is often true for life saving drugs, particularly drugs for cancers or HIV/AIDS, which are expensive and beyond the reach of poor people because of the proprietary positions of these patented drugs. Another contentious issue is the patent eligibility of human genes and mutations that are often thought of nature's contribution to human health and propagation and should be beyond the reach of patentability. In this review, we address some of these current legal issues and their implications for the development of diagnostic methods, therapeutic interventions and even prevention for cancer, a scourge of mankind. PMID:22954683

  5. ARV Re-Entry Module Aerodynmics And Aerothermodynamics

    NASA Astrophysics Data System (ADS)

    Scheer, Heloise; Tran, Philippe; Berthe, Philippe

    2011-05-01

    Astrium-ST is the prime contractor of ARV phase A and is especially in charge of designing the Reentry Module (RM). The RM aeroshape has been defined following a trade-off. High level system requirements were derived with particular attention paid on minimum lift-over-drag ratio, trim incidence, centre-of-gravity lateral off-set and box size, volumetric efficiency, attitude at parachute deployment, flight heritage and aeroheating. Since moderate cross-range and thus L/D ratio were required, the aeroshape trade-off has been performed among blunt capsule candidates. Two front- shield families were considered: spherical (Apollo/ARD/Soyuz type) and sphero-conical (CTV type) segment front-shield. The rear-cone angle was set to 20° for internal pressurized volume and accommodation purposes. Figures of merit were assessed and a spherical front- shield of ARD type with a 20° rear-cone section was selected and proposed for further investigations. Maximum benefits will be taken from ARD flight heritage. CFD and WTT campaigns plans will be presented including preliminary results.

  6. AR-v7 protein expression is regulated by protein kinase and phosphatase

    PubMed Central

    Li, Yinan; Xie, Ning; Gleave, Martin E.; Rennie, Paul S.; Dong, Xuesen

    2015-01-01

    Failure of androgen-targeted therapy and progression of castration-resistant prostate cancer (CRPC) are often attributed to sustained expression of the androgen receptor (AR) and its major splice variant, AR-v7. Although the new generation of anti-androgens such as enzalutamide effectively inhibits AR activity, accumulating pre-clinical and clinical evidence indicates that AR-v7 remains constitutively active in driving CRPC progression. However, molecular mechanisms which control AR-v7 protein expression remain unclear. We apply multiple prostate cancer cell models to demonstrate that enzalutamide induces differential activation of protein phosphatase-1 (PP-1) and Akt kinase depending on the gene context of cancer cells. The balance between PP-1 and Akt activation governs AR phosphorylation status and activation of the Mdm2 ubiquitin ligase. Mdm2 recognizes phosphorylated serine 213 of AR-v7, and induces AR-v7 ubiquitination and protein degradation. These findings highlight the decisive roles of PP-1 and Akt for AR-v7 protein expression and activities when AR is functionally blocked. PMID:26378044

  7. Arv1 promotes cell division by recruiting IQGAP1 and myosin to the cleavage furrow.

    PubMed

    Sundvold, Hilde; Sundvold-Gjerstad, Vibeke; Malerød-Fjeld, Helle; Haglund, Kaisa; Stenmark, Harald; Malerød, Lene

    2016-01-01

    Cell division is strictly regulated by a diversity of proteins and lipids to ensure proper duplication and segregation of genetic material and organelles. Here we report a novel role of the putative lipid transporter ACAT-related protein required for viability 1 (Arv1) during telophase. We observed that the subcellular localization of Arv1 changes according to cell cycle progression and that Arv1 is recruited to the cleavage furrow in early telophase by epithelial protein lost in neoplasm (EPLIN). At the cleavage furrow Arv1 recruits myosin heavy chain 9 (MYH9) and myosin light chain 9 (MYL9) by interacting with IQ-motif-containing GTPase-activating protein (IQGAP1). Consequently the lack of Arv1 delayed telophase-progression, and a strongly increased incidence of furrow regression and formation of multinuclear cells was observed both in human cells in culture and in follicle epithelial cells of egg chambers of Drosophila melanogaster in vivo. Interestingly, the cholesterol-status at the cleavage furrow did not affect the recruitment of either IQGAP1, MYH9 or MYL. These results identify a novel function for Arv1 in regulation of cell division through promotion of the contractile actomyosin ring, which is independent of its lipid transporter activity.

  8. AR-v7 protein expression is regulated by protein kinase and phosphatase.

    PubMed

    Li, Yinan; Xie, Ning; Gleave, Martin E; Rennie, Paul S; Dong, Xuesen

    2015-10-20

    Failure of androgen-targeted therapy and progression of castration-resistant prostate cancer (CRPC) are often attributed to sustained expression of the androgen receptor (AR) and its major splice variant, AR-v7. Although the new generation of anti-androgens such as enzalutamide effectively inhibits AR activity, accumulating pre-clinical and clinical evidence indicates that AR-v7 remains constitutively active in driving CRPC progression. However, molecular mechanisms which control AR-v7 protein expression remain unclear. We apply multiple prostate cancer cell models to demonstrate that enzalutamide induces differential activation of protein phosphatase-1 (PP-1) and Akt kinase depending on the gene context of cancer cells. The balance between PP-1 and Akt activation governs AR phosphorylation status and activation of the Mdm2 ubiquitin ligase. Mdm2 recognizes phosphorylated serine 213 of AR-v7, and induces AR-v7 ubiquitination and protein degradation. These findings highlight the decisive roles of PP-1 and Akt for AR-v7 protein expression and activities when AR is functionally blocked.

  9. Extending the market exclusivity of therapeutic antibodies through dosage patents.

    PubMed

    Storz, Ulrich

    2016-07-01

    Dosage patents are one way to extend the market exclusivity of an approved drug beyond the lifetime of the patent that protects the drug as such. Dosage patents may help to compensate the applicant for the long period where the active pharmaceutical ingredient as such is already under patent prosecution, but not on the market yet, due to lengthy development and approval procedures. This situation erodes part of the time the drug is marketed under patent protection. Dosage patents filed at a later date can provide remedy for this problem. Examples of successful and unsuccesful attempts, and the reasons for the respective outcomes, are provided in this article. PMID:27115842

  10. Geopolitical and cultural factors affecting ARV adherence on the US-Mexico border.

    PubMed

    Shedlin, Michele G; Decena, Carlos Ulises; Beltran, Oscar

    2013-10-01

    The data discussed represent the findings from a study by the NIH-funded Hispanic Health Disparities Research Center, exploring the influence of institutional and psychosocial factors on adherence to antiretroviral medications by Mexican-origin persons living with AIDS on the US-Mexico Border. A qualitative approach was utilized consisting of clinic observations, baseline and follow-up interviews with patients (N = 113), key informant interviews (N = 9) and focus groups (5) with patients and health providers. Findings include the social-normative, institutional and geo-political factors affecting treatment and service delivery as well as individual variation and culturally patterned behaviors. ARV adherence and retention were found to depend on complex interactions and negotiation of co-occurring factors including the experience of medications and side-effects, patient/provider relationships, cultural norms and the changing dynamics of international borders. We note effects of drug-related violence which created border-crossing obstacles influencing mobility, access to services and adherence. PMID:22797951

  11. The UNITAID Patent Pool Initiative: Bringing Patents Together for the Common Good

    PubMed Central

    Bermudez, Jorge; 't Hoen, Ellen

    2010-01-01

    Developing and delivering appropriate, affordable, well-adapted medicines for HIV/AIDS remains an urgent challenge: as first-line therapies fail, increasing numbers of people require costly second-line therapy; one-third of ARVs are not available in pediatric formulations; and certain key first- and second-line triple fixed-dose combinations do not exist or sufficient suppliers are lacking. UNITAID aims to help solve these problems through an innovative initiative for the collective management of intellectual property (IP) rights – a patent pool for HIV medicines. The idea behind a patent pool is that patent holders - companies, governments, researchers or universities - voluntarily offer, under certain conditions, the IP related to their inventions to the patent pool. Any company that wants to use the IP to produce or develop medicines can seek a license from the pool against the payment of royalties, and may then produce the medicines for use in developing countries (conditional upon meeting agreed quality standards). The patent pool will be a voluntary mechanism, meaning its success will largely depend on the willingness of pharmaceutical companies to participate and commit their IP to the pool. Generic producers must also be willing to cooperate. The pool has the potential to provide benefits to all. PMID:20309404

  12. The UNITAID Patent Pool Initiative: Bringing Patents Together for the Common Good.

    PubMed

    Bermudez, Jorge; 't Hoen, Ellen

    2010-01-19

    Developing and delivering appropriate, affordable, well-adapted medicines for HIV/AIDS remains an urgent challenge: as first-line therapies fail, increasing numbers of people require costly second-line therapy; one-third of ARVs are not available in pediatric formulations; and certain key first- and second-line triple fixed-dose combinations do not exist or sufficient suppliers are lacking. UNITAID aims to help solve these problems through an innovative initiative for the collective management of intellectual property (IP) rights - a patent pool for HIV medicines. The idea behind a patent pool is that patent holders - companies, governments, researchers or universities - voluntarily offer, under certain conditions, the IP related to their inventions to the patent pool. Any company that wants to use the IP to produce or develop medicines can seek a license from the pool against the payment of royalties, and may then produce the medicines for use in developing countries (conditional upon meeting agreed quality standards). The patent pool will be a voluntary mechanism, meaning its success will largely depend on the willingness of pharmaceutical companies to participate and commit their IP to the pool. Generic producers must also be willing to cooperate. The pool has the potential to provide benefits to all.

  13. [Research on composition rules of prescriptions dealing with syndrome of deficiency of both qi and blood from National Standard for Chinese Patent Drugs].

    PubMed

    Shao, Wei-rong; Shen, Dan; Tang, Shi-huan

    2015-05-01

    Based on the software of Traditional Chinese Medicine Inheritance Support System (TCMISS), the article made analysis on the composition rules of prescriptions dealing with syndrome of deficiency of both qi and blood from National Standard for Chinese Patent Drugs (NSCPD) enacted by Ministry of Public Health of China. First, prescriptions were collected from NSCPD. Second, used integrated data mining methods in TCMISS, including association rules, improved mutual information method, et al. to analyze the medication rules. At last, irregular menstruation, insomnia, consumptive diseases with the same syndrome of deficiency of both qi and blood, were chosen to make comparative analysis on frequency of medicines used, core drug combinations, et al. to better find the similarities and differences of medications rules when confronted with the same syndrome while different diseases. And the similar core drug combinations directly reflected the characters of clinical practices of traditional Chinese medicine, which emphasizes on the treatment based on the syndromes of differentiation, and treating different diseases with the same methods.

  14. Loss of Subcellular Lipid Transport Due to ARV1 Deficiency Disrupts Organelle Homeostasis and Activates the Unfolded Protein Response*

    PubMed Central

    Shechtman, Caryn F.; Henneberry, Annette L.; Seimon, Tracie A.; Tinkelenberg, Arthur H.; Wilcox, Lisa J.; Lee, Eunjee; Fazlollahi, Mina; Munkacsi, Andrew B.; Bussemaker, Harmen J.; Tabas, Ira; Sturley, Stephen L.

    2011-01-01

    The ARV1-encoded protein mediates sterol transport from the endoplasmic reticulum (ER) to the plasma membrane. Yeast ARV1 mutants accumulate multiple lipids in the ER and are sensitive to pharmacological modulators of both sterol and sphingolipid metabolism. Using fluorescent and electron microscopy, we demonstrate sterol accumulation, subcellular membrane expansion, elevated lipid droplet formation, and vacuolar fragmentation in ARV1 mutants. Motif-based regression analysis of ARV1 deletion transcription profiles indicates activation of Hac1p, an integral component of the unfolded protein response (UPR). Accordingly, we show constitutive splicing of HAC1 transcripts, induction of a UPR reporter, and elevated expression of UPR targets in ARV1 mutants. IRE1, encoding the unfolded protein sensor in the ER lumen, exhibits a lethal genetic interaction with ARV1, indicating a viability requirement for the UPR in cells lacking ARV1. Surprisingly, ARV1 mutants expressing a variant of Ire1p defective in sensing unfolded proteins are viable. Moreover, these strains also exhibit constitutive HAC1 splicing that interacts with DTT-mediated perturbation of protein folding. These data suggest that a component of UPR induction in arv1Δ strains is distinct from protein misfolding. Decreased ARV1 expression in murine macrophages also results in UPR induction, particularly up-regulation of activating transcription factor-4, CHOP (C/EBP homologous protein), and apoptosis. Cholesterol loading or inhibition of cholesterol esterification further elevated CHOP expression in ARV1 knockdown cells. Thus, loss or down-regulation of ARV1 disturbs membrane and lipid homeostasis, resulting in a disruption of ER integrity, one consequence of which is induction of the UPR. PMID:21266578

  15. Loss of subcellular lipid transport due to ARV1 deficiency disrupts organelle homeostasis and activates the unfolded protein response.

    PubMed

    Shechtman, Caryn F; Henneberry, Annette L; Seimon, Tracie A; Tinkelenberg, Arthur H; Wilcox, Lisa J; Lee, Eunjee; Fazlollahi, Mina; Munkacsi, Andrew B; Bussemaker, Harmen J; Tabas, Ira; Sturley, Stephen L

    2011-04-01

    The ARV1-encoded protein mediates sterol transport from the endoplasmic reticulum (ER) to the plasma membrane. Yeast ARV1 mutants accumulate multiple lipids in the ER and are sensitive to pharmacological modulators of both sterol and sphingolipid metabolism. Using fluorescent and electron microscopy, we demonstrate sterol accumulation, subcellular membrane expansion, elevated lipid droplet formation, and vacuolar fragmentation in ARV1 mutants. Motif-based regression analysis of ARV1 deletion transcription profiles indicates activation of Hac1p, an integral component of the unfolded protein response (UPR). Accordingly, we show constitutive splicing of HAC1 transcripts, induction of a UPR reporter, and elevated expression of UPR targets in ARV1 mutants. IRE1, encoding the unfolded protein sensor in the ER lumen, exhibits a lethal genetic interaction with ARV1, indicating a viability requirement for the UPR in cells lacking ARV1. Surprisingly, ARV1 mutants expressing a variant of Ire1p defective in sensing unfolded proteins are viable. Moreover, these strains also exhibit constitutive HAC1 splicing that interacts with DTT-mediated perturbation of protein folding. These data suggest that a component of UPR induction in arv1Δ strains is distinct from protein misfolding. Decreased ARV1 expression in murine macrophages also results in UPR induction, particularly up-regulation of activating transcription factor-4, CHOP (C/EBP homologous protein), and apoptosis. Cholesterol loading or inhibition of cholesterol esterification further elevated CHOP expression in ARV1 knockdown cells. Thus, loss or down-regulation of ARV1 disturbs membrane and lipid homeostasis, resulting in a disruption of ER integrity, one consequence of which is induction of the UPR.

  16. Evolutionary dynamics of complex networks of HIV drug-resistant strains: the case of San Francisco.

    PubMed

    Smith, Robert J; Okano, Justin T; Kahn, James S; Bodine, Erin N; Blower, Sally

    2010-02-01

    Over the past two decades, HIV resistance to antiretroviral drugs (ARVs) has risen to high levels in the wealthier countries of the world, which are able to afford widespread treatment. We have gained insights into the evolution and transmission dynamics of ARV resistance by designing a biologically complex multistrain network model. With this model, we traced the evolutionary history of ARV resistance in San Francisco and predict its future dynamics. By using classification and regression trees, we identified the key immunologic, virologic, and treatment factors that increase ARV resistance. Our modeling shows that 60% of the currently circulating ARV-resistant strains in San Francisco are capable of causing self-sustaining epidemics, because each individual infected with one of these strains can cause, on average, more than one new resistant infection. It is possible that a new wave of ARV-resistant strains that pose a substantial threat to global public health is emerging. PMID:20075214

  17. The putative lipid transporter, Arv1, is required for activating pheromone-induced MAP kinase signaling in Saccharomyces cerevisiae.

    PubMed

    Villasmil, Michelle L; Ansbach, Alison; Nickels, Joseph T

    2011-02-01

    Saccharomyces cerevisiae haploid cells respond to extrinsic mating signals by forming polarized projections (shmoos), which are necessary for conjugation. We have examined the role of the putative lipid transporter, Arv1, in yeast mating, particularly the conserved Arv1 homology domain (AHD) within Arv1 and its role in this process. Previously it was shown that arv1 cells harbor defects in sphingolipid and glycosylphosphatidylinositol (GPI) biosyntheses and may harbor sterol trafficking defects. Here we demonstrate that arv1 cells are mating defective and cannot form shmoos. They lack the ability to initiate pheromone-induced G1 cell cycle arrest, due to failure to polarize PI(4,5)P(2) and the Ste5 scaffold, which results in weakened MAP kinase signaling activity. A mutant Ste5, Ste5(Q59L), which binds more tightly to the plasma membrane, suppresses the MAP kinase signaling defects of arv1 cells. Filipin staining shows arv1 cells contain altered levels of various sterol microdomains that persist throughout the mating process. Data suggest that the sterol trafficking defects of arv1 affect PI(4,5)P(2) polarization, which causes a mislocalization of Ste5, resulting in defective MAP kinase signaling and the inability to mate. Importantly, our studies show that the AHD of Arv1 is required for mating, pheromone-induced G1 cell cycle arrest, and for sterol trafficking.

  18. The Putative Lipid Transporter, Arv1, Is Required for Activating Pheromone-Induced MAP Kinase Signaling in Saccharomyces cerevisiae

    PubMed Central

    Villasmil, Michelle L.; Ansbach, Alison; Nickels, Joseph T.

    2011-01-01

    Saccharomyces cerevisiae haploid cells respond to extrinsic mating signals by forming polarized projections (shmoos), which are necessary for conjugation. We have examined the role of the putative lipid transporter, Arv1, in yeast mating, particularly the conserved Arv1 homology domain (AHD) within Arv1 and its role in this process. Previously it was shown that arv1 cells harbor defects in sphingolipid and glycosylphosphatidylinositol (GPI) biosyntheses and may harbor sterol trafficking defects. Here we demonstrate that arv1 cells are mating defective and cannot form shmoos. They lack the ability to initiate pheromone-induced G1 cell cycle arrest, due to failure to polarize PI(4,5)P2 and the Ste5 scaffold, which results in weakened MAP kinase signaling activity. A mutant Ste5, Ste5Q59L, which binds more tightly to the plasma membrane, suppresses the MAP kinase signaling defects of arv1 cells. Filipin staining shows arv1 cells contain altered levels of various sterol microdomains that persist throughout the mating process. Data suggest that the sterol trafficking defects of arv1 affect PI(4,5)P2 polarization, which causes a mislocalization of Ste5, resulting in defective MAP kinase signaling and the inability to mate. Importantly, our studies show that the AHD of Arv1 is required for mating, pheromone-induced G1 cell cycle arrest, and for sterol trafficking. PMID:21098723

  19. Patent Family Databases.

    ERIC Educational Resources Information Center

    Simmons, Edlyn S.

    1985-01-01

    Reports on retrieval of patent information online and includes definition of patent family, basic and equivalent patents, "parents and children" applications, designated states, patent family databases--International Patent Documentation Center, World Patents Index, APIPAT (American Petroleum Institute), CLAIMS (IFI/Plenum). A table noting country…

  20. 75 FR 32479 - Determination of Regulatory Review Period for Purposes of Patent Extension; ABLAVAR

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-08

    ... Patent Extension; ABLAVAR AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... Patents and Trademarks, Department of Commerce, for the extension of a patent which claims the human drug... Price Competition and Patent Term Restoration Act of 1984 (Public Law 98-417) and the Generic...

  1. 75 FR 17414 - Determination of Regulatory Review Period for Purposes of Patent Extension; TOVIAZ

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-06

    ... Animal Drug and Patent Term Restoration Act (Public Law 100-670) generally provide that a patent may be extended for a period of up to 5 years so long as the patented item (human drug product, animal drug... periods of time: A testing phase and an approval phase. For human drug products, the testing phase...

  2. The International Patent Situation

    ERIC Educational Resources Information Center

    Helliwell, B. F. M.

    1974-01-01

    Highlights the differences in patent laws in different countries to illustrate the importance of searching foreign patents, indicates how patent searches should be tackled and what assistance is available from patent offices, searching organizations and commercial patent documentation services, and considers the probable effect of the Europatent…

  3. 75 FR 21299 - Determination of Regulatory Review Period for Purposes of Patent Extension; VIMPAT-NDA 22-254

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-23

    ... Patent Extension; VIMPAT--NDA 22-254 AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY... Drug Price Competition and Patent Term Restoration Act of 1984 (Public Law 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Public Law 100-670) generally provide that a patent may...

  4. Patents and patent office resources in biotechnology.

    PubMed

    Koniarek, J P; Coleman, K D

    1988-02-01

    Patents play an increasingly important role in the dissemination of information in many fast moving fields such as biotechnology and semiconductors. Quite a few new developments are introduced as patents, and only later, if at all, do they find their way into the scientific literature. In spite of this, patents lack wide acceptance as a source of information among scientists in academia and, to a lesser degree, industry. Patents share many similarities with scientific papers. They both are organized in a similar way and are carefully reviewed by experts in the field. Both can be effective and timely sources of information. Patents can be accessed through data bases, library collections, the "Official Gazette of the Patent and Trademark Office," or directly in the Patent and Trademark Office. This article is designed to serve as a guide to the type of information which can be found in patents, and alternatives for obtaining this information.

  5. Patents and patent office resources in biotechnology.

    PubMed

    Koniarek, J P; Coleman, K D

    1988-02-01

    Patents play an increasingly important role in the dissemination of information in many fast moving fields such as biotechnology and semiconductors. Quite a few new developments are introduced as patents, and only later, if at all, do they find their way into the scientific literature. In spite of this, patents lack wide acceptance as a source of information among scientists in academia and, to a lesser degree, industry. Patents share many similarities with scientific papers. They both are organized in a similar way and are carefully reviewed by experts in the field. Both can be effective and timely sources of information. Patents can be accessed through data bases, library collections, the "Official Gazette of the Patent and Trademark Office," or directly in the Patent and Trademark Office. This article is designed to serve as a guide to the type of information which can be found in patents, and alternatives for obtaining this information. PMID:3273180

  6. Droplet Digital PCR Based Androgen Receptor Variant 7 (AR-V7) Detection from Prostate Cancer Patient Blood Biopsies

    PubMed Central

    Ma, Yafeng; Luk, Alison; Young, Francis P.; Lynch, David; Chua, Wei; Balakrishnar, Bavanthi; de Souza, Paul; Becker, Therese M.

    2016-01-01

    Androgen receptor splice variant V7 (AR-V7) was recently identified as a valuable predictive biomarker in metastatic castrate-resistant prostate cancer. Here, we report a new, sensitive and accurate screen for AR-V7 mRNA expression directly from circulating tumor cells (CTCs): We combined EpCAM-based immunomagnetic CTC isolation using the IsoFlux microfluidic platform with droplet digital polymerase chain reaction (ddPCR) to analyze total AR and AR-V7 expression from prostate cancer patients CTCs. We demonstrate that AR-V7 is reliably detectable in enriched CTC samples with as little as five CTCs, even considering tumor heterogeneity, and confirm detection of AR-V7 in CTC samples from advanced prostate cancer (PCa) patients with AR-V7 detection limited to castrate resistant disease status in our sample set. Sensitive molecular analyses of circulating tumor cells (CTCs) or circulating tumor nucleic acids present exciting strategies to detect biomarkers, such as AR-V7 from non-invasive blood samples, so-called blood biopsies. PMID:27527157

  7. Arv1 regulates PM and ER membrane structure and homeostasis but is dispensable for intracellular sterol transport

    PubMed Central

    Georgiev, Alexander G.; Johansen, Jesper; Ramanathan, Vidhya D.; Sere, Yves Y.; Beh, Christopher T.; Menon, Anant K.

    2013-01-01

    The pan-eukaryotic endoplasmic reticulum (ER) membrane protein Arv1 has been suggested to play a role in intracellular sterol transport. We tested this proposal by comparing sterol traffic in wild-type and Arv1-deficient Saccharomyces cerevisiae. We used fluorescence microscopy to track the retrograde movement of exogenously supplied dehydroergosterol (DHE) from the plasma membrane (PM) to the ER and lipid droplets and high performance liquid chromatography to quantify, in parallel, the transport-coupled formation of DHE esters. Metabolic labeling and subcellular fractionation were used to assay anterograde transport of ergosterol from the ER to the PM. We report that sterol transport between the ER and PM is unaffected by Arv1 deficiency. Instead, our results indicate differences in ER morphology and the organization of the PM lipid bilayer between wild-type and arv1Δ cells suggesting a distinct role for Arv1 in membrane homeostasis. In arv1Δ cells, specific defects affecting single C-terminal transmembrane domain proteins suggest that Arv1 might regulate membrane insertion of tail-anchored proteins involved in membrane homoeostasis. PMID:23668914

  8. Arv1 regulates PM and ER membrane structure and homeostasis but is dispensable for intracellular sterol transport.

    PubMed

    Georgiev, Alexander G; Johansen, Jesper; Ramanathan, Vidhya D; Sere, Yves Y; Beh, Christopher T; Menon, Anant K

    2013-08-01

    The pan-eukaryotic endoplasmic reticulum (ER) membrane protein Arv1 has been suggested to play a role in intracellular sterol transport. We tested this proposal by comparing sterol traffic in wild-type and Arv1-deficient Saccharomyces cerevisiae. We used fluorescence microscopy to track the retrograde movement of exogenously supplied dehydroergosterol (DHE) from the plasma membrane (PM) to the ER and lipid droplets and high performance liquid chromatography to quantify, in parallel, the transport-coupled formation of DHE esters. Metabolic labeling and subcellular fractionation were used to assay anterograde transport of ergosterol from the ER to the PM. We report that sterol transport between the ER and PM is unaffected by Arv1 deficiency. Instead, our results indicate differences in ER morphology and the organization of the PM lipid bilayer between wild-type and arv1Δ cells suggesting a distinct role for Arv1 in membrane homeostasis. In arv1Δ cells, specific defects affecting single C-terminal transmembrane domain proteins suggest that Arv1 might regulate membrane insertion of tail-anchored proteins involved in membrane homoeostasis.

  9. Droplet Digital PCR Based Androgen Receptor Variant 7 (AR-V7) Detection from Prostate Cancer Patient Blood Biopsies.

    PubMed

    Ma, Yafeng; Luk, Alison; Young, Francis P; Lynch, David; Chua, Wei; Balakrishnar, Bavanthi; de Souza, Paul; Becker, Therese M

    2016-08-04

    Androgen receptor splice variant V7 (AR-V7) was recently identified as a valuable predictive biomarker in metastatic castrate-resistant prostate cancer. Here, we report a new, sensitive and accurate screen for AR-V7 mRNA expression directly from circulating tumor cells (CTCs): We combined EpCAM-based immunomagnetic CTC isolation using the IsoFlux microfluidic platform with droplet digital polymerase chain reaction (ddPCR) to analyze total AR and AR-V7 expression from prostate cancer patients CTCs. We demonstrate that AR-V7 is reliably detectable in enriched CTC samples with as little as five CTCs, even considering tumor heterogeneity, and confirm detection of AR-V7 in CTC samples from advanced prostate cancer (PCa) patients with AR-V7 detection limited to castrate resistant disease status in our sample set. Sensitive molecular analyses of circulating tumor cells (CTCs) or circulating tumor nucleic acids present exciting strategies to detect biomarkers, such as AR-V7 from non-invasive blood samples, so-called blood biopsies.

  10. 77 FR 20827 - Determination of Regulatory Review Period for Purposes of Patent Extension; TEFLARO

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-06

    ... Patent Extension; TEFLARO AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L....

  11. 77 FR 20830 - Determination of Regulatory Review Period for Purposes of Patent Extension; VIIBRYD

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-06

    ... Patent Extension; VIIBRYD AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub....

  12. 75 FR 55332 - Determination of Regulatory Review Period for Purposes of Patent Extension; ULORIC

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-10

    ... Patent Extension; ULORIC AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and... extension of a patent which claims that human drug product. ADDRESSES: Submit electronic comments to http..., 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term Restoration Act...

  13. 77 FR 20829 - Determination of Regulatory Review Period for Purposes of Patent Extension; NATROBA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-06

    ... Patent Extension; NATROBA AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub....

  14. 76 FR 36929 - Determination of Regulatory Review Period for Purposes of Patent Extension; DEXILANT

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-23

    ... Patent Extension; DEXILANT AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... Commerce, for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  15. 77 FR 26554 - Determination of Regulatory Review Period for Purposes of Patent Extension; GILENYA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-04

    ... Patent Extension; GILENYA AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  16. 75 FR 77877 - Determination of Regulatory Review Period for Purposes of Patent Extension; VIBATIV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-14

    ... Patent Extension; VIBATIV AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub....

  17. 76 FR 14671 - Determination of Regulatory Review Period for Purposes of Patent Extension; ISTODAX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-17

    ... Patent Extension; ISTODAX AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  18. 75 FR 75679 - Determination of Regulatory Review Period for Purposes of Patent Extension; BESIVANCE

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-06

    ... Patent Extension; BESIVANCE AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  19. 76 FR 36548 - Determination of Regulatory Review Period for Purposes of Patent Extension; METVIXIA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-22

    ... Patent Extension; METVIXIA AGENCY: Food and Drug Administration, HHS. ] ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  20. 76 FR 36928 - Determination of Regulatory Review Period for Purposes of Patent Extension; BROVANA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-23

    ... Patent Extension; BROVANA AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  1. 75 FR 76990 - Determination of Regulatory Review Period for Purposes of Patent Extension; COARTEM

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-10

    ... Patent Extension; COARTEM AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food..., for the extension of a patent which claims that human drug product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  2. Comprehensive quantitative analysis of Chinese patent drug YinHuang drop pill by ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry.

    PubMed

    Wong, Tin-Long; An, Ya-Qi; Yan, Bing-Chao; Yue, Rui-Qi; Zhang, Tian-Bo; Ho, Hing-Man; Ren, Tian-Jing; Fung, Hau-Yee; Ma, Dik-Lung; Leung, Chung-Hang; Liu, Zhong-Liang; Pu, Jian-Xin; Han, Quan-Bin; Sun, Han-Dong

    2016-06-01

    YinHuang drop pill (YHDP) is a new preparation, derived from the traditional YinHuang (YH) decoction. Since drop pills are one of the newly developed forms of Chinese patent drugs, not much research has been done regarding the quality and efficacy. This study aims to establish a comprehensive quantitative analysis of the chemical profile of YHDP. ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry (UHPLC-Q-TOF-MS/MS) was used to identify 34 non-sugar small molecules including 15 flavonoids, 9 phenolic acids, 5 saponins, 1 iridoid, and 4 iridoid glycosides in YHDP samples, and 26 of them were quantitatively determined. Sugar composition of YHDP in terms of fructose, glucose and sucrose was examined via a high performance liquid chromatography-evaporative light scattering detector on an amide column (HPLC-NH2P-ELSD). Macromolecules were examined by high performance gel permeation chromatography coupled with ELSD (HPGPC-ELSD). The content of the drop pill's skeleton component PEG-4000 was also quantified via ultra-high performance liquid chromatography coupled with charged aerosol detector (UHPLC-CAD). The results showed that up to 73% (w/w) of YHDP could be quantitatively determined. Small molecules accounted for approximately 5%, PEG-4000 represented 68%, while no sugars or macromolecules were found. Furthermore, YHDP showed no significant differences in terms of daily dosage, compared to YinHuang granules and YinHuang oral liquid; however, it has a higher small molecules content compared to YinHuang lozenge. PMID:27131804

  3. Comprehensive quantitative analysis of Chinese patent drug YinHuang drop pill by ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry.

    PubMed

    Wong, Tin-Long; An, Ya-Qi; Yan, Bing-Chao; Yue, Rui-Qi; Zhang, Tian-Bo; Ho, Hing-Man; Ren, Tian-Jing; Fung, Hau-Yee; Ma, Dik-Lung; Leung, Chung-Hang; Liu, Zhong-Liang; Pu, Jian-Xin; Han, Quan-Bin; Sun, Han-Dong

    2016-06-01

    YinHuang drop pill (YHDP) is a new preparation, derived from the traditional YinHuang (YH) decoction. Since drop pills are one of the newly developed forms of Chinese patent drugs, not much research has been done regarding the quality and efficacy. This study aims to establish a comprehensive quantitative analysis of the chemical profile of YHDP. ultra high-performance liquid chromatography quadrupole time of flight mass spectrometry (UHPLC-Q-TOF-MS/MS) was used to identify 34 non-sugar small molecules including 15 flavonoids, 9 phenolic acids, 5 saponins, 1 iridoid, and 4 iridoid glycosides in YHDP samples, and 26 of them were quantitatively determined. Sugar composition of YHDP in terms of fructose, glucose and sucrose was examined via a high performance liquid chromatography-evaporative light scattering detector on an amide column (HPLC-NH2P-ELSD). Macromolecules were examined by high performance gel permeation chromatography coupled with ELSD (HPGPC-ELSD). The content of the drop pill's skeleton component PEG-4000 was also quantified via ultra-high performance liquid chromatography coupled with charged aerosol detector (UHPLC-CAD). The results showed that up to 73% (w/w) of YHDP could be quantitatively determined. Small molecules accounted for approximately 5%, PEG-4000 represented 68%, while no sugars or macromolecules were found. Furthermore, YHDP showed no significant differences in terms of daily dosage, compared to YinHuang granules and YinHuang oral liquid; however, it has a higher small molecules content compared to YinHuang lozenge.

  4. Are There Enduring Patents?

    ERIC Educational Resources Information Center

    Noma, Elliot; Olivastro, Dominic

    1985-01-01

    A study comparing citations received by patents in given year to number received in subsequent years found that, even though influential patents remain influential, both highly and infrequently cited patents age at same rate. Distribution of patents by number of citations received is stable over time. (17 references) (EJS)

  5. 77 FR 26016 - Determination of Regulatory Review Period for Purposes of Patent Extension; Alair Bronchial...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-02

    ... Patents and Trademarks, Department of Commerce, for the extension of a patent which claims that medical... dated February 17, 2011, FDA advised the Patent and Trademark Office that this medical device had... Patent Extension; Alair Bronchial Thermoplasty System AGENCY: Food and Drug Administration, HHS....

  6. AR-V7 and prostate cancer: The watershed for treatment selection?

    PubMed

    Ciccarese, Chiara; Santoni, Matteo; Brunelli, Matteo; Buti, Sebastiano; Modena, Alessandra; Nabissi, Massimo; Artibani, Walter; Martignoni, Guido; Montironi, Rodolfo; Tortora, Giampaolo; Massari, Francesco

    2016-02-01

    The androgen receptor (AR) plays a key role in progression to metastatic castration-resistant prostate cancer (mCRPC). Despite the recent progress in targeting persistent AR activity with the next-generation hormonal therapies (abiraterone acetate and enzalutamide), resistance to these agents limits therapeutic efficacy for many patients. Several explanations for response and/or resistance to abiraterone acetate and enzalutamide are emerging, but growing interest is focusing on importance of AR splice variants (AR-Vs) and in particular of AR-V7. Increasing evidences highlight the concept that variant expression could be used as a potential predictive biomarker and a therapeutic target in advanced prostate cancer. Therefore, understanding the mechanisms of treatment resistance or sensitivity can help to achieve a more effective management of mCRPC, increasing clinical outcomes and representing a promising and engaging area of prostate cancer research.

  7. Academic Patents and Access to Medicines in Developing Countries

    PubMed Central

    2009-01-01

    There is a widespread and growing concern that patents hinder access to life-saving drugs in developing countries. Recent student movements and legislative initiatives emphasize the potential role that research universities in developed countries could have in ameliorating this “access gap.” These efforts are based on the assumption that universities own patents on a substantial number of drugs and that patents on these drugs are currently filed in developing countries. I provide empirical evidence regarding these issues and explore the feasibility and desirability of proposals to change university patenting and licensing practices to promote access to medicines in the developing world. PMID:19008514

  8. Decreased expression of ARV1 results in cholesterol retention in the endoplasmic reticulum and abnormal bile acid metabolism.

    PubMed

    Tong, Fumin; Billheimer, Jeffrey; Shechtman, Caryn F; Liu, Ying; Crooke, Roseann; Graham, Mark; Cohen, David E; Sturley, Stephen L; Rader, Daniel J

    2010-10-29

    Endoplasmic reticulum (ER) membrane cholesterol is maintained at an optimal concentration of ∼5 mol % by the net impact of sterol synthesis, modification, and export. Arv1p was first identified in the yeast Saccharomyces cerevisiae as a key component of this homeostasis due to its probable role in intracellular sterol transport. Mammalian ARV1, which can fully complement the yeast lesion, encodes a ubiquitously expressed, resident ER protein. Repeated dosing of specific antisense oligonucleotides to ARV1 produced a marked reduction of ARV1 transcripts in liver, adipose, and to a lesser extent, intestine. This resulted in marked hypercholesterolemia, elevated serum bile acids, and activation of the hepatic farnesoid X receptor (FXR) regulatory pathway. Knockdown of ARV1 in murine liver and HepG2 cells was associated with accumulation of cholesterol in the ER at the expense of the plasma membrane and suppression of sterol regulatory element-binding proteins and their targets. These studies indicate a critical role of mammalian Arv1p in sterol movement from the ER and in the ensuing regulation of hepatic cholesterol and bile acid metabolism.

  9. Decreased Expression of ARV1 Results in Cholesterol Retention in the Endoplasmic Reticulum and Abnormal Bile Acid Metabolism*

    PubMed Central

    Tong, Fumin; Billheimer, Jeffrey; Shechtman, Caryn F.; Liu, Ying; Crooke, Roseann; Graham, Mark; Cohen, David E.; Sturley, Stephen L.; Rader, Daniel J.

    2010-01-01

    Endoplasmic reticulum (ER) membrane cholesterol is maintained at an optimal concentration of ∼5 mol % by the net impact of sterol synthesis, modification, and export. Arv1p was first identified in the yeast Saccharomyces cerevisiae as a key component of this homeostasis due to its probable role in intracellular sterol transport. Mammalian ARV1, which can fully complement the yeast lesion, encodes a ubiquitously expressed, resident ER protein. Repeated dosing of specific antisense oligonucleotides to ARV1 produced a marked reduction of ARV1 transcripts in liver, adipose, and to a lesser extent, intestine. This resulted in marked hypercholesterolemia, elevated serum bile acids, and activation of the hepatic farnesoid X receptor (FXR) regulatory pathway. Knockdown of ARV1 in murine liver and HepG2 cells was associated with accumulation of cholesterol in the ER at the expense of the plasma membrane and suppression of sterol regulatory element-binding proteins and their targets. These studies indicate a critical role of mammalian Arv1p in sterol movement from the ER and in the ensuing regulation of hepatic cholesterol and bile acid metabolism. PMID:20663892

  10. Detection and characterization of two co-infection variant strains of avian orthoreovirus (ARV) in young layer chickens using next-generation sequencing (NGS).

    PubMed

    Tang, Yi; Lin, Lin; Sebastian, Aswathy; Lu, Huaguang

    2016-04-19

    Using next-generation sequencing (NGS) for full genomic characterization studies of the newly emerging avian orthoreovirus (ARV) field strains isolated in Pennsylvania poultry, we identified two co-infection ARV variant strains from one ARV isolate obtained from ARV-affected young layer chickens. The de novo assembly of the ARV reads generated 19 contigs of two different ARV variant strains according to 10 genome segments of each ARV strain. The two variants had the same M2 segment. The complete genomes of each of the two variant strains were 23,493 bp in length, and 10 dsRNA segments ranged from 1192 bp (S4) to 3958 bp (L1), encoding 12 viral proteins. Sequence comparison of nucleotide (nt) and amino acid (aa) sequences of all 10 genome segments revealed 58.1-100% and 51.4-100% aa identity between the two variant strains, and 54.3-89.4% and 49.5-98.1% aa identity between the two variants and classic vaccine strains. Phylogenetic analysis revealed a moderate to significant nt sequence divergence between the two variant and ARV reference strains. These findings have demonstrated the first naturally occurring co-infection of two ARV variants in commercial young layer chickens, providing scientific evidence that multiple ARV strains can be simultaneously present in one host species of chickens.

  11. Detection and characterization of two co-infection variant strains of avian orthoreovirus (ARV) in young layer chickens using next-generation sequencing (NGS)

    PubMed Central

    Tang, Yi; Lin, Lin; Sebastian, Aswathy; Lu, Huaguang

    2016-01-01

    Using next-generation sequencing (NGS) for full genomic characterization studies of the newly emerging avian orthoreovirus (ARV) field strains isolated in Pennsylvania poultry, we identified two co-infection ARV variant strains from one ARV isolate obtained from ARV-affected young layer chickens. The de novo assembly of the ARV reads generated 19 contigs of two different ARV variant strains according to 10 genome segments of each ARV strain. The two variants had the same M2 segment. The complete genomes of each of the two variant strains were 23,493 bp in length, and 10 dsRNA segments ranged from 1192 bp (S4) to 3958 bp (L1), encoding 12 viral proteins. Sequence comparison of nucleotide (nt) and amino acid (aa) sequences of all 10 genome segments revealed 58.1–100% and 51.4–100% aa identity between the two variant strains, and 54.3–89.4% and 49.5–98.1% aa identity between the two variants and classic vaccine strains. Phylogenetic analysis revealed a moderate to significant nt sequence divergence between the two variant and ARV reference strains. These findings have demonstrated the first naturally occurring co-infection of two ARV variants in commercial young layer chickens, providing scientific evidence that multiple ARV strains can be simultaneously present in one host species of chickens. PMID:27089943

  12. Paradoxes in antiretroviral treatment for injecting drug users: access, adherence and structural barriers in Asia and the former Soviet Union.

    PubMed

    Wolfe, Daniel

    2007-08-01

    Offered proper support, injection drug users (IDUs) can achieve the same levels of adherence to and clinical benefit from antiretroviral treatment (ARV) as other patients with HIV. Nonetheless, in countries of Asia and the former Soviet Union where IDUs represent the largest share of HIV cases, IDUs have been disproportionately less likely to receive ARV. While analysis of adherence amongst IDUs has focused on individual patient ability to adhere to medical regimens, HIV treatment systems themselves are in need of examination. Structural impediments to provision of ARV for IDUs include competing, vertical systems of care; compulsory drug treatment and rehabilitation services that often offer neither ARV nor effective treatment for chemical dependence; lack of opiate substitution treatments demonstrated to increase adherence to ARV; and policies that explicitly or implicitly discourage ARV delivery to active IDUs. Labeling active drug users as socially untrustworthy or unproductive, health systems can create a series of paradoxes that ensure confirmation of these stereotypes. Needed reforms include professional education and public campaigns that emphasize IDU capacity for health protection and responsible choice; recognition that the chronic nature of injecting drug use and its links to HIV infection require development of ARV treatment delivery that includes active drug users; and integrated treatment that strengthens links between health providers and builds on, rather than seeks to bypass, IDU social networks and organizations.

  13. How to successfully patent therapeutic antibodies.

    PubMed

    Lahrtz, Fritz

    2015-04-01

    Therapeutic antibodies have become an established class of drugs for the treatment of a variety of diseases, especially cancer and autoimmune/inflammatory disorders, and a sufficient patent protection is a prerequisite for their successful commercialization. As monoclonal antibodies and their therapeutic potential have been well known for decades, the mere production of yet another therapeutic antibody is in many jurisdictions not considered a patentable invention. In contrast, antibodies with novel structural features and/or improved properties may be patentable. When drafting the claims, care should be taken to obtain a broad patent scope that protects both the antibody of interest and related antibodies having the same functional features, thereby preventing competitors from marketing a functionally equivalent antibody. Furthermore, the application should contain experimental evidence showing the improved properties of the claimed antibody. After the filing of a priority patent application, patent protection should be initiated at least in countries that are of particular commercial importance. Subsequent inventions relating to novel uses, formulations, dosage regimens, and combinations with other treatment modalities should be protected by further patent applications to extend patent term. PMID:25614506

  14. How to successfully patent therapeutic antibodies.

    PubMed

    Lahrtz, Fritz

    2015-04-01

    Therapeutic antibodies have become an established class of drugs for the treatment of a variety of diseases, especially cancer and autoimmune/inflammatory disorders, and a sufficient patent protection is a prerequisite for their successful commercialization. As monoclonal antibodies and their therapeutic potential have been well known for decades, the mere production of yet another therapeutic antibody is in many jurisdictions not considered a patentable invention. In contrast, antibodies with novel structural features and/or improved properties may be patentable. When drafting the claims, care should be taken to obtain a broad patent scope that protects both the antibody of interest and related antibodies having the same functional features, thereby preventing competitors from marketing a functionally equivalent antibody. Furthermore, the application should contain experimental evidence showing the improved properties of the claimed antibody. After the filing of a priority patent application, patent protection should be initiated at least in countries that are of particular commercial importance. Subsequent inventions relating to novel uses, formulations, dosage regimens, and combinations with other treatment modalities should be protected by further patent applications to extend patent term.

  15. Modern evaluation of patents

    NASA Astrophysics Data System (ADS)

    Ignat, V.

    2016-08-01

    The number of patents is not so important as the market value. The market value is especially important for licensing of patents, make-or-buy decisions for technology procurement, corporate finance. Patents can be used as collateral for financing. Patents and credit approvals: without patents only 46% and with patents 54%. The value share of knowledge-based components to industrial products already reached 50% and it is still rising. OECD called these developments under the slogan "knowledge economy”. German Norm-DIN 77100 provides a working method for monetary evaluation of a patent. The value of a patent arises from its use. A patent can be used to protect or to earn licensing revenues. An evaluation expertise is required in areas, such as marketing, finance, R & D and strategic planning. As an indicator of the value of a patent is often used the number of citations. The number of a patent citation refers to its meaning and value. Other indicators would be: size of the patent family, validity of the patent, result of objections against patent application, number and quality of claims. The analysis of 9.000 patents resulted that only 7.2% worth over 10 million euro and 68% below 1 million euro. The cost method: it is considered the cost that would be incurred for the development and patenting of a similar invention. The market method: are used the prices that have been achieved in comparable with recently transactions. The Income method: the potential reward is measured, which can arise from a patent. The evaluation will be in the following areas: legal status, technology, market conditions, finance and strategy. Each question relates to a different parameter of a value.

  16. Confocal fluorescence microscopy: An ultra-sensitive tool used to evaluate intracellular antiretroviral nano-drug delivery in HeLa cells

    PubMed Central

    Mandal, Subhra; Zhou, You; Shibata, Annemarie; Destache, Christopher J.

    2015-01-01

    In the last decade, confocal fluorescence microscopy has emerged as an ultra-sensitive tool for real-time study of nanoparticles (NPs) fate at the cellular-level. According to WHO 2007 report, Human Immunodeficiency Virus/Acquired Immunodeficiency Syndrome (HIV/AIDS) is still one of the world’s major health threats by claiming approximately 7,000 new infections daily worldwide. Although combination antiretroviral drugs (cARV) therapy has improved the life-expectancy of HIV-infected patients, routine use of high doses of cARV has serious health consequences and requires complete adherence to the regimen for success. Thus, our research goal is to fabricate long-acting novel cARV loaded poly(lactide-co-glycolic acid) (PLGA) nanoparticles (cARV-NPs) as drug delivery system. However, important aspects of cARV-NPs that require special emphasis are their cellular-uptake, potency, and sustained drug release efficiency over-time. In this article, ultra-sensitive confocal microscopy is been used to evaluate the uptake and sustained drug release kinetics of cARV-NPs in HeLa cells. To evaluate with the above goal, instead of cARV-drug, Rhodamine6G dye (fluorescent dye) loaded NPs (Rho6G NPs) have been formulated. To correlate the Rhodamin6G release kinetics with the ARV release from NPs, a parallel HPLC study was also performed. The results obtained indicate that Rho6G NPs were efficiently taken up at low concentration (<500 ng/ml) and that release was sustained for a minimum of 4 days of treatment. Therefore, high drug assimilation and sustained release properties of PLGA-NPs make them an attractive vehicle for cARV nano-drug delivery with the potential to reduce drug dosage as well as the number of drug administrations per month. PMID:26221566

  17. Confocal fluorescence microscopy: An ultra-sensitive tool used to evaluate intracellular antiretroviral nano-drug delivery in HeLa cells

    NASA Astrophysics Data System (ADS)

    Mandal, Subhra; Zhou, You; Shibata, Annemarie; Destache, Christopher J.

    2015-08-01

    In the last decade, confocal fluorescence microscopy has emerged as an ultra-sensitive tool for real-time study of nanoparticles (NPs) fate at the cellular-level. According to WHO 2007 report, Human Immunodeficiency Virus/Acquired Immunodeficiency Syndrome (HIV/AIDS) is still one of the world's major health threats by claiming approximately 7,000 new infections daily worldwide. Although combination antiretroviral drugs (cARV) therapy has improved the life-expectancy of HIV-infected patients, routine use of high doses of cARV has serious health consequences and requires complete adherence to the regimen for success. Thus, our research goal is to fabricate long-acting novel cARV loaded poly(lactide-co-glycolic acid) (PLGA) nanoparticles (cARV-NPs) as drug delivery system. However, important aspects of cARV-NPs that require special emphasis are their cellular-uptake, potency, and sustained drug release efficiency over-time. In this article, ultra-sensitive confocal microscopy is been used to evaluate the uptake and sustained drug release kinetics of cARV-NPs in HeLa cells. To evaluate with the above goal, instead of cARV-drug, Rhodamine6G dye (fluorescent dye) loaded NPs (Rho6G NPs) have been formulated. To correlate the Rhodamin6G release kinetics with the ARV release from NPs, a parallel HPLC study was also performed. The results obtained indicate that Rho6G NPs were efficiently taken up at low concentration (<500 ng/ml) and that release was sustained for a minimum of 4 days of treatment. Therefore, high drug assimilation and sustained release properties of PLGA-NPs make them an attractive vehicle for cARV nano-drug delivery with the potential to reduce drug dosage as well as the number of drug administrations per month.

  18. 76 FR 15323 - Determination of Regulatory Review Period for Purposes of Patent Extension; ATRYN

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-21

    ... Patent Extension; ATRYN AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and... extension of a patent which claims that human biological product. ADDRESSES: Submit electronic comments to... 20993-0002. 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  19. 77 FR 26017 - Determination of Regulatory Review Period for Purposes of Patent Extension; KALBITOR

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-02

    ... Patent Extension; KALBITOR AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... the extension of a patent which claims that human biological product. ADDRESSES: Submit electronic..., MD 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent...

  20. Development of AR-V7 as a putative treatment selection marker for metastatic castration-resistant prostate cancer

    PubMed Central

    Luo, Jun

    2016-01-01

    Prostate cancer cells demonstrate a remarkable “addiction” to androgen receptor (AR) signaling in all stages of disease progression. As such, suppression of AR signaling remains the therapeutic goal in systemic treatment of prostate cancer. A number of molecular alterations arise in patients treated with AR-directed therapies. These molecular alterations may indicate the emergence of treatment resistance and may be targeted for the development of novel agents for prostate cancer. The presence of functional androgen receptor splice variants may represent a potential explanation for resistance to abiraterone and enzalutamide, newer AR-directed agents developed to treat metastatic castration-resistant prostate cancer (mCRPC). In the last 8 years, many androgen receptor splice variants have been identified and characterized. Among these, androgen receptor splice variant-7 (AR-V7) has been investigated extensively. In AR-V7, the entire COOH-terminal ligand-binding domain of the canonical AR is truncated and replaced with a variant-specific peptide of 16 amino acids. Functionally, AR-V7 is capable of mediating constitutive nuclear localization and androgen receptor signaling in the absence of androgens, or in the presence of enzalutamide. In this review, we will focus on clinical translational studies involving detection/measurement of AR-V7. Methods have been developed to detect AR-V7 in clinical mCRPC specimens. AR-V7 can be reliably measured in both tissue and circulating tumor cells derived from mCRPC patients, making it possible to conduct both cross-sectional and longitudinal clinical correlative studies. Current evidence derived from studies focusing on detection of AR-V7 in mCRPC support its potential clinical utility as a treatment selection marker. PMID:27174161

  1. Development of AR-V7 as a putative treatment selection marker for metastatic castration-resistant prostate cancer.

    PubMed

    Luo, Jun

    2016-01-01

    Prostate cancer cells demonstrate a remarkable "addiction" to androgen receptor (AR) signaling in all stages of disease progression. As such, suppression of AR signaling remains the therapeutic goal in systemic treatment of prostate cancer. A number of molecular alterations arise in patients treated with AR-directed therapies. These molecular alterations may indicate the emergence of treatment resistance and may be targeted for the development of novel agents for prostate cancer. The presence of functional androgen receptor splice variants may represent a potential explanation for resistance to abiraterone and enzalutamide, newer AR-directed agents developed to treat metastatic castration-resistant prostate cancer (mCRPC). In the last 8 years, many androgen receptor splice variants have been identified and characterized. Among these, androgen receptor splice variant-7 (AR-V7) has been investigated extensively. In AR-V7, the entire COOH-terminal ligand-binding domain of the canonical AR is truncated and replaced with a variant-specific peptide of 16 amino acids. Functionally, AR-V7 is capable of mediating constitutive nuclear localization and androgen receptor signaling in the absence of androgens, or in the presence of enzalutamide. In this review, we will focus on clinical translational studies involving detection/measurement of AR-V7. Methods have been developed to detect AR-V7 in clinical mCRPC specimens. AR-V7 can be reliably measured in both tissue and circulating tumor cells derived from mCRPC patients, making it possible to conduct both cross-sectional and longitudinal clinical correlative studies. Current evidence derived from studies focusing on detection of AR-V7 in mCRPC support its potential clinical utility as a treatment selection marker.

  2. Universities That Litigate Patents

    ERIC Educational Resources Information Center

    Rooksby, Jacob H.

    2012-01-01

    American research universities frequently obtain and license patents to their faculty members' inventions. While university licensing is carefully tracked and thoroughly studied, little is known about university decisions to assertively litigate their patents through filing patent infringement lawsuits in federal court. Which universities…

  3. Challenges in oral drug delivery of antiretrovirals and the innovative strategies to overcome them.

    PubMed

    Sosnik, Alejandro; Augustine, Robin

    2016-08-01

    Development of novel drug delivery systems (DDS) represents a promising opportunity to overcome the various bottlenecks associated with the chronic antiretroviral (ARV) therapy of the human immunodeficiency virus (HIV) infection. Oral drug delivery is the most convenient and simplest route of drug administration that involves the swallowing of a pharmaceutical compound with the intention of releasing it into the gastrointestinal tract. In oral delivery, drugs can be formulated in such a way that they are protected from digestive enzymes, acids, etc. and released in different regions of the small intestine and/or the colon. Not surprisingly, with the exception of the subcutaneous enfuvirtide, all the marketed ARVs are administered orally. However, conventional (marketed) and innovative (under investigation) oral delivery systems must overcome numerous challenges, including the acidic gastric environment, and the poor aqueous solubility and physicochemical instability of many of the approved ARVs. In addition, the mucus barrier can prevent penetration and subsequent absorption of the released drug, a phenomenon that leads to lower oral bioavailability and therapeutic concentration in plasma. Moreover, the frequent administration of the cocktail (ARVs are administered at least once a day) favors treatment interruption. To improve the oral performance of ARVs, the design and development of more efficient oral drug delivery systems are called for. The present review highlights various innovative research strategies adopted to overcome the limitations of the present treatment regimens and to enhance the efficacy of the oral ARV therapy in HIV.

  4. The Advanced Re-Entry Vehicle (ARV) a Development Step from ATV Toward Manned Transportation Systems

    NASA Astrophysics Data System (ADS)

    Bottacini, M.; Berthe, P.; Vo, X.; Pietsch, K.

    2011-08-01

    The Advanced Re-entry Vehicle (ARV) programme has been undertaken by Europe with the objective to contribute to the preparation of a future European crew transportation system, while providing a valuable logistic support to the ISS through an operational cargo return system. This development would allow: - the early acquisition of critical technologies; - the design, development and testing of elements suitable for the follow up human rated transportation system. These vehicles should also serve future LEO infrastructures and exploration missions. With the aim to satisfy the above objectives a team composed by major European industries and led by EADS Astrium Space Transportation is currently conducting the phase A of the programme under contract with the European Space Agency (ESA). Two vehicle versions are being investigated: a Cargo version, transporting cargo only to/from the ISS, and a Crew version, which will allow the transfer of both crew and cargo to/from the ISS. The ARV Cargo version, in its present configuration, is composed of three modules. The Versatile Service Module (VSM) provides to the system the propulsion/GNC for orbital manoeuvres and attitude control and the orbital power generation. Its propulsion system and GNC shall be robust enough to allow its use for different launch stacks and different LEO missions in the future. The Un-pressurised Cargo Module (UCM) provides the accommodation for about 3000 kg of un-pressurised cargo and is to be sufficiently flexible to ensure the transportation of: - orbital infrastructure components (ORU's); - scientific / technological experiments; - propellant for re-fuelling, re-boost (and deorbiting) of the ISS. The Re-entry Module (RM) provides a pressurized volume to accommodate active/passive cargo (2000 kg upload/1500 kg download). It is conceived as an expendable conical capsule with spherical heat- hield, interfacing with the new docking standard of the ISS, i.e. it carries the IBDM docking system, on a

  5. The Advanced Re-Entry Vehicle (ARV) A Development Step From ATV Toward Manned Transportation Systems

    NASA Astrophysics Data System (ADS)

    Bottacini, Massimiliano; Berthe, Philippe; Vo, Xavier; Pietsch, Klaus

    2011-05-01

    The Advanced Re-entry Vehicle (ARV) programme has been undertaken by Europe with the objective to contribute to the preparation of a future European crew transportation system, while providing a valuable logistic support to the ISS through an operational cargo return system. This development would allow: - the early acquisition of critical technologies; - the design, development and testing of elements suitable for the follow up human rated transportation system. These vehicles should also serve future LEO infrastructures and exploration missions. With the aim to satisfy the above objectives a team composed by major European industries and led by EADS Astrium Space Transportation is currently conducting the phase A of the programme under contract with the European Space Agency (ESA). Two vehicle versions are being investigated: a Cargo version, transporting cargo only to/from the ISS, and a Crew version, which will allow the transfer of both crew and cargo to/from the ISS. The ARV Cargo version, in its present configuration, is composed of three modules. The Versatile Service Module (VSM) provides to the system the propulsion/GNC for orbital manoeuvres and attitude control and the orbital power generation. Its propulsion system and GNC shall be robust enough to allow its use for different launch stacks and different LEO missions in the future. The Un-pressurised Cargo Module (UCM) provides the accommodation for about 3000 kg of unpressurised cargo and is to be sufficiently flexible to ensure the transportation of: - orbital infrastructure components (ORU’s); - scientific / technological experiments; - propellant for re-fuelling, re-boost (and de-orbiting) of the ISS. The Re-entry Module (RM) provides a pressurized volume to accommodate active/passive cargo (2000 kg upload/1500 kg download). It is conceived as an expendable conical capsule with spherical heat-shield, interfacing with the new docking standard of the ISS, i.e. it carries the IBDM docking system, on

  6. 75 FR 17415 - Determination of Regulatory Review Period for Purposes of Patent Extension; FANAPT

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-06

    ... human drug product FANAPT (iloperidone). FANAPT is indicated for the acute treatment of schizophrenia in adults. Subsequent to this approval, the Patent and Trademark Office received a patent term...

  7. India: New patent law may restrict access to HIV/AIDS treatments.

    PubMed

    Cruess, Gord

    2005-08-01

    On 4 April 2005, India's Patents (Amendment) Act, 2005 (the Act) received presidential assent. The Act, which represents a major shift in Indian patent policy, raises serious concerns that the supply of generic drugs to developing countries could decline.

  8. Evergreening by whom? A review of secondary patents for omeprazole.

    PubMed

    Lloyd, Mike

    2013-11-01

    Evergreening, or the practice of technology developers to retain legal protection over valuable drugs beyond the normal patent term, is a well known practice by originators of successful drugs. Generic competitors also attempt similar strategies for commercial reasons. In this paper we look at secondary US and European patents in relation to the 'blockbuster' drug omeprazole (e.g., Prilosec® by AstraZeneca among other brands), with these secondary patents selected because they refer to the 'omeprazole' in either the title, abstract, Derwent Title or first claim. We find that 485 patents meet this criteria, with only 29% owned by the drugs originator (or known subsidiaries or predecessors). AstraZeneca was also the leading applicant by a number of measures, including grant ratio, number of patents filed, forward citation count, family member count and claim breadth.

  9. Patent indicators: a window to pharmaceutical market success.

    PubMed

    Guo, Yang; Hu, Yuanjia; Zheng, Mingli; Wang, Yitao

    2013-07-01

    Pharmaceutical success in the market is the best reward for pharmaceutical investors undergoing the lengthy, costly and risky process of pharmaceutical Research and Development (R&D). Drugs with high market revenues trigger fierce competition between pharmaceutical enterprises, as is demonstrated by the increasing Mergers & Acquisitions (M&A) cases focusing on seizing the best-selling products. On the other hand, patents, as the best shield for innovative drugs against generic drugs, become a powerful weapon for pharmaceutical enterprises to win the substantial returns generated by market exclusivity. Patents seem to be directly responsible for the commercial success of new medicines. In this context, it is of great significance to find out the empirical associations between pharmaceutical commercial success and patents. By comprehensively analysing 127 drugs marketed in the USA and their 621 American patents, this article identifies the evidence to link various patent indicators with pharmaceutical sales in actual market.

  10. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Identification of patent, patent application, or patent-related proceeding. 1.5 Section 1.5 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN...

  11. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Identification of patent, patent application, or patent-related proceeding. 1.5 Section 1.5 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN...

  12. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Identification of patent, patent application, or patent-related proceeding. 1.5 Section 1.5 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN...

  13. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Identification of patent, patent application, or patent-related proceeding. 1.5 Section 1.5 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN...

  14. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Identification of patent, patent application, or patent-related proceeding. 1.5 Section 1.5 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN...

  15. Regulation and the circulation of knowledge: penicillin patents in Spain.

    PubMed

    Romero de Pablos, Ana

    2011-01-01

    This paper tells the early history of penicillin patenting in Spain. Patents turn out to be useful instruments for analysing the management of knowledge and its circulation in different professional and geographical domains. They protected knowledge while contributing to standardisation. Patents also ensured quality and guaranteed reliability in manufacturing, delivering and prescribing new drugs. They gained special prominence by allowing the creation of a network in which political, economic and business, industrial power, public health and international cooperation fields came together. The main source of information used for this purpose has been the earliest patent applications for penicillin in Spain between 1948 and 1950, which are kept in the Historical Archives of the Oficina Española de Patentes y Marcas. The study of these patents for penicillin shows their role as agents in introducing this drug in Spain. PMID:22332464

  16. Clearing the fog: patenting trends for the treatment of Alzheimer's disease.

    PubMed

    Lloyd, Mike; Mokdsi, George; Spielthenner, Doris

    2012-09-01

    This article asks, "What can Network Patent Analysis™ (NPA) tell us about developments in the treatment of this serious condition?" Patents filed for the treatment of Alzheimer's disease have been analyzed by NPA. NPA is an unique patent analysis method that maps the 'collective intelligence' of the patent applicants to group and rank patents, technologies and patent applicants. A search for Alzheimer's disease patents identified approximately 24,000 patents, to which we added 24,000 citationally connected patents. NPA identified the leading 2,153 patents in the combined 48,000 patents and grouped most of these 2153 patents into 23 subject clusters. The 23 clusters of patents fall into two major groupings: drugs targeted to the β-amyloid protein ('amyloid grouping'); and drugs targeted to the Tau/serotonin and other alternative pathways ('Tau grouping'). Filing activity for the 2153 strongest patents peaked between the year 2000 and 2005. This, along with the broad range of subject matter in the patent clusters, suggests that Alzheimer's disease treatments are still undergoing strong development.

  17. Clearing the fog: patenting trends for the treatment of Alzheimer's disease.

    PubMed

    Lloyd, Mike; Mokdsi, George; Spielthenner, Doris

    2012-09-01

    This article asks, "What can Network Patent Analysis™ (NPA) tell us about developments in the treatment of this serious condition?" Patents filed for the treatment of Alzheimer's disease have been analyzed by NPA. NPA is an unique patent analysis method that maps the 'collective intelligence' of the patent applicants to group and rank patents, technologies and patent applicants. A search for Alzheimer's disease patents identified approximately 24,000 patents, to which we added 24,000 citationally connected patents. NPA identified the leading 2,153 patents in the combined 48,000 patents and grouped most of these 2153 patents into 23 subject clusters. The 23 clusters of patents fall into two major groupings: drugs targeted to the β-amyloid protein ('amyloid grouping'); and drugs targeted to the Tau/serotonin and other alternative pathways ('Tau grouping'). Filing activity for the 2153 strongest patents peaked between the year 2000 and 2005. This, along with the broad range of subject matter in the patent clusters, suggests that Alzheimer's disease treatments are still undergoing strong development. PMID:24236882

  18. Patent Deployment Strategies and Patent Value in LED Industry

    PubMed Central

    Wu, Ming-Fu; Chang, Keng-Wei; Zhou, Wei; Hao, Juan; Yuan, Chien-Chung; Chang, Ke-Chiun

    2015-01-01

    This study applies two variables in the measurement of company patent deployment strategies: patent family depth and earn plan ratio. Patent family depth represents the degree to which certain fields and markets are valued by the patent owner. Earn plan ratio defined as the ratio of the number of patent forward citations to patent family size. Earn plan ratio indicates the degree to which a patent family could be cited by later innovators and competitors. This study applies a logistic regression model in the analysis LED industry data. The results demonstrate that patent value has a positive relationship with the patent family depth, and earn plan ratio. PMID:26098313

  19. Patent Deployment Strategies and Patent Value in LED Industry.

    PubMed

    Wu, Ming-Fu; Chang, Keng-Wei; Zhou, Wei; Hao, Juan; Yuan, Chien-Chung; Chang, Ke-Chiun

    2015-01-01

    This study applies two variables in the measurement of company patent deployment strategies: patent family depth and earn plan ratio. Patent family depth represents the degree to which certain fields and markets are valued by the patent owner. Earn plan ratio defined as the ratio of the number of patent forward citations to patent family size. Earn plan ratio indicates the degree to which a patent family could be cited by later innovators and competitors. This study applies a logistic regression model in the analysis LED industry data. The results demonstrate that patent value has a positive relationship with the patent family depth, and earn plan ratio.

  20. Patent Deployment Strategies and Patent Value in LED Industry.

    PubMed

    Wu, Ming-Fu; Chang, Keng-Wei; Zhou, Wei; Hao, Juan; Yuan, Chien-Chung; Chang, Ke-Chiun

    2015-01-01

    This study applies two variables in the measurement of company patent deployment strategies: patent family depth and earn plan ratio. Patent family depth represents the degree to which certain fields and markets are valued by the patent owner. Earn plan ratio defined as the ratio of the number of patent forward citations to patent family size. Earn plan ratio indicates the degree to which a patent family could be cited by later innovators and competitors. This study applies a logistic regression model in the analysis LED industry data. The results demonstrate that patent value has a positive relationship with the patent family depth, and earn plan ratio. PMID:26098313

  1. Nanofiber patent landscape.

    PubMed

    Ngiam, Michelle; Ramakrishna, Seeram; Raghunath, Michael; Chan, Casey K

    2007-01-01

    Despite the large number of publications in peer review literature in the field of nanofibers, there is still uncertainty as to what aspects of these research results have commercial applications. In an effort to better understand the technological progress made in the field of nanofibers, we surveyed the patents issued in the United States from 1976 up to end 2006. The present review will provide an overall view of the current patent landscape including trends and key applications. Key assignees and key inventors were identified and their contributions were discussed. Patents were identified using keywords such as nanofibers, ultrafine, and electrospinning. After patents were downloaded, we reviewed each patent for relevancy and identified 100 patents to be related to nanofibers. 75% of the current issued patents on nanofibers are directed at either fabrication methods or the use of nanofibers in filtration systems. The patent data indicates that medical applications and medical products using nanofibers appear to be the emerging application for nanofibers. We anticipate a growing number of patents on novel applications for nanofiber would originate from academic centers in the future.

  2. Androgen receptor and its splice variant, AR-V7, differentially regulate FOXA1 sensitive genes in LNCaP prostate cancer cells.

    PubMed

    Krause, William C; Shafi, Ayesha A; Nakka, Manjula; Weigel, Nancy L

    2014-09-01

    Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation.

  3. Is Patent “Evergreening” Restricting Access to Medicine/Device Combination Products?

    PubMed Central

    Beall, Reed F.; Nickerson, Jason W.; Kaplan, Warren A.; Attaran, Amir

    2016-01-01

    Background Not all new drug products are truly new. Some are the result of marginal innovation and incremental patenting of existing products, but in such a way that confers no major therapeutic improvement. This phenomenon, pejoratively known as “evergreening”, can allow manufacturers to preserve market exclusivity, but without significantly bettering the standard of care. Other studies speculate that evergreening is especially problematic for medicine/device combination products, because patents on the device component may outlast expired patents on the medicine component, and thereby keep competing, possibly less-expensive generic products off the market. Materials and Methods We focused on four common conditions that are often treated by medicine/device product combinations: asthma and chronic obstructive pulmonary disease (COPD), diabetes, and severe allergic reactions. The patent data for a sample of such products (n = 49) for treating these conditions was extracted from the United States Food and Drug Administration’s Orange Book. Additional patent-related data (abstracts, claims, etc) were retrieved using LexisNexis TotalPatent. Comparisons were then made between each product’s device patents and medicine patents. Results Unexpired device patents exist for 90 percent of the 49 medicine/device product combinations studied, and were the only sort of unexpired patent for 14 products. Overall, 55 percent of the 235 patents found by our study were device patents. Comparing the last-to-expire device patent to that of the last-to-expire active ingredient patent, the median additional years of patent protection afforded by device patents was 4.7 years (range: 1.3–15.2 years). Conclusion Incremental, patentable innovation in devices to extend the overall patent protection of medicine/device product combinations is very common. Whether this constitutes “evergreening” depends on whether these incremental innovations and the years of extra patent

  4. An empirical analysis of primary and secondary pharmaceutical patents in Chile.

    PubMed

    Abud, María José; Hall, Bronwyn; Helmers, Christian

    2015-01-01

    We analyze the patent filing strategies of foreign pharmaceutical companies in Chile distinguishing between "primary" (active ingredient) and "secondary" patents (patents on modified compounds, formulations, dosages, particular medical uses, etc.). There is prior evidence that secondary patents are used by pharmaceutical originator companies in the U.S. and Europe to extend patent protection on drugs in length and breadth. Using a novel dataset that comprises all drugs registered in Chile between 1991 and 2010 as well as the corresponding patents and trademarks, we find evidence that foreign originator companies pursue similar strategies in Chile. We find a primary to secondary patents ratio of 1:4 at the drug-level, which is comparable to the available evidence for Europe; most secondary patents are filed over several years following the original primary patent and after the protected active ingredient has obtained market approval in Chile. This points toward effective patent term extensions through secondary patents. Secondary patents dominate "older" therapeutic classes like anti-ulcer and anti-depressants. In contrast, newer areas like anti-virals and anti-neoplastics (anti-cancer) have a much larger share of primary patents. PMID:25915050

  5. An empirical analysis of primary and secondary pharmaceutical patents in Chile.

    PubMed

    Abud, María José; Hall, Bronwyn; Helmers, Christian

    2015-01-01

    We analyze the patent filing strategies of foreign pharmaceutical companies in Chile distinguishing between "primary" (active ingredient) and "secondary" patents (patents on modified compounds, formulations, dosages, particular medical uses, etc.). There is prior evidence that secondary patents are used by pharmaceutical originator companies in the U.S. and Europe to extend patent protection on drugs in length and breadth. Using a novel dataset that comprises all drugs registered in Chile between 1991 and 2010 as well as the corresponding patents and trademarks, we find evidence that foreign originator companies pursue similar strategies in Chile. We find a primary to secondary patents ratio of 1:4 at the drug-level, which is comparable to the available evidence for Europe; most secondary patents are filed over several years following the original primary patent and after the protected active ingredient has obtained market approval in Chile. This points toward effective patent term extensions through secondary patents. Secondary patents dominate "older" therapeutic classes like anti-ulcer and anti-depressants. In contrast, newer areas like anti-virals and anti-neoplastics (anti-cancer) have a much larger share of primary patents.

  6. An Empirical Analysis of Primary and Secondary Pharmaceutical Patents in Chile

    PubMed Central

    Abud, María José; Hall, Bronwyn; Helmers, Christian

    2015-01-01

    We analyze the patent filing strategies of foreign pharmaceutical companies in Chile distinguishing between “primary” (active ingredient) and “secondary” patents (patents on modified compounds, formulations, dosages, particular medical uses, etc.). There is prior evidence that secondary patents are used by pharmaceutical originator companies in the U.S. and Europe to extend patent protection on drugs in length and breadth. Using a novel dataset that comprises all drugs registered in Chile between 1991 and 2010 as well as the corresponding patents and trademarks, we find evidence that foreign originator companies pursue similar strategies in Chile. We find a primary to secondary patents ratio of 1:4 at the drug-level, which is comparable to the available evidence for Europe; most secondary patents are filed over several years following the original primary patent and after the protected active ingredient has obtained market approval in Chile. This points toward effective patent term extensions through secondary patents. Secondary patents dominate “older” therapeutic classes like anti-ulcer and anti-depressants. In contrast, newer areas like anti-virals and anti-neoplastics (anti-cancer) have a much larger share of primary patents. PMID:25915050

  7. What Is Patent Ductus Arteriosus?

    MedlinePlus

    ... page from the NHLBI on Twitter. What Is Patent Ductus Arteriosus? Patent ductus arteriosus (PDA) is a ... the lung arteries. Normal Heart and Heart With Patent Ductus Arteriosus Figure A shows the interior of ...

  8. Trends in nanotechnology patents applied to the health sector.

    PubMed

    Antunes, Adelaide Maria de Souza; Alencar, Maria Simone de Menezes; da Silva, Cicera Henrique; Nunes, Jeziel; Mendes, Flavia Maria Lins

    2012-01-01

    The aim of the article is to present a method for identifying trends in patent applications for nanotechnology applied to the health sector around the world, based on the International Patent Classification. This classification divides the sector into: dental care, drugs, diagnostic kits, and medical apparatus & medical care. The Derwent database was mined for patent documents using nanotechnology terms associated with the IPC subclasses from the health subsectors. The number of patents was found to be rising, led by the United States, particularly universities and R centers. In the dental care subsector, nanotechnology was found to be used in composite material for manufacturing dental appliances. In drugs, the focus is on the use of nanoparticulate compositions comprising agents that are useful for a variety of diseases. In diagnostic kits, nanostructures have been patented that are capable of detecting target analytes. Meanwhile, in medical apparatus & medical care, patent applications have been made for nanocapsules and/or nanocomposite materials inserted in devices and guide catheters. A study was also made of patents in Brazil, where the same assignees and the same country (United States) as in the survey of global patents were found to be the leading patent applicants / holders.

  9. 75 FR 77878 - Determination of Regulatory Review Period for Purposes of Patent Extension; FREESTYLE NAVIGATOR

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-14

    ... HUMAN SERVICES Food and Drug Administration Determination of Regulatory Review Period for Purposes of Patent Extension; FREESTYLE NAVIGATOR AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) has determined the regulatory review period for...

  10. Ownership of knowledge--the role of patents in pharmaceutical R&D.

    PubMed Central

    Correa, Carlos María

    2004-01-01

    Both the public and the private sectors contribute to research and development (R&D) in pharmaceuticals. The public sector originates many of the discoveries of new drugs. The private sector, which focuses on development, is heavily reliant on patents. Though patents are presumed to reward genuine inventions, lax rules on patentability and shortcomings in procedures permit protection to be obtained on a myriad of minor developments. These patents, though weak and possibly invalid in many cases, are used to restrain competition and delay the entry of generic competition. Developing countries should design and implement their patent laws so as to prevent strategic patenting and promote competition and access to medicines. PMID:15643801

  11. Antiretroviral drug supply challenges in the era of scaling up ART in Malawi.

    PubMed

    Schouten, Erik J; Jahn, Andreas; Ben-Smith, Anne; Makombe, Simon D; Harries, Anthony D; Aboagye-Nyame, Francis; Chimbwandira, Frank

    2011-01-01

    The number of people receiving antiretroviral treatment (ART) has increased considerably in recent years and is expected to continue to grow in the coming years. A major challenge is to maintain uninterrupted supplies of antiretroviral (ARV) drugs and prevent stock outs. This article discusses issues around the management of ARVs and prevention of stock outs in Malawi, a low-income country with a high HIV/AIDS burden, and a weak procurement and supply chain management system. This system for ARVs, paid for by the Global Fund to Fight AIDS, Tuberculosis and Malaria, and bypassing the government Central Medical Stores, is in place, using the United Nations Children's Fund's (UNICEF's) procurement services. The system, managed by a handful of people who spend limited time on supply management, is characterized by a centrally coordinated quantification based on verified data from all national ART clinics, parallel procurement through UNICEF, and direct distribution to ART clinics. The model worked well in the first years of the ART programme with a single first-line ARV regimen, but with more regimens becoming available (e.g., alternative first-line, second-line and paediatric regimens), it has become more difficult to administer. Managing supplies through a parallel system has the advantage that weaknesses in the national system have limited influence on the ARV procurement and supply chain management system. However, as the current system operates without a central warehouse and national buffer stock capacity, it diminishes the ability to prevent ARV stock outs. The process of ordering ARVs, from the time that estimates are made to the arrival of supplies in health facilities, takes approximately one year. Addressing the challenges involved in maintaining ARVs through an efficient procurement and supply chain management system that prevents ARV stock outs through the establishment of a dedicated procurement team, a central warehouse and/or national buffer stock is a

  12. Antiretroviral drug supply challenges in the era of scaling up ART in Malawi.

    PubMed

    Schouten, Erik J; Jahn, Andreas; Ben-Smith, Anne; Makombe, Simon D; Harries, Anthony D; Aboagye-Nyame, Francis; Chimbwandira, Frank

    2011-07-06

    The number of people receiving antiretroviral treatment (ART) has increased considerably in recent years and is expected to continue to grow in the coming years. A major challenge is to maintain uninterrupted supplies of antiretroviral (ARV) drugs and prevent stock outs. This article discusses issues around the management of ARVs and prevention of stock outs in Malawi, a low-income country with a high HIV/AIDS burden, and a weak procurement and supply chain management system. This system for ARVs, paid for by the Global Fund to Fight AIDS, Tuberculosis and Malaria, and bypassing the government Central Medical Stores, is in place, using the United Nations Children's Fund's (UNICEF's) procurement services. The system, managed by a handful of people who spend limited time on supply management, is characterized by a centrally coordinated quantification based on verified data from all national ART clinics, parallel procurement through UNICEF, and direct distribution to ART clinics. The model worked well in the first years of the ART programme with a single first-line ARV regimen, but with more regimens becoming available (e.g., alternative first-line, second-line and paediatric regimens), it has become more difficult to administer. Managing supplies through a parallel system has the advantage that weaknesses in the national system have limited influence on the ARV procurement and supply chain management system. However, as the current system operates without a central warehouse and national buffer stock capacity, it diminishes the ability to prevent ARV stock outs. The process of ordering ARVs, from the time that estimates are made to the arrival of supplies in health facilities, takes approximately one year. Addressing the challenges involved in maintaining ARVs through an efficient procurement and supply chain management system that prevents ARV stock outs through the establishment of a dedicated procurement team, a central warehouse and/or national buffer stock is a

  13. Environmentally conscious patent histories

    NASA Astrophysics Data System (ADS)

    Crouch, Dennis D.; Crouch, Henry L.

    2004-02-01

    There is a need for investigators, legislators, and business leaders to understand the magnitude of innovation and discovery in the field of environmentally conscious technologies (ECTs). Knowledge of the "big picture" is important to providing a national and global account of actual environmental stewardship over the last twenty-five years. A recitation of the Environmental Protection Agency (EPA) supported Acts which have been enacted into law reveals one facet of the multifaceted dynamic of environmental consciousness. The popular discussion and debate, as well as partisan lobbying, which created the political forces leading to environmentally conscious legislation is another facet. A third facet is the corporate response to the threats and opportunities predicted by CEO"s and others through environmental scanning. This paper examines changes in environmentally conscious inventive effort by comparing data from United States Patents issued from 1976 through 2003. Patents are useful tool for measuring technological innovation because they are publicly available records of innovative activity. Although not all inventions result in patent applications, the monopoly rights granted on the invention give the inventor a strong incentive to obtain patents on any viable product or process. Among the results, we found a significant increase in patents relating to environmentally conscious products and processes during the period in question. Specifically, a dramatic increase in patent activity was seen for the decade of the 1990"s. Surprisingly, the patenting rate from 2000 to 2003 seems to have stabilized. Additionally public discussion of ECTs appears to have a positive impact on patent filings.

  14. A Patent Dilemma

    ERIC Educational Resources Information Center

    Downes, Stephen

    2007-01-01

    When Blackboard unveiled its U.S. patent for 44 features of learning management systems and then filed a patent infringement suit against Design2Learn, the response of the educational technology community was negative and swift. Stephen Downes discusses why many educators oppose Blackboard's proprietary claims to technologies long considered in…

  15. Problem Solving with Patents

    ERIC Educational Resources Information Center

    Moore, Jerilou; Sumrall, William J.

    2008-01-01

    Exploring our patent system is a great way to engage students in creative problem solving. As a result, the authors designed a teaching unit that uses the study of patents to explore one avenue in which scientists and engineers do science. Specifically, through the development of an idea, students learn how science and technology are connected.…

  16. 77 FR 26290 - Determination of Regulatory Review Period for Purposes of Patent Extension; KRYSTEXXA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-03

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  17. 77 FR 26291 - Determination of Regulatory Review Period for Purposes of Patent Extension; LASTACAFT

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-03

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  18. 76 FR 35899 - Determination of Regulatory Review Period for Purposes of Patent Extension; MYFORTIC

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-20

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  19. 77 FR 20644 - Determination of Regulatory Review Period for Purposes of Patent Extension; FLECTOR

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  20. 78 FR 13685 - Determination of Regulatory Review Period for Purposes of Patent Extension; LAVIV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-28

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  1. 77 FR 34388 - Determination of Regulatory Review Period for Purposes of Patent Extension; CYSVIEW (Previously...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-11

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  2. 77 FR 52035 - Determination of Regulatory Review Period for Purposes of Patent Extension; TORISEL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-28

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  3. 77 FR 26289 - Determination of Regulatory Review Period for Purposes of Patent Extension; PRADAXA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-03

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  4. 75 FR 76740 - Determination of Regulatory Review Period for Purposes of Patent Extension; BEPREVE

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-09

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  5. 75 FR 79381 - Determination of Regulatory Review Period for Purposes of Patent Extension; FOLOTYN

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  6. 76 FR 25357 - Determination of Regulatory Review Period for Purposes of Patent Extension; VOTRIENT

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-04

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  7. 75 FR 53314 - Determination of Regulatory Review Period for Purposes of Patent Extension; PRISTIQ

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-31

    ... Restoration Act of 1984 (Public Law 98-417) and the Generic Animal Drug and Patent Term Restoration Act... as the patented item (human drug product, animal drug product, medical device, food additive, or... applicant may receive. A regulatory review period consists of two periods of time: A testing phase and...

  8. 75 FR 76739 - Determination of Regulatory Review Period for Purposes of Patent Extension; ILARIS

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-09

    ... Restoration Act of 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L... patented item (human drug product, animal drug product, medical device, food additive, or color additive... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  9. Searching bioremediation patents through Cooperative Patent Classification (CPC).

    PubMed

    Prasad, Rajendra

    2016-03-01

    Patent classification systems have traditionally evolved independently at each patent jurisdiction to classify patents handled by their examiners to be able to search previous patents while dealing with new patent applications. As patent databases maintained by them went online for free access to public as also for global search of prior art by examiners, the need arose for a common platform and uniform structure of patent databases. The diversity of different classification, however, posed problems of integrating and searching relevant patents across patent jurisdictions. To address this problem of comparability of data from different sources and searching patents, WIPO in the recent past developed what is known as International Patent Classification (IPC) system which most countries readily adopted to code their patents with IPC codes along with their own codes. The Cooperative Patent Classification (CPC) is the latest patent classification system based on IPC/European Classification (ECLA) system, developed by the European Patent Office (EPO) and the United States Patent and Trademark Office (USPTO) which is likely to become a global standard. This paper discusses this new classification system with reference to patents on bioremediation.

  10. Searching bioremediation patents through Cooperative Patent Classification (CPC).

    PubMed

    Prasad, Rajendra

    2016-03-01

    Patent classification systems have traditionally evolved independently at each patent jurisdiction to classify patents handled by their examiners to be able to search previous patents while dealing with new patent applications. As patent databases maintained by them went online for free access to public as also for global search of prior art by examiners, the need arose for a common platform and uniform structure of patent databases. The diversity of different classification, however, posed problems of integrating and searching relevant patents across patent jurisdictions. To address this problem of comparability of data from different sources and searching patents, WIPO in the recent past developed what is known as International Patent Classification (IPC) system which most countries readily adopted to code their patents with IPC codes along with their own codes. The Cooperative Patent Classification (CPC) is the latest patent classification system based on IPC/European Classification (ECLA) system, developed by the European Patent Office (EPO) and the United States Patent and Trademark Office (USPTO) which is likely to become a global standard. This paper discusses this new classification system with reference to patents on bioremediation. PMID:26812756

  11. HIV Drug Resistance-Associated Mutations in Antiretroviral Naïve HIV-1-Infected Latin American Children

    PubMed Central

    Soto-Ramirez, Luis E.; Rodriguez-Diaz, Roberto; Harris, D. Robert; Hazra, Rohan

    2010-01-01

    Our goal was to describe the presence of HIV drug resistance among HIV-1-infected, antiretroviral (ARV) naïve children and adolescents in Latin America and to examine resistance in these children in relation to drug exposure in the mother. Genotyping was performed on plasma samples obtained at baseline from HIV-1-infected participants in a prospective cohort study in Brazil, Argentina, and Mexico (NISDI Pediatric Study). Of 713 HIV-infected children enrolled, 69 were ARV naïve and eligible for the analysis. At enrollment, mean age was 7.3 years; 81.2% were infected with HIV perinatally. Drug resistance mutations (DRMs) were detected in 6 (8.7%; 95% confidence interval 3.1–18.2%) ARV-naïve subjects; none of the mothers of these 6 received ARVs during their pregnancies and none of the children received ARV prophylaxis. Reverse transcriptase mutations K70R and K70E were detected in 3 and 2 subjects, respectively; protease mutation I50 V was detected in 1 subject. Three of the 6 children with DRMs initiated ARV therapy during followup, with a good response in 2. The overall rate of primary drug resistance in this pediatric HIV-infected population was low, and no subjects had more than 1 DRM. Mutations associated with resistance to nucleoside reverse transcriptase inhibitors were the most prevalent. PMID:22331986

  12. Non-CFC metered dose inhalers: the patent landscape.

    PubMed

    Bowman, P A; Greenleaf, D

    1999-09-10

    There have been many patent applications to the European Patent Office over the past decade involving the transition of pressurised metered dose inhalers from the CFCs to non-CFC propellants. In addition to those where formulations are changed, there are those relating to specific drugs or drug classes, processes of manufacture and modifications to the container/closure system. Many of these have been opposed, usually on the grounds of obviousness. However, due to the length of time for the opposition process and the fact that there are few non-CFC pressurised inhalers on the market yet, the complete picture of which patents are valid has yet to unfold.

  13. Recent Overview of Ocular Patents

    PubMed Central

    Gaudana, Ripal J.; Gokulgandhi, Mitan R.; Boddu, Sai H.S.; Mitra, Ashim K.

    2015-01-01

    Ocular drug therapy has always been considered as a major challenge in the field of drug delivery. The presence of blood ocular barriers and efflux pumps has imposed a great concern as well. Various vision threatening disorders require a long term therapy of drug molecules, especially for the diseases that affect the posterior segment. Pharmaceutical companies and other research institutes have adopted a multidisciplinary approach to meet the current challenges which is evidenced by the trends seen in the published and filed U.S. patents. Various strategies have been employed to achieve long term sustained and targeted delivery for both the anterior and the posterior segments of the ocular diseases. These strategies include formulating drugs into implant, micro or nanoparticulate systems and hydrogel-based systems. Transporter targeted approach has also allowed scientists to deliver drugs to both the segments of the eye. Recent developments such as delivery of drugs utilizing ultrasound, iontophoresis and microneedle based devices have been promising. Gene-based therapeutics has opened a new avenue for vision threatening disorders. In all, the current developments in the entire field have been very exciting for finding out new strategies to treat vision threatening disorders. PMID:22493994

  14. Modeling HIV/AIDS Drug Price Determinants in Brazil: Is Generic Competition a Myth?

    PubMed Central

    Meiners, Constance; Sagaon-Teyssier, Luis; Hasenclever, Lia; Moatti, Jean-Paul

    2011-01-01

    Background Brazil became the first developing country to guarantee free and universal access to HIV/AIDS treatment, with antiretroviral drugs (ARVs) being delivered to nearly 190,000 patients. The analysis of ARV price evolution and market dynamics in Brazil can help anticipate issues soon to afflict other developing countries, as the 2010 revision of the World Health Organization guidelines shifts demand towards more expensive treatments, and, at the same time, current evolution of international legislation and trade agreements on intellectual property rights may reduce availability of generic drugs for HIV care. Methods and Findings Our analyses are based on effective prices paid for ARV procurement in Brazil between 1996 and 2009. Data panel structure was exploited to gather ex-ante and ex-post information and address various sources of statistical bias. In-difference estimation offered in-depth information on ARV market characteristics which significantly influence prices. Although overall ARV prices follow a declining trend, changing characteristics in the generic segment help explain recent increase in generic ARV prices. Our results show that generic suppliers are more likely to respond to factors influencing demand size and market competition, while originator suppliers tend to set prices strategically to offset compulsory licensing threats and generic competition. Significance In order to guarantee the long term sustainability of access to antiretroviral treatment, our findings highlight the importance of preserving and stimulating generic market dynamics to sustain developing countries' bargaining power in price negotiations undertaken with originator companies. PMID:21858138

  15. Patent law for the dermatologist.

    PubMed

    Mei, Dan Feng; Liu, Josephine

    2013-12-01

    An exciting discovery in the laboratory may translate to a commercial product. How does the patent system fit into the picture? We first discuss the circumstances under which an invention is granted a patent. What is the purpose of a patent and what are the functions of the patent system? Who can apply for a patent? What makes an invention patentable? A patent does not automatically grant a right to make or sell a product. This is because multiple patents can cover a single pharmaceutical product. Understanding the patent landscape covering a product of interest is key to evaluating the risk of infringing another's exclusivity rights. We use a hypothetical example relating to skin cancer to guide a discussion of patent law.

  16. Retrieving Patent Information Online

    ERIC Educational Resources Information Center

    Kaback, Stuart M.

    1978-01-01

    This paper discusses patent information retrieval from online files in terms of types of questions, file contents, coverage, timeliness, and other file variations. CLAIMS, Derwent, WPI, APIPAT and Chemical Abstracts Service are described. (KP)

  17. Patent urachus repair

    MedlinePlus

    Patent urachal tube repair ... belly. Next, the surgeon will find the urachal tube and remove it. The bladder opening will be ... surgeon uses the tools to remove the urachal tube and close off the bladder and area where ...

  18. Patents, antibiotics, and autarky in Spain.

    PubMed

    Romero De Pablos, Ana

    2014-01-01

    Patents on antibiotics were introduced in Spain in 1949. Preliminary research reveals diversification in the types of antibiotics: patents relating to penicillin were followed by those relating to streptomycin, erythromycin and tetracycline. There was also diversification in the firms that applied for patents: while Merck & Co. Incorporated and Schenley Industries Inc. were the main partners with Spanish antibiotics manufacturers in the late 1940s, this industrial space also included many others, such as Eli Lilly & Company, Abbott Laboratories, Chas. Pfizer & Co. Incorporated, and American Cyanamid Company in the mid-1970s. The introduction of these drugs in Spain adds new elements to a re-evaluation of the autarkic politics of the early years of the Franco dictatorship.

  19. Patents, antibiotics, and autarky in Spain.

    PubMed

    Romero De Pablos, Ana

    2014-01-01

    Patents on antibiotics were introduced in Spain in 1949. Preliminary research reveals diversification in the types of antibiotics: patents relating to penicillin were followed by those relating to streptomycin, erythromycin and tetracycline. There was also diversification in the firms that applied for patents: while Merck & Co. Incorporated and Schenley Industries Inc. were the main partners with Spanish antibiotics manufacturers in the late 1940s, this industrial space also included many others, such as Eli Lilly & Company, Abbott Laboratories, Chas. Pfizer & Co. Incorporated, and American Cyanamid Company in the mid-1970s. The introduction of these drugs in Spain adds new elements to a re-evaluation of the autarkic politics of the early years of the Franco dictatorship. PMID:26054209

  20. Text mining patents for biomedical knowledge.

    PubMed

    Rodriguez-Esteban, Raul; Bundschus, Markus

    2016-06-01

    Biomedical text mining of scientific knowledge bases, such as Medline, has received much attention in recent years. Given that text mining is able to automatically extract biomedical facts that revolve around entities such as genes, proteins, and drugs, from unstructured text sources, it is seen as a major enabler to foster biomedical research and drug discovery. In contrast to the biomedical literature, research into the mining of biomedical patents has not reached the same level of maturity. Here, we review existing work and highlight the associated technical challenges that emerge from automatically extracting facts from patents. We conclude by outlining potential future directions in this domain that could help drive biomedical research and drug discovery.

  1. Text mining patents for biomedical knowledge.

    PubMed

    Rodriguez-Esteban, Raul; Bundschus, Markus

    2016-06-01

    Biomedical text mining of scientific knowledge bases, such as Medline, has received much attention in recent years. Given that text mining is able to automatically extract biomedical facts that revolve around entities such as genes, proteins, and drugs, from unstructured text sources, it is seen as a major enabler to foster biomedical research and drug discovery. In contrast to the biomedical literature, research into the mining of biomedical patents has not reached the same level of maturity. Here, we review existing work and highlight the associated technical challenges that emerge from automatically extracting facts from patents. We conclude by outlining potential future directions in this domain that could help drive biomedical research and drug discovery. PMID:27179985

  2. Paying for On-Patent Pharmaceuticals

    PubMed Central

    Goldfield, Norbert

    2016-01-01

    In this article we propose a new approach to pricing for patent-protected (on-patent) pharmaceuticals. We describe and define limit pricing as a method for drug companies to maximize revenue for their investment by offering budget-neutral pricing to encourage early adoption by payers. Under this approach, payers are incentivized to adopt innovative but expensive drugs more quickly if drug companies provide detailed analyses of the net impact of the new pharmaceutical upon total health budgets. For payers to adopt use of a new pharmaceutical, they would require objective third-party evaluation and pharmaceutical manufacturer accountability for projected outcomes efficacy of their treatments on population health. The pay for outcomes underpinning of this approach falls within the wider aspirations of health reform. PMID:26945298

  3. Monitoring and modeling the snowpack dynamics in the Arve upper catchment for hydrological purposes

    NASA Astrophysics Data System (ADS)

    Revuelto, Jesús; Lecourt, Grégoire; Charrois, Luc; Lafaysse, Matthieu; Condom, Thomas; Dumont, Marie; Morin, Samuel; Rabatel, Antoine; Six, Delphine; Vionnet, Vincent; Zin, Isabella

    2016-04-01

    Snow accumulation and its evolution over space and time have major importance for the hydrological cycle, especially at high elevations. The characteristics of mountain valley, such as a wide altitudinal range, large glaciated areas, snow presence all along the year; when combined with specific meteorological conditions like heat waves or extreme rain events, may originate dramatic flash floods, potentially affecting populated areas. Thus, improving snowpack monitoring and forecasting tools are needed to strength the reliability of warning systems. Nowadays, accurately characterising and simulating snowpack evolution over large areas still represents a challenge, and uncertainties arise. The study presented here is focused in analysing two different types of simulation of the snowpack dynamics, performed with different discretization approaches, distributed or semi-distributed, and how these could move forward assimilating remote sensing data from satellites. The considered study area is the Arve catchment at Chamonix, in the French Northern Alps. This valley has the previously mentioned characteristics: it comprises a large elevation range (between 1000 to 4800m asl, with large areas above 2000m asl) and about 32% of its extension (200km2) is glaciated. Thus, the hydrological cycle of this area is highly dependent on the snowpack and the glacier melt dynamics. The snowpack of the Arve catchment has been simulated from 1990 to 2014 with the Crocus model integrated within the SURFEX modelling platform. The input fields are provided by the SAFRAN reanalysis system and the simulations have been performed with both a semi-distributed (classifying terrain by aspect, elevation, slope and land use/land cover) and a distributed (250m spatial resolution grid cells over the study area) approaches. The use of these two approaches using the same snowpack model and same meteorological forcing, enables their comparison in terms of river discharges at several outlets; showing the

  4. Recent advances and patent perspectives in gastroretentive technology.

    PubMed

    Pahwa, Rakesh; Singh, Manisha; Kumar, Vipin; Kohli, Kanchan

    2012-12-01

    Gastroretentive drug delivery technology has emerged as an efficient approach for enhancing the bioavailability and controlled delivery of various therapeutic molecules. Myriad of patents issued in the vistas of gastroretentive technology have inspired scientific community worldwide to develop more innovative strategies for the fabrication of drug delivery devices which can be retained in stomach for a controlled period of time. The present paper describes various recent efforts and technological advancements of gastroretentive drug delivery systems along with potential advantages and available marketed preparations. Numerous significant patents concerning gastroretentive drug delivery devices are also highlighted.

  5. Patent controversies and court cases: cancer diagnosis, therapy and prevention.

    PubMed

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2012-11-01

    Patents are issued essentially by all countries on inventions that are deemed novel, non-obvious, clearly described and of significant utility or industrial application. The only exceptions to patenting an invention are abstract ideas, laws of nature and natural phenomena, although the exceptions vary depending on countries where moral, public order or human rights considerations are also taken into account. Although patent laws are updated over decades, the rapid progress of science creates situations that the patent laws on the book cannot address, leading to contentious legal issues. This is often true for life saving drugs, particularly drugs for cancers or HIV/AIDS, which are expensive and beyond the reach of poor people because of the proprietary positions of these patented drugs. Another contentious issue is the patent eligibility of human genes and mutations that are often thought of nature's contribution to human health and propagation and should be beyond the reach of patentability. In this review, we address some of these current legal issues and their implications for the development of diagnostic methods, therapeutic interventions and even prevention for cancer, a scourge of mankind.

  6. The RNA-binding protein Sam68 regulates expression and transcription function of the androgen receptor splice variant AR-V7.

    PubMed

    Stockley, Jacqueline; Markert, Elke; Zhou, Yan; Robson, Craig N; Elliott, David J; Lindberg, Johan; Leung, Hing Y; Rajan, Prabhakar

    2015-01-01

    Castration-resistant (CR) prostate cancer (PCa) partly arises due to persistence of androgen receptor (AR) transcriptional activity in the absence of cognate ligand. An emerging mechanism underlying the CRPCa phenotype and predicting response to therapy is the expression of the constitutively-active AR-V7 splice variant generated by AR cryptic exon 3b inclusion. Here, we explore the role of the RNA-binding protein (RBP) Sam68 (encoded by KHDRBS1), which is over-expressed in clinical PCa, on AR-V7 expression and transcription function. Using a minigene reporter, we show that Sam68 controls expression of exon 3b resulting in an increase in endogenous AR-V7 mRNA and protein expression in RNA-binding-dependent manner. We identify a novel protein-protein interaction between Sam68 and AR-V7 mediated by a common domain shared with full-length AR, and observe these proteins in the cell nucleoplasm. Using a luciferase reporter, we demonstrate that Sam68 co-activates ligand-independent AR-V7 transcriptional activity in an RNA-binding-independent manner, and controls expression of the endogenous AR-V7-specific gene target UBE2C. Our data suggest that Sam68 has separable effects on the regulation of AR-V7 expression and transcriptional activity, through its RNA-binding capacity. Sam68 and other RBPs may control expression of AR-V7 and other splice variants as well as their downstream functions in CRPCa. PMID:26310125

  7. The RNA-binding protein Sam68 regulates expression and transcription function of the androgen receptor splice variant AR-V7.

    PubMed

    Stockley, Jacqueline; Markert, Elke; Zhou, Yan; Robson, Craig N; Elliott, David J; Lindberg, Johan; Leung, Hing Y; Rajan, Prabhakar

    2015-08-27

    Castration-resistant (CR) prostate cancer (PCa) partly arises due to persistence of androgen receptor (AR) transcriptional activity in the absence of cognate ligand. An emerging mechanism underlying the CRPCa phenotype and predicting response to therapy is the expression of the constitutively-active AR-V7 splice variant generated by AR cryptic exon 3b inclusion. Here, we explore the role of the RNA-binding protein (RBP) Sam68 (encoded by KHDRBS1), which is over-expressed in clinical PCa, on AR-V7 expression and transcription function. Using a minigene reporter, we show that Sam68 controls expression of exon 3b resulting in an increase in endogenous AR-V7 mRNA and protein expression in RNA-binding-dependent manner. We identify a novel protein-protein interaction between Sam68 and AR-V7 mediated by a common domain shared with full-length AR, and observe these proteins in the cell nucleoplasm. Using a luciferase reporter, we demonstrate that Sam68 co-activates ligand-independent AR-V7 transcriptional activity in an RNA-binding-independent manner, and controls expression of the endogenous AR-V7-specific gene target UBE2C. Our data suggest that Sam68 has separable effects on the regulation of AR-V7 expression and transcriptional activity, through its RNA-binding capacity. Sam68 and other RBPs may control expression of AR-V7 and other splice variants as well as their downstream functions in CRPCa.

  8. Evergreening, patent challenges, and effective market life in pharmaceuticals.

    PubMed

    Hemphill, C Scott; Sampat, Bhaven N

    2012-03-01

    Observers worry that generic patent challenges are on the rise and reduce the effective market life of drugs. A related concern is that challenges disproportionately target high-sales drugs, reducing market life for these "blockbusters." To study these questions, we examine new data on generic entry over the past decade. We show that challenges are more common for higher sales drugs. We also demonstrate a slight increase in challenges over this period, and a sharper increase for early challenges. Despite this, effective market life is stable across drug sales categories, and has hardly changed over the decade. To better understand these results, we examine which patents are challenged on each drug, and show that lower quality and later expiring patents disproportionately draw challenges. Overall, this evidence suggests that challenges serve to maintain, not reduce, the historical baseline of effective market life, thereby limiting the effectiveness of "evergreening" by branded firms.

  9. A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

    PubMed

    Vestergaard, Gisle; Häring, Monika; Peng, Xu; Rachel, Reinhard; Garrett, Roger A; Prangishvili, David

    2005-05-25

    Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

  10. Differential regulation of metabolic pathways by androgen receptor (AR) and its constitutively active splice variant, AR-V7, in prostate cancer cells.

    PubMed

    Shafi, Ayesha A; Putluri, Vasanta; Arnold, James M; Tsouko, Efrosini; Maity, Suman; Roberts, Justin M; Coarfa, Cristian; Frigo, Daniel E; Putluri, Nagireddy; Sreekumar, Arun; Weigel, Nancy L

    2015-10-13

    Metastatic prostate cancer (PCa) is primarily an androgen-dependent disease, which is treated with androgen deprivation therapy (ADT). Tumors usually develop resistance (castration-resistant PCa [CRPC]), but remain androgen receptor (AR) dependent. Numerous mechanisms for AR-dependent resistance have been identified including expression of constitutively active AR splice variants lacking the hormone-binding domain. Recent clinical studies show that expression of the best-characterized AR variant, AR-V7, correlates with resistance to ADT and poor outcome. Whether AR-V7 is simply a constitutively active substitute for AR or has novel gene targets that cause unique downstream changes is unresolved. Several studies have shown that AR activation alters cell metabolism. Using LNCaP cells with inducible expression of AR-V7 as a model system, we found that AR-V7 stimulated growth, migration, and glycolysis measured by ECAR (extracellular acidification rate) similar to AR. However, further analyses using metabolomics and metabolic flux assays revealed several differences. Whereas AR increased citrate levels, AR-V7 reduced citrate mirroring metabolic shifts observed in CRPC patients. Flux analyses indicate that the low citrate is a result of enhanced utilization rather than a failure to synthesize citrate. Moreover, flux assays suggested that compared to AR, AR-V7 exhibits increased dependence on glutaminolysis and reductive carboxylation to produce some of the TCA (tricarboxylic acid cycle) metabolites. These findings suggest that these unique actions represent potential therapeutic targets.

  11. The new patent regime and disease priorities in India.

    PubMed

    Gupta, Indrani; Guin, Pradeep; Trivedi, Mayur

    2013-01-01

    The World Trade Organization (WTO) and Trade-Related Aspects of Intellectual Property Rights (TRIPS), which made product patents compulsory for countries to follow, meant that the entire market for generic drugs was out of bounds for manufacturing till the time the products went off-patent. The TRIPS has generated widespread discussions and debates around the costs and benefits of new patent regimes on countries such as India. This article analyses whether the post-WTO system was consistent with, and conducive to, improved public health in India. It is a first-of-its-kind effort in which the data on pharmaceutical patents applications were collected, collated, cleaned and classified according to IPC codes, to enable preliminary understanding of the nature and type of the applications. The patent applications that are filed in India are not found to be consistent with the disease burden of the country.

  12. Selling Complementary Patents: Experimental Investigation

    SciTech Connect

    Bjornstad, David J; Santore, Rudy; McKee, Michael

    2010-02-01

    Production requiring licensing groups of complementary patents implements a coordination game among patent holders, who can price patents by choosing among combinations of fixed and royalty fees. Summed across patents, these fees become the total producer cost of the package of patents. Royalties, because they function as excise taxes, add to marginal costs, resulting in higher prices and reduced quantities of the downstream product and lower payoffs to the patent holders. Using fixed fees eliminates this inefficiency but yields a more complex coordination game in which there are multiple equilibria, which are very fragile in that small mistakes can lead the downstream firm to not license the technology, resulting in inefficient outcomes. We report on a laboratory market investigation of the efficiency effects of coordinated pricing of patents in a patent pool. We find that pool-like pricing agreements can yield fewer coordination failures in the pricing of complementary patents.

  13. 75 FR 9227 - Determination of Regulatory Review Period for Purposes of Patent Extension; FIRMAGON

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-01

    ...The Food and Drug Administration (FDA) has determined the regulatory review period for FIRMAGON and is publishing this notice of that determination as required by law. FDA has made the determination because of the submission of an application to the Director of Patents and Trademarks, Department of Commerce, for the extension of a patent which claims that human drug...

  14. 78 FR 13684 - Determination of Regulatory Review Period for Purposes of Patent Extension; ZYTIGA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-28

    ...The Food and Drug Administration (FDA) has determined the regulatory review period for ZYTIGA and is publishing this notice of that determination as required by law. FDA has made the determination because of the submission of an application to the Director of Patents and Trademarks, Department of Commerce, for the extension of a patent which claims that human drug...

  15. 77 FR 26558 - Determination of Regulatory Review Period for Purposes of Patent Extension; JEVTANA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-04

    ...The Food and Drug Administration (FDA) has determined the regulatory review period for JEVTANA and is publishing this notice of that determination as required by law. FDA has made the determination because of the submission of applications to the Director of Patents and Trademarks, Department of Commerce, for the extension of a patent which claims that human drug...

  16. Research Tool Patents--Rumours of their Death are Greatly Exaggerated

    ERIC Educational Resources Information Center

    Carroll, Peter G.; Roberts, John S.

    2006-01-01

    Using a patented drug during clinical trials is not infringement [35 U.S.C. 271(e)(1)]. Merck v Integra enlarged this "safe harbour" to accommodate preclinical use of drugs and patented "research tools" if "reasonably related" to FDA approval. The decision allowed lower courts, should they wish, to find any use of a research tool, except for…

  17. 75 FR 17142 - Determination of Regulatory Review Period for Purposes of Patent Extension; LUSEDRA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-05

    ... Patent Extension; LUSEDRA AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food... the extension of a patent which claims that human drug product. ADDRESSES: Submit written comments and... determining the amount of extension an applicant may receive. A regulatory review period consists of...

  18. 75 FR 78714 - Determination of Regulatory Review Period for Purposes of Patent Extension; ANGIOMAX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-16

    ... Regulatory Policy, Food and Drug Administration, 10903 New Hampshire Ave., Bldg. 51, rm. 6222, Silver Spring... drug becomes effective and runs until the approval phase begins. The approval phase starts with the... for ANGIOMAX (U.S. Patent No. 5,196,404) from The Medicines Company, and the Patent and...

  19. 75 FR 54152 - Determination of Regulatory Review Period for Purposes of Patent Extension; NEURX DIAPHRAGM...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-03

    ... Trademarks, Department of Commerce, for the extension of a patent which claims that medical device. ADDRESSES... years so long as the patented item (human drug product, animal drug product, medical device, food... and an approval phase. For medical devices, the testing phase begins with a clinical investigation...

  20. 76 FR 12974 - Determination of Regulatory Review Period for Purposes of Patent Extension; AMPYRA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-09

    ...The Food and Drug Administration (FDA) has determined the regulatory review period for AMPYRA and is publishing this notice of that determination as required by law. FDA has made the determination because of the submission of applications to the Director of Patents and Trademarks, Department of Commerce, for the extension of patents which claim that human drug...

  1. Evidence-based guideline: Antiepileptic drug selection for people with HIV/AIDS

    PubMed Central

    Birbeck, G.L.; French, J.A.; Perucca, E.; Simpson, D.M.; Fraimow, H.; George, J.M.; Okulicz, J.F.; Clifford, D.B.; Hachad, H.; Levy, R.H.

    2012-01-01

    Objective: To develop guidelines for selection of antiepileptic drugs (AEDs) among people with HIV/AIDS. Methods: The literature was systematically reviewed to assess the global burden of relevant comorbid entities, to determine the number of patients who potentially utilize AEDs and antiretroviral agents (ARVs), and to address AED-ARV interactions. Results and Recommendations: AED-ARV administration may be indicated in up to 55% of people taking ARVs. Patients receiving phenytoin may require a lopinavir/ritonavir dosage increase of ∼50% to maintain unchanged serum concentrations (Level C). Patients receiving valproic acid may require a zidovudine dosage reduction to maintain unchanged serum zidovudine concentrations (Level C). Coadministration of valproic acid and efavirenz may not require efavirenz dosage adjustment (Level C). Patients receiving ritonavir/atazanavir may require a lamotrigine dosage increase of ∼50% to maintain unchanged lamotrigine serum concentrations (Level C). Coadministration of raltegravir/atazanavir and lamotrigine may not require lamotrigine dosage adjustment (Level C). Coadministration of raltegravir and midazolam may not require midazolam dosage adjustment (Level C). Patients may be counseled that it is unclear whether dosage adjustment is necessary when other AEDs and ARVs are combined (Level U). It may be important to avoid enzyme-inducing AEDs in people on ARV regimens that include protease inhibitors or nonnucleoside reverse transcriptase inhibitors, as pharmacokinetic interactions may result in virologic failure, which has clinical implications for disease progression and development of ARV resistance. If such regimens are required for seizure control, patients may be monitored through pharmacokinetic assessments to ensure efficacy of the ARV regimen (Level C). PMID:22218281

  2. Patent litigation in India continues to throw up new challenges.

    PubMed

    Reddy Thikkavarapu, Prashant

    2016-07-01

    For several years after the reinstitution of a pharmaceutical patent regime in India, most innovator pharmaceutical companies have faced a string of high-profile defeats during litigation in India. In the last 2 years, however, the fortunes of pharmaceutical patentees have changed dramatically. Not only have Indian courts enforced pharmaceutical patents and issued injunctions restraining Indian generic companies from infringing valid patents, but they have also refused to invoke 'public interest' arguments to delay the enforcement of patents. This string of victories for pharmaceutical patents indicates a new era for the innovator industry in India. These victories for the innovator industry demonstrate the objectivity of the Indian judiciary. Even on the issue of compulsory licensing, the Patent Office, which functions as a part of the central government, has been restrained - granting only one compulsory license for a drug owned by Bayer but declining two other similar requests. Similarly, even the Indian judiciary while enforcing patents has also remained sensitive to the flexibilities in the Patents Act, such as the 'Bolar-type' provisions and compulsory licensing provisions. PMID:27348790

  3. Edison's vacuum technology patents

    NASA Astrophysics Data System (ADS)

    Waits, Robert K.

    2003-07-01

    During 1879 Thomas Edison's Menlo Park, New Jersey laboratory developed the means to evacuate glass lamp globes to less than a mTorr in 20 min and in mid-1880 began production of carbon-filament incandescent lamps. Among Edison's nearly 1100 U.S. patents are five for vacuum pump improvements, and at least eight others that are vacuum-related; all applied for between 1880 and 1886. Inspired by an 1878 article by De La Rue and Müller [Philos. Trans. R. Soc. London, Ser. A 169, 155 (1878)] on studies of glow discharges, Edison devised a combination pump using the Geissler pump as a rough pump and the Sprengel pump for continuous exhaustion. Edison's patents described means to control the mercury flow and automate the delivery of the mercury to banks of up to a hundred pumps. Other patents described various means to remove residual gases during lamp processing.

  4. Humira: the impending patent battles over adalimumab biosimilars.

    PubMed

    Norman, Peter

    2016-05-01

    The world's top selling drug, adalimumab (AbbVie's Humira), generated sales in excess of US$13 billion in 2015. The primary product patent expires in 2016 in the USA and 2018 in Europe. This has resulted in a rush by companies to develop adalimumab biosimilars and Amgen submitted regulatory filings for its product ABP-501 in late 2015 in both the USA and Europe. AbbVie has claimed its patent portfolio provides product protection until 2022, but an increasing number of patent challenges are being made and the filings for approval of biosimilars will see more challenges made over the next few years.

  5. Humira: the impending patent battles over adalimumab biosimilars.

    PubMed

    Norman, Peter

    2016-05-01

    The world's top selling drug, adalimumab (AbbVie's Humira), generated sales in excess of US$13 billion in 2015. The primary product patent expires in 2016 in the USA and 2018 in Europe. This has resulted in a rush by companies to develop adalimumab biosimilars and Amgen submitted regulatory filings for its product ABP-501 in late 2015 in both the USA and Europe. AbbVie has claimed its patent portfolio provides product protection until 2022, but an increasing number of patent challenges are being made and the filings for approval of biosimilars will see more challenges made over the next few years. PMID:27087201

  6. ARV robotic technologies (ART): a risk reduction effort for future unmanned systems

    NASA Astrophysics Data System (ADS)

    Jaster, Jeffrey F.

    2006-05-01

    The Army's ARV (Armed Robotic Vehicle) Robotic Technologies (ART) program is working on the development of various technological thrusts for use in the robotic forces of the future. The ART program will develop, integrate and demonstrate the technology required to advance the maneuver technologies (i.e., perception, mobility, tactical behaviors) and increase the survivability of unmanned platforms for the future force while focusing on reducing the soldiers' burden by providing an increase in vehicle autonomy coinciding with a decrease in the total number user interventions required to control the unmanned assets. This program will advance the state of the art in perception technologies to provide the unmanned platform an increasingly accurate view of the terrain that surrounds it; while developing tactical/mission behavior technologies to provide the Unmanned Ground Vehicle (UGV) the capability to maneuver tactically, in conjunction with the manned systems in an autonomous mode. The ART testbed will be integrated with the advanced technology software and associated hardware developed under this effort, and incorporate appropriate mission modules (e.g. RSTA sensors, MILES, etc.) to support Warfighter experiments and evaluations (virtual and field) in a military significant environment (open/rolling and complex/urban terrain). The outcome of these experiments as well as other lessons learned through out the program life cycle will be used to reduce the current risks that are identified for the future UGV systems that will be developed under the Future Combat Systems (FCS) program, including the early integration of an FCS-like autonomous navigation system onto a tracked skid steer platform.

  7. Patents protect deepwater platform concepts

    SciTech Connect

    Khurana, S.

    1998-06-22

    Numerous deepwater platform concepts have patents that provide an inventor protection for his new ideas. But an inventor should not be discouraged by the fact that many patents exist. In fact, it may be advantageous to build on existing patents and prior art, and patent new ideas and concepts for reducing costs. Challenges still remain such as for optimizing drilling and production operations simultaneously on deepwater platforms for accessing and producing oil and gas reserves.

  8. Recent Patents in Pulmonary Delivery of Macromolecules.

    PubMed

    Ray, Animikh; Mandal, Abhirup; Mitra, Ashim K

    2015-01-01

    Pulmonary delivery is a non-invasive form of delivery that holds tremendous therapeutic promise for topical and systemic administration of several macromolecules. Oral administration of macromolecules has several limitations such as low bioavailability, degradation of drug before reaching circulation and insufficient absorption across intestinal membrane. Administration of macromolecules such as proteins, peptides and nucleic acids via inhalation offers great potential due to the avoidance of first pass metabolism, higher surface area and rapid clinical response. However, delivery of reproducible, uniform and safe doses of inhaled particles remains a major challenge for clinical translation. Recent advances in the fields of biotechnology and particle engineering led to progress in novel pulmonary drug delivery systems. Moreover, significant developments in carriers and delivery devices prevent denaturation of macromolecules and control their release within the lungs. This article reviews the advances in pulmonary drug delivery systems by focusing on the recent patents in delivery of macromolecules. Furthermore, recent patents in gene delivery to the lungs have also been discussed. List of patents included in this review is comprehensive in terms of pulmonary delivery of therapeutics. It includes inventions related to proteins and peptides, DNA therapeutics, siRNA and other genetic materials with therapeutic applications. The diseases targeted by these therapeutic molecules are varied including but not limited to different forms of cancer, respiratory diseases etc.

  9. Patent Searching for Librarians and Inventors.

    ERIC Educational Resources Information Center

    Wherry, Timothy Lee

    Information on patents is provided for librarians and laypersons requiring an understanding of the system and the processes involved. Chapter 1 discusses successful patents; terms and concepts; patent types; copyright; trademark; requirements; patent examiners; patent pending; expiration; patentee and assignee; and reissued patents. Chapter 2…

  10. Antiretroviral Drugs-Loaded Nanoparticles Fabricated by Dispersion Polymerization with Potential for HIV/AIDS Treatment

    PubMed Central

    Ogunwuyi, Oluwaseun; Kumari, Namita; Smith, Kahli A.; Bolshakov, Oleg; Adesina, Simeon; Gugssa, Ayele; Anderson, Winston A.; Nekhai, Sergei; Akala, Emmanuel O.

    2016-01-01

    Highly active antiretroviral (ARV) therapy (HAART) for chronic suppression of HIV replication has revolutionized the treatment of HIV/AIDS. HAART is no panacea; treatments must be maintained for life. Although great progress has been made in ARV therapy, HIV continues to replicate in anatomical and intracellular sites where ARV drugs have restricted access. Nanotechnology has been considered a platform to circumvent some of the challenges in HIV/AIDS treatment. Dispersion polymerization was used to fabricate two types (PMM and ECA) of polymeric nanoparticles, and each was successfully loaded with four ARV drugs (zidovudine, lamivudine, nevirapine, and raltegravir), followed by physicochemical characterization: scanning electron microscope, particle size, zeta potential, drug loading, and in vitro availability. These nanoparticles efficiently inhibited HIV-1 infection in CEM T cells and peripheral blood mononuclear cells; they hold promise for the treatment of HIV/AIDS. The ARV-loaded nanoparticles with polyethylene glycol on the corona may facilitate tethering ligands for targeting specific receptors expressed on the cells of HIV reservoirs. PMID:27013886

  11. 37 CFR 3.21 - Identification of patents and patent applications.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Identification of patents and patent applications. 3.21 Section 3.21 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... for Recording § 3.21 Identification of patents and patent applications. An assignment relating to...

  12. 37 CFR 3.21 - Identification of patents and patent applications.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Identification of patents and patent applications. 3.21 Section 3.21 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... for Recording § 3.21 Identification of patents and patent applications. An assignment relating to...

  13. 37 CFR 3.21 - Identification of patents and patent applications.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Identification of patents and patent applications. 3.21 Section 3.21 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... for Recording § 3.21 Identification of patents and patent applications. An assignment relating to...

  14. 37 CFR 3.21 - Identification of patents and patent applications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Identification of patents and patent applications. 3.21 Section 3.21 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... for Recording § 3.21 Identification of patents and patent applications. An assignment relating to...

  15. 37 CFR 3.21 - Identification of patents and patent applications.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Identification of patents and patent applications. 3.21 Section 3.21 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... for Recording § 3.21 Identification of patents and patent applications. An assignment relating to...

  16. Patenting inventions in combinatorial chemistry.

    PubMed

    Borson, D B

    2000-02-01

    I have intended to provide an overview of some patent strategies for protecting intellectual property in the combinatorial chemistry arts, along with examples taken from recently issued patents. The opinions in this paper are those of the author, and are not intended to be relied upon as legal advice. Specific questions about any particular patent or invention should be discussed with competent counsel before action is taken. If you would like to look at the patents discussed in this article, they are available on-line at http:¿www.patents.ibm.com/boolquery and at other locations.

  17. Patent production is a prerequisite for successful exit of a biopharmaceutical company.

    PubMed

    Saotome, Chikako; Nakaya, Yurie; Abe, Seiji

    2016-03-01

    Patents are especially important for the business of drug discovery; however, their importance for biopharmaceutical companies has not been revealed quantitatively yet. To examine the correlation between patents and long-term business outcome of biopharmaceutical companies we analyze annual number of patent families and business conditions of 123 public-listed biopharmaceutical companies established from 1990 to 1995 in the USA. Our results show the number of patent families per year correlates well with the business condition: average of the bankruptcy group is significantly smaller than those of the continuing and the merger and acquisitions (M&A) groups. In the M&A by big pharma group, the acquisition cost correlates with the number of annual patent families. However, patentability and strategy of foreign patent application are not different among the groups. Therefore, the productivity of invention is the key factor for success of biopharmaceutical companies.

  18. Disclosing in utero HIV/ARV exposure to the HIV-exposed uninfected adolescent: is it necessary?

    PubMed Central

    Jao, Jennifer; Hazra, Rohan; Mellins, Claude A; Remien, Robert H; Abrams, Elaine J

    2016-01-01

    Introduction The tremendous success of antiretroviral therapy has resulted in a diminishing population of perinatally HIV-infected children on the one hand and a mounting number of HIV-exposed uninfected (HEU) children on the other. As the oldest of these HEU children are reaching adolescence, questions have emerged surrounding the implications of HEU status disclosure to these adolescents. This article outlines the arguments for and against disclosure of a child's HEU status. Discussion Disclosure of a child's HEU status, by definition, requires disclosure of maternal HIV status. It is necessary to weigh the benefits and harms which could occur with disclosure in each of the following domains: psychosocial impact, long-term physical health of the HEU individual and the public health impact. Does disclosure improve or worsen the psychological health of the HEU individual and extended family unit? Do present data on the long-term safety of in utero HIV/ARV exposure reveal potential health risks which merit disclosure to the HEU adolescent? What research and public health programmes or systems need to be in place to afford monitoring of HEU individuals and which, if any, of these require disclosure? Conclusions At present, it is not clear that there is sufficient evidence on whether long-term adverse effects are associated with in utero HIV/ARV exposures, making it difficult to mandate universal disclosure. However, as more countries adopt electronic medical record systems, the HEU status of an individual should be an important piece of the health record which follows the infant not only through childhood and adolescence but also adulthood. Clinicians and researchers should continue to approach the dialogue around mother–child disclosure with sensitivity and a cogent consideration of the evolving risks and benefits as new information becomes available while also working to maintain documentation of an individual's perinatal HIV/ARV exposures as a vital part of his

  19. HIV-1 Antiretroviral Drug Resistance Mutations in Treatment Naïve and Experienced Panamanian Subjects: Impact on National Use of EFV-Based Schemes.

    PubMed

    Mendoza, Yaxelis; Castillo Mewa, Juan; Martínez, Alexander A; Zaldívar, Yamitzel; Sosa, Néstor; Arteaga, Griselda; Armién, Blas; Bautista, Christian T; García-Morales, Claudia; Tapia-Trejo, Daniela; Ávila-Ríos, Santiago; Reyes-Terán, Gustavo; Bello, Gonzalo; Pascale, Juan M

    2016-01-01

    The use of antiretroviral therapy in HIV infected subjects prevents AIDS-related illness and delayed occurrence of death. In Panama, rollout of ART started in 1999 and national coverage has reached 62.8% since then. The objective of this study was to determine the level and patterns of acquired drug resistance mutations of clinical relevance (ADR-CRM) and surveillance drug resistance mutations (SDRMs) from 717 HIV-1 pol gene sequences obtained from 467 ARV drug-experienced and 250 ARV drug-naïve HIV-1 subtypes B infected subjects during 2007-2013, respectively. The overall prevalence of SDRM and of ADR-CRM during the study period was 9.2% and 87.6%, respectively. The majority of subjects with ADR-CRM had a pattern of mutations that confer resistance to at least two classes of ARV inhibitors. The non-nucleoside reverse transcriptase inhibitor (NNRTI) mutations K103N and P225H were more prevalent in both ARV drug-naïve and ARV drug-experienced subjects. The nucleoside reverse transcriptase inhibitor (NRTI) mutation M184V was more frequent in ARV drug-experienced individuals, while T215YFrev and M41L were more frequent in ARV drug-naïve subjects. Prevalence of mutations associated to protease inhibitors (PI) was lower than 4.1% in both types of subjects. Therefore, there is a high level of resistance (>73%) to Efavirenz/Nevirapine, Lamivudine and Azidothymidine in ARV drug-experienced subjects, and an intermediate to high level of resistance (5-10%) to Efavirenz/Nevirapine in ARV drug-naïve subjects. During the study period, we observed an increasing trend in the prevalence of ADR-CRM in subjects under first-line schemes, but not significant changes in the prevalence of SDRM. These results reinforce the paramount importance of a national surveillance system of ADR-CRM and SDRM for national management policies of subjects living with HIV.

  20. HIV-1 Antiretroviral Drug Resistance Mutations in Treatment Naïve and Experienced Panamanian Subjects: Impact on National Use of EFV-Based Schemes.

    PubMed

    Mendoza, Yaxelis; Castillo Mewa, Juan; Martínez, Alexander A; Zaldívar, Yamitzel; Sosa, Néstor; Arteaga, Griselda; Armién, Blas; Bautista, Christian T; García-Morales, Claudia; Tapia-Trejo, Daniela; Ávila-Ríos, Santiago; Reyes-Terán, Gustavo; Bello, Gonzalo; Pascale, Juan M

    2016-01-01

    The use of antiretroviral therapy in HIV infected subjects prevents AIDS-related illness and delayed occurrence of death. In Panama, rollout of ART started in 1999 and national coverage has reached 62.8% since then. The objective of this study was to determine the level and patterns of acquired drug resistance mutations of clinical relevance (ADR-CRM) and surveillance drug resistance mutations (SDRMs) from 717 HIV-1 pol gene sequences obtained from 467 ARV drug-experienced and 250 ARV drug-naïve HIV-1 subtypes B infected subjects during 2007-2013, respectively. The overall prevalence of SDRM and of ADR-CRM during the study period was 9.2% and 87.6%, respectively. The majority of subjects with ADR-CRM had a pattern of mutations that confer resistance to at least two classes of ARV inhibitors. The non-nucleoside reverse transcriptase inhibitor (NNRTI) mutations K103N and P225H were more prevalent in both ARV drug-naïve and ARV drug-experienced subjects. The nucleoside reverse transcriptase inhibitor (NRTI) mutation M184V was more frequent in ARV drug-experienced individuals, while T215YFrev and M41L were more frequent in ARV drug-naïve subjects. Prevalence of mutations associated to protease inhibitors (PI) was lower than 4.1% in both types of subjects. Therefore, there is a high level of resistance (>73%) to Efavirenz/Nevirapine, Lamivudine and Azidothymidine in ARV drug-experienced subjects, and an intermediate to high level of resistance (5-10%) to Efavirenz/Nevirapine in ARV drug-naïve subjects. During the study period, we observed an increasing trend in the prevalence of ADR-CRM in subjects under first-line schemes, but not significant changes in the prevalence of SDRM. These results reinforce the paramount importance of a national surveillance system of ADR-CRM and SDRM for national management policies of subjects living with HIV. PMID:27119150

  1. HIV-1 Antiretroviral Drug Resistance Mutations in Treatment Naïve and Experienced Panamanian Subjects: Impact on National Use of EFV-Based Schemes

    PubMed Central

    Mendoza, Yaxelis; Castillo Mewa, Juan; Martínez, Alexander A.; Zaldívar, Yamitzel; Sosa, Néstor; Arteaga, Griselda; Armién, Blas; Bautista, Christian T.; García-Morales, Claudia; Tapia-Trejo, Daniela; Ávila-Ríos, Santiago; Reyes-Terán, Gustavo; Bello, Gonzalo; Pascale, Juan M.

    2016-01-01

    The use of antiretroviral therapy in HIV infected subjects prevents AIDS-related illness and delayed occurrence of death. In Panama, rollout of ART started in 1999 and national coverage has reached 62.8% since then. The objective of this study was to determine the level and patterns of acquired drug resistance mutations of clinical relevance (ADR-CRM) and surveillance drug resistance mutations (SDRMs) from 717 HIV-1 pol gene sequences obtained from 467 ARV drug-experienced and 250 ARV drug-naïve HIV-1 subtypes B infected subjects during 2007–2013, respectively. The overall prevalence of SDRM and of ADR-CRM during the study period was 9.2% and 87.6%, respectively. The majority of subjects with ADR-CRM had a pattern of mutations that confer resistance to at least two classes of ARV inhibitors. The non-nucleoside reverse transcriptase inhibitor (NNRTI) mutations K103N and P225H were more prevalent in both ARV drug-naïve and ARV drug-experienced subjects. The nucleoside reverse transcriptase inhibitor (NRTI) mutation M184V was more frequent in ARV drug-experienced individuals, while T215YFrev and M41L were more frequent in ARV drug-naïve subjects. Prevalence of mutations associated to protease inhibitors (PI) was lower than 4.1% in both types of subjects. Therefore, there is a high level of resistance (>73%) to Efavirenz/Nevirapine, Lamivudine and Azidothymidine in ARV drug-experienced subjects, and an intermediate to high level of resistance (5–10%) to Efavirenz/Nevirapine in ARV drug-naïve subjects. During the study period, we observed an increasing trend in the prevalence of ADR-CRM in subjects under first-line schemes, but not significant changes in the prevalence of SDRM. These results reinforce the paramount importance of a national surveillance system of ADR-CRM and SDRM for national management policies of subjects living with HIV. PMID:27119150

  2. Efficacy and durability of nevirapine in antiretroviral drug näive patients.

    PubMed

    Lange, Joep M A

    2003-09-01

    Nevirapine is a non-nucleoside reverse transcriptase inhibitor (NNRTI) that was first reported in the scientific literature in 1990. Varying doses of nevirapine (NVP) and a number of regimens containing this NNRTI have been studied in antiretroviral (ARV) näive patients. Four key studies have compared the efficacy and safety of triple drug regimens containing NVP in ARV näive, HIV-1 infected patients. The INCAS study was the first demonstration of how to use NVP in an effective and durable manner: as a component of a triple drug regimen. The COMBINE Study was a comparison of protease inhibitor (PI)-based and NVP-based triple regimens. The Atlantic Study is comparing the safety and efficacy of three triple drug regimens in ARV näive patients. In this study, treatment consists of a divergent drug regimen (PI and nucleoside reverse transcriptase inhibitors, NRTIs) targeting both HIV-1 protease and reverse transcriptase or a convergent regimen targeting reverse transcriptase alone (three NRTIs or two NRTIs plus a NNRTI). A clinical endpoint study (BI 1090) compared the efficacy and durability of multi-drug regimens in ARV näive patients with high baseline plasma HIV-1 RNA levels (pVLs) and low peripheral blood CD4+ lymphocyte counts. Data from these studies confirm that triple regimens containing NVP suppressed viral replication for up to one year, even when the ARV näive patients had low CD4+ cell counts at baseline. Nevirapine-containing regimens suppressed pVLs to < 50 copies/ mL in approximately 50% of patients in the studies discussed (Intent to Treat analyses). Data from 96 weeks of follow up in the Atlantic Study demonstrates that the regimens containing didanosine and stavudine plus indinavir or NVP were significantly more successful in suppressing pVLs to < 50 copies/mL during this period than a regimen composed of these NRTIs and lamivudine (p < or = 0.001). As with other ARV drugs, NVP should always be used as part of a fully suppressive ARV regimen

  3. Recent patents on ophthalmic nanoformulations and therapeutic implications.

    PubMed

    Ako-Adounvo, Ann-Marie; Nagarwal, Ramesh C; Oliveira, Lais; Boddu, Sai H S; Wang, Xiang S; Dey, Surajit; Karla, Pradeep K

    2014-01-01

    Nanoformulations (NF) are widely explored as potential alternatives for traditional ophthalmic formulation approaches. The effective treatment of ocular diseases using conventional eye drops is often hampered by factors such as: physiological barriers, rapid elimination, protein binding, and enzymatic drug degradation. Combined, these factors are known to contribute to reduced ocular residence time and poor bioavailability. Recent research studies demonstrated that NF can significantly enhance the therapeutic efficacy and bioavailability of ocular drugs, compared to the established ophthalmic drug delivery strategies. The research studies resulted in a number of patent inventions, reporting a significant increase in therapeutic efficacy for various chronic ocular disease states of both the anterior and posterior ocular segments. This article reviews these patent disclosures in detail and emphasizes the therapeutic advantages conferred by the following nanoformulation approaches: Calcium Phosphate (CaP) nanoparticles, Liposomes, Nanoemulsions, Nanomicelles, and Hydrogels. The nanoformulation approaches were shown to enhance the ocular bioavailability by reducing the drugprotein binding, increasing the corneal resident time, enhancing the drug permeability and providing a sustained drug release. Further, the article discusses United States Food and Drug Administration (USFDA) approved ocular drugs employing nanotechnology and future developments. It should be noted that, despite the potential therapeutic promise demonstrated by nanotechnology for ocular drug delivery, the bench to bed transition from patent inventions to marketed drug products has been insignificant. Majority of the discussed technologies are still in development and testing phase for commercial viability. Further, studies are in progress to assess ocular tolerance and nanotoxicity for prolonged use of NF.

  4. Recent Patents on Ophthalmic Nanoformulations and Therapeutic Implications

    PubMed Central

    Ako-Adounvo, Ann-Marie; Nagarwal, Ramesh C.; Oliveira, Lais; Boddu, Sai H.S.; Wang, Xiang S.; Dey, Surajit; Karla, Pradeep K.

    2015-01-01

    Nanoformulations (NF) are widely explored as potential alternatives for traditional ophthalmic formulation approaches. The effective treatment of ocular diseases using conventional eye drops is often hampered by factors such as: physiological barriers, rapid elimination, protein binding, and enzymatic drug degradation. Combined, these factors are known to contribute to reduced ocular residence time and poor bioavailability. Recent research studies demonstrated that NF can significantly enhance the therapeutic efficacy and bioavailability of ocular drugs, compared to the established ophthalmic drug delivery strategies. The research studies resulted in a number of patent inventions, reporting a significant increase in therapeutic efficacy for various chronic ocular disease states of both the anterior and posterior ocular segments. This article reviews these patent disclosures in detail and emphasizes the therapeutic advantages conferred by the following nanoformulation approaches: Calcium Phosphate (CaP) nanoparticles, Liposomes, Nanoemulsions, Nanomicelles, and Hydrogels. The nanoformulation approaches were shown to enhance the ocular bioavailability by reducing the drugprotein binding, increasing the corneal resident time, enhancing the drug permeability and providing a sustained drug release. Further, the article discusses United States Food and Drug Administration (USFDA) approved ocular drugs employing nanotechnology and future developments. It should be noted that, despite the potential therapeutic promise demonstrated by nanotechnology for ocular drug delivery, the bench to bed transition from patent inventions to marketed drug products has been insignificant. Majority of the discussed technologies are still in development and testing phase for commercial viability. Further, studies are in progress to assess ocular tolerance and nanotoxicity for prolonged use of NF. PMID:25262835

  5. Determinants of HIV drug resistance and public health implications in low- and middle-income countries.

    PubMed

    Bertagnolio, Silvia; De Luca, Andrea; Vitoria, Marco; Essajee, Shaffiq; Penazzato, Martina; Hong, Steven Y; McClure, Craig; Duncombe, Chris; Jordan, Michael R

    2012-01-01

    Global scale-up of antiretroviral therapy (ART) in low- and middle-income countries (LMICs) is an unprecedented public health achievement. With planned efforts of expanded ART access including earlier treatment initiation and the use of antiretroviral (ARV) drugs for prophylaxis, increasing levels of HIV drug resistance (HIVDR) are expected.Several factors may lead to selection and transmission of significant HIVDR in LMICs, which will lead to decreased population-level efficacy of standard first- and second-line ART regimens. These factors include low genetic barrier of some ARVs to resistance development, drug-drug interactions, inappropriate prescribing practices, interruption of drug supply, poor retention in care and lack of routine viral load monitoring.To maximize long-term effectiveness of available ARVs, policy makers and programme managers in LMICs should routinely monitor programme factors associated with emergence and transmission of HIVDR and implement routine HIVDR surveillance following standardized methods. When surveillance results suggest the need for action, specific public health interventions must be taken to adjust ART programme functioning to minimize further emergence and transmission of HIVDR.In this paper, we review ARV drug, HIV, patient and programme-related determinants of HIVDR. Additionally, we summarize the World Health Orgnization's global HIVDR surveillance and prevention strategy and describe resulting public health and policy implications. PMID:22898622

  6. Recreational Drugs and HIV

    MedlinePlus

    ... when used with didanosine (Videx, fact_sheet 413 ) Cocaine Although interactions between cocaine and ARVs are unlikely to increase cocaine toxicity, the cocaine use may decrease ARV effectiveness ...

  7. 43 CFR 6.52 - Patents.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 1 2011-10-01 2011-10-01 false Patents. 6.52 Section 6.52 Public Lands: Interior Office of the Secretary of the Interior PATENT REGULATIONS Licenses § 6.52 Patents. Patents in... sublicenses, are classified as follows: (a) Class A. Patents, other than those referred to in paragraph (c)...

  8. 37 CFR 501.9 - Patent protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Patent protection. 501.9 Section 501.9 Patents, Trademarks, and Copyrights UNDER SECRETARY FOR TECHNOLOGY, DEPARTMENT OF COMMERCE UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES § 501.9 Patent protection....

  9. 37 CFR 501.9 - Patent protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Patent protection. 501.9 Section 501.9 Patents, Trademarks, and Copyrights UNDER SECRETARY FOR TECHNOLOGY, DEPARTMENT OF COMMERCE UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES § 501.9 Patent protection....

  10. 37 CFR 501.9 - Patent protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent protection. 501.9 Section 501.9 Patents, Trademarks, and Copyrights UNDER SECRETARY FOR TECHNOLOGY, DEPARTMENT OF COMMERCE UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES § 501.9 Patent protection....

  11. 43 CFR 6.52 - Patents.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Patents. 6.52 Section 6.52 Public Lands: Interior Office of the Secretary of the Interior PATENT REGULATIONS Licenses § 6.52 Patents. Patents in... sublicenses, are classified as follows: (a) Class A. Patents, other than those referred to in paragraph (c)...

  12. 75 FR 17380 - Patents Ombudsman Pilot Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-06

    ... procedure. See Request for Comments on Patents Ombudsman Pilot Program, 74 FR 55212 (Oct. 27, 2009), 1348... United States Patent and Trademark Office Patents Ombudsman Pilot Program AGENCY: United States Patent and Trademark Office, Commerce. ACTION: Notice. SUMMARY: The United States Patent and Trademark...

  13. 43 CFR 6.52 - Patents.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 1 2012-10-01 2011-10-01 true Patents. 6.52 Section 6.52 Public Lands: Interior Office of the Secretary of the Interior PATENT REGULATIONS Licenses § 6.52 Patents. Patents in... sublicenses, are classified as follows: (a) Class A. Patents, other than those referred to in paragraph (c)...

  14. 43 CFR 6.52 - Patents.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 1 2013-10-01 2013-10-01 false Patents. 6.52 Section 6.52 Public Lands: Interior Office of the Secretary of the Interior PATENT REGULATIONS Licenses § 6.52 Patents. Patents in... sublicenses, are classified as follows: (a) Class A. Patents, other than those referred to in paragraph (c)...

  15. 43 CFR 6.52 - Patents.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 1 2014-10-01 2014-10-01 false Patents. 6.52 Section 6.52 Public Lands: Interior Office of the Secretary of the Interior PATENT REGULATIONS Licenses § 6.52 Patents. Patents in... sublicenses, are classified as follows: (a) Class A. Patents, other than those referred to in paragraph (c)...

  16. Biotechnology patents and ethical aspects.

    PubMed

    Terragni, F

    1993-01-01

    Should we set any limits on patenting? More specifically, must we set any limits on patenting in the field of biotechnology? There should be general agreement on the exclusion of humans from patentability. The European Parliament voted unanimously on an amendment to the Community Directive regarding patenting stating that the human body and its parts are not patentable as such. Patenting of humans indeed would be against fundamental human rights; against the shared principles of freedom, autonomy, and dignity of each single human being. The same reasons apply to requests to reject the "commercialization of the human body." However, much more difficult is reaching a consensus on what are the parts of humans that should not be marketed--organs, tissues, cells, genes, smaller DNA fragments? Probably there is no consensus on where to draw the line when we deal with parts of the human body. Nevertheless, an ethical component is very strong in raising opposition to patenting human DNA. Whatever our personal view on the issue, we cannot deny that ethical aspects must be considered in granting patents on human DNA. With reference to animals, the fears raised are that the patenting of transgenic animals could amplify the instrumental use (reification) and the neglect of their sentient nonobjectual nature: patenting could motivate, instead, the tendency to consider animals as the standard of things invented and as new consumer products. Moreover, animal patenting increases production and thus brings about the great suffering of animals. In regard to plants, the ethical implications of patenting have more to do with their socioeconomic effects, in particular on Third World countries, than for the organisms involved.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Drugs.

    ERIC Educational Resources Information Center

    Hurst, Hunter, Ed.; And Others

    1984-01-01

    This document contains the third volume of "Today's Delinquent," an annual publication of the National Center for Juvenile Justice. This volume deals with the issue of drugs and includes articles by leading authorities in delinquency and substance abuse who share their views on causes and cures for the drug problem among youth in this country.…

  18. 75 FR 54888 - Determination of Regulatory Review Period for Purposes of Patent Extension; IXIARO

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-09

    .... 1061, Rockville, MD 20852. FOR FURTHER INFORMATION CONTACT: Beverly Friedman, Office of Regulatory... 20993-0002, 301-796-3602. SUPPLEMENTARY INFORMATION: The Drug Price Competition and Patent Term... years of age and older. Subsequent to this approval, the Patent and Trademark Office received a...

  19. New patents on topical anesthetics.

    PubMed

    Cantisani, Carmen; Macaluso, Laura; Frascani, Federica; Paolino, Giovanni; D'Andrea, Vito; Richetta, Antonio G; Calvieri, Stefano

    2014-01-01

    Anesthesia is defined as a total or partial loss of sensation and it may be general, local or topical, depending on the method of drug administration and area of the body affected. General anesthesia is a reversible state of unconsciousness produced by anesthetic agents, characterized by amnesia, muscle relaxation and loss of sensitivity to pain of the whole body. General anesthetic drugs can be classified into two main groups according to their predominant molecular pharmacological effects: volatile and intravenous agents. Local anesthesia produce a reversible loss of sensation in a portion of the body and it reversibly block impulse conduction along nerve axons and other excitable membrane. All local anesthetics (LA) are membrane stabilizing drugs; they reversibly decrease the rate of depolarization and repolarization of excitable membranes. They act mainly by inhibiting sodium influx through sodium-specific ion channels in the neuronal cell membrane, in particular the voltage-gated sodium channels. When the influx of sodium is interrupted, an action potential cannot arise and signal conduction is inhibited. The main local anesthetic (LA) agents for skin anesthesia are benzocaine (aminoester), prilocaine and lidocaine (aminoamides) which are commercially available as gels, ointments and creams (benzocaine and eutectic mixture of lidocaine and prilocaine) or as a bioadhesive (lidocaine) with different compositions (vehicles and excipients) for adults or pediatric use. Topical anesthetics decrease anxiety, pain and discomfort during cutaneous procedures and provide effective analgesia with rapid onset, prolonged duration and minimal side effects. This article outlines the different classes of topical anesthetics available and gives an overview of the mechanism of action, metabolism of each different class, of the possible complications that can occur because of their use and their possible treatment options and new patents.

  20. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and...

  1. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and...

  2. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and...

  3. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and...

  4. 77 FR 4509 - Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-30

    ... United States Patent and Trademark Office 37 CFR Chapter I Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule AGENCY: United States Patent and Trademark Office, Department... (AIA), the United States Patent and Trademark Office (USPTO) may set or adjust by rule any patent...

  5. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patents subject to extension of the patent term. 1.710 Section 1.710 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and...

  6. Polymorphs and Prodrugs and Salts (Oh My!): An Empirical Analysis of “Secondary” Pharmaceutical Patents

    PubMed Central

    2012-01-01

    Background While there has been much discussion by policymakers and stakeholders about the effects of “secondary patents” on the pharmaceutical industry, there is no empirical evidence on their prevalence or determinants. Characterizing the landscape of secondary patents is important in light of recent court decisions in the U.S. that may make them more difficult to obtain, and for developing countries considering restrictions on secondary patents. Methodology/Principal Findings We read the claims of the 1304 Orange Book listed patents on all new molecular entities approved in the U.S. between 1988 and 2005, and coded the patents as including chemical compound claims (claims covering the active molecule itself) and/or one of several types of secondary claims. We distinguish between patents with any secondary claims, and those with only secondary claims and no chemical compound claims (“independent” secondary patents). We find that secondary claims are common in the pharmaceutical industry. We also show that independent secondary patents tend to be filed and issued later than chemical compound patents, and are also more likely to be filed after the drug is approved. When present, independent formulation patents add an average of 6.5 years of patent life (95% C.I.: 5.9 to 7.3 years), independent method of use patents add 7.4 years (95% C.I.: 6.4 to 8.4 years), and independent patents on polymorphs, isomers, prodrug, ester, and/or salt claims add 6.3 years (95% C.I.: 5.3 to 7.3 years). We also provide evidence that late-filed independent secondary patents are more common for higher sales drugs. Conclusions/Significance Policies and court decisions affecting secondary patenting are likely to have a significant impact on the pharmaceutical industry. Secondary patents provide substantial additional patent life in the pharmaceutical industry, at least nominally. Evidence that they are also more common for best-selling drugs is consistent with accounts of active

  7. Simple, illustrated medicines information improves ARV knowledge and patient self-efficacy in limited literacy South African HIV patients.

    PubMed

    Dowse, R; Barford, K; Browne, S H

    2014-01-01

    Few studies have investigated antiretroviral (ARV) knowledge and self-efficacy in limited literacy patients. Using a randomized controlled study design, we investigated the influence of a simple pre-tested patient information leaflet (PIL) containing both text and illustrations on HIV- and ARV-related knowledge and on self-efficacy over six months in a limited literacy African population. The recruited patients were randomly allocated to either control (standard care) or intervention group (standard care plus illustrated PIL). HIV and medicines-related knowledge was evaluated with a 22-question test at baseline, one, three, and six months. Self-efficacy was assessed using a modified version of the HIV Treatment Adherence Self-Efficacy Scale. Two-thirds of the patients were female, mean age was 39.0 ± 9.6 years and mean education was 7.3 ± 2.8 years. Patients who received the PIL showed a significant knowledge increase over the six-month period (62.0-94.4%), with improvement at each subsequent interview whereas the control group showed no improvement. At baseline, side effect knowledge was the lowest (50-56%) but increased in the intervention group to 92%. Similarly, other medicine-related knowledge at baseline (57-67%) improved significantly (93%) and was sustained over six months. Cohen's d values post-baseline ranged between 1.36 and 2.18, indicating a large intervention effect. Self-efficacy improved significantly over six months in intervention but not control patients. At baseline, patients with ≤ 3 years of education had lower knowledge and self-efficacy but this was not observed post-intervention, which we attribute to the PIL mitigating the effect of limited education. Knowledge and self-efficacy were significantly correlated in the intervention group. In conclusion, a low-cost intervention of a well-designed, pre-tested, simple, illustrated PIL significantly increased both ARV knowledge and self-efficacy in HIV patients with limited education.

  8. Effects of Hormonal Contraception on Anti-Retroviral Drug Metabolism, Pharmacokinetics and Pharmacodynamics

    PubMed Central

    Thurman, Andrea Ries; Anderson, Sharon; Doncel, Gustavo F

    2014-01-01

    Among women, human immunodeficiency virus type 1 (HIV-1) infection is most prevalent in those of reproductive age. These women are also at risk of unintended or mistimed pregnancies. Hormonal contraceptives (HCs) are one of the most commonly used methods of family planning world-wide. Therefore concurrent use of HC among women on anti-retroviral medications (ARVs) is increasingly common. ARVs are being investigated and have been approved for pre-exposure prophylaxis (PrEP), and therefore drug-drug interactions must also be considered in HIV-1 negative women who want to prevent both unintended pregnancy and HIV-1 infection. This article will review four main interactions: (1) the effect of HCs on ARV pharmacokinetics (PK) and pharmacodynamics (PD) during therapy, (2) the effect of ARVs on HC PK and PD, (3) the role of drug transporters on drug-drug interactions and (4) ongoing research into the effect of HCs on pre-exposure prophylaxis PK and PD. PMID:24521428

  9. Patent foramen ovale and cryptogenic stroke: the hole story.

    PubMed

    Furlan, Anthony J; Jauss, Marek

    2013-09-01

    Despite 3 recent randomized clinical trials, the management of patients with cryptogenic stroke and patent foramen ovale remains unsettled. The primary results of Evaluation of the STARFlex Septal Closure System in Patients with a Stroke and/or Transient Ischemic Attack due to Presumed Paradoxical Embolism Through a Patent Foramen Ovale (CLOSURE), Percutaneous Closure of Patent Foramen Ovale in Cryptogenic Stroke (PC), and Randomized Evaluation of Recurrent Stroke Comparing PFO Closure to Established Current Standard of Care Treatment (RESPECT) were the same; the intent to treat analysis for the primary end point in all 3 trials failed to demonstrate superiority of device closure compared with medical therapy. CLOSURE put the brakes on indiscriminate device closure of patent foramen ovales in patients with cryptogenic stroke or transient ischemic attack. RESPECT suggested, but did not prove, that highly selected patients without vascular risk factors, with a cortical infarct on baseline magnetic resonance imaging and a substantial patent foramen ovale shunt may benefit from the Amplatzer device during a multiple-year period. In the absence of definitive clinical trial results, the precise definition of which patient subgroups should be considered for patent foramen ovale device closure should be agreed to by the stakeholder societies and the Food and Drug Administration.

  10. Towards a Patent Pool for HIV Medicines: The Background.

    PubMed

    Childs, Michelle

    2010-01-01

    Recent WHO guidelines for antiretroviral therapy recommend switching to less toxic, but more expensive medicines for first-line and second-line ART, raising questions about the financial sustainability of many AIDS treatment programmes. At the same time, many key generic producing countries such as India now grant pharmaceutical product patents so competition between multiple manufacturers will not be able to play the role it has in bringing down the price of newer drugs.Overcoming these patent barriers will require a range of solutions, such as restricting patentability criteria, or compulsory licensing. One additional systematic solution is provided by the patent pool, a collective solution to the management of patent rights, initially presented by Médecins Sans Frontières to the French Foreign Ministry and subsequently the UNITAID Executive Board in 2006.A patent pool must not be implemented at any costs, but answer medical needs, be based on economic realities and meet the access needs of the developing world, including middle-income countries. PMID:20148090

  11. Towards a Patent Pool for HIV Medicines: The Background.

    PubMed

    Childs, Michelle

    2010-01-19

    Recent WHO guidelines for antiretroviral therapy recommend switching to less toxic, but more expensive medicines for first-line and second-line ART, raising questions about the financial sustainability of many AIDS treatment programmes. At the same time, many key generic producing countries such as India now grant pharmaceutical product patents so competition between multiple manufacturers will not be able to play the role it has in bringing down the price of newer drugs.Overcoming these patent barriers will require a range of solutions, such as restricting patentability criteria, or compulsory licensing. One additional systematic solution is provided by the patent pool, a collective solution to the management of patent rights, initially presented by Médecins Sans Frontières to the French Foreign Ministry and subsequently the UNITAID Executive Board in 2006.A patent pool must not be implemented at any costs, but answer medical needs, be based on economic realities and meet the access needs of the developing world, including middle-income countries.

  12. SureChEMBL: a large-scale, chemically annotated patent document database

    PubMed Central

    Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A.; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P.

    2016-01-01

    SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. PMID:26582922

  13. SureChEMBL: a large-scale, chemically annotated patent document database.

    PubMed

    Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P

    2016-01-01

    SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/.

  14. SureChEMBL: a large-scale, chemically annotated patent document database.

    PubMed

    Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P

    2016-01-01

    SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. PMID:26582922

  15. Patent and product piracy

    NASA Astrophysics Data System (ADS)

    Ignat, V.

    2016-08-01

    Advanced industrial countries are affected by technology theft. German industry annually loses more than 50 billion euros. The main causes are industrial espionage and fraudulent copying patents and industrial products. Many Asian countries are profiteering saving up to 65% of production costs. Most affected are small medium enterprises, who do not have sufficient economic power to assert themselves against some powerful countries. International organizations, such as Interpol and World Customs Organization - WCO - work together to combat international economic crime. Several methods of protection can be achieved by registering patents or specific technical methods for recognition of product originality. They have developed more suitable protection, like Hologram, magnetic stripe, barcode, CE marking, digital watermarks, DNA or Nano-technologies, security labels, radio frequency identification, micro color codes, matrix code, cryptographic encodings. The automotive industry has developed the method “Manufactures against Product Piracy”. A sticker on the package features original products and it uses a Data Matrix verifiable barcode. The code can be recorded with a smartphone camera. The smartphone is connected via Internet to a database, where the identification numbers of the original parts are stored.

  16. "It's important to take your medication everyday okay?" An evaluation of counselling by lay counsellors for ARV adherence support in the Western Cape, South Africa.

    PubMed

    Dewing, S; Mathews, C; Schaay, N; Cloete, A; Louw, J; Simbayi, L

    2013-01-01

    There is growing interest in standard care programmes for antiretroviral (ARV) adherence support. In South Africa, individual counselling following ARV initiation is a main strategy for supporting adherence in the public sector. Egan's client-centred "Skilled Helper" counselling model is the predominant model used in HIV counselling in this context. This study evaluated counselling delivered by lay ARV adherence counsellors in Cape Town in terms of adherence to Egan's model. Thirty-eight transcripts of counselling sessions with non-adherent patients were analysed based on the methods of content analysis. These sessions were conducted by 30 counsellors. Generally counsellors' practice adhered neither to Egan's model nor a client-centred approach. Inconsistent with evidence-based approaches to counselling for ARV adherence support, counsellors mainly used information-giving and advice as strategies for addressing clients' non-adherence. Recommendations for improving practice are made. The question as to how appropriate strategies from developed countries are for this setting is also raised.

  17. Gene Patents on the Line

    PubMed Central

    Carlson, Bob

    2009-01-01

    Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Patent Statute (USC 35, Part II, Chapter 10, Section 101). PMID:22478783

  18. Online Patent Searching: The Realities.

    ERIC Educational Resources Information Center

    Kaback, Stuart M.

    1983-01-01

    Considers patent subject searching capabilities of major online databases, noting patent claims, "deep-indexed" files, test searches, retrieval of related references, multi-database searching, improvements needed in indexing of chemical structures, full text searching, improvements needed in handling numerical data, and augmenting a subject search…

  19. Patent Pools: Intellectual Property Rights and Competition

    PubMed Central

    Rodriguez, Victor

    2010-01-01

    Patent pools do not correct all problems associated with patent thickets. In this respect, patent pools might not stop the outsider problem from striking pools. Moreover, patent pools can be expensive to negotiate, can exclude patent holders with smaller numbers of patents or enable a group of major players to form a cartel that excludes new competitors. For all the above reasons, patent pools are subject to regulatory clearance because they could result in a monopoly. The aim of this article is to present the relationship between patents and competition in a broad context. PMID:20200607

  20. Behaviour change counselling for ARV adherence support within primary health care facilities in the Western Cape, South Africa.

    PubMed

    Dewing, S; Mathews, C; Schaay, N; Cloete, A; Louw, J; Simbayi, L

    2012-07-01

    Health care systems have been described as ideal settings for behaviour change counselling interventions. There is little research evaluating the feasibility of implementing such interventions in routine practice in primary care facilities. We implemented an intervention called Options for Health within routine adherence counselling practice in 20 antiretroviral facilities in Cape Town, South Africa. Lay counsellors were trained to use Options to help clients to optimise ARV adherence and reduce sexual risk behaviour. Counsellors delivered the intervention to 9% of eligible patients over 12 months. Interviews with counsellors revealed barriers to implementation including a lack of counselling space, time pressure and patient resistance to counselling. Counsellors felt that Options was not appropriate for use with all patients and adherence problems, and used parts of the intervention as it suited their needs. Findings revealed weaknesses in the current adherence counselling system that have implications for the feasibility of behaviour change counselling within this context.

  1. [Patent rights and biotechnological inventions].

    PubMed

    Lobato García-Miján, M

    1998-01-01

    In spite of all the controversy surrounding it and the problems encountered in the process leading to its adoption, the Directive on the legal protection of biotechnology inventions does not feature anything substantially new compared to the criteria used by patent offices in determining whether inventions of this type can be patented. The Directive's originality stems not so much from the interpretation given of patenting requirements but rather from the legal importance attached to issues of public policy or morality. It sets out and interprets for the member states of the European Union what is meant by the term. However, in our opinion this regulation of morality reflects above all else an attempt to satisfy the views of sectors opposed to the Directive. Clearly, there is some doubt as to whether in practice patents for genetic material can be turned down because they run counter to morality, except in blatant cases of immorality (applications for patents for human embryos, etc).

  2. Revitalizing the patent system to incentivize pharmaceutical innovation: the potential of claims with means-plus-function clauses.

    PubMed

    Tang, Wanli Lily

    2013-02-01

    The pharmaceutical industry relies on innovation. However, many innovative firms are cutting their research and development investments and seeing their new product pipelines dry up, due in part to a lack of sufficient patent protection. This Note identifies two major factors that have caused this inadequacy in patent protection. First, pharmaceutical patents are challenged early and often by generic manufacturers, as encouraged by the 1984 Hatch-Waxman Act. Second, the scope of pharmaceutical-patents is sometimes unduly restrained due to limited application of the doctrine of equivalents. Consequently, pharmaceutical patents, especially drug-product patents, are easily designed around and cannot offer the protection necessary for innovative firms to recoup their developmental costs. This Note argues for a wider application of means-plus-function clauses in pharmaceutical patents as a potential cure for this problem. Means-plus-function claims, although authorized by Congress in the 1952 Patent Act, have not been explored much in the pharmaceutical context. This Note argues that this claiming strategy is not only appropriate but also particularly effective for pharmaceutical patents. Means-plus-function claims would give drug-product patents adequate scope even with the limited use of the doctrine of equivalents and thus would provide the protection necessary for innovative firms to withstand frequent attacks by generic manufacturers. Finally, this Note examines issues anticipated with applying means-plus-function claims to pharmaceutical patents and proposes possible solutions.

  3. Patent arterial duct.

    PubMed

    Forsey, Jonathan T; Elmasry, Ola A; Martin, Robin P

    2009-07-10

    Patent arterial duct (PAD) is a congenital heart abnormality defined as persistent patency in term infants older than three months. Isolated PAD is found in around 1 in 2000 full term infants. A higher prevalence is found in preterm infants, especially those with low birth weight. The female to male ratio is 2:1. Most patients are asymptomatic when the duct is small. With a moderate-to-large duct, a characteristic continuous heart murmur (loudest in the left upper chest or infraclavicular area) is typical. The precordium may be hyperactive and peripheral pulses are bounding with a wide pulse pressure. Tachycardia, exertional dyspnoea, laboured breathing, fatigue or poor growth are common. Large shunts may lead to failure to thrive, recurrent infection of the upper respiratory tract and congestive heart failure. In the majority of cases of PAD there is no identifiable cause. Persistence of the duct is associated with chromosomal aberrations, asphyxia at birth, birth at high altitude and congenital rubella. Occasional cases are associated with specific genetic defects (trisomy 21 and 18, and the Rubinstein-Taybi and CHARGE syndromes). Familial occurrence of PAD is uncommon and the usual mechanism of inheritance is considered to be polygenic with a recurrence risk of 3%. Rare families with isolated PAD have been described in which the mode of inheritance appears to be dominant or recessive. Familial incidence of PAD has also been linked to Char syndrome, familial thoracic aortic aneurysm/dissection associated with patent arterial duct, and familial patent arterial duct and bicuspid aortic valve associated with hand abnormalities. Diagnosis is based on clinical examination and confirmed with transthoracic echocardiography. Assessment of ductal blood flow can be made using colour flow mapping and pulsed wave Doppler. Antenatal diagnosis is not possible, as PAD is a normal structure during antenatal life. Conditions with signs and symptoms of pulmonary overcirculation

  4. Patent arterial duct

    PubMed Central

    Forsey, Jonathan T; Elmasry, Ola A; Martin, Robin P

    2009-01-01

    Patent arterial duct (PAD) is a congenital heart abnormality defined as persistent patency in term infants older than three months. Isolated PAD is found in around 1 in 2000 full term infants. A higher prevalence is found in preterm infants, especially those with low birth weight. The female to male ratio is 2:1. Most patients are asymptomatic when the duct is small. With a moderate-to-large duct, a characteristic continuous heart murmur (loudest in the left upper chest or infraclavicular area) is typical. The precordium may be hyperactive and peripheral pulses are bounding with a wide pulse pressure. Tachycardia, exertional dyspnoea, laboured breathing, fatigue or poor growth are common. Large shunts may lead to failure to thrive, recurrent infection of the upper respiratory tract and congestive heart failure. In the majority of cases of PAD there is no identifiable cause. Persistence of the duct is associated with chromosomal aberrations, asphyxia at birth, birth at high altitude and congenital rubella. Occasional cases are associated with specific genetic defects (trisomy 21 and 18, and the Rubinstein-Taybi and CHARGE syndromes). Familial occurrence of PAD is uncommon and the usual mechanism of inheritance is considered to be polygenic with a recurrence risk of 3%. Rare families with isolated PAD have been described in which the mode of inheritance appears to be dominant or recessive. Familial incidence of PAD has also been linked to Char syndrome, familial thoracic aortic aneurysm/dissection associated with patent arterial duct, and familial patent arterial duct and bicuspid aortic valve associated with hand abnormalities. Diagnosis is based on clinical examination and confirmed with transthoracic echocardiography. Assessment of ductal blood flow can be made using colour flow mapping and pulsed wave Doppler. Antenatal diagnosis is not possible, as PAD is a normal structure during antenatal life. Conditions with signs and symptoms of pulmonary overcirculation

  5. Patenting the life sciences at the European Patent Office.

    PubMed

    Gates, Christina

    2014-12-01

    The European patent system is very much like those of the United States and other major countries. Patent applications can be filed as a first filing, as a priority application, or as a national phase of a Patent Cooperation Treaty application. The applications are searched, rigorously examined, and ultimately granted, with the time periods varying somewhat depending on the application type. The object of this article is to highlight some of the differences between the U.S. and European systems, particularly as they relate to life sciences. PMID:25342060

  6. Patenting genetic diagnostic methods: NGS, GWAS, SNPs and patents.

    PubMed

    Lawson, Charles

    2015-06-01

    This article reviews the problems posed by patent claims to genetic diagnostic methods associated with genome-wide association studies (GWAS) adopting methodologies using next-generation sequencing (NGS) and single nucleotide polymorphisms (SNP). These problems are essentially about experimental reproducibility and the credibility and veracity of reported developments. An analysis of the relevant law demonstrates that the current Australian and United States laws about suitable patentable subject matter differ, and that the current reproducibility (sufficiency, enablement and inutility) standards are unlikely to address these problems. The article concludes that following the United States approach excluding these genetic diagnostic method claims from patenting is one solution. Failing this, improving analysis and quality controls that are now being adopted in the basic research will reduce the nature of the problems, although this will remain problematic for patent examiners and the broader public.

  7. Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs

    PubMed Central

    Hijazi, Karolin; Cuppone, Anna M.; Smith, Kieron; Stincarelli, Maria A.; Ekeruche-Makinde, Julia; De Falco, Giulia; Hold, Georgina L.; Shattock, Robin; Kelly, Charles G.; Pozzi, Gianni; Iannelli, Francesco

    2015-01-01

    Anti-retroviral (ARV) –based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on expression of drug

  8. 77 FR 26768 - Determination of Regulatory Review Period for Purposes of Patent Extension; PROLIA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-07

    ... 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L. 100-670... (human drug product, animal drug product, medical device, food additive, or color additive) was subject... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  9. 77 FR 26556 - Determination of Regulatory Review Period for Purposes of Patent Extension; EQUIDONE GEL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-04

    ... Patent Extension; EQUIDONE GEL AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) has determined the regulatory review period for EQUIDONE GEL and is....S.C. 156(g)(4)(B). FDA approved for marketing the animal drug product EQUIDONE GEL...

  10. 76 FR 24034 - Determination of Regulatory Review Period for Purposes of Patent Extension; CONVENIA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-29

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration Determination of Regulatory Review Period for Purposes of... patented item (human drug product, animal drug product, medical device, food additive, or color...

  11. 78 FR 6826 - Determination of Regulatory Review Period for Purposes of Patent Extension; BEYAZ

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-31

    ... 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L. 100-670... (human drug product, animal drug product, medical device, food additive, or color additive) was subject... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  12. 75 FR 76741 - Determination of Regulatory Review Period for Purposes of Patent Extension; SABRIL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-09

    ... 1984 (Pub. L. 98-417) and the Generic Animal Drug and Patent Term Restoration Act (Pub. L. 100-670... (human drug product, animal drug product, medical device, food additive, or color additive) was subject... regulatory review period consists of two periods of time: A testing phase and an approval phase. For...

  13. Developing a Systematic Patent Search Training Program

    ERIC Educational Resources Information Center

    Zhang, Li

    2009-01-01

    This study aims to develop a systematic patent training program using patent analysis and citation analysis techniques applied to patents held by the University of Saskatchewan. The results indicate that the target audience will be researchers in life sciences, and aggregated patent database searching and advanced search techniques should be…

  14. 43 CFR 2544.5 - Patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patent. 2544.5 Section 2544.5 Public Lands...: Louisiana § 2544.5 Patent. Upon the submission of satisfactory proof, the Bureau will, if no protest or contest is pending, issue patent, such patent to contain a stipulation that all the minerals in the...

  15. 43 CFR 2544.5 - Patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patent. 2544.5 Section 2544.5 Public Lands...: Louisiana § 2544.5 Patent. Upon the submission of satisfactory proof, the Bureau will, if no protest or contest is pending, issue patent, such patent to contain a stipulation that all the minerals in the...

  16. 43 CFR 2741.9 - Patent provisions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patent provisions. 2741.9 Section 2741.9... Public Purposes Act: Requirements § 2741.9 Patent provisions. (a) All patents under the act shall provide... management plan. (b) Patents shall also provide that the Secretary of the Interior may take action to...

  17. 43 CFR 2544.5 - Patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patent. 2544.5 Section 2544.5 Public Lands...: Louisiana § 2544.5 Patent. Upon the submission of satisfactory proof, the Bureau will, if no protest or contest is pending, issue patent, such patent to contain a stipulation that all the minerals in the...

  18. 78 FR 31885 - Patent Term Extension

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-28

    ... Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its continuing effort to reduce...: Susan K. Fawcett, Records Officer, Office of the Chief Information Officer, United States Patent...

  19. 43 CFR 2544.5 - Patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patent. 2544.5 Section 2544.5 Public Lands...: Louisiana § 2544.5 Patent. Upon the submission of satisfactory proof, the Bureau will, if no protest or contest is pending, issue patent, such patent to contain a stipulation that all the minerals in the...

  20. 43 CFR 2741.9 - Patent provisions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patent provisions. 2741.9 Section 2741.9... Public Purposes Act: Requirements § 2741.9 Patent provisions. (a) All patents under the act shall provide... management plan. (b) Patents shall also provide that the Secretary of the Interior may take action to...

  1. 43 CFR 2741.9 - Patent provisions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patent provisions. 2741.9 Section 2741.9... Public Purposes Act: Requirements § 2741.9 Patent provisions. (a) All patents under the act shall provide... management plan. (b) Patents shall also provide that the Secretary of the Interior may take action to...

  2. 78 FR 67339 - Initial Patent Applications

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-12

    ... Patent and Trademark Office Initial Patent Applications ACTION: Proposed collection; Extension of Comment Period. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its continuing efforts... Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450. Federal Rulemaking Portal:...

  3. 37 CFR 501.9 - Patent protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Patent protection. 501.9 Section 501.9 Patents, Trademarks, and Copyrights NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES §...

  4. 37 CFR 501.9 - Patent protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Patent protection. 501.9 Section 501.9 Patents, Trademarks, and Copyrights NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE UNIFORM PATENT POLICY FOR RIGHTS IN INVENTIONS MADE BY GOVERNMENT EMPLOYEES §...

  5. 75 FR 20561 - Patent Term Extension

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-20

    ... Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its continuing effort to reduce... the Chief Information Officer, United States Patent and Trademark Office, P.O. Box 1450,...

  6. 75 FR 23227 - Initial Patent Applications

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-03

    ... Patent and Trademark Office Initial Patent Applications ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its continuing efforts to..., Records Officer, Office of the Chief Information Officer, U.S. Patent and Trademark Office, P.O. Box...

  7. 43 CFR 2741.9 - Patent provisions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patent provisions. 2741.9 Section 2741.9... Public Purposes Act: Requirements § 2741.9 Patent provisions. (a) All patents under the act shall provide... management plan. (b) Patents shall also provide that the Secretary of the Interior may take action to...

  8. 37 CFR 1.33 - Correspondence respecting patent applications, patent reexamination proceedings, and other...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Correspondence respecting patent applications, patent reexamination proceedings, and other proceedings. 1.33 Section 1.33 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES...

  9. 43 CFR 3815.8 - Notation required in application for patent; conditions required in patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... patent; conditions required in patent. 3815.8 Section 3815.8 Public Lands: Interior Regulations Relating... Notation required in application for patent; conditions required in patent. (a) Every application for patent for any minerals located subject to this Act must bear on its face, before being executed by...

  10. 43 CFR 3815.8 - Notation required in application for patent; conditions required in patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... patent; conditions required in patent. 3815.8 Section 3815.8 Public Lands: Interior Regulations Relating... Notation required in application for patent; conditions required in patent. (a) Every application for patent for any minerals located subject to this Act must bear on its face, before being executed by...

  11. 43 CFR 3815.8 - Notation required in application for patent; conditions required in patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... patent; conditions required in patent. 3815.8 Section 3815.8 Public Lands: Interior Regulations Relating... Notation required in application for patent; conditions required in patent. (a) Every application for patent for any minerals located subject to this Act must bear on its face, before being executed by...

  12. 37 CFR 1.33 - Correspondence respecting patent applications, patent reexamination proceedings, and other...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Correspondence respecting patent applications, patent reexamination proceedings, and other proceedings. 1.33 Section 1.33 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES...

  13. 43 CFR 3815.8 - Notation required in application for patent; conditions required in patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... patent; conditions required in patent. 3815.8 Section 3815.8 Public Lands: Interior Regulations Relating... Notation required in application for patent; conditions required in patent. (a) Every application for patent for any minerals located subject to this Act must bear on its face, before being executed by...

  14. Embryonic Stem Cell Patents and Human Dignity

    PubMed Central

    Resnik, David B.

    2009-01-01

    This article examines the assertion that human embryonic stem cells patents are immoral because they violate human dignity. After analyzing the concept of human dignity and its role in bioethics debates, this article argues that patents on human embryos or totipotent embryonic stem cells violate human dignity, but that patents on pluripotent or multipotent stem cells do not. Since patents on pluripotent or multipotent stem cells may still threaten human dignity by encouraging people to treat embryos as property, patent agencies should carefully monitor and control these patents to ensure that patents are not inadvertently awarded on embryos or totipotent stem cells. PMID:17922198

  15. The academic advantage: gender disparities in patenting.

    PubMed

    Sugimoto, Cassidy R; Ni, Chaoqun; West, Jevin D; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  16. Patent cliff mitigation strategies: giving new life to blockbusters.

    PubMed

    Kakkar, Ashish Kumar

    2015-01-01

    With several blockbuster drugs on the brink of another significant patent expiry cliff, innovator pharmaceutical firms are at risk of losing billions of dollars in sales to generic competition. With issues such as staggering R&D costs, reduced productivity and increasing governmental emphasis on pharmacoeconomics, timely planning and implementation of product lifecycle management strategies is becoming indispensable. A variety of strategies designed to mitigate the post-patent expiry revenue loss exist. These approaches range from fairly straightforward measures, such as strategic price cuts and launching own or authorized generics, to complex and lengthy ones, such as new formulations and indications that require companies to reinvent their pharmaceuticals. As patent expiries loom and product pipelines continue to remain thin, proactive planning for generic entry will be critical for pharma companies to drive growth and earnings in a sustainable manner.

  17. Patent cliff mitigation strategies: giving new life to blockbusters.

    PubMed

    Kakkar, Ashish Kumar

    2015-01-01

    With several blockbuster drugs on the brink of another significant patent expiry cliff, innovator pharmaceutical firms are at risk of losing billions of dollars in sales to generic competition. With issues such as staggering R&D costs, reduced productivity and increasing governmental emphasis on pharmacoeconomics, timely planning and implementation of product lifecycle management strategies is becoming indispensable. A variety of strategies designed to mitigate the post-patent expiry revenue loss exist. These approaches range from fairly straightforward measures, such as strategic price cuts and launching own or authorized generics, to complex and lengthy ones, such as new formulations and indications that require companies to reinvent their pharmaceuticals. As patent expiries loom and product pipelines continue to remain thin, proactive planning for generic entry will be critical for pharma companies to drive growth and earnings in a sustainable manner. PMID:26372691

  18. Recent patents in food nanotechnology.

    PubMed

    Pérez-Esteve, Edgar; Bernardos, Andrea; Martínez-Mañez, Ramón; Barat, José M

    2011-09-01

    Nanotechnology is a multidisciplinary field of current interest. The huge possibilities in most industries are making nanoscience grow at a rapid pace, but what is the real impact of nanotechnology in a traditional industry such as food? The study of patents published in the last 20 years provides the answer, and the results are quite surprising; the food industry is the fifth largest sector in terms of patents related to nanotechnology.

  19. Rightpollex: From Patent To Startup

    NASA Astrophysics Data System (ADS)

    Leba, Monica; Ionica, Andreea Cristina; Dobra, Remus

    2015-07-01

    RightPollex is an innovative product patented and developed by a multidisciplinary team from the University of Petrosani. The paper presents not only the idea and implementation possibilities of this patent, but also the current stage on the path towards the development of startups, an initiative of our university together with a private investor. The result of this initiative is JV Sensor Ventures that supports several startups.

  20. Formulation and Characterization of Polymeric Films Containing Combinations of Antiretrovirals (ARVs) for HIV Prevention

    PubMed Central

    Akil, Ayman; Agashe, Hrushikesh; Dezzutti, Charlene S.; Moncla, Bernard J.; Hillier, Sharon L.; Devlin, Brid; Shi, Yuan; Uranker, Kevin; Rohan, Lisa Cencia

    2014-01-01

    Purpose To develop polymeric films containing dual combinations of anti-HIV drug candidate tenofovir, maraviroc and dapivirine for vaginal application as topical microbicides. Methods A solvent casting method was used to manufacture the films. Solid phase solubility was used to identify potential polymers for use in the film formulation. Physical and chemical properties (such as water content, puncture strength and in vitro release) and product stability were determined. The bioactivity of the film products against HIV was assessed using the TZM-bl assay and a cervical explant model. Results Polymers identified from the solid phase solubility study maintained tenofovir and maraviroc in an amorphous state and prevented drug crystallization. Three combination film products were developed using cellulose polymers and polyvinyl alcohol. The residual water content in all films was < 10% (w/w). All films delivered the active agents with release of > 50% of film drug content within 30 minutes. Stability testing confirmed that the combination film products were stable for 12 months at ambient temperature and 6 months under stressed conditions. Antiviral activity was confirmed in TZM-bl and cervical explant models. Conclusions Polymeric films can be used as a stable dosage form for the delivery of antiretroviral combinations as microbicides. PMID:25079391

  1. Patent Law for Computer Scientists

    NASA Astrophysics Data System (ADS)

    Closa, Daniel; Gardiner, Alex; Giemsa, Falk; Machek, Jörg

    More than five centuries ago the first patent statute was passed by the Venetian senate. It already had most of the features of modern patent law, recognizing the public interest in innovation and granting exclusive right in exchange for a full disclosure. Some 350 years later the industrial revolution led to globalisation. The wish to protect intellectual property on a more international level evolved and supranational treaties were negotiated. Patent laws are still different in many countries, however, and inventors are sometimes at a loss to understand which basic requirements should be satisfied if an invention is to be granted a patent. This is particularly true for inventions implemented on a computer. While roughly a third of all applications (and granted patents) relate, in one way or another, to a computer, applications where the innovation mainly resides in software or in a business method are treated differently by the major patent offices. The procedures at the USPTO, JPO and EPO and, in particular, the differences in the treatment of applications centring on software are briefly explained. In later sections of this book, a wealth of examples will be presented. The methodology behind the treatment of these examples is explained.

  2. Universities and Patent Demands

    PubMed Central

    Cordova, Andrew K.; Feldman, Robin

    2015-01-01

    Research universities have made enormous contributions to the field of medicine and the treatment of human disease. Alone or in collaboration with pharmaceutical companies, academic researchers have added to the store of knowledge that has led to numerous life science breakthroughs. A new chapter may be opening for academic researchers, however, that could lead to a darker tale. ‘The mouse that trolled: the long and tortuous history of a gene mutation patent that became an expensive impediment to Alzheimer's research, by Bubela et al., chronicles one such tale.’ The authors do an excellent job of bringing to life the twisting saga that engulfed numerous academic and non-profit Alzheimer's researchers over many years. The authors note that the story is an outlier, but sadly, that may not be the case. There are increasing signs that academic researchers and their institutions are being caught up in the rush for gold that is accompanying the proliferation of the non-practicing entity business model. As I have noted before, academic institutions have a dual role, as keepers of the academic flame and guardians of the public monies entrusted to them through state and federal research funding. The specter of taxpayer money being used, not to advance research and for the betterment of society, but as part of schemes to extract money from productive companies may not sit well with voters, and ultimately, with legislators. In that case, researchers and institutions themselves may have much to lose. PMID:27774221

  3. Patent perspectives for corticosteroids based ophthalmic therapeutics.

    PubMed

    Suresh, Preeti K; Sah, Abhishek K

    2014-01-01

    Eye inflammation, if untreated at right time poses the risk of vision loss. Several categories of drugs are available in the global market, but corticosteroids are still used for the treatment of ocular inflammation including anterior/ posterior uveitis, age related macular degeneration (AMD) and post cataract surgery inflammation. Although corticosteroids have well-documented side effects as compared to non steroidal anti-inflammatory drugs (NSAIDs), but they are still regarded as better anti-inflammatory agents for treating ocular inflammations. The prime concern with conventional formulations such as (ophthalmic solutions, suspensions, ointments) is low drug bioavailability due to precorneal barrier of the eye, tear turnover and rapid drainage of drug via nasolacrimal drainage and drug induced systemic toxicity. To overcome these limitations, various novel formulations of corticosteroids have been explored. These include nanoparticles, solid lipid nanoparticles (SLN), nanostructured lipid carriers (NLC), nanomicelles, in-situ gels, iontophoresis, liposomes, nanoemulsions, microemulsions and ocular implants for the effective ophthalmic delivery of the corticosteroids. Topical nanocarriers have also been demonstrated to be promising vectors with potential application in the ophthalmic therapeutics. This review summarizes the clinical findings and patents on various corticosteroids as ocular pharmacotherapeutics. PMID:25020063

  4. An interdisciplinary framework for measuring and supporting adherence in HIV prevention trials of ARV-based vaginal rings

    PubMed Central

    MacQueen, Kathleen M; Tolley, Elizabeth E; Owen, Derek H; Amico, K Rivet; Morrow, Kathleen M; Moench, Thomas; Friend, David R; Friedland, Barbara

    2014-01-01

    Introduction Product adherence and its measurement have emerged as a critical challenge in the evaluation of new HIV prevention technologies. Long-acting ARV-based vaginal rings may simplify use instructions and require less user behaviour, thereby facilitating adherence. One ARV-based ring is in efficacy trials and others, including multipurpose rings, are in the pipeline. Participant motivations, counselling support and measurement challenges during ring trials must still be addressed. In previous HIV prevention trials, this has been done largely using descriptive and post-hoc methods that are highly variable and minimally evaluated. We outline an interdisciplinary framework for systematically investigating promising strategies to support product uptake and adherence, and to measure adherence in the context of randomized, blinded clinical trials. Discussion The interdisciplinary framework highlights the dual use of adherence measurement (i.e. to provide feedback during trial implementation and to inform interpretation of trial findings) and underscores the complex pathways that connect measurement, adherence support and enacted adherence behaviour. Three inter-related approaches are highlighted: 1) adherence support – sequential efforts to define motivators of study product adherence and to develop, test, refine and evaluate adherence support messages; 2) self-reported psychometric measures – creation of valid and generalizable measures based in easily administered scales that capture vaginal ring use with improved predictive ability at screening, baseline and follow-up that better engage participants in reporting adherence; and 3) more objective measurement of adherence – real-time adherence monitoring and cumulative measurement to correlate adherence with overall product effectiveness through innovative designs, models and prototypes using electronic and biometric technologies to detect ring insertion and/or removal or expulsion. Coordinating research

  5. Antibody-drug conjugates: Intellectual property considerations

    PubMed Central

    Storz, Ulrich

    2015-01-01

    Antibody-drug conjugates are highly complex entities that combine an antibody, a linker and a toxin. This complexity makes them demanding both technically and from a regulatory point of view, and difficult to deal with in their patent aspects. This article discusses different issues of patent protection and freedom to operate with regard to this promising new class of drugs. PMID:26292154

  6. Antibody-drug conjugates: Intellectual property considerations.

    PubMed

    Storz, Ulrich

    2015-01-01

    Antibody-drug conjugates are highly complex entities that combine an antibody, a linker and a toxin. This complexity makes them demanding both technically and from a regulatory point of view, and difficult to deal with in their patent aspects. This article discusses different issues of patent protection and freedom to operate with regard to this promising new class of drugs. PMID:26292154

  7. Antiretroviral drug expenditure, pricing and judicial demand: an analysis of federal procurement data in Brazil from 2004–2011

    PubMed Central

    2014-01-01

    Background Previous studies have described expenditures for antiretroviral (ARV) medicines in Brazil through 2005. While prior studies examined overall expenditures, they have not have analyzed drug procurement data in order to describe the role of court litigation on access and pricing. Methods ARV drug procurement from private sector sources for the years 2004–2011 was obtained through the general procurement database of the Brazilian Federal Government (SIASG). Procurement was measured in Defined Daily Doses (DDD) per 1000 persons-under-treatment per day. Expenditures and price per DDD were calculated and expressed in U.S. Dollars. Justifications for ARV purchases were examined in order to determine the relationship between health litigation and incorporation into Brazil’s national treatment guidelines. Results Drug procurement of ARVs from private sources underwent marked expansion in 2005, peaked in 2009, and stabilized to 2008 levels by 2011. Expenditures followed procurement curves. Medications which were procured for the first time after 2007 cost more than medicines which were introduced before 2007. Judicial actions initially resulted in purchases of newer medications for a select number of patients in Brazil but ultimately expanded availability to a larger population through incorporation into the national treatment guidelines. Conclusions Drug procurement and expenditures for ARVs in Brazil varied between 2004–2011. The procurement of some drugs from the private sector ceased after public manufacturers started producing them locally. Judicial demand has resulted in the incorporation of newer drugs into the national treatment guidelines. In order for the AIDS treatment program to remain sustainable, efforts should be pursued to reduce prices through generic drugs, price negotiation and other public health flexibilities such as compulsory licensing. PMID:24735589

  8. 78 FR 72872 - Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-04

    ... Expert Randomization)//U.S. Patent No. 8,085,459: Plasmonic Transistor//U.S. Patent No. 8,094,317... Transistor//U.S. Patent No. 8,530,885: Graphene-Based Conductive, Lossless Photonic Bandgap Method...

  9. Considerations on patent valuation based on patent classification and citation in biotechnological field

    NASA Astrophysics Data System (ADS)

    Mihara, Kenji

    Regarding innovation measurement utilizing patent information, a number of researchers are making great efforts to measure a "patent value (patent quality)." For patent valuation, patent classification and citation are often utilized as patent information. Also, biotechnological field is attracting attention from the viewpoint of application to environmental or medical study, and considerable researches on patent valuation are ongoing in this technical field. However, it is not enough recognized that researchers cannot be too careful when they deal with classification information in the biotech field because patent classification structure in this field is not well-established. And also, it is not known enough that citation patterns of both academic papers and patent documents are so complicated that the patterns cannot be easily generalized. In this article, the issues above were verified from a position based on working experiences of biotech patent examiner at Japan Patent Office, and considerations and implications were given on what patent valuation should be.

  10. Should ANVISA be permitted to reject pharmaceutical patent applications in Brazil?

    PubMed

    Mueller, Lisa L; Taketsuma Costa, Silvia Moreira

    2014-01-01

    Pharmaceutical manufacturers who seek new markets for expansion are particularly attracted to Brazil given its potential for growth and the expectation that it will be the fifth largest drug market by 2015. Given the significance of Brazil in the marketplace, strong patent protection for pharmaceutical products and processes is critical. In April 2013, a new workflow came into effect in Brazil which allows the National Sanitary Vigilance Agency (ANVISA), a government agency whose function is to protect public health, to examine and reject any patent application that claims a pharmaceutical product or process before any examination of the application by the Brazilian Patent Office. If a patent application is rejected by ANVISA, the application is returned to the Brazilian Patent Office and filed away, without any further examination, for an unknown period of time. Therefore, the examination of pharmaceutical product and process applications under this new workflow is problematic for local and global pharmaceutical manufacturers for multiple reasons.

  11. Phase I safety, pharmacokinetics, and pharmacogenetics study of the antituberculosis drug PA-824 with concomitant lopinavir-ritonavir, efavirenz, or rifampin.

    PubMed

    Dooley, Kelly E; Luetkemeyer, Anne F; Park, Jeong-Gun; Allen, Reena; Cramer, Yoninah; Murray, Stephen; Sutherland, Deborah; Aweeka, Francesca; Koletar, Susan L; Marzan, Florence; Bao, Jing; Savic, Rada; Haas, David W

    2014-09-01

    There is an urgent need for new antituberculosis (anti-TB) drugs, including agents that are safe and effective with concomitant antiretrovirals (ARV) and first-line TB drugs. PA-824 is a novel antituberculosis nitroimidazole in late-phase clinical development. Cytochrome P450 (CYP) 3A, which can be induced or inhibited by ARV and antituberculosis drugs, is a minor (∼20%) metabolic pathway for PA-824. In a phase I clinical trial, we characterized interactions between PA-824 and efavirenz (arm 1), lopinavir/ritonavir (arm 2), and rifampin (arm 3) in healthy, HIV-uninfected volunteers without TB disease. Participants in arms 1 and 2 were randomized to receive drugs via sequence 1 (PA-824 alone, washout, ARV, and ARV plus PA-824) or sequence 2 (ARV, ARV with PA-824, washout, and PA-824 alone). In arm 3, participants received PA-824 and then rifampin and then both. Pharmacokinetic sampling occurred at the end of each dosing period. Fifty-two individuals participated. Compared to PA-824 alone, plasma PA-824 values (based on geometric mean ratios) for maximum concentration (Cmax), area under the concentration-time curve from 0 to 24 h (AUC0-24), and trough concentration (Cmin) were reduced 28%, 35%, and 46% with efavirenz, 13%, 17%, and 21% with lopinavir-ritonavir (lopinavir/r) and 53%, 66%, and 85% with rifampin, respectively. Medications were well tolerated. In conclusion, lopinavir/r had minimal effect on PA-824 exposures, supporting PA-824 use with lopinavir/r without dose adjustment. PA-824 exposures, though, were reduced more than expected when given with efavirenz or rifampin. The clinical implications of these reductions will depend upon data from current clinical trials defining PA-824 concentration-effect relationships. (This study has been registered at ClinicalTrials.gov under registration no. NCT01571414.).

  12. Phase I Safety, Pharmacokinetics, and Pharmacogenetics Study of the Antituberculosis Drug PA-824 with Concomitant Lopinavir-Ritonavir, Efavirenz, or Rifampin

    PubMed Central

    Luetkemeyer, Anne F.; Park, Jeong-Gun; Allen, Reena; Cramer, Yoninah; Murray, Stephen; Sutherland, Deborah; Aweeka, Francesca; Koletar, Susan L.; Marzan, Florence; Bao, Jing; Savic, Rada; Haas, David W.

    2014-01-01

    There is an urgent need for new antituberculosis (anti-TB) drugs, including agents that are safe and effective with concomitant antiretrovirals (ARV) and first-line TB drugs. PA-824 is a novel antituberculosis nitroimidazole in late-phase clinical development. Cytochrome P450 (CYP) 3A, which can be induced or inhibited by ARV and antituberculosis drugs, is a minor (∼20%) metabolic pathway for PA-824. In a phase I clinical trial, we characterized interactions between PA-824 and efavirenz (arm 1), lopinavir/ritonavir (arm 2), and rifampin (arm 3) in healthy, HIV-uninfected volunteers without TB disease. Participants in arms 1 and 2 were randomized to receive drugs via sequence 1 (PA-824 alone, washout, ARV, and ARV plus PA-824) or sequence 2 (ARV, ARV with PA-824, washout, and PA-824 alone). In arm 3, participants received PA-824 and then rifampin and then both. Pharmacokinetic sampling occurred at the end of each dosing period. Fifty-two individuals participated. Compared to PA-824 alone, plasma PA-824 values (based on geometric mean ratios) for maximum concentration (Cmax), area under the concentration-time curve from 0 to 24 h (AUC0–24), and trough concentration (Cmin) were reduced 28%, 35%, and 46% with efavirenz, 13%, 17%, and 21% with lopinavir-ritonavir (lopinavir/r) and 53%, 66%, and 85% with rifampin, respectively. Medications were well tolerated. In conclusion, lopinavir/r had minimal effect on PA-824 exposures, supporting PA-824 use with lopinavir/r without dose adjustment. PA-824 exposures, though, were reduced more than expected when given with efavirenz or rifampin. The clinical implications of these reductions will depend upon data from current clinical trials defining PA-824 concentration-effect relationships. (This study has been registered at ClinicalTrials.gov under registration no. NCT01571414.) PMID:24957823

  13. The importance of patents to innovation: updated cross-industry comparisons with biopharmaceuticals.

    PubMed

    Cockburn, Iain; Long, Genia

    2015-07-01

    Patents have long been considered essential incentives to foster innovation, particularly the development of new prescription drugs, due to the lengthy, costly, and risky nature of the research and development (R&D) process as compared to the lower levels of investment and risk associated with generic drug entry. Compared with other forms of intellectual property protection (such as trade secrets, trademarks, and copyrights) and strategic complementary assets (such as lead time, sales and service, and manufacturing advantages), researchers focused on the US since the 1980s consistently have found patents to be relatively more important to R&D in pharmaceuticals than in other industries. Despite many changes in the market and patent landscape, the most recent data from government surveys and annual surveys of licensing professionals continue to find differential and high importance of patents to biopharmaceutical innovation.

  14. Behavioral Economics Matters for HIV Research: The Impact of Behavioral Biases on Adherence to Antiretrovirals (ARVs).

    PubMed

    Linnemayr, Sebastian; Stecher, Chad

    2015-11-01

    Behavioral economics (BE) has been used to study a number of health behaviors such as smoking and drug use, but there is little knowledge of how these insights relate to HIV prevention and care. We present novel evidence on the prevalence of the common behavioral decision-making errors of present-bias, overoptimism, and information salience among 155 Ugandan HIV patients, and analyze their association with subsequent medication adherence. 36 % of study participants are classified as present-biased, 21 % as overoptimistic, and 34 % as having salient HIV information. Patients displaying present-bias were 13 % points (p = 0.006) less likely to have adherence rates above 90 %, overoptimistic clients were 9 % points (p = 0.04) less likely, and those not having salient HIV information were 17 % points (p < 0.001) less likely. These findings indicate that BE may be used to screen for future adherence problems and to better design and target interventions addressing these behavioral biases and the associated suboptimal adherence.

  15. Behavioral Economics Matters for HIV Research: The Impact of Behavioral Biases on Adherence to Antiretrovirals (ARVs)

    PubMed Central

    Stecher, Chad

    2016-01-01

    Behavioral economics (BE) has been used to study a number of health behaviors such as smoking and drug use, but there is little knowledge of how these insights relate to HIV prevention and care. We present novel evidence on the prevalence of the common behavioral decision-making errors of present-bias, overoptimism, and information salience among 155 Ugandan HIV patients, and analyze their association with subsequent medication adherence. 36 % of study participants are classified as present-biased, 21 % as overoptimistic, and 34 % as having salient HIV information. Patients displaying present-bias were 13 % points (p = 0.006) less likely to have adherence rates above 90 %, overoptimistic clients were 9 % points (p = 0.04) less likely, and those not having salient HIV information were 17 % points (p < 0.001) less likely. These findings indicate that BE may be used to screen for future adherence problems and to better design and target interventions addressing these behavioral biases and the associated suboptimal adherence. PMID:25987190

  16. Patents and the supply of therapeutic products.

    PubMed

    Hayhurst, W L

    1992-01-01

    In some countries protests against the grant of exclusive rights in developments that benefit humanity have caused limits to be placed on the scope of patent rights. A characteristic of all modern patent systems is that the invention that one seeks to patent must have some practical utility and be new. The US is making patent protection available even for methods of medical treatment and for non human living things. A patent will expire in most developed countries 20 years from the filing of the application except in the US which grants patents from 17 years. India, China, and Brazil grant patents for shorter terms. In Australia and New Zealand, the term of a patent may be extended. In France and the US; extensions of term are possible only for medically related inventions. A patent grants to the owner of the patent the right, during its term, to exclude others from making, using, or selling the patented inventions. A patent grants to the owner of the patent the rights, during its term, to exclude others from making, using, or selling the patented invention. A patent owner who attempts to enforce a patent may be faced with a challenge that the patentee has misbehaved. In the US an alleged infringer may argue that the patentee misled the Patent Office when applying for the patent. The Patent laws of many countries enable the government to use patented inventions but compensate patent owners. Under sections 37 and 38 of the French patent legislation the government may decree that licenses are available in the interests of public health. In connection with Roussel-Uclaf's mifepristone, RU-486 it has been reported that such a decree cannot be made for a medicine that has not been approved by the government for distribution. The Canadian government has announced its intention to cancel the provisions in the Canadian Patent Act relating to compulsory licensing of medicines. Negotiations are continuing under the General Agreement on Tariffs and Trade that may lead to an

  17. 7 CFR 1210.367 - Patents, copyrights, inventions, and publications.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Patents, copyrights, inventions, and publications....367 Patents, copyrights, inventions, and publications. Any patents, copyrights, inventions, product... such patents, copyrights, inventions, product formulations, or publications shall be considered...

  18. 48 CFR 27.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability....

  19. 7 CFR 1210.367 - Patents, copyrights, inventions, and publications.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Patents, copyrights, inventions, and publications....367 Patents, copyrights, inventions, and publications. Any patents, copyrights, inventions, product... such patents, copyrights, inventions, product formulations, or publications shall be considered...

  20. 48 CFR 27.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability....

  1. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability....

  2. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability....

  3. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability....

  4. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Patent and copyright... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and copyright infringement liability....

  5. 7 CFR 1210.367 - Patents, copyrights, inventions, and publications.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Patents, copyrights, inventions, and publications....367 Patents, copyrights, inventions, and publications. Any patents, copyrights, inventions, product... such patents, copyrights, inventions, product formulations, or publications shall be considered...

  6. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent and copyright... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and copyright infringement liability....

  7. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability....

  8. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability....

  9. 48 CFR 27.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability....

  10. 48 CFR 27.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability....

  11. 7 CFR 1210.367 - Patents, copyrights, inventions, and publications.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Patents, copyrights, inventions, and publications....367 Patents, copyrights, inventions, and publications. Any patents, copyrights, inventions, product... such patents, copyrights, inventions, product formulations, or publications shall be considered...

  12. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Patent and copyright... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and copyright infringement liability....

  13. 48 CFR 27.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability....

  14. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Patent and copyright... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and copyright infringement liability....

  15. 7 CFR 1210.367 - Patents, copyrights, inventions, and publications.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Patents, copyrights, inventions, and publications....367 Patents, copyrights, inventions, and publications. Any patents, copyrights, inventions, product... such patents, copyrights, inventions, product formulations, or publications shall be considered...

  16. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Patent and copyright... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and copyright infringement liability....

  17. 48 CFR 1327.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Administration of patent... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1327.305 Administration of patent rights clauses....

  18. 48 CFR 1327.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Administration of patent... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1327.305 Administration of patent rights clauses....

  19. 48 CFR 2427.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Administration of patent... AND URBAN DEVELOPMENT SOCIOECONOMIC PROGRAMS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 2427.305 Administration of patent rights clauses....

  20. 48 CFR 27.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Administration of patent... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights under Government Contracts 27.305 Administration of patent rights clauses....

  1. 48 CFR 2427.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Administration of patent... AND URBAN DEVELOPMENT SOCIOECONOMIC PROGRAMS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 2427.305 Administration of patent rights clauses....

  2. 48 CFR 1327.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Administration of patent... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1327.305 Administration of patent rights clauses....

  3. 48 CFR 1327.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Administration of patent... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1327.305 Administration of patent rights clauses....

  4. 48 CFR 27.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Administration of patent... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights under Government Contracts 27.305 Administration of patent rights clauses....

  5. 48 CFR 2427.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Administration of patent... AND URBAN DEVELOPMENT SOCIOECONOMIC PROGRAMS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 2427.305 Administration of patent rights clauses....

  6. 48 CFR 1227.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Administration of patent... TRANSPORTATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1227.305 Administration of patent rights clauses....

  7. 48 CFR 1227.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Administration of patent... TRANSPORTATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1227.305 Administration of patent rights clauses....

  8. 48 CFR 27.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Administration of patent... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights under Government Contracts 27.305 Administration of patent rights clauses....

  9. 48 CFR 27.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Administration of patent... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights under Government Contracts 27.305 Administration of patent rights clauses....

  10. 48 CFR 27.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Administration of patent... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights under Government Contracts 27.305 Administration of patent rights clauses....

  11. 48 CFR 1227.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Administration of patent... TRANSPORTATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1227.305 Administration of patent rights clauses....

  12. 48 CFR 2427.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Administration of patent... AND URBAN DEVELOPMENT SOCIOECONOMIC PROGRAMS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 2427.305 Administration of patent rights clauses....

  13. 48 CFR 2427.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Administration of patent... AND URBAN DEVELOPMENT SOCIOECONOMIC PROGRAMS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 2427.305 Administration of patent rights clauses....

  14. 48 CFR 1327.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Administration of patent... GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1327.305 Administration of patent rights clauses....

  15. 48 CFR 1227.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Administration of patent... TRANSPORTATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1227.305 Administration of patent rights clauses....

  16. 48 CFR 1227.305 - Administration of patent rights clauses.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Administration of patent... TRANSPORTATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patent Rights Under Government Contracts 1227.305 Administration of patent rights clauses....

  17. Prevention of mother-to-child HIV-1 transmission in Burkina Faso: evaluation of vertical transmission by PCR, molecular characterization of subtypes and determination of antiretroviral drugs resistance

    PubMed Central

    Sagna, Tani; Bisseye, Cyrille; Compaore, Tegewende R.; Kagone, Therese S.; Djigma, Florencia W.; Ouermi, Djeneba; Pirkle, Catherine M.; Zeba, Moctar T. A.; Bazie, Valerie J. T.; Douamba, Zoenabo; Moret, Remy; Pietra, Virginio; Koama, Adjirita; Gnoula, Charlemagne; Sia, Joseph D.; Nikiema, Jean-Baptiste; Simpore, Jacques

    2015-01-01

    Background Vertical human immunodeficiency virus (HIV) transmission is a public health problem in Burkina Faso. The main objective of this study on the prevention of mother-to-child HIV-1 transmission was to determine the residual risk of HIV transmission in infants born to mothers receiving highly active antiretroviral therapy (HAART). Moreover, we detect HIV antiretroviral (ARV) drug resistance among mother–infant pairs and identify subtypes and circulating recombinant forms (CRF) in Burkina Faso. Design In this study, 3,215 samples of pregnant women were analyzed for HIV using rapid tests. Vertical transmission was estimated by polymerase chain reaction in 6-month-old infants born to women who tested HIV positive. HIV-1 resistance to ARV, subtypes, and CRFs was determined through ViroSeq kit using the ABI PRISM 3,130 sequencer. Results In this study, 12.26% (394/3,215) of the pregnant women were diagnosed HIV positive. There was 0.52% (2/388) overall vertical transmission of HIV, with rates of 1.75% (2/114) among mothers under prophylaxis and 0.00% (0/274) for those under HAART. Genetic mutations were also isolated that induce resistance to ARV such as M184V, Y115F, K103N, Y181C, V179E, and G190A. There were subtypes and CRF of HIV-1 present, the most common being: CRF06_CPX (58.8%), CRF02_AG (35.3%), and subtype G (5.9%). Conclusions ARV drugs reduce the residual rate of HIV vertical transmission. However, the virus has developed resistance to ARV, which could limit future therapeutic options when treatment is needed. Resistance to ARV therefore requires a permanent interaction between researchers, physicians, and pharmacists, to strengthen the network of monitoring and surveillance of drug resistance in Burkina Faso. PMID:25630709

  18. Recent Patents in Oncolytic Virotherapy.

    PubMed

    Ahmad, Tauqeer; Venkataraman, Srividhya; AbouHaidar, Mounir; Hefferon, Kathleen L

    2016-01-01

    Recent innovative and advanced developments in the diagnosis and treatment of human diseases as well as enhanced in-depth understanding of virus molecular biology have opened novel avenues with respect to the patent landscape. Included are viruses utilized in the development of anticancer agents, agents that are employed against the spread of infectious viral diseases, RNA silencing agents and virus-derived expression vectors that can be used for over-expression of therapeutic proteins or as gene therapy vehicles. The current review describes several recent patents pertaining to virus sequences and their medical and biotechnological applications.

  19. Rituximab: how approval history is reflected by a corresponding patent filing strategy.

    PubMed

    Storz, Ulrich

    2014-01-01

    Because drug development is not a static process, a drug's market authorisation may change over time. In many cases, the number of indications for which a drug is approved increases. Because this facet of drug development also comes at significant costs, a corresponding patent filing strategy is required to protect these investments. The strategy as applied to rituximab, which is approved for a variety of indications, is discussed in this review. PMID:24866199

  20. The role of patents in biodiversity conservation.

    PubMed

    Lawson, Charles

    2009-11-01

    Patents may not establish clear property and use rights and this may promote biodiversity destruction and decline. What is needed are schemes for patents to suit conservation and sustainable-use objectives.

  1. 22 CFR 92.72 - Services in connection with patents and patent applications.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Services in connection with patents and patent... RELATED SERVICES Miscellaneous Notarial Services § 92.72 Services in connection with patents and patent applications. (a) Affidavit of applicant. The form of the affidavit of an applicant for a United States...

  2. 22 CFR 92.72 - Services in connection with patents and patent applications.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Services in connection with patents and patent... RELATED SERVICES Miscellaneous Notarial Services § 92.72 Services in connection with patents and patent applications. (a) Affidavit of applicant. The form of the affidavit of an applicant for a United States...

  3. 22 CFR 92.72 - Services in connection with patents and patent applications.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Services in connection with patents and patent... RELATED SERVICES Miscellaneous Notarial Services § 92.72 Services in connection with patents and patent applications. (a) Affidavit of applicant. The form of the affidavit of an applicant for a United States...

  4. 22 CFR 92.72 - Services in connection with patents and patent applications.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Services in connection with patents and patent... RELATED SERVICES Miscellaneous Notarial Services § 92.72 Services in connection with patents and patent applications. (a) Affidavit of applicant. The form of the affidavit of an applicant for a United States...

  5. 22 CFR 92.72 - Services in connection with patents and patent applications.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Services in connection with patents and patent... RELATED SERVICES Miscellaneous Notarial Services § 92.72 Services in connection with patents and patent applications. (a) Affidavit of applicant. The form of the affidavit of an applicant for a United States...

  6. A Review of the Toxicity of HIV Medications II: Interactions with Drugs and Complementary and Alternative Medicine Products.

    PubMed

    Stolbach, Andrew; Paziana, Karolina; Heverling, Harry; Pham, Paul

    2015-09-01

    For many patients today, HIV has become a chronic disease. For those patients who have access to and adhere to lifelong antiretroviral (ARV) therapy, the potential for drug-drug interactions has become a real and life-threatening concern. It is known that most ARV drug interactions occur through the cytochrome P450 (CYP) pathway. Medications for comorbid medical conditions, holistic supplements, and illicit drugs can be affected by CYP inhibitors and inducers and have the potential to cause harm and toxicity. Protease inhibitors (PIs) tend to inhibit CYP3A4, while most non-nucleoside reverse transcriptase inhibitors (NNRTIs) tend to induce the enzyme. As such, failure to adjust the dose of co-administered medications, such as statins and steroids, may lead to serious complications including rhabdomyolysis and hypercortisolism, respectively. Similarly, gastric acid blockers can decrease several ARV absorption, and warfarin doses may need to be adjusted to maintain therapeutic concentrations. Illicit drugs such as methylenedioxymethamphetamine (MDMA, "ecstasy") in combination with PIs lead to increased toxicity, while the concomitant administration of sedative drugs such as midazolam and alprazolam in patients taking PIs can result in prolonged sedation, delayed recovery, and increased length of stay. Even supplements like St. John's Wort can alter PI concentrations. In theory, any drug that is metabolized by CYP has potential for a pharmacokinetic drug-drug interaction with all PIs, cobicistat, and most NNRTIs. When adding a new medication to an ARV regimen, use of a drug-drug interaction software and/or consultation with a clinical pharmacist/pharmacologist or HIV specialist is recommended. PMID:26036354

  7. 75 FR 19406 - Determination of Regulatory Review Period for Purposes of Patent Extension; AFINITOR

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-14

    ... the submission of an application to the Director of Patents and Trademarks, Department of Commerce... product, animal drug product, medical device, food additive, or color additive) was subject to regulatory... an application to market the human drug product and continues until FDA grants permission to...

  8. 76 FR 31349 - Determination of Regulatory Review Period for Purposes of Patent Extension; ACTEMRA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-31

    ... treatment of rheumatoid arthritis. Subsequent to this approval, the Patent and Trademark Office received... HUMAN SERVICES Food and Drug Administration Determination of Regulatory Review Period for Purposes of... and Drug Administration (FDA) has determined the regulatory review period for ACTEMRA and...

  9. 75 FR 54887 - Determination of Regulatory Review Period for Purposes of Patent Extension; REPEL-CV

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-09

    ... Patent Extension; REPEL-CV AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) has determined the regulatory review period for REPEL-CV and is... in 35 U.S.C. 156(g)(3)(B). FDA recently approved for marketing the medical device, REPEL-CV....

  10. 75 FR 32951 - Determination of Regulatory Review Period for Purposes of Patent Extension; PROMACTA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-10

    ... product, animal drug product, medical device, food additive, or color additive) was subject to regulatory... marketing the human drug product PROMACTA (eltrombopag olamine). PROMACTA is indicated the treatment of... marketing or use of the product. Thereafter, the Patent and Trademark Office requested that FDA...

  11. Past, present and future of pharmaceutical patents under Korea-US Trade Agreement.

    PubMed

    Shin, Yoon Suk

    2016-07-01

    The introduction of substance patents in 1987 was viewed with apprehension as it was believed that the system would only reinforce the domination of the technology of advanced countries based on the trade agreement between Korea and the USA. However, substance patents provided the Korean pharmaceutical industry with the driving force required to develop new substances, and the Korean pharmaceutical industry has been constantly improving its research and development capability. The patent-approval linkage system was implemented according to the Korea-US Free Trade Agreement in 2015. The system comprises the following: registering the drugs in the Green List, notifying the listed patent and marketing approval holders about the application for generic marketing approval, patent holder's request for staying generic sales and first generic exclusivity. Korean generic companies are expected to have opportunities that enable them to challenge the global market by accumulating experience of designing of generic products, making patent challenges and strategically developing of new drugs or incrementally modified drugs through the linkage system. PMID:27338849

  12. A Case Study of Pharmaceutical Pricing in China: Setting the Price for Off-Patent Originators.

    PubMed

    Hu, Shanlian; Zhang, Yabing; He, Jiangjiang; Du, Lixia; Xu, Mingfei; Xie, Chunyan; Peng, Ying; Wang, Linan

    2015-08-01

    This article aims to define a value-based approach to pricing and reimbursement for off-patent originators using a multiple criteria decision analysis (MCDA) approach centered on a systematic analysis of current pricing and reimbursement policies in China. A drug price policy review was combined with a quantitative analysis of China's drug purchasing database. Policy preferences were identified through a MCDA performed by interviewing well-known academic experts and industry stakeholders. The study findings indicate that the current Chinese price policy includes cost-based pricing and the establishment of maximum retail prices and premiums for off-patent originators, whereas reference pricing may be adopted in the future. The literature review revealed significant differences in the dissolution profiles between originators and generics; therefore, dissolution profiles need to be improved. Market data analysis showed that the overall price ratio of generics and off-patent originators was around 0.54-0.59 in 2002-2011, with a 40% price difference, on average. Ten differentiating value attributes were identified and MCDA was applied to test the impact of three pricing policy scenarios. With the condition of implementing quality consistency regulations and controls, a reduction in the price gap between high-quality off-patent products (including originator and generics) seemed to be the preferred policy. Patents of many drugs will expire within the next 10 years; thus, pricing will be an issue of importance for off-patent originators and generic alternatives. PMID:26091710

  13. A Case Study of Pharmaceutical Pricing in China: Setting the Price for Off-Patent Originators.

    PubMed

    Hu, Shanlian; Zhang, Yabing; He, Jiangjiang; Du, Lixia; Xu, Mingfei; Xie, Chunyan; Peng, Ying; Wang, Linan

    2015-08-01

    This article aims to define a value-based approach to pricing and reimbursement for off-patent originators using a multiple criteria decision analysis (MCDA) approach centered on a systematic analysis of current pricing and reimbursement policies in China. A drug price policy review was combined with a quantitative analysis of China's drug purchasing database. Policy preferences were identified through a MCDA performed by interviewing well-known academic experts and industry stakeholders. The study findings indicate that the current Chinese price policy includes cost-based pricing and the establishment of maximum retail prices and premiums for off-patent originators, whereas reference pricing may be adopted in the future. The literature review revealed significant differences in the dissolution profiles between originators and generics; therefore, dissolution profiles need to be improved. Market data analysis showed that the overall price ratio of generics and off-patent originators was around 0.54-0.59 in 2002-2011, with a 40% price difference, on average. Ten differentiating value attributes were identified and MCDA was applied to test the impact of three pricing policy scenarios. With the condition of implementing quality consistency regulations and controls, a reduction in the price gap between high-quality off-patent products (including originator and generics) seemed to be the preferred policy. Patents of many drugs will expire within the next 10 years; thus, pricing will be an issue of importance for off-patent originators and generic alternatives.

  14. Patenting for the research scientist: an update.

    PubMed

    Crespi, R Stephen

    2004-12-01

    Academic institutional research constantly produces results worthy of patent protection, but coping with the demands of patent law presents considerable challenges to bioscientists working in these institutions. Inventors need, however, to be aware of recent patent office guidelines and court decisions if they are to seek useful intellectual property as a basis for technology transfer to industry.

  15. 43 CFR 2542.4 - Patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patent. 2542.4 Section 2542.4 Public Lands..., Contiguous to Spanish or Mexican Grants § 2542.4 Patent. (a) Upon submission of satisfactory proof of... there be no protest, contest or other objection against the application, patent will then be issued...

  16. 43 CFR 2631.4 - Patents.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patents. 2631.4 Section 2631.4 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) RAILROAD GRANTS Patents for Lands Sold by Railroad Carriers (Transportation Act of 1940) § 2631.4 Patents. If all be found regular and in conformity with...

  17. 43 CFR 402.10 - Patent.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted...

  18. 43 CFR 2562.7 - Patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patent. 2562.7 Section 2562.7 Public Lands... Patent. The application and proofs filed therewith will be carefully examined and, if all be found regular, the application will be allowed and patent issued upon payment for the land at the rate of...

  19. 43 CFR 2541.3 - Patents.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patents. 2541.3 Section 2541.3 Public... § 2541.3 Patents. (a) Any applicant who satisfied all requirements for a claim of class 1 or class 2... will receive a patent conveying title to all other minerals except: (1) Any minerals which, at the...

  20. 43 CFR 2542.4 - Patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patent. 2542.4 Section 2542.4 Public Lands..., Contiguous to Spanish or Mexican Grants § 2542.4 Patent. (a) Upon submission of satisfactory proof of... there be no protest, contest or other objection against the application, patent will then be issued...

  1. 43 CFR 2562.7 - Patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patent. 2562.7 Section 2562.7 Public Lands... Patent. The application and proofs filed therewith will be carefully examined and, if all be found regular, the application will be allowed and patent issued upon payment for the land at the rate of...

  2. 48 CFR 35.012 - Patent rights.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights,...

  3. 43 CFR 402.10 - Patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 1 2011-10-01 2011-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted...

  4. 43 CFR 2541.3 - Patents.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patents. 2541.3 Section 2541.3 Public... § 2541.3 Patents. (a) Any applicant who satisfied all requirements for a claim of class 1 or class 2... will receive a patent conveying title to all other minerals except: (1) Any minerals which, at the...

  5. 48 CFR 970.2703 - Patent rights.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights....

  6. 43 CFR 2543.5 - Patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patent. 2543.5 Section 2543.5 Public Lands...: Arkansas § 2543.5 Patent. Upon submission of satisfactory proof, if no protest or contest is pending, patent will be issued....

  7. 48 CFR 35.012 - Patent rights.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights,...

  8. 43 CFR 2562.7 - Patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patent. 2562.7 Section 2562.7 Public Lands... Patent. The application and proofs filed therewith will be carefully examined and, if all be found regular, the application will be allowed and patent issued upon payment for the land at the rate of...

  9. 43 CFR 2541.3 - Patents.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patents. 2541.3 Section 2541.3 Public... § 2541.3 Patents. (a) Any applicant who satisfied all requirements for a claim of class 1 or class 2... will receive a patent conveying title to all other minerals except: (1) Any minerals which, at the...

  10. 43 CFR 2541.3 - Patents.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patents. 2541.3 Section 2541.3 Public... § 2541.3 Patents. (a) Any applicant who satisfied all requirements for a claim of class 1 or class 2... will receive a patent conveying title to all other minerals except: (1) Any minerals which, at the...

  11. 43 CFR 2542.4 - Patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patent. 2542.4 Section 2542.4 Public Lands..., Contiguous to Spanish or Mexican Grants § 2542.4 Patent. (a) Upon submission of satisfactory proof of... there be no protest, contest or other objection against the application, patent will then be issued...

  12. 43 CFR 2562.7 - Patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patent. 2562.7 Section 2562.7 Public Lands... Patent. The application and proofs filed therewith will be carefully examined and, if all be found regular, the application will be allowed and patent issued upon payment for the land at the rate of...

  13. 43 CFR 402.10 - Patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 1 2012-10-01 2011-10-01 true Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted...

  14. 48 CFR 970.2703 - Patent rights.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights....

  15. 43 CFR 2532.2 - Trust patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Trust patent. 2532.2 Section 2532.2 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) INDIAN ALLOTMENTS Allotments § 2532.2 Trust patent... patent will be suspended for a period of 2 years from date of settlement; but in those cases where...

  16. 43 CFR 2631.4 - Patents.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patents. 2631.4 Section 2631.4 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) RAILROAD GRANTS Patents for Lands Sold by Railroad Carriers (Transportation Act of 1940) § 2631.4 Patents. If all be found regular and in conformity with...

  17. 43 CFR 2543.5 - Patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Patent. 2543.5 Section 2543.5 Public Lands...: Arkansas § 2543.5 Patent. Upon submission of satisfactory proof, if no protest or contest is pending, patent will be issued....

  18. 43 CFR 2532.2 - Trust patent.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Trust patent. 2532.2 Section 2532.2 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) INDIAN ALLOTMENTS Allotments § 2532.2 Trust patent... patent will be suspended for a period of 2 years from date of settlement; but in those cases where...

  19. 48 CFR 35.012 - Patent rights.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights,...

  20. 43 CFR 2532.2 - Trust patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Trust patent. 2532.2 Section 2532.2 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) INDIAN ALLOTMENTS Allotments § 2532.2 Trust patent... patent will be suspended for a period of 2 years from date of settlement; but in those cases where...

  1. Understanding Patenting Decisions: A Classroom Exercise

    ERIC Educational Resources Information Center

    Bernard, John C.; Yiannaka, Amalia

    2010-01-01

    Although many students have some knowledge of patents, it can be difficult for them to understand the components of an innovator's decision-making process. Key issues, such as whether to patent or to use trade secrecy, how broad a scope to claim, and what to do in the event of patent infringement, can be difficult to grasp from a standard lecture.…

  2. 43 CFR 2631.4 - Patents.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patents. 2631.4 Section 2631.4 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) RAILROAD GRANTS Patents for Lands Sold by Railroad Carriers (Transportation Act of 1940) § 2631.4 Patents. If all be found regular and in conformity with...

  3. 43 CFR 2543.5 - Patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patent. 2543.5 Section 2543.5 Public Lands...: Arkansas § 2543.5 Patent. Upon submission of satisfactory proof, if no protest or contest is pending, patent will be issued....

  4. 43 CFR 2631.4 - Patents.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Patents. 2631.4 Section 2631.4 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) RAILROAD GRANTS Patents for Lands Sold by Railroad Carriers (Transportation Act of 1940) § 2631.4 Patents. If all be found regular and in conformity with...

  5. 48 CFR 970.2703 - Patent rights.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights....

  6. 43 CFR 2543.5 - Patent.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 43 Public Lands: Interior 2 2012-10-01 2012-10-01 false Patent. 2543.5 Section 2543.5 Public Lands...: Arkansas § 2543.5 Patent. Upon submission of satisfactory proof, if no protest or contest is pending, patent will be issued....

  7. 43 CFR 402.10 - Patent.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 1 2013-10-01 2013-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted...

  8. 48 CFR 35.012 - Patent rights.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights,...

  9. 48 CFR 970.2703 - Patent rights.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights....

  10. 48 CFR 970.2703 - Patent rights.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights....

  11. 48 CFR 35.012 - Patent rights.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights,...

  12. 43 CFR 402.10 - Patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 1 2014-10-01 2014-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted...

  13. 43 CFR 2532.2 - Trust patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Trust patent. 2532.2 Section 2532.2 Public... OF THE INTERIOR LAND RESOURCE MANAGEMENT (2000) INDIAN ALLOTMENTS Allotments § 2532.2 Trust patent... patent will be suspended for a period of 2 years from date of settlement; but in those cases where...

  14. 43 CFR 2542.4 - Patent.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 43 Public Lands: Interior 2 2014-10-01 2014-10-01 false Patent. 2542.4 Section 2542.4 Public Lands..., Contiguous to Spanish or Mexican Grants § 2542.4 Patent. (a) Upon submission of satisfactory proof of... there be no protest, contest or other objection against the application, patent will then be issued...

  15. 78 FR 60256 - Initial Patent Applications

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-01

    ..., design, and provisional applications, can be submitted to the USPTO through EFS- Web. EFS-Web is the... permitted to be filed via EFS-Web and patent applications and documents not permitted to be filed via EFS... Patent and Trademark Office Initial Patent Applications ACTION: Proposed collection; comment...

  16. 37 CFR 1.705 - Patent term adjustment determination.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent...

  17. 37 CFR 1.705 - Patent term adjustment determination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent...

  18. 37 CFR 1.705 - Patent term adjustment determination.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent...

  19. 37 CFR 1.705 - Patent term adjustment determination.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent...

  20. 37 CFR 1.705 - Patent term adjustment determination.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent...

  1. Patent data mining method and apparatus

    DOEpatents

    Boyack, Kevin W.; Grafe, V. Gerald; Johnson, David K.; Wylie, Brian N.

    2002-01-01

    A method of data mining represents related patents in a multidimensional space. Distance between patents in the multidimensional space corresponds to the extent of relationship between the patents. The relationship between pairings of patents can be expressed based on weighted combinations of several predicates. The user can select portions of the space to perceive. The user also can interact with and control the communication of the space, focusing attention on aspects of the space of most interest. The multidimensional spatial representation allows more ready comprehension of the structure of the relationships among the patents.

  2. Pharmaceutical patent law: the Canadian perspective.

    PubMed

    Aumand, Livia; Norman, John

    2016-07-01

    This article provides an overview of the patent regime in Canada, with a focus on issues most relevant to the pharmaceutical industry. The process of applying for a patent is discussed, as well as enforcement and litigation. Recent developments in the case law dealing with patentability requirements - novelty, obviousness, utility and sufficiency - are reviewed. Finally, the impact of recently negotiated trade agreements on Canadian patent law is addressed. In this article, we aim to provide an overview of the patent regime in Canada, with a focus on issues that are particularly relevant to the pharmaceutical industry. PMID:27346187

  3. The Patentability of Stem Cells in Australia.

    PubMed

    Petering, Jenny; Cowin, Prue

    2015-07-01

    The potential therapeutic applications of stem cells are unlimited. However, the ongoing political and social debate surrounding the intellectual property and patenting considerations of stem cell research has led to the implementation of strict legislative regulations. In Australia the patent landscape surrounding stem cells has evolved considerably over the past 20 years. The Australian Patents Act 1990 includes a specific exclusion to the patentability of human beings and of biological processes for their generation. However, this exclusion has received no judicial consideration to date, and so its scope and potential impact on stem cell patents is unclear.

  4. Pharmaceutical patent law: the Canadian perspective.

    PubMed

    Aumand, Livia; Norman, John

    2016-07-01

    This article provides an overview of the patent regime in Canada, with a focus on issues most relevant to the pharmaceutical industry. The process of applying for a patent is discussed, as well as enforcement and litigation. Recent developments in the case law dealing with patentability requirements - novelty, obviousness, utility and sufficiency - are reviewed. Finally, the impact of recently negotiated trade agreements on Canadian patent law is addressed. In this article, we aim to provide an overview of the patent regime in Canada, with a focus on issues that are particularly relevant to the pharmaceutical industry.

  5. Entrepreneurial patent management in pharmaceutical startups.

    PubMed

    Holgersson, Marcus; Phan, Tai; Hedner, Thomas

    2016-07-01

    Startups fill an increasingly important role as innovators in the pharmaceutical industry, and patenting is typically central to their success. This article aims to explore patent management in pharmaceutical startups. The results show that startups need to deal with several challenges related to patenting and an 'entrepreneurial' approach to patent management is called for. Resource constraints, venture capital provision, exits and other conditions and events must be readily considered in the patent management process to build a successful pharmaceutical venture, something that could benefit the pharmaceutical industry as a whole. PMID:26948802

  6. Unanticipated Effects of New Drug Availability on Antiretroviral Durability: Implications for Comparative Effectiveness Research

    PubMed Central

    Eaton, Ellen F.; Tamhane, Ashutosh R.; Burkholder, Greer A.; Willig, James H.; Saag, Michael S.; Mugavero, Michael J.

    2016-01-01

    Background. Durability of antiretroviral (ARV) therapy is associated with improved human immunodeficiency virus (HIV) outcomes. Data on ARV regimen durability in recent years and clinical settings are lacking. Methods. This retrospective follow-up study included treatment-naive HIV-infected patients initiating ARV therapy between January 2007 and December 2012 in a university-affiliated HIV clinic in the Southeastern United States. Outcome of interest was durability (time to discontinuation) of the initial regimen. Durability was evaluated using Kaplan-Meier survival analyses. Cox proportional hazard analyses was used to evaluate the association among durability and sociodemographic, clinical, and regimen-level factors. Results. Overall, 546 patients were analyzed. Median durability of all regimens was 39.5 months (95% confidence interval, 34.1–44.4). Commonly prescribed regimens were emtricitabine and tenofovir with efavirenz (51%; median duration = 40.1 months) and with raltegravir (14%; 47.8 months). Overall, 67% of patients had an undetectable viral load at the time of regimen cessation. Discontinuation was less likely with an integrase strand transfer inhibitor (adjusted hazards ratio [aHR] = 0.35, P = .001) or protease inhibitor-based regimen (aHR = 0.45, P = .006) and more likely with a higher pill burden (aHR = 2.25, P = .003) and a later treatment era (aHR = 1.64, P < .001). Conclusions. Initial ARV regimen longevity declined in recent years contemporaneous with the availability of several new ARV drugs and combinations. Reduced durability mostly results from a preference for newly approved regimens rather than indicating failing therapy, as indicated by viral suppression observed in a majority of patients (67%) prior to regimen cessation. Durability is influenced by extrinsic factors including new drug availability and provider preference. Medication durability must be interpreted carefully in the context of a dynamic treatment landscape. PMID

  7. US photovoltaic patents: 1991--1993

    SciTech Connect

    Pohle, L

    1995-03-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials as well as manufacturing and support functions. The patent entries in this document were issued from 1991 to 1993. The entries were located by searching USPA, the database of the US Patent Office. The final search retrieved all patents under the class ``Batteries, Thermoelectric and Photoelectric`` and the subclasses ``Photoelectric,`` ``Testing,`` and ``Applications.`` The search also located patents that contained the words ``photovoltaic(s)`` or ``solar cell(s)`` and their derivatives. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors, and subjects only peripherally concerned with photovoltaic. Some patents on these three subjects were included when ft appeared that those inventions might be of use in terrestrial PV power technologies.

  8. Molecular farming, patents and access to medicines.

    PubMed

    Drake, Pascal M W; Thangaraj, Harry

    2010-08-01

    Transgenic plants have several advantages over other expression systems for the production of recombinant medicines, including low costs, large-scale production and the ability to produce complex multimeric proteins with appropriate post-translational modifications. Several plant-made pharmaceuticals, including the enzyme glucocerebrosidase, insulin and IFN-alpha(2b), are approaching commercialization and these developments have been accompanied by considerable patenting activity. In the present article, we investigated plant-made pharmaceutical patents between the years 2002 and 2008. There was a clear downward trend in the number of patents filed between these years and a greater number of patents were filed by public sector institutions or inventors than by the private sector. The USA dominated patenting activity providing nearly 30% of inventors. The majority of patents were for vaccine candidates (55%), followed by therapeutics (38%) and antibodies (7%). The relationship of patenting to innovation and access to medicines, particularly in the developing world, will be discussed. PMID:20673006

  9. DNA patenting: implications for public health research.

    PubMed Central

    Dutfield, Graham

    2006-01-01

    I weigh the arguments for and against the patenting of functional DNA sequences including genes, and find the objections to be compelling. Is an outright ban on DNA patenting the right policy response? Not necessarily. Governments may wish to consider options ranging from patent law reforms to the creation of new rights. There are alternative ways to protect DNA sequences that industry may choose if DNA patenting is restricted or banned. Some of these alternatives may be more harmful than patents. Such unintended consequences of patent bans mean that we should think hard before concluding that prohibition is the only response to legitimate concerns about the appropriateness of patents in the field of human genomics. PMID:16710549

  10. US photovoltaic patents: 1991-1993

    NASA Astrophysics Data System (ADS)

    Pohle, L.

    1995-03-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials as well as manufacturing and support functions. The patent entries in this document were issued from 1991 to 1993. The entries were located by searching USPA, the database of the US Patent Office. The final search retrieved all patents under the class 'Batteries, Thermoelectric and Photoelectric' and the subclasses 'Photoelectric,' 'Testing,' and 'Applications.' The search also located patents that contained the words 'photovoltaic(s)' or 'solar cell(s)' and their derivatives. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors, and subjects only peripherally concerned with photovoltaic. Some patents on these three subjects were included when ft appeared that those inventions might be of use in terrestrial PV power technologies.

  11. Modeling HIV Vaccines in Brazil: Assessing the Impact of a Future HIV Vaccine on Reducing New Infections, Mortality and Number of People Receiving ARV

    PubMed Central

    Fonseca, Maria Goretti P.; Forsythe, Steven; Menezes, Alexandre; Vuthoori, Shilpa; Possas, Cristina; Veloso, Valdiléa; de Fátima Lucena, Francisca; Stover, John

    2010-01-01

    Background The AIDS epidemic in Brazil remains concentrated in populations with high vulnerability to HIV infection, and the development of an HIV vaccine could make an important contribution to prevention. This study modeled the HIV epidemic and estimated the potential impact of an HIV vaccine on the number of new infections, deaths due to AIDS and the number of people receiving ARV treatment, under various scenarios. Methods and Findings The historical HIV prevalence was modeled using Spectrum and projections were made from 2010 to 2050 to study the impact of an HIV vaccine with 40% to 70% efficacy, and 80% coverage of adult population, specific groups such as MSM, IDU, commercial sex workers and their partners, and 15 year olds. The possibility of disinhibition after vaccination, neglecting medium- and high-risk groups, and a disease-modifying vaccine were also considered. The number of new infections and deaths were reduced by 73% and 30%, respectively, by 2050, when 80% of adult population aged 15–49 was vaccinated with a 40% efficacy vaccine. Vaccinating medium- and high-risk groups reduced new infections by 52% and deaths by 21%. A vaccine with 70% efficacy produced a great decline in new infections and deaths. Neglecting medium- and high-risk population groups as well as disinhibition of vaccinated population reduced the impact or even increased the number of new infections. Disease-modifying vaccine also contributed to reducing AIDS deaths, the need for ART and new HIV infections. Conclusions Even in a country with a concentrated epidemic and high levels of ARV coverage, such as Brazil, moderate efficacy vaccines as part of a comprehensive package of treatment and prevention could have a major impact on preventing new HIV infections and AIDS deaths, as well as reducing the number of people on ARV. Targeted vaccination strategies may be highly effective and cost-beneficial. PMID:20668523

  12. Mixed WTO ruling on generic drug development.

    PubMed

    Elliott, R

    2000-01-01

    On 17 March 2000, the World Trade Organization upheld the provision in Canada's patent laws that allows generic drug manufacturers to develop (but not sell) their cheaper versions of patented medicines before the 20-year patients expire. The decision prevents pharmaceutical companies from enjoying market monopolies beyond their patent terms, avoiding what would otherwise be even lengthier delays in the sale of cheaper, generic drugs in Canada. This decision is of significance not only to Canada, but also to other WTO member countries and to all individuals who use pharmaceutical products. However, the decision is not all positive: the WTO also ruled that Canada is violating international agreements by letting generic manufacturers stockpile their versions of patented drugs before patents expire. This article explains the issues, the arguments, and the decision.

  13. Patent and Exclusivity Status of Essential Medicines for Non-Communicable Disease

    PubMed Central

    Mackey, Tim K.; Liang, Bryan A.

    2012-01-01

    Objective The threat of non-communicable diseases (“NCDs”) is increasingly becoming a global health crisis and are pervasive in high, middle, and low-income populations resulting in an estimated 36 million deaths per year. There is a need to assess intellectual property rights (“IPRs”) that may impede generic production and availability and affordability to essential NCD medicines. Methods Using the data sources listed below, the study design systematically eliminated NCD drugs that had no patent/exclusivity provisions on API, dosage, or administration route. The first step identified essential medicines that treat certain high disease burden NCDs. A second step examined the patent and exclusivity status of active ingredient, dosage and listed route of administration using exclusion criteria outlined in this study. Materials We examined the patent and exclusivity status of medicines listed in the World Health Organization’s (“WHO”) Model List of Essential Drugs (Medicines) (“MLEM”) and other WHO sources for drugs treating certain NCDs. i.e., cardiovascular and respiratory disease, cancers, and diabetes. We utilized the USA Food and Drug Administration Orange Book and the USA Patent and Trademark Office databases as references given the predominant number of medicines registered in the USA. Results Of the 359 MLEM medicines identified, 22% (79/359) address targeted NCDs. Of these 79, only eight required in-depth patent or exclusivity assessment. Upon further review, no NCD MLEM medicines had study patent or exclusivity protection for reviewed criteria. Conclusions We find that ensuring availability and affordability of potential generic formulations of NCD MLEM medicines appears to be more complex than the presence of IPRs with API, dosage, or administration patent or exclusivity protection. Hence, more sophisticated analysis of NCD barriers to generic availability and affordability should be conducted in order to ensure equitable access to global

  14. Antifolate Agents: A Patent Review (2006–2010)

    PubMed Central

    Wright, Dennis L.; Anderson, Amy C.

    2011-01-01

    Introduction For over 50 years, drugs targeting the folate pathway have significantly impacted disease treatment as anticancer, antimicrobial and immunomodulatory agents. The discovery of novel antifolate agents with improved properties and superior activities remains an attractive strategy, both in academia and the pharmaceutical industry. Areas covered This review surveys the patent literature from 2006–2010 for small molecule inhibitors of enzymatic targets in the folate biosynthetic pathway. Expert opinion The pursuit of antifolates as anticancer and antimicrobial agents continues to be an active area of research. New patent disclosures reveal novel antifolate scaffolds, antifolates with improved drug-like properties and new strategies to effectively target cancer cells. The continued use of high resolution structural information has guided the discovery of several compounds. Owing to the need for high levels of potency and selectivity, especially in targeting pathogenic species, the use of high resolution crystal structures remains an important tool to guide the design of novel antifolates. Interestingly, the patents disclosing novel compounds were ones where X-ray crystallography was an integral component of the design process. Finally, a variety of new structures have been reported that may play an important role in the future development of therapeutic antifolates. PMID:21619471

  15. Patent first, ask questions later: morality and biotechnology in patent law.

    PubMed

    Bagley, Margo A

    2003-12-01

    This Article explores the U.S. "patent first, ask questions later" approach to determining what subject matter should receive patent protection. Under this approach, the U.S. Patent and Trademark Office (USPTO or the Agency) issues patents on "anything under the sun made by man," and to the extent a patent's subject matter is sufficiently controversial, Congress acts retrospectively in assessing whether patents should issue on such interventions. This practice has important ramifications for morally controversial biotechnology patents specifically, and for American society generally. For many years a judicially created "moral utility" doctrine served as a type of gatekeeper of patent subject matter eligibility. The doctrine allowed both the USTPO and courts to deny patents on morally controversial subject matter under the fiction that such inventions were not "useful." The gate, however, is currently untended. A combination of the demise of the moral utility doctrine, along with expansive judicial interpretations of the scope of patent-eligible subject matter, has resulted in virtually no basis on which the USTPO or courts can deny patent protection to morally controversial, but otherwise patentable, subject matter. This is so despite position statements by the Agency to the contrary. Biotechnology is an area in which many morally controversial inventions are generated. Congress has been in react-mode following the issuance of a stream of morally controversial biotech patents, including patents on transgenic animals, surgical methods, and methods of cloning humans. With no statutory limits on patent eligibility, and with myriad concerns complicating congressional action following a patent's issuance, it is not Congress, the representative of the people, determining patent eligibility. Instead, it is patent applicants, scientific inventors, who are deciding matters of high public policy through the contents of the applications they file with the USTPO. This Article

  16. Patent first, ask questions later: morality and biotechnology in patent law.

    PubMed

    Bagley, Margo A

    2003-12-01

    This Article explores the U.S. "patent first, ask questions later" approach to determining what subject matter should receive patent protection. Under this approach, the U.S. Patent and Trademark Office (USPTO or the Agency) issues patents on "anything under the sun made by man," and to the extent a patent's subject matter is sufficiently controversial, Congress acts retrospectively in assessing whether patents should issue on such interventions. This practice has important ramifications for morally controversial biotechnology patents specifically, and for American society generally. For many years a judicially created "moral utility" doctrine served as a type of gatekeeper of patent subject matter eligibility. The doctrine allowed both the USTPO and courts to deny patents on morally controversial subject matter under the fiction that such inventions were not "useful." The gate, however, is currently untended. A combination of the demise of the moral utility doctrine, along with expansive judicial interpretations of the scope of patent-eligible subject matter, has resulted in virtually no basis on which the USTPO or courts can deny patent protection to morally controversial, but otherwise patentable, subject matter. This is so despite position statements by the Agency to the contrary. Biotechnology is an area in which many morally controversial inventions are generated. Congress has been in react-mode following the issuance of a stream of morally controversial biotech patents, including patents on transgenic animals, surgical methods, and methods of cloning humans. With no statutory limits on patent eligibility, and with myriad concerns complicating congressional action following a patent's issuance, it is not Congress, the representative of the people, determining patent eligibility. Instead, it is patent applicants, scientific inventors, who are deciding matters of high public policy through the contents of the applications they file with the USTPO. This Article

  17. The Academic Advantage: Gender Disparities in Patenting

    PubMed Central

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women’s rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women’s patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women—and in particular academic women—contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed. PMID:26017626

  18. US photovoltaic patents, 1951--1987

    NASA Astrophysics Data System (ADS)

    1988-09-01

    This document contains 2195 U.S. patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials as well as manufacturing and support functions. The patent entries in this document were issued from 1951 through 1987; no patents were found in 1950. The entries were located by searching USPA, the data base of the U.S. Patent Office. The final search retrieved all patents under the class Batteries, Thermoelectric and Photoelectric, and the subclasses Photoelectric, Testing, and Applications. The search also located patents that contained the words photovoltaic(s) or solar cell(s) and their derivatives. A manual search of the patents in the Solar Energy Research Institute (SERI) patent file augmented the data base search. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors, and subjects only peripherally concerned with photovoltaics. Some patents on these three subjects were included when it appeared that those inventions might be of use in terrwstrial PV power technologies.

  19. A functional, genome-wide evaluation of liposensitive yeast identifies the "ARE2 required for viability" (ARV1) gene product as a major component of eukaryotic fatty acid resistance.

    PubMed

    Ruggles, Kelly V; Garbarino, Jeanne; Liu, Ying; Moon, James; Schneider, Kerry; Henneberry, Annette; Billheimer, Jeff; Millar, John S; Marchadier, Dawn; Valasek, Mark A; Joblin-Mills, Aidan; Gulati, Sonia; Munkacsi, Andrew B; Repa, Joyce J; Rader, Dan; Sturley, Stephen L

    2014-02-14

    The toxic subcellular accumulation of lipids predisposes several human metabolic syndromes, including obesity, type 2 diabetes, and some forms of neurodegeneration. To identify pathways that prevent lipid-induced cell death, we performed a genome-wide fatty acid sensitivity screen in Saccharomyces cerevisiae. We identified 167 yeast mutants as sensitive to 0.5 mm palmitoleate, 45% of which define pathways that were conserved in humans. 63 lesions also impacted the status of the lipid droplet; however, this was not correlated to the degree of fatty acid sensitivity. The most liposensitive yeast strain arose due to deletion of the "ARE2 required for viability" (ARV1) gene, encoding an evolutionarily conserved, potential lipid transporter that localizes to the endoplasmic reticulum membrane. Down-regulation of mammalian ARV1 in MIN6 pancreatic β-cells or HEK293 cells resulted in decreased neutral lipid synthesis, increased fatty acid sensitivity, and lipoapoptosis. Conversely, elevated expression of human ARV1 in HEK293 cells or mouse liver significantly increased triglyceride mass and lipid droplet number. The ARV1-induced hepatic triglyceride accumulation was accompanied by up-regulation of DGAT1, a triglyceride synthesis gene, and the fatty acid transporter, CD36. Furthermore, ARV1 was identified as a transcriptional of the protein peroxisome proliferator-activated receptor α (PPARα), a key regulator of lipid homeostasis whose transcriptional targets include DGAT1 and CD36. These results implicate ARV1 as a protective factor in lipotoxic diseases due to modulation of fatty acid metabolism. In conclusion, a lipotoxicity-based genetic screen in a model microorganism has identified 75 human genes that may play key roles in neutral lipid metabolism and disease.

  20. A Functional, Genome-wide Evaluation of Liposensitive Yeast Identifies the “ARE2 Required for Viability” (ARV1) Gene Product as a Major Component of Eukaryotic Fatty Acid Resistance*

    PubMed Central

    Ruggles, Kelly V.; Garbarino, Jeanne; Liu, Ying; Moon, James; Schneider, Kerry; Henneberry, Annette; Billheimer, Jeff; Millar, John S.; Marchadier, Dawn; Valasek, Mark A.; Joblin-Mills, Aidan; Gulati, Sonia; Munkacsi, Andrew B.; Repa, Joyce J.; Rader, Dan; Sturley, Stephen L.

    2014-01-01

    The toxic subcellular accumulation of lipids predisposes several human metabolic syndromes, including obesity, type 2 diabetes, and some forms of neurodegeneration. To identify pathways that prevent lipid-induced cell death, we performed a genome-wide fatty acid sensitivity screen in Saccharomyces cerevisiae. We identified 167 yeast mutants as sensitive to 0.5 mm palmitoleate, 45% of which define pathways that were conserved in humans. 63 lesions also impacted the status of the lipid droplet; however, this was not correlated to the degree of fatty acid sensitivity. The most liposensitive yeast strain arose due to deletion of the “ARE2 required for viability” (ARV1) gene, encoding an evolutionarily conserved, potential lipid transporter that localizes to the endoplasmic reticulum membrane. Down-regulation of mammalian ARV1 in MIN6 pancreatic β-cells or HEK293 cells resulted in decreased neutral lipid synthesis, increased fatty acid sensitivity, and lipoapoptosis. Conversely, elevated expression of human ARV1 in HEK293 cells or mouse liver significantly increased triglyceride mass and lipid droplet number. The ARV1-induced hepatic triglyceride accumulation was accompanied by up-regulation of DGAT1, a triglyceride synthesis gene, and the fatty acid transporter, CD36. Furthermore, ARV1 was identified as a transcriptional of the protein peroxisome proliferator-activated receptor α (PPARα), a key regulator of lipid homeostasis whose transcriptional targets include DGAT1 and CD36. These results implicate ARV1 as a protective factor in lipotoxic diseases due to modulation of fatty acid metabolism. In conclusion, a lipotoxicity-based genetic screen in a model microorganism has identified 75 human genes that may play key roles in neutral lipid metabolism and disease. PMID:24273168

  1. Yeast ARV1 Is Required for Efficient Delivery of an Early GPI Intermediate to the First Mannosyltransferase during GPI Assembly and Controls Lipid Flow from the Endoplasmic Reticulum

    PubMed Central

    Kajiwara, Kentaro; Watanabe, Reika; Pichler, Harald; Ihara, Kensuke; Murakami, Suguru; Riezman, Howard

    2008-01-01

    Glycosylphosphatidylinositol (GPI), covalently attached to many eukaryotic proteins, not only acts as a membrane anchor but is also thought to be a sorting signal for GPI-anchored proteins that are associated with sphingolipid and sterol-enriched domains. GPI anchors contain a core structure conserved among all species. The core structure is synthesized in two topologically distinct stages on the leaflets of the endoplasmic reticulum (ER). Early GPI intermediates are assembled on the cytoplasmic side of the ER and then are flipped into the ER lumen where a complete GPI precursor is synthesized and transferred to protein. The flipping process is predicted to be mediated by a protein referred as flippase; however, its existence has not been proven. Here we show that yeast Arv1p is an important protein required for the delivery of an early GPI intermediate, GlcN-acylPI, to the first mannosyltransferase of GPI synthesis in the ER lumen. We also provide evidence that ARV1 deletion and mutations in other proteins involved in GPI anchor synthesis affect inositol phosphorylceramide synthesis as well as the intracellular distribution and amounts of sterols, suggesting a role of GPI anchor synthesis in lipid flow from the ER. PMID:18287539

  2. Yeast ARV1 is required for efficient delivery of an early GPI intermediate to the first mannosyltransferase during GPI assembly and controls lipid flow from the endoplasmic reticulum.

    PubMed

    Kajiwara, Kentaro; Watanabe, Reika; Pichler, Harald; Ihara, Kensuke; Murakami, Suguru; Riezman, Howard; Funato, Kouichi

    2008-05-01

    Glycosylphosphatidylinositol (GPI), covalently attached to many eukaryotic proteins, not only acts as a membrane anchor but is also thought to be a sorting signal for GPI-anchored proteins that are associated with sphingolipid and sterol-enriched domains. GPI anchors contain a core structure conserved among all species. The core structure is synthesized in two topologically distinct stages on the leaflets of the endoplasmic reticulum (ER). Early GPI intermediates are assembled on the cytoplasmic side of the ER and then are flipped into the ER lumen where a complete GPI precursor is synthesized and transferred to protein. The flipping process is predicted to be mediated by a protein referred as flippase; however, its existence has not been proven. Here we show that yeast Arv1p is an important protein required for the delivery of an early GPI intermediate, GlcN-acylPI, to the first mannosyltransferase of GPI synthesis in the ER lumen. We also provide evidence that ARV1 deletion and mutations in other proteins involved in GPI anchor synthesis affect inositol phosphorylceramide synthesis as well as the intracellular distribution and amounts of sterols, suggesting a role of GPI anchor synthesis in lipid flow from the ER.

  3. PATENTS IN GENOMICS AND HUMAN GENETICS

    PubMed Central

    Cook-Deegan, Robert; Heaney, Christopher

    2010-01-01

    Genomics and human genetics are scientifically fundamental and commercially valuable. These fields grew to prominence in an era of growth in government and nonprofit research funding, and of even greater growth of privately funded research and development in biotechnology and pharmaceuticals. Patents on DNA technologies are a central feature of this story, illustrating how patent law adapts---and sometimes fails to adapt---to emerging genomic technologies. In instrumentation and for therapeutic proteins, patents have largely played their traditional role of inducing investment in engineering and product development, including expensive postdiscovery clinical research to prove safety and efficacy. Patents on methods and DNA sequences relevant to clinical genetic testing show less evidence of benefits and more evidence of problems and impediments, largely attributable to university exclusive licensing practices. Whole-genome sequencing will confront uncertainty about infringing granted patents but jurisprudence trends away from upholding the broadest and potentially most troublesome patent claims. PMID:20590431

  4. Inventions and patents: a practical tutorial.

    PubMed

    Tidwell, J Lille; Liotta, Lance A

    2012-01-01

    Patents are designed to protect and encourage creativity and innovation. Patenting a biomedical discovery can be a requirement before a pharmaceutical company or biotech entity will invest in the lengthy and costly clinical testing necessary to achieve patient benefit. Although scientists and clinicians are well versed in research publication requirements, patent descriptions and claims are formatted in a manner quite different from a research paper. Patents require (a) a series of logical statements clearly delineating the boundaries of the novel aspects of the invention and (b) sufficient disclosure of the invention so that it can be reproduced by others. Patents are granted only for inventions that meet three conditions: novelty, nonobviousness, and usefulness. This chapter provides basic guidelines and definitions of technology transfer: inventions, inventorship, and patent filing, which are summarized using a question and answer format.

  5. Patentability of self-replicating technologies.

    PubMed

    Shear, Richard H

    2015-01-01

    Patents provide an incentive to inventors, investors, and entrepreneurs to conduct research and development, especially in risky (i.e., unpredictable) fields of technology. This review discusses whether self-replicating technologies are patentable within the United States and the issues surrounding them. Self-replicating technologies discussed include plants, bacteria, and genetic technology and the historical legal precedents that have led to the current status of the patent law. To clearly understand these issues, the review also discusses various U.S. Supreme Court cases that, although not related to self-replicating technologies, have an impact on these patentability issues. Finally, some thoughts regarding patent strategy are presented so as to maximize patent protection for these technologies. PMID:25256175

  6. Patentability of Parthenogenic Stem Cells: International Stem Cell Corporation v. Comptroller General of Patents.

    PubMed

    Mansnérus, Juli

    2015-06-01

    The European Court of Justice (ECJ) has recently issued a ruling in Case C-364/13 International Stem Cell Corporation v. Comptroller General of Patents Designs and Tademarks (Case) that aims at harmonising the patenting practices regarding interpretation of Article 6.2.c of Directive 98/44/EC (Biotech Patent Directive) in respect of patentability of human parthenogenic stem cells (hpSCs). The Case alters the patenting regime for human embryonic stem cell (hESC) applications, by stating that moral restrictions against hESC-patents are only applicable to such cells derived from embryos that had the potential to develop into a human being. Consequently, hpSC-based inventions may be patentable in Europe. This Case represents a leap forward to striking a balance between protecting human dignity and integrity whilst granting patent incentives for biomedical research.

  7. 37 CFR 1.81 - Drawings required in patent application.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Drawings required in patent application. 1.81 Section 1.81 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions The...

  8. 43 CFR 3862.8-1 - Land descriptions in patents.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 43 Public Lands: Interior 2 2013-10-01 2013-10-01 false Land descriptions in patents. 3862.8-1... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Lode Mining Claim Patent Applications § 3862.8-1 Land descriptions in patents. The land description in a patent...

  9. 43 CFR 3862.8-1 - Land descriptions in patents.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 43 Public Lands: Interior 2 2011-10-01 2011-10-01 false Land descriptions in patents. 3862.8-1... MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) MINERAL PATENT APPLICATIONS Lode Mining Claim Patent Applications § 3862.8-1 Land descriptions in patents. The land description in a patent...

  10. 37 CFR 42.9 - Action by patent owner.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Action by patent owner. 42.9 Section 42.9 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE TRIAL PRACTICE BEFORE THE PATENT TRIAL AND APPEAL BOARD Trial Practice and Procedure General §...

  11. 37 CFR 1.215 - Patent application publication.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Patent application publication. 1.215 Section 1.215 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions...

  12. 37 CFR 3.81 - Issue of patent to assignee.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Issue of patent to assignee. 3.81 Section 3.81 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE... of patent to assignee. (a) With payment of the issue fee: An application may issue in the name of...

  13. 37 CFR 1.315 - Delivery of patent.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Delivery of patent. 1.315 Section 1.315 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Allowance and Issue...

  14. 37 CFR 1.46 - Assigned inventions and patents.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Assigned inventions and patents. 1.46 Section 1.46 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Who May...

  15. 37 CFR 3.81 - Issue of patent to assignee.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Issue of patent to assignee. 3.81 Section 3.81 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE... of patent to assignee. (a) With payment of the issue fee: An application may issue in the name of...

  16. 37 CFR 42.221 - Amendment of the patent.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Amendment of the patent. 42.221 Section 42.221 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE TRIAL PRACTICE BEFORE THE PATENT TRIAL AND APPEAL BOARD Post-Grant Review...

  17. 37 CFR 1.81 - Drawings required in patent application.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Drawings required in patent application. 1.81 Section 1.81 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions The...

  18. 37 CFR 1.42 - Applicant for patent.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Applicant for patent. 1.42 Section 1.42 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Who May Apply for...

  19. 37 CFR 1.177 - Issuance of multiple reissue patents.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Issuance of multiple reissue patents. 1.177 Section 1.177 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Reissues §...

  20. 37 CFR 11.9 - Limited recognition in patent matters.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Limited recognition in patent matters. 11.9 Section 11.9 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE REPRESENTATION OF OTHERS BEFORE THE UNITED STATES PATENT AND TRADEMARK...