The incidence of rugby-related catastrophic injuries (including cardiac events) in South Africa from 2008 to 2011: a cohort study

PubMed Central

Brown, James Craig; Lambert, Mike I; Verhagen, Evert; Readhead, Clint; van Mechelen, Willem; Viljoen, Wayne

2013-01-01

Objectives To establish an accurate and comprehensive injury incidence registry of all rugby union-related catastrophic events in South Africa between 2008 and 2011. An additional aim was to investigate correlates associated with these injuries. Design Prospective. Setting The South African amateur and professional rugby-playing population. Participants An estimated 529 483 Junior and 121 663 Senior rugby union (‘rugby’) players (population at risk). Outcome measures Annual average incidences of rugby-related catastrophic injuries by type (cardiac events, traumatic brain and acute spinal cord injuries (ASCIs)) and outcome (full recoveries—fatalities). Playing level (junior and senior levels), position and event (phase of play) were also assessed. Results The average annual incidence of ASCIs and Traumatic Brain Injuries combined was 2.00 per 100 000 players (95% CI 0.91 to 3.08) from 2008 to 2011. The incidence of ASCIs with permanent outcomes was significantly higher at the Senior level (4.52 per 100 000 players, 95% CI 0.74 to 8.30) than the Junior level (0.24 per 100 000 players, 95% CI 0 to 0.65) during this period. The hooker position was associated with 46% (n=12 of 26) of all permanent ASCI outcomes, the majority of which (83%) occurred during the scrum phase of play. Conclusions The incidence of rugby-related catastrophic injuries in South Africa between 2008 and 2011 is comparable to that of other countries and to most other collision sports. The higher incidence rate of permanent ASCIs at the Senior level could be related to the different law variations or characteristics (eg, less regular training) compared with the Junior level. The hooker and scrum were associated with high proportions of permanent ASCIs. The BokSmart injury prevention programme should focus efforts on these areas (Senior level, hooker and scrum) and use this study as a reference point for the evaluation of the effectiveness of the programme. PMID:23447464

The incidence of rugby-related catastrophic injuries (including cardiac events) in South Africa from 2008 to 2011: a cohort study.

PubMed

Brown, James Craig; Lambert, Mike I; Verhagen, Evert; Readhead, Clint; van Mechelen, Willem; Viljoen, Wayne

2013-01-01

To establish an accurate and comprehensive injury incidence registry of all rugby union-related catastrophic events in South Africa between 2008 and 2011. An additional aim was to investigate correlates associated with these injuries. Prospective. The South African amateur and professional rugby-playing population. An estimated 529 483 Junior and 121 663 Senior rugby union ('rugby') players (population at risk). Annual average incidences of rugby-related catastrophic injuries by type (cardiac events, traumatic brain and acute spinal cord injuries (ASCIs)) and outcome (full recoveries-fatalities). Playing level (junior and senior levels), position and event (phase of play) were also assessed. The average annual incidence of ASCIs and Traumatic Brain Injuries combined was 2.00 per 100 000 players (95% CI 0.91 to 3.08) from 2008 to 2011. The incidence of ASCIs with permanent outcomes was significantly higher at the Senior level (4.52 per 100 000 players, 95% CI 0.74 to 8.30) than the Junior level (0.24 per 100 000 players, 95% CI 0 to 0.65) during this period. The hooker position was associated with 46% (n=12 of 26) of all permanent ASCI outcomes, the majority of which (83%) occurred during the scrum phase of play. The incidence of rugby-related catastrophic injuries in South Africa between 2008 and 2011 is comparable to that of other countries and to most other collision sports. The higher incidence rate of permanent ASCIs at the Senior level could be related to the different law variations or characteristics (eg, less regular training) compared with the Junior level. The hooker and scrum were associated with high proportions of permanent ASCIs. The BokSmart injury prevention programme should focus efforts on these areas (Senior level, hooker and scrum) and use this study as a reference point for the evaluation of the effectiveness of the programme.

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Adaptation of the Attitude toward the Subject of Chemistry Inventory (ASCI) into Turkish

ERIC Educational Resources Information Center

Sen, Senol; Yilmaz, Ayhan; Temel, Senar

2016-01-01

Developing an attitude influential in individuals' behaviours and related with academic achievement is a concept whose development science educators consider important. This research aims to adapt the 8-item Attitude toward the Subject of Chemistry Inventory (ASCI)--which was developed by Bauer (2008) and revised by Xu and Lewis (2011)--into…

A Novel Gene, ROA, Is Required for Normal Morphogenesis and Discharge of Ascospores in Gibberella zeae▿†

PubMed Central

Min, Kyunghun; Lee, Jungkwan; Kim, Jin-Cheol; Kim, Sang Gyu; Kim, Young Ho; Vogel, Steven; Trail, Frances; Lee, Yin-Won

2010-01-01

Head blight, caused by Gibberella zeae, is a significant disease among cereal crops, including wheat, barley, and rice, due to contamination of grain with mycotoxins. G. zeae is spread by ascospores forcibly discharged from sexual fruiting bodies forming on crop residues. In this study, we characterized a novel gene, ROA, which is required for normal sexual development. Deletion of ROA (Δroa) resulted in an abnormal size and shape of asci and ascospores but did not affect vegetative growth. The Δroa mutation triggered round ascospores and insufficient cell division after spore delimitation. The asci of the Δroa strain discharged fewer ascospores from the perithecia but achieved a greater dispersal distance than those of the wild-type strain. Turgor pressure within the asci was calculated through the analysis of osmolytes in the epiplasmic fluid. Deletion of the ROA gene appeared to increase turgor pressure in the mutant asci. The higher turgor pressure of the Δroa mutant asci and the mutant spore shape contributed to the longer distance dispersal. When the Δroa mutant was outcrossed with a Δmat1-2 mutant, a strain that contains a green fluorescence protein (GFP) marker in place of the MAT1-2 gene, unusual phenotypic segregation occurred. The ratio of GFP to non-GFP segregation was 1:1; however, all eight spores had the same shape. Taken together, the results of this study suggest that ROA plays multiple roles in maintaining the proper morphology and discharge of ascospores in G. zeae. PMID:20802018

Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms.

PubMed

Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno

2016-03-18

The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.

Downregulation of miR-199b promotes the acute spinal cord injury through IKKβ-NF-κB signaling pathway activating microglial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Heng-Jun; Wang, Li-Qing; Xu, Qing-Sheng

Inflammatory response played an important role in the progression of spinal cord injury (SCI). Several miRNAs were associated with the pathology of SCI. However, the molecular mechanism of miRNA involving in inflammatory response in acute SCI (ASCI) was poorly understood. Sprague-Dawley (SD) rats were divided into 2 groups: control group (n=6) and acute SCI (ASCI) group (n=6). The expression of miR-199b and IκB kinase β-nuclear factor-kappa B (IKKβ-NF-κB) signaling pathway were evaluated by quantitative reverse transcription-PCR (qRT-PCR) in rats with ASCI and in primary microglia activated by lipopolysaccharide (LPS). We found that downregulation of miR-199b and activation of IKKβ/NF-κB weremore » observed in rats after ASCI and in activated microglia. miR-199b negatively regulated IKKβ by targeting its 3′- untranslated regions (UTR) through using luciferase reporter assay. Overexpression of miR-199b reversed the up-regulation of IKKβ, p-p65, tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in LPS-treated BV2 cells assessed by western blotting analysis. In addition, BMS-345541 reversed the up-regulation effects of miR-199b inhibitor on the expression of TNF-α and IL-1β. In the SCI rats, overexpression of miR-199b attenuated ASCI and decreased the expression of IKKβ-NF-κB signaling pathway and TNF-α and IL-1β. These results indicated that miR-199b attenuated ASCI at least partly through IKKβ-NF-κB signaling pathway and affecting the function of microglia. Our findings suggest that miR-199b may be employed as therapeutic for spinal cord injury. - Highlights: • Downregulation of miR-199b and activation of IKKβ/NF-κB were observed in rat after SCI. • miR-199b negatively regulated IKKβ by targeting its 3′-UTR. • miR-199b overexpression reversed the increasing IKKβ, p-p65, TNF-α and IL-1β in LPS-treated BV2. • BMS-345541 reversed the up-regulation of TNF-α and IL-1β induced by miR-199b inhibitor. • Overexpression of miR-199b attenuated ASCI and decreased the expression of IKKβ-NF-κB in rats.« less

Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

DTIC Science & Technology

2011-10-01

GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

Spinal cord injuries in Australian footballers 1997-2002.

PubMed

Carmody, David J; Taylor, Thomas K F; Parker, David A; Coolican, Myles R J; Cumming, Robert G

2005-06-06

To review acute spinal cord injuries (ASCIs) in all Australian codes of football (rugby union [RU], rugby league [RL], Australian Rules football [ARF] and soccer) for 1997-2002 and to compare data with those of a 1986-1996 survey. Retrospective review of hospital records, and structured interviews with injured players. Patients admitted to any of the six Australian spinal cord injury units with a documented football-related ASCI over the period 1997-2002. Average annual incidence of ASCIs per 100,000 players in the different codes, final Frankel grading of injuries, and wheelchair status. Fifty-two footballers (45 adult men and seven schoolboys) suffered ASCIs between 1997 and 2002. The average annual incidence of ASCIs per 100,000 players was 3.2 for RU, 1.5 for RL, 0.5 for ARF and 0.2 for soccer. While there has been little change in incidence since the 1986-1996 survey, there has been a trend towards less severe injuries in RU and RL, but not in ARF. There have been no scrum injuries in RL since 1996, when the scrum stopped being contested. Seven injuries occurred in RU scrums, six at the moment of engagement of the opposing teams. The incidence of 2-on-1 and "gang" tackles (involving multiple tacklers) in RL is disturbing. Overall, 39% of injured players became permanently wheelchair-dependent. There continues to be good reason to revise the laws of scrum engagement in RU. The laws relating to multiple tacklers in RL should be examined. The insurance cover for injured players is grossly inadequate. The longstanding need for a registry of spinal cord injuries for all football codes regrettably remains unmet.

An Insertional Translocation in Neurospora That Generates Duplications Heterozygous for Mating Type

PubMed Central

Perkins, David D.

1972-01-01

In strain T(I→II)39311 a long interstitial segment is transposed from IL to IIR, where it is inserted in reversed order with respect to the centromere. In crosses of T x T essentially all asci have eight viable, black spores, and all progeny are phenotypically normal. When T(I→II)39311 is crossed by Normal sequence (N), the expected duplication class is viable while the corresponding deficiency is lethal; 44% of the asci have 8 Black (viable) spores and 0 White (inviable) spores, 41% have 4 Black: 4 White, and 10% have 6 Black: 2 White. These are the ascus types expected from normal centromere disjunction without crossing over (8B:0W and 4B:4W equally probable), and with crossing over between centromere and break point (6B:2W). On germination, 8B:0W asci give rise to only parental types—4 T and 4 N; 4B:4W asci usually give four duplication (Dup) progeny; and 6B:2W asci usually give 2 T, 2 N, 2 Dup. Thus one third of all viable, black ascospores contain duplications.—Recessive markers in the donor chromosome which contributes the translocated segment can be mapped by duplication coverage. Ratios of 2 Dominant: 1 Recessive vs. 1 Dominant: 2 Recessive distinguish location in or outside the transposed segment. Eleven loci including mating type have been shown to lie within the segment, and markers at four loci have been transferred into the segment by meiotic recombination. The frequency of marker transfer indicates that the inserted segment usually pairs with its homologue. Ascus types that would result from single exchanges within the insertion are infrequent, as expected if asci containing dicentric bridges usually do not survive.—Duplication ascospores germinate to produce distinctive inhibited colonies. Later these "escape" to grow like wild type, and genes that were initially heterozygous in the duplication segregate when escape occurs. As with duplications from pericentric inversion In(IL→IR)H4250 (Newmeyer and Taylor 1967), the initial inhibition is attributed to mating-type heterozygosity, and escape to a somatic event that makes mating type homoor hemizygous.—Twenty additional duplication-generating Neurospora rearrangements are listed and described briefly in an Appendix. PMID:17248574

Transreplication and crossing over in Sordaria fimicola.

PubMed

KITANI, Y; OLIVE, L S; EL-ANI, A S

1961-09-08

A study of the segregation of markers closely linked to the gray ascospore color locus in Sordaria fimicola reveals that there is a high incidence of crossing over very near the locus when it transreplicates, which is much more pronounced in 5:3 than in 6:2 asci. Also, a single 7:1 and several aberrant 4:4 asci are described. At a different spore color locus, transreplication yields only 6:2 ratios, while other spore color loci fail to transreplicate altogether

Changes in the Lipid Composition and Fine Structure of Saccharomyces cerevisiae During Ascus Formation

PubMed Central

Illingworth, R. F.; Rose, A. H.; Beckett, A.

1973-01-01

Eighty to ninety percent of vegetative cells of Saccharomyces cerevisiae DCL 740 incubated in KCl-acetate medium form asci, the majority of which are four-spored. Ascospores are visible in asci after about 24 hr, and spore formation is complete after about 48 hr. The dry weight of the cells increases by about 75% during 48 hr of incubation, while the lipid content of the cells increases by a factor of four. The increase in lipid content is attributed mainly to an increased synthesis of sterol esters and triacylglycerols and to a lesser extent of phospholipids. The phospholipid and sterol compositions do not change appreciably, but there is a marked increase in the proportion of unsaturated fatty acid residues in ascan lipids. Uniformly labeled 14C-acetate is incorporated mainly into sterol esters and triacylglycerols and phospholipids. Pulse-labeling by adding acetate-U-14C to sporulating cultures and harvesting after a further 6 hr of incubation reveal two main periods of acetate incorporation, namely between 0 and 18 hr, and between 24 and 30 hr. Electron micrographs of thin sections through developing asci show that the principal changes in fine structure occur between 18 and 24 hr and include the appearance of numerous electron-transparent vesicles which become aligned around the meiotic nucleus, and the laying down of extensive endoplasmic reticulum membranes. Changes in fine structure are discussed in relation to the alterations in lipid content and composition of asci. Images PMID:4569408

Expression of Meiotic Drive Elements Spore Killer-2 and Spore Killer-3 in Asci of Neurospora Tetrasperma

PubMed Central

Raju, N. B.; Perkins, D. D.

1991-01-01

It was shown previously that when a chromosomal Spore killer factor is heterozygous in Neurospora species with eight-spored asci, the four sensitive ascospores in each ascus die and the four survivors are all killers. Sk-2(K) and Sk-3(K) are nonrecombining haplotypes that segregate with the centromere of linkage group III. No killing occurs when either one of these killers is homozygous, but each is sensitive to killing by the other in crosses of Sk-2(K) X Sk-3(K). In the present study, Sk-2(K) and Sk-3(K) were transferred by recurrent backcrosses from the eight-spored species Neurospora crassa into Neurospora tetrasperma, a pseudohomothallic species which normally makes asci with four large spores, each heterokaryotic for mating type and for any other centromere-linked genes that are heterozygous in the cross. The action of Sk-2(K) and Sk-3(K) in N. tetrasperma is that predicted from their behavior in eight-spored species. A sensitive nucleus is protected from killing if it is enclosed in the same ascospore with a killer nucleus. Crosses of Sk-2(K) X Sk-2(S), Sk-3(K) X Sk-3(S), and Sk-2(K) X Sk-3(K) all produce four-spored asci that are wild type in appearance, with the ascospores heterokaryotic and viable. The Eight-spore gene E, which shows variable penetrance, was used to obtain N. tetrasperma asci in which two to eight spores are small and homokaryotic. When killer and sensitive alleles are segregating in the presence of E, only those ascospores that contain a killer allele survive. Half of the small ascospores are killed. In crosses of Sk-2(K) X Sk-3(K) (with E heterozygous), effectively all small ascospores are killed. The ability of N. tetrasperma to carry killer elements in cryptic condition suggests a possible role for Spore killers in the origin of pseudohomothallism, with adoption of the four-spored mode restoring ascospore viability of crosses in which killing would otherwise occur. PMID:1834522

Characterization of Listeria monocytogenes from an ice cream plant by serotyping and pulsed-field gel electrophoresis.

PubMed

Miettinen, M K; Björkroth, K J; Korkeala, H J

1999-02-18

One dominating strain of serotype 1/2b was found when serotyping and pulsed-field gel electrophoresis (PFGE) patterns were used for the characterization of 41 Listeria monocytogenes isolates originating from an ice cream plant. Samples were taken from the production environment, equipment and ice cream during the years 1990-1997. Serotyping divided the isolates into two serovars, 1/2b and 4b. Three rare-cutting enzymes (ApaI, AscI and SmaI) were used in the creation of PFGE patterns. AscI resulted in the best restriction enzyme digestion patterns (REDPs) for visual comparison. Eight different AscI REDPs were obtained, whereas ApaI produced six and SmaI seven banding patterns. When one-band differences are taken into account, 12 different PFGE types were distinguished based on information obtained with all three enzymes. The dominant PFGE type was found to have persisted in the ice cream plant for seven years. Improved and precisely targeted cleaning and disinfection practices combined with structural changes making for easier cleaning of the packaging machine, resulted in eradication of L. monocytogenes from this plant.

Keeping an Eye on the Prize

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hazi, A U

2007-02-06

Setting performance goals is part of the business plan for almost every company. The same is true in the world of supercomputers. Ten years ago, the Department of Energy (DOE) launched the Accelerated Strategic Computing Initiative (ASCI) to help ensure the safety and reliability of the nation's nuclear weapons stockpile without nuclear testing. ASCI, which is now called the Advanced Simulation and Computing (ASC) Program and is managed by DOE's National Nuclear Security Administration (NNSA), set an initial 10-year goal to obtain computers that could process up to 100 trillion floating-point operations per second (teraflops). Many computer experts thought themore » goal was overly ambitious, but the program's results have proved them wrong. Last November, a Livermore-IBM team received the 2005 Gordon Bell Prize for achieving more than 100 teraflops while modeling the pressure-induced solidification of molten metal. The prestigious prize, which is named for a founding father of supercomputing, is awarded each year at the Supercomputing Conference to innovators who advance high-performance computing. Recipients for the 2005 prize included six Livermore scientists--physicists Fred Streitz, James Glosli, and Mehul Patel and computer scientists Bor Chan, Robert Yates, and Bronis de Supinski--as well as IBM researchers James Sexton and John Gunnels. This team produced the first atomic-scale model of metal solidification from the liquid phase with results that were independent of system size. The record-setting calculation used Livermore's domain decomposition molecular-dynamics (ddcMD) code running on BlueGene/L, a supercomputer developed by IBM in partnership with the ASC Program. BlueGene/L reached 280.6 teraflops on the Linpack benchmark, the industry standard used to measure computing speed. As a result, it ranks first on the list of Top500 Supercomputer Sites released in November 2005. To evaluate the performance of nuclear weapons systems, scientists must understand how materials behave under extreme conditions. Because experiments at high pressures and temperatures are often difficult or impossible to conduct, scientists rely on computer models that have been validated with obtainable data. Of particular interest to weapons scientists is the solidification of metals. ''To predict the performance of aging nuclear weapons, we need detailed information on a material's phase transitions'', says Streitz, who leads the Livermore-IBM team. For example, scientists want to know what happens to a metal as it changes from molten liquid to a solid and how that transition affects the material's characteristics, such as its strength.« less

Most Uv-Induced Reciprocal Translocations in SORDARIA MACROSPORA Occur in or near Centromere Regions

PubMed Central

Leblon, G.; Zickler, D.; Lebilcot, S.

1986-01-01

In fungi, translocations can be identified and classified by the patterns of ascospore abortion in asci from crosses of rearrangement x normal sequence. Previous studies of UV-induced rearrangements in Sordaria macrospora revealed that a major class (called type III) appeared to be reciprocal translocations that were anomalous in producing an unexpected class of asci with four aborted ascospores in bbbbaaaa linear sequence (b = black; a = abortive). The present study shows that the anomalous type III rearrangements are, in fact, reciprocal translocations having both breakpoints within or adjacent to centromeres and that bbbbaaaa asci result from 3:1 disjunction from the translocation quadrivalent.—Electron microscopic observations of synaptonemal complexes enable centromeres to be visualized. Lengths of synaptonemal complexes lateral elements in translocation quadrivalents accurately reflect chromosome arm lengths, enabling breakpoints to be located reliably in centromere regions. All genetic data are consistent with the behavior expected of translocations with breakpoints at centromeres.—Two-thirds of the UV-induced reciprocal translocations are of this type. Certain centromere regions are involved preferentially. Among 73 type-III translocations, there were but 13 of the 21 possible chromosome combinations and 20 of the 42 possible combinations of chromosome arms. PMID:17246312

Most Uv-Induced Reciprocal Translocations in SORDARIA MACROSPORA Occur in or near Centromere Regions.

PubMed

Leblon, G; Zickler, D; Lebilcot, S

1986-02-01

In fungi, translocations can be identified and classified by the patterns of ascospore abortion in asci from crosses of rearrangement x normal sequence. Previous studies of UV-induced rearrangements in Sordaria macrospora revealed that a major class (called type III) appeared to be reciprocal translocations that were anomalous in producing an unexpected class of asci with four aborted ascospores in bbbbaaaa linear sequence (b = black; a = abortive). The present study shows that the anomalous type III rearrangements are, in fact, reciprocal translocations having both breakpoints within or adjacent to centromeres and that bbbbaaaa asci result from 3:1 disjunction from the translocation quadrivalent.-Electron microscopic observations of synaptonemal complexes enable centromeres to be visualized. Lengths of synaptonemal complexes lateral elements in translocation quadrivalents accurately reflect chromosome arm lengths, enabling breakpoints to be located reliably in centromere regions. All genetic data are consistent with the behavior expected of translocations with breakpoints at centromeres.-Two-thirds of the UV-induced reciprocal translocations are of this type. Certain centromere regions are involved preferentially. Among 73 type-III translocations, there were but 13 of the 21 possible chromosome combinations and 20 of the 42 possible combinations of chromosome arms.

LATIS3D: The Goal Standard for Laser-Tissue-Interaction Modeling

NASA Astrophysics Data System (ADS)

London, R. A.; Makarewicz, A. M.; Kim, B. M.; Gentile, N. A.; Yang, T. Y. B.

2000-03-01

The goal of this LDRD project has been to create LATIS3D-the world's premier computer program for laser-tissue interaction modeling. The development was based on recent experience with the 2D LATIS code and the ASCI code, KULL. With LATIS3D, important applications in laser medical therapy were researched including dynamical calculations of tissue emulsification and ablation, photothermal therapy, and photon transport for photodynamic therapy. This project also enhanced LLNL's core competency in laser-matter interactions and high-energy-density physics by pushing simulation codes into new parameter regimes and by attracting external expertise. This will benefit both existing LLNL programs such as ICF and SBSS and emerging programs in medical technology and other laser applications. The purpose of this project was to develop and apply a computer program for laser-tissue interaction modeling to aid in the development of new instruments and procedures in laser medicine.

Modeling and Simulation of Explosively Driven Electromechanical Devices

NASA Astrophysics Data System (ADS)

Demmie, Paul N.

2002-07-01

Components that store electrical energy in ferroelectric materials and produce currents when their permittivity is explosively reduced are used in a variety of applications. The modeling and simulation of such devices is a challenging problem since one has to represent the coupled physics of detonation, shock propagation, and electromagnetic field generation. The high fidelity modeling and simulation of complicated electromechanical devices was not feasible prior to having the Accelerated Strategic Computing Initiative (ASCI) computers and the ASCI developed codes at Sandia National Laboratories (SNL). The EMMA computer code is used to model such devices and simulate their operation. In this paper, I discuss the capabilities of the EMMA code for the modeling and simulation of one such electromechanical device, a slim-loop ferroelectric (SFE) firing set.

Attitude to the subject of chemistry in undergraduate nursing students at Fiji National University and Federation University, Australia.

PubMed

Brown, Stephen; Wakeling, Lara; Peck, Blake; Naiker, Mani; Hill, Dolores; Naidu, Keshni

2015-01-01

Attitude to the subject of chemistry was quantified in first-year undergraduate nursing students, at two geographically distinct universities. A purpose-designed diagnostic instrument (ASCI) was given to students at Federation University, Australia (n= 114), and at Fiji National University, Fiji (n=160). Affective and cognitive sub-scales within ASCI showed reasonable internal consistency. Cronbach's alpha for the cognitive sub-scale was 0.786 and 0.630, and 0.787 and 0.788 for affective sub-scale for the Federation University and Fiji National University students, respectively. Mean (SD) score for the cognitive sub-scale was 10.5 (5.6) and 15.2 (4.1) for students at Federation University and Fiji National University, respectively (P<0.001, t-test). Mean (SD) score for the affective sub-scale was 13.1 (5.1) and 20.7 (4.3) for students at Federation University and Fiji National University, respectively (P < 0.001, t-test). An exploratory factor analysis (n=274) confirmed a two-factor solution consistent with affective and cognitive sub-scales, each with good internal consistency. Quantifying attitude to chemistry in undergraduate nursing students using ASCI may have utility in assessing the impact of novel teaching strategies used in the education of nursing students in areas of bioscience and chemistry. However, geographically distinct populations of undergraduate nurses may show very different attitudes to chemistry.

[Measuring the impact of practices of social appropriation of science and technology: a proposal for a set of indicators].

PubMed

Daza-Caicedo, Sandra; Maldonado, Oscar; Arboleda-Castrillón, Tania; Falla, Sigrid; Moreno, Pablo; Tafur-Sequera, Mayali; Papagayo, Diana

2017-01-01

We propose a set of qualitative indicators for monitoring practices of social appropriation of science and technology. The design of this set is based on the Maloka case, but it can be of use to multiple actors involved in the social appropriation of science and technology (referred to by its Spanish acronym, ASCyT). The introduction discusses the concept of ASCyT. The first section provides a review of the literature about measuring activities that link science and society. The second section explains why it is important to develop this type of measurement. The third section lays out the methodology used in designing the indicators. The fourth section explains the set of indicators and the fifth reflects on that process.

Onward to Petaflops Computing

NASA Technical Reports Server (NTRS)

Bailey, David H.; Chancellor, Marisa K. (Technical Monitor)

1997-01-01

With programs such as the US High Performance Computing and Communications Program (HPCCP), the attention of scientists and engineers worldwide has been focused on the potential of very high performance scientific computing, namely systems that are hundreds or thousands of times more powerful than those typically available in desktop systems at any given point in time. Extending the frontiers of computing in this manner has resulted in remarkable advances, both in computing technology itself and also in the various scientific and engineering disciplines that utilize these systems. Within the month or two, a sustained rate of 1 Tflop/s (also written 1 teraflops, or 10(exp 12) floating-point operations per second) is likely to be achieved by the 'ASCI Red' system at Sandia National Laboratory in New Mexico. With this objective in sight, it is reasonable to ask what lies ahead for high-end computing.

Zhenbao pill protects against acute spinal cord injury via miR-146a-5p regulating the expression of GPR17

PubMed Central

Lv, Bokang; Huan, Yanqiang; Liu, Bin; Li, Yutang; Jia, Lizhou; Qu, Chenhui; Wang, Dongsheng; Yu, Hai

2018-01-01

The aim of the present study was to observe the effect of zhenbao pill on the motor function of acute spinal cord injury (ASCI) rats and the molecular mechanisms involving miR-146a-5p and G-protein-coupled receptor 17 (GPR17). ASCI rat model was established by modified Allen method, and then the rats were divided into three groups. SH-SY5Y cells were cultured overnight in hypoxia condition and transfected with miR-146a-5p mimic or miR-146a-5p inhibitor. The hind limb motor function of the rats was evaluated by Basso, Beattie, Bresnahan (BBB) scoring system. Quantitative real-time PCR (qRT-PCR) and Western blot were used to detect the expression of miR-146a-5p, GPR17, inducible nitric oxide synthase (iNOS), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α). Neuronal apoptosis was measured using flow cytometry assay. Luciferase reporter assay was performed to determine the regulation of miR-146a-5p on GPR17. Zhenbao pill could enhance hind limb motor function and attenuate the inflammatory response caused by ASCI. Moreover, zhenbao pill increased the level of miR-146a-5p and decreased GPR17 expression in vivo and in vitro. Bioinformatics software predicted that GPR17 3′-UTR had a binding site with miR-146a-5p. Luciferase reporter assay showed that miR-146a-5p had a negative regulatory effect on GPR17 expression. Knockdown of miR-146a-5p could reverse the effect of zhenbao pill on the up-regulation of GPR17 induced by hypoxia, reversed the inhibitory effect of zhenbao pill on the cell apoptosis induced by hypoxia and the recovery of zhenbao pill on hind limb motor function in ASCI rats. Zhenbao pill could inhibit neuronal apoptosis by regulating miR-146a-5p/GPR17 expression, and then promoting the recovery of spinal cord function. PMID:29187582

2017 Multimodality Appropriate Use Criteria for Noninvasive Cardiac Imaging: Expert Consensus of the Asian Society of Cardiovascular Imaging.

PubMed

Beck, Kyongmin Sarah; Kim, Jeong A; Choe, Yeon Hyeon; Hian, Sim Kui; Hoe, John; Hong, Yoo Jin; Kim, Sung Mok; Kim, Tae Hoon; Kim, Young Jin; Kim, Yun Hyeon; Kuribayashi, Sachio; Lee, Jongmin; Leong, Lilian; Lim, Tae-Hwan; Lu, Bin; Park, Jae Hyung; Sakuma, Hajime; Yang, Dong Hyun; Yaw, Tan Swee; Wan, Yung-Liang; Zhang, Zhaoqi; Zhao, Shihua; Yong, Hwan Seok

2017-01-01

In 2010, the Asian Society of Cardiovascular Imaging (ASCI) provided recommendations for cardiac CT and MRI, and this document reflects an update of the 2010 ASCI appropriate use criteria (AUC). In 2016, the ASCI formed a new working group for revision of AUC for noninvasive cardiac imaging. A major change that we made in this document is the rating of various noninvasive tests (exercise electrocardiogram, echocardiography, positron emission tomography, single-photon emission computed tomography, radionuclide imaging, cardiac magnetic resonance, and cardiac computed tomography/angiography), compared side by side for their applications in various clinical scenarios. Ninety-five clinical scenarios were developed from eight selected pre-existing guidelines and classified into four sections as follows: 1) detection of coronary artery disease, symptomatic or asymptomatic; 2) cardiac evaluation in various clinical scenarios; 3) use of imaging modality according to prior testing; and 4) evaluation of cardiac structure and function. The clinical scenarios were scored by a separate rating committee on a scale of 1-9 to designate appropriate use, uncertain use, or inappropriate use according to a modified Delphi method. Overall, the AUC ratings for CT were higher than those of previous guidelines. These new AUC provide guidance for clinicians choosing among available testing modalities for various cardiac diseases and are also unique, given that most previous AUC for noninvasive imaging include only one imaging technique. As cardiac imaging is multimodal in nature, we believe that these AUC will be more useful for clinical decision making.

Test and evaluation procedures for Sandia's Teraflops Operating System (TOS) on Janus.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnette, Daniel Wayne

This report describes the test and evaluation methods by which the Teraflops Operating System, or TOS, that resides on Sandia's massively-parallel computer Janus is verified for production release. Also discussed are methods used to build TOS before testing and evaluating, miscellaneous utility scripts, a sample test plan, and a proposed post-test method for quickly examining the large number of test results. The purpose of the report is threefold: (1) to provide a guide to T&E procedures, (2) to aid and guide others who will run T&E procedures on the new ASCI Red Storm machine, and (3) to document some ofmore » the history of evaluation and testing of TOS. This report is not intended to serve as an exhaustive manual for testers to conduct T&E procedures.« less

UPEML Version 2. 0: A machine-portable CDC Update emulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mehlhorn, T.A.; Young, M.F.

1987-05-01

UPEML is a machine-portable CDC Update emulation program. UPEML is written in ANSI standard Fortran-77 and is relatively simple and compact. It is capable of emulating a significant subset of the standard CDC Update functions, including program library creation and subsequent modification. Machine-portability is an essential attribute of UPEML. UPEML was written primarily to facilitate the use of CDC-based scientific packages on alternate computer systems such as the VAX 11/780 and the IBM 3081. UPEML has also been successfully used on the multiprocessor ELXSI, on CRAYs under both COS and CTSS operating systems, on APOLLO workstations, and on the HP-9000.more » Version 2.0 includes enhanced error checking, full ASCI character support, a program library audit capability, and a partial update option in which only selected or modified decks are written to the compile file. Further enhancements include checks for overlapping corrections, processing of nested calls to common decks, and reads and addfiles from alternate input files.« less

Ascus dysgenesis in hybrid crosses of Neurospora and Sordaria (Sordariaceae).

PubMed

Kasbekar, Durgadas P

2017-07-01

When two lineages derived from a common ancestor become reproductively isolated (e.g. Neurospora crassa and N. tetrasperma), genes that have undergone mutation and adaptive evolution in one lineage can potentially become dysfunctional when transferred into the other, since other genes have undergone mutation and evolution in the second lineage, and the derived alleles were never 'tested' together before hybrid formation. Bateson (1909), Dobzhansky (1936), and Muller (1942) recognized that incompatibility between the derived alleles could potentially make the hybrid lethal, sterile, or display some other detriment. Alternatively, the detrimental effects seen in crosses with the hybrids may result from the silencing of ascus-development genes by meiotic silencing by unpaired DNA (MSUD). Aberrant transcripts from genes improperly paired in meiosis are processed into single-stranded MSUD-associated small interfering RNA (masiRNA), which is used to degrade complementary mRNA. Recently, backcrosses of N. crassa / N. tetrasperma hybrid translocation strains with wild-type N. tetrasperma were found to elicit novel ascus dysgenesis phenotypes. One was a transmission ratio distortion that apparently disfavoured the homokaryotic ascospores formed following alternate segregation. Another was the production of heterokaryotic ascospores in eight-spored asci. Lewis (1969) also had reported sighting rare eight-spored asci with heterokaryotic ascospores in interspecific crosses in Sordaria, a related genus. Ordinarily, in both Neurospora and Sordaria, the ascospores are partitioned at the eight-nucleus stage, and ascospores in eight-spored asci are initially uninucleate. Evidently, in hybrid crosses of the family Sordariaceae, ascospore partitioning can be delayed until after one or more mitoses following the postmeiotic mitosis.

2017 Multimodality Appropriate Use Criteria for Noninvasive Cardiac Imaging: Expert Consensus of the Asian Society of Cardiovascular Imaging

PubMed Central

Beck, Kyongmin Sarah; Kim, Jeong A; Choe, Yeon Hyeon; Hian, Sim Kui; Hoe, John; Hong, Yoo Jin; Kim, Sung Mok; Kim, Tae Hoon; Kim, Young Jin; Kim, Yun Hyeon; Kuribayashi, Sachio; Lee, Jongmin; Leong, Lilian; Lim, Tae-Hwan; Lu, Bin; Park, Jae Hyung; Sakuma, Hajime; Yang, Dong Hyun; Yaw, Tan Swee; Wan, Yung-Liang; Zhang, Zhaoqi; Zhao, Shihua

2017-01-01

In 2010, the Asian Society of Cardiovascular Imaging (ASCI) provided recommendations for cardiac CT and MRI, and this document reflects an update of the 2010 ASCI appropriate use criteria (AUC). In 2016, the ASCI formed a new working group for revision of AUC for noninvasive cardiac imaging. A major change that we made in this document is the rating of various noninvasive tests (exercise electrocardiogram, echocardiography, positron emission tomography, single-photon emission computed tomography, radionuclide imaging, cardiac magnetic resonance, and cardiac computed tomography/angiography), compared side by side for their applications in various clinical scenarios. Ninety-five clinical scenarios were developed from eight selected pre-existing guidelines and classified into four sections as follows: 1) detection of coronary artery disease, symptomatic or asymptomatic; 2) cardiac evaluation in various clinical scenarios; 3) use of imaging modality according to prior testing; and 4) evaluation of cardiac structure and function. The clinical scenarios were scored by a separate rating committee on a scale of 1–9 to designate appropriate use, uncertain use, or inappropriate use according to a modified Delphi method. Overall, the AUC ratings for CT were higher than those of previous guidelines. These new AUC provide guidance for clinicians choosing among available testing modalities for various cardiac diseases and are also unique, given that most previous AUC for noninvasive imaging include only one imaging technique. As cardiac imaging is multimodal in nature, we believe that these AUC will be more useful for clinical decision making. PMID:29089819

Architectural requirements for the Red Storm computing system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camp, William J.; Tomkins, James Lee

This report is based on the Statement of Work (SOW) describing the various requirements for delivering 3 new supercomputer system to Sandia National Laboratories (Sandia) as part of the Department of Energy's (DOE) Accelerated Strategic Computing Initiative (ASCI) program. This system is named Red Storm and will be a distributed memory, massively parallel processor (MPP) machine built primarily out of commodity parts. The requirements presented here distill extensive architectural and design experience accumulated over a decade and a half of research, development and production operation of similar machines at Sandia. Red Storm will have an unusually high bandwidth, low latencymore » interconnect, specially designed hardware and software reliability features, a light weight kernel compute node operating system and the ability to rapidly switch major sections of the machine between classified and unclassified computing environments. Particular attention has been paid to architectural balance in the design of Red Storm, and it is therefore expected to achieve an atypically high fraction of its peak speed of 41 TeraOPS on real scientific computing applications. In addition, Red Storm is designed to be upgradeable to many times this initial peak capability while still retaining appropriate balance in key design dimensions. Installation of the Red Storm computer system at Sandia's New Mexico site is planned for 2004, and it is expected that the system will be operated for a minimum of five years following installation.« less

Wickerhamiella van der Walt (1973)

USDA-ARS?s Scientific Manuscript database

This chapter describes the ascomycetous yeast genus Wickerhamiella, which has five described species and has been defined from multigene deoxyribonucleic acid (DNA) sequence analysis. The species reproduce by multilateral budding but do not form hyphae or pseudohyphae. Asci typically form a single a...

Numerical Technology for Large-Scale Computational Electromagnetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharpe, R; Champagne, N; White, D

The key bottleneck of implicit computational electromagnetics tools for large complex geometries is the solution of the resulting linear system of equations. The goal of this effort was to research and develop critical numerical technology that alleviates this bottleneck for large-scale computational electromagnetics (CEM). The mathematical operators and numerical formulations used in this arena of CEM yield linear equations that are complex valued, unstructured, and indefinite. Also, simultaneously applying multiple mathematical modeling formulations to different portions of a complex problem (hybrid formulations) results in a mixed structure linear system, further increasing the computational difficulty. Typically, these hybrid linear systems aremore » solved using a direct solution method, which was acceptable for Cray-class machines but does not scale adequately for ASCI-class machines. Additionally, LLNL's previously existing linear solvers were not well suited for the linear systems that are created by hybrid implicit CEM codes. Hence, a new approach was required to make effective use of ASCI-class computing platforms and to enable the next generation design capabilities. Multiple approaches were investigated, including the latest sparse-direct methods developed by our ASCI collaborators. In addition, approaches that combine domain decomposition (or matrix partitioning) with general-purpose iterative methods and special purpose pre-conditioners were investigated. Special-purpose pre-conditioners that take advantage of the structure of the matrix were adapted and developed based on intimate knowledge of the matrix properties. Finally, new operator formulations were developed that radically improve the conditioning of the resulting linear systems thus greatly reducing solution time. The goal was to enable the solution of CEM problems that are 10 to 100 times larger than our previous capability.« less

Modal characterization of the ASCIE segmented optics testbed: New algorithms and experimental results

NASA Technical Reports Server (NTRS)

Carrier, Alain C.; Aubrun, Jean-Noel

1993-01-01

New frequency response measurement procedures, on-line modal tuning techniques, and off-line modal identification algorithms are developed and applied to the modal identification of the Advanced Structures/Controls Integrated Experiment (ASCIE), a generic segmented optics telescope test-bed representative of future complex space structures. The frequency response measurement procedure uses all the actuators simultaneously to excite the structure and all the sensors to measure the structural response so that all the transfer functions are measured simultaneously. Structural responses to sinusoidal excitations are measured and analyzed to calculate spectral responses. The spectral responses in turn are analyzed as the spectral data become available and, which is new, the results are used to maintain high quality measurements. Data acquisition, processing, and checking procedures are fully automated. As the acquisition of the frequency response progresses, an on-line algorithm keeps track of the actuator force distribution that maximizes the structural response to automatically tune to a structural mode when approaching a resonant frequency. This tuning is insensitive to delays, ill-conditioning, and nonproportional damping. Experimental results show that is useful for modal surveys even in high modal density regions. For thorough modeling, a constructive procedure is proposed to identify the dynamics of a complex system from its frequency response with the minimization of a least-squares cost function as a desirable objective. This procedure relies on off-line modal separation algorithms to extract modal information and on least-squares parameter subset optimization to combine the modal results and globally fit the modal parameters to the measured data. The modal separation algorithms resolved modal density of 5 modes/Hz in the ASCIE experiment. They promise to be useful in many challenging applications.

Tri-Laboratory Linux Capacity Cluster 2007 SOW

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seager, M

2007-03-22

The Advanced Simulation and Computing (ASC) Program (formerly know as Accelerated Strategic Computing Initiative, ASCI) has led the world in capability computing for the last ten years. Capability computing is defined as a world-class platform (in the Top10 of the Top500.org list) with scientific simulations running at scale on the platform. Example systems are ASCI Red, Blue-Pacific, Blue-Mountain, White, Q, RedStorm, and Purple. ASC applications have scaled to multiple thousands of CPUs and accomplished a long list of mission milestones on these ASC capability platforms. However, the computing demands of the ASC and Stockpile Stewardship programs also include a vastmore » number of smaller scale runs for day-to-day simulations. Indeed, every 'hero' capability run requires many hundreds to thousands of much smaller runs in preparation and post processing activities. In addition, there are many aspects of the Stockpile Stewardship Program (SSP) that can be directly accomplished with these so-called 'capacity' calculations. The need for capacity is now so great within the program that it is increasingly difficult to allocate the computer resources required by the larger capability runs. To rectify the current 'capacity' computing resource shortfall, the ASC program has allocated a large portion of the overall ASC platforms budget to 'capacity' systems. In addition, within the next five to ten years the Life Extension Programs (LEPs) for major nuclear weapons systems must be accomplished. These LEPs and other SSP programmatic elements will further drive the need for capacity calculations and hence 'capacity' systems as well as future ASC capability calculations on 'capability' systems. To respond to this new workload analysis, the ASC program will be making a large sustained strategic investment in these capacity systems over the next ten years, starting with the United States Government Fiscal Year 2007 (GFY07). However, given the growing need for 'capability' systems as well, the budget demands are extreme and new, more cost effective ways of fielding these systems must be developed. This Tri-Laboratory Linux Capacity Cluster (TLCC) procurement represents the ASC first investment vehicle in these capacity systems. It also represents a new strategy for quickly building, fielding and integrating many Linux clusters of various sizes into classified and unclassified production service through a concept of Scalable Units (SU). The programmatic objective is to dramatically reduce the overall Total Cost of Ownership (TCO) of these 'capacity' systems relative to the best practices in Linux Cluster deployments today. This objective only makes sense in the context of these systems quickly becoming very robust and useful production clusters under the crushing load that will be inflicted on them by the ASC and SSP scientific simulation capacity workload.« less

PARAPHYSOIDS, PSEUDOPARAPHYSES, AND APICAL PARAPHYSES,

DTIC Science & Technology

The distinct, vertical, paraphysis-like hyphae developing in the centrum of loculoascomycetes prior to the formation of asci are properly termed...structure is of doubtful usefulness. The downward-growing palisade of hyphae with free tips in the centrum of hypocreaceous fungi should be distinguished as apical paraphyses. (Author)

Spherical harmonic results for the 3D Kobayashi Benchmark suite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, P N; Chang, B; Hanebutte, U R

1999-03-02

Spherical harmonic solutions are presented for the Kobayashi benchmark suite. The results were obtained with Ardra, a scalable, parallel neutron transport code developed at Lawrence Livermore National Laboratory (LLNL). The calculations were performed on the IBM ASCI Blue-Pacific computer at LLNL.

Further evidence that aberrant segregation and crossing over in Sordaria brevicollis may be discrete, though associated, events.

PubMed

Theivendirarajah, K; Whitehouse, H L

1983-01-01

Crosses were made between buff spore colour mutants in Sordaria brevicollis in the presence of flanking markers. Recombinant asci with one or more wild-type spores were isolated and the spores germinated and scored for buff and flanking marker genotype. The buff genotype was determined by back-crossing to each parent and looking for recombinants. It was found that the majority of the recombinant asci had aberrant segregation at one or other mutant site but not both. It was inferred that in the recombinants hybrid DNA rarely extended to both sites. When the aberrant segregation was associated with crossing-over, the crossovers were situated at either end of the gene rather than between the allelic sites where the hybrid DNA was believed to terminate. Thus, some of the crossovers were separated from the site of the aberrant segregation by a site apparently not involved in hybrid DNA and none was in the position predicted by the Meselson-Radding model, that is, where the hybrid DNA terminates.

The Manifestation of Chromosome Rearrangements in Unordered Asci of Neurospora

PubMed Central

Perkins, David D.

1974-01-01

Rapid, effective techniques have been developed for detecting and characterizing chromosome aberrations in Neurospora by visual inspection of ascospores and asci. Rearrangements that are detectable by the presence of deficient, nonblack ascospores in test crosses make up 5 to 10% of survivors after UV doses giving 10-55% survival. Over 135 rearrangements have been diagnosed by classifying unordered asci according to numbers of defective spores. (These include 15 originally identified or analyzed by other workers.) About 100 reciprocal translocations (RT's) have been confirmed and mapped genetically, involving all combinations of the seven chromosomes. Thirty-three other rearrangements generate viable nontandem duplications in meiosis. These consist of insertional translocations (IT's) (15 confirmed), and of rearrangements that involve a chromosome tip (10 translocations and 3 pericentric inversions). No inversion has been found that does not include the centromere. A reciprocal translocation was found within one population in nature. When pairs of RT's that involve the same two chromosome arms were intercrossed, viable duplications were produced if the breakpoints overlapped in such a way that pairing resembled that of insertional translocations (27 combinations).—The rapid analytical technique depends on the following. Deficiency ascospores are usually nonblack (W: "white") and inviable, while nondeficient ascospores, even those that include duplications, are black (B) and viable. Thus RT's typically produce 50% black spores, and IT's 75% black. Asci are shot spontaneously from ripe perithecia, and can be collected in large numbers as groups of eight ascospores representing unordered tetrads, which fall into five classes: 8B:0W; 6B:2W, 4B:4W, 2B:6B, 0B:8W. In isosequential crosses, 90-95% of tetrads are 8:0. When a rearrangement is heterozygous, the frequencies of tetrad classes are diagnostic of the type of rearrangement, and provide information also on the positions of break points. With RT's, 8:0 (alternate centromere segregation) = 0:8 (adjacent-1), 4:4's require interstitial crossing over in a centromere-break point interval, and no 6:2's or 2:6's are expected. With IT's, duplications are viable, 8:0 = 4:4, 6:2's are from interstitial crossing over, 0:8's or 2:6's are rare. Tetrads from RT's that involve a chromosome tip resemble those from IT's, as do tetrads from intercrosses between partially overlapping RT's that involve identical chromosome arms.—Because viable duplications and other aneuploid derivatives regularly occur among the offspring of rearrangements such as insertional translocations, care must be taken in selecting stocks, and original strains should be kept for reference. PMID:4416353

Proceedings from the conference on high speed computing: High speed computing and national security

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirons, K.P.; Vigil, M.; Carlson, R.

1997-07-01

This meeting covered the following topics: technologies/national needs/policies: past, present and future; information warfare; crisis management/massive data systems; risk assessment/vulnerabilities; Internet law/privacy and rights of society; challenges to effective ASCI programmatic use of 100 TFLOPs systems; and new computing technologies.

Australasian sequestrate fungi 17: the genus Hydnoplicata (Ascomycota, Pezizaceae) resurrected.

Treesearch

James M. Trappe; Andrew W. Claridge

2006-01-01

The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whitei, even though the species is consistently...

Australasian sequestrate fungi 17: The genus Hydnoplicata (Ascomycota, Pezizacae) resurrected

Treesearch

James M. Trappe; Andrew W. Claridge

2006-01-01

The genus Hydnoplicata and its type species, H. whitei, were described by Gilkey in 1954. Having discovered that it has amyloid asci and other characters that relate it to the genus Peziza, Trappe later proposed the new combination, Peziza whiten, even though the species is consistently...

Complex Multi-Chamber Airbag Performance Simulation Final Report CRADA No. TSB-961-94

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kay, Gregory; Kithil, Philip

The purpose of this small business CRADA was to evaluate the performance of new airbag concepts which were developed by the Advanced Safety Concepts, Inc. (ASCI). These new airbag concepts, if successful, could have major potential savings to society in terms of fewer injuries, lost time and lives.

Quantifying Attitude to Chemistry in Students at the University of the South Pacific

ERIC Educational Resources Information Center

Brown, S. J.; Sharma, B. N.; Wakeling, L.; Naiker, M.; Chandra, S.; Gopalan, R. D.; Bilimoria, V. B.

2014-01-01

The attitude towards the study of chemistry for new entrant chemistry students from a multi-national, regional, tertiary educational institution in the South Pacific was investigated using a purpose-designed diagnostic instrument. The Attitude toward the Study of Chemistry Inventory (ASCI) was used to quantify attitude in a cohort of first year…

Attitude to the Study of Chemistry and Its Relationship with Achievement in an Introductory Undergraduate Course

ERIC Educational Resources Information Center

Brown, Stephen J.; White, Sue; Sharma, Bibhya; Wakeling, Lara; Naiker, Mani; Chandra, Shaneel; Gopalan, Romila; Bilimoria, Veena

2015-01-01

A positive attitude to a subject may be congruent with higher achievement; however, limited evidence supports this for students in undergraduate chemistry--this may result from difficulties in quantifying attitude. Therefore, in this study, the Attitude to the Study of Chemistry Inventory (ASCI)--a validated instrument to quantify attitude, was…

Using SPEEDES to simulate the blue gene interconnect network

NASA Technical Reports Server (NTRS)

Springer, P.; Upchurch, E.

2003-01-01

JPL and the Center for Advanced Computer Architecture (CACR) is conducting application and simulation analyses of BG/L in order to establish a range of effectiveness for the Blue Gene/L MPP architecture in performing important classes of computations and to determine the design sensitivity of the global interconnect network in support of real world ASCI application execution.

Diagnosing Changes in Attitude in First-Year College Chemistry Students with a Shortened Version of Bauer's Semantic Differential

ERIC Educational Resources Information Center

Brandriet, Alexandra R.; Xu, Xiaoying; Bretz, Stacey Lowery; Lewis, Jennifer E.

2011-01-01

In this quantitative study, a shortened version of the Attitude toward the Subject of Chemistry Inventory (ASCI) created by Bauer (2008) was used to identify the chemistry attitudes of two populations of general chemistry students at two universities. The ASCIv2 contained just two factors from the original instrument. These factors measured…

Application Specific Chemical Information Microprocessor (ASCI mu P)

DTIC Science & Technology

1999-09-30

lithography created channels in polydimethylsiloxane polymer. 1C. Optical micrograph of 100 um line widths using soft lithography Progress has also been made...also collaborated with Dr. Jose Almirall at Florida International University and have accomplished the HPLC method development of explosives detection...analytical materials. We have established the base for LIF electrophoretic chip analysis and similarly for the electrochemcial detection. We have learned the

Evaluation of the fish passage effectiveness of the Bonneville I prototype surface collector using three-dimensional ultrasonic fish tracking - Final Report

USGS Publications Warehouse

Faber, D.M; Weiland, M.A.; Moursund, R.A.; Carlson, T.J.; Adams, N.; Rondorf, D.

2001-01-01

This report describes tests conducted at Bonneville Dam on the Columbia River in the spring of 2000. The studies used three-dimensional (3D) acoustic telemetry and computational fluid dynamics (CFD) hydraulic modeling techniques to evaluate the response of outmigrating juvenile steelhead (Oncorhynchus mykiss) and yearling chinook (O. tshawytscha) to the Prototype Surface Collector (PSC) installed at Powerhouse I of Bonneville Dam in 1998 to test the concept of using a deep-slot surface bypass collector to divert downstream migrating salmon from turbines. The study was conducted by Pacific Northwest National Laboratory (PNNL), the Waterways Experiment Station of the U.S. Army Corp of Engineers (COE), Asci Corporation, and the U.S. Geological Survey (USGS), and was sponsored by COE’s Portland District. The goal of the study was to observe the three-dimensional behavior of tagged fish (fish bearing ultrasonic micro-transmitters) within 100 meters (m) of the surface flow bypass structure to test hypotheses about the response of migrants to flow stimuli generated by the presence of the surface flow bypass prototype and its operation. Research was done in parallel with radio telemetry studies conducted by USGS and hydroacoustic studies conducted by WES & Asci to evaluate the prototype surface collector.

Scaling Properties of Algorithms in Nanotechnology

NASA Technical Reports Server (NTRS)

Saini, Subhash; Bailey, David H.; Chancellor, Marisa K. (Technical Monitor)

1996-01-01

At the present time, several technologies are pressing the limits of microminiature manufacturing. In semiconductor technology, for example, the Intel Pentium Pro (which is used in the Department of Energy's ASCI 'red' parallel supercomputer system) and the DEC Alpha 21164 (which is used in the CRAY T3E) both are fabricated using 0.35 micron process technology. Recently Texas Instruments (TI) announced the availability of 0.25 micron technology chips by the end of 1996 and plans to have 0.18 micron devices in production within two years. However, some significant challenges lie down the road. These include the skyrocketing cost of manufacturing plants, the 0.1 micron foreseeable limit of the photolithography process, quantum effects, data communication bandwidth limitations, heat dissipation, and others. Some related microminiature technologies include micro-electromechanical systems (MEMS), opto-electronic devices, quantum computing, biological computing, and others. All of these technologies require the fabrication of devices whose sizes are approaching the nanometer level. As such they are often collectively referred to with the name 'nanotechnology'. Clearly nanotechnology in this general sense is destined to be a very important technology of the 21st century. The ultimate dream in this arena is 'molecular nanotechnology', in other words the fabrication of devices and materials with most or all atoms and molecules in a pre-programmed position, possibly placed there by 'nano-robots'. This futuristic capability will probably not be achieved for at least two decades. However, it appears that somewhat less ambitious variations of molecular nanotechnology, such as devices and materials based on 'buckyballs' and 'nanotubes' may be realized significantly sooner, possibly within ten years or so. Even at the present time, semiconductor devices are approaching the regime where quantum chemical effects must be considered in design.

Matrix Metalloproteinases as a Therapeutic Target to Improve Neurologic Recovery After Spinal Cord Injury

DTIC Science & Technology

2015-12-01

aberrant remodeling of the bladder wall, which could contribute to increased weight of this structure and reduced voiding. We next evaluated the...moderate levels of SCI show both neurological and urological recovery. Task 4. Analysis of lesion epicenter and serotonergic fiber tracks caudal to a...SCI in mice. 4a. Perfuse animals with fixative, remove the cords, and stain with Eriochrome cyanine or immunostain for serotonergic fiber tracks

User Metrics in NASA Earth Science Data Systems

NASA Technical Reports Server (NTRS)

Lynnes, Chris

2018-01-01

This presentation the collection and use of user metrics in NASA's Earth Science data systems. A variety of collection methods is discussed, with particular emphasis given to the American Customer Satisfaction Index (ASCI). User sentiment on potential use of cloud computing is presented, with generally positive responses. The presentation also discusses various forms of automatically collected metrics, including an example of the relative usage of different functions within the Giovanni analysis system.

Studying Turbulence Using Numerical Simulation Databases. No. 7; Proceedings of the Summer Program

NASA Technical Reports Server (NTRS)

1998-01-01

The Seventh Summer Program of the Center for Turbulence Research took place in the four-week period, July 5 to July 31, 1998. This was the largest CTR Summer Program to date, involving thirty-six participants from the U. S. and nine other countries. Thirty-one Stanford and NASA-Ames staff members facilitated and contributed to most of the Summer projects. A new feature, and perhaps a preview of the future programs, was that many of the projects were executed on non-NASA computers. These included supercomputers located in Europe as well as those operated by the Departments of Defense and Energy in the United States. In addition, several simulation programs developed by the visiting participants at their home institutions were used. Another new feature was the prevalence of lap-top personal computers which were used by several participants to carry out some of the work that in the past were performed on desk-top workstations. We expect these trends to continue as computing power is enhanced and as more researchers (many of whom CTR alumni) use numerical simulations to study turbulent flows. CTR's main role continues to be in providing a forum for the study of turbulence for engineering analysis and in facilitating intellectual exchange among the leading researchers in the field. Once again the combustion group was the largest. Turbulent combustion has enjoyed remarkable progress in using simulations to address increasingly complex and practically more relevant questions. The combustion group's studies included such challenging topics as fuel evaporation, soot chemistry, and thermonuclear reactions. The latter study was one of three projects related to the Department of Energy's ASCI Program (www.llnl.gov/asci); the other two (rocket propulsion and fire safety) were carried out in the turbulence modeling group. The flow control and acoustics group demonstrated a successful application of the so-called evolution algorithms which actually led to a previously unknown forcing strategy for jets yielding increased spreading rate. A very efficient algorithm for flow in complex geometries with moving boundaries based on the immersed boundary forcing technique was tested with very encouraging results. Also a new strategy for the destruction of aircraft trailing vortices was introduced and tested. The Reynolds Averaged Modeling (RANS) group demonstrated that the elliptic relaxation concept for RANS calculations is also applicable to transonic flows with shocks; however, prediction of laminar/turbulent transition remains an important pacing item. A large fraction of the LES effort was devoted to the development and testing of a new algorithmic procedure (as opposed to phenomenological model) for subgrid scale modeling based on regularized de-filtering of the flow variables. This appears to be a very promising approach, and a significant effort is currently underway to assess its robustness in high Reynolds number flows and in conjunction with numerical methods for complex flows. As part of the Summer Program two review tutorials were given on Turbulent structures in hydrocarbon pool fires (Sheldon Tieszen), and Turbulent combustion modeling: from RANS to LES via DNS (Luc Vervisch); and two seminars entitled Assessment of turbulence models for engineering applications (Paul Durbin) and Subgrid-scale modeling for non-premixed, turbulent reacting flows (James Riley) were presented. A number of colleagues from universities, government agencies, and industry attended the final presentations of the participants on July 31 and participated in the discussions. There are twenty-six papers in this volume grouped in five areas. Each group is preceded with an overview by its coordinator.

Terascale spectral element algorithms and implementations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, P. F.; Tufo, H. M.

1999-08-17

We describe the development and implementation of an efficient spectral element code for multimillion gridpoint simulations of incompressible flows in general two- and three-dimensional domains. We review basic and recently developed algorithmic underpinnings that have resulted in good parallel and vector performance on a broad range of architectures, including the terascale computing systems now coming online at the DOE labs. Sustained performance of 219 GFLOPS has been recently achieved on 2048 nodes of the Intel ASCI-Red machine at Sandia.

Manual for automatic generation of finite element models of spiral bevel gears in mesh

NASA Technical Reports Server (NTRS)

Bibel, G. D.; Reddy, S.; Kumar, A.

1994-01-01

The goal of this research is to develop computer programs that generate finite element models suitable for doing 3D contact analysis of faced milled spiral bevel gears in mesh. A pinion tooth and a gear tooth are created and put in mesh. There are two programs: Points.f and Pat.f to perform the analysis. Points.f is based on the equation of meshing for spiral bevel gears. It uses machine tool settings to solve for an N x M mesh of points on the four surfaces, pinion concave and convex, and gear concave and convex. Points.f creates the file POINTS.OUT, an ASCI file containing N x M points for each surface. (N is the number of node points along the length of the tooth, and M is nodes along the height.) Pat.f reads POINTS.OUT and creates the file tl.out. Tl.out is a series of PATRAN input commands. In addition to the mesh density on the tooth face, additional user specified variables are the number of finite elements through the thickness, and the number of finite elements along the tooth full fillet. A full fillet is assumed to exist for both the pinion and gear.

Parallel and Portable Monte Carlo Particle Transport

NASA Astrophysics Data System (ADS)

Lee, S. R.; Cummings, J. C.; Nolen, S. D.; Keen, N. D.

1997-08-01

We have developed a multi-group, Monte Carlo neutron transport code in C++ using object-oriented methods and the Parallel Object-Oriented Methods and Applications (POOMA) class library. This transport code, called MC++, currently computes k and α eigenvalues of the neutron transport equation on a rectilinear computational mesh. It is portable to and runs in parallel on a wide variety of platforms, including MPPs, clustered SMPs, and individual workstations. It contains appropriate classes and abstractions for particle transport and, through the use of POOMA, for portable parallelism. Current capabilities are discussed, along with physics and performance results for several test problems on a variety of hardware, including all three Accelerated Strategic Computing Initiative (ASCI) platforms. Current parallel performance indicates the ability to compute α-eigenvalues in seconds or minutes rather than days or weeks. Current and future work on the implementation of a general transport physics framework (TPF) is also described. This TPF employs modern C++ programming techniques to provide simplified user interfaces, generic STL-style programming, and compile-time performance optimization. Physics capabilities of the TPF will be extended to include continuous energy treatments, implicit Monte Carlo algorithms, and a variety of convergence acceleration techniques such as importance combing.

Investigation of Surface Phenomena in Shocked Tin in Converging Geometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rousculp, Christopher L.; Oro, David Michael; Griego, Jeffrey Randall

2016-04-14

There is a great interest in RMI as source of ejecta from metal shells. Previous experiments have explored wavelength amplitude (kA) variation but they have a small range of drive pressures and are in planer geometry. Simulations, both MD and hydro, have explored RMI in planer geometry. The ejecta source model from RMI is an area of active algorithm and code development in ASCI-IC Lagrangian Applications Project. PHELIX offers precise, reproducible variable driver for Hydro and material physics diagnoses with proton radiography.

Endomyces tetrasperma, sp. n

PubMed Central

Macy, J. M.; Miller, M. W.

1971-01-01

A new fungal species has been described and placed in the genus Endomyces. Endomyces tetrasperma forms a true septate, multinucleate mycelium which breaks up into arthrospores. Ascus formation occurs after isogamous copulation between sexual protuberances which develop at the ends of arthrospores or between two cells, adjacent mycelial cells, or arthrospores. The asci which dehisce at maturity release two to four smooth, ovoid, thick-walled spores, each containing two oil droplets. The proposed life cycle is based on morphological and cytological observations. Images PMID:5541538

Deterministic alternatives to the full configuration interaction quantum Monte Carlo method for strongly correlated systems

NASA Astrophysics Data System (ADS)

Tubman, Norm; Whaley, Birgitta

The development of exponential scaling methods has seen great progress in tackling larger systems than previously thought possible. One such technique, full configuration interaction quantum Monte Carlo, allows exact diagonalization through stochastically sampling of determinants. The method derives its utility from the information in the matrix elements of the Hamiltonian, together with a stochastic projected wave function, which are used to explore the important parts of Hilbert space. However, a stochastic representation of the wave function is not required to search Hilbert space efficiently and new deterministic approaches have recently been shown to efficiently find the important parts of determinant space. We shall discuss the technique of Adaptive Sampling Configuration Interaction (ASCI) and the related heat-bath Configuration Interaction approach for ground state and excited state simulations. We will present several applications for strongly correlated Hamiltonians. This work was supported through the Scientific Discovery through Advanced Computing (SciDAC) program funded by the U.S. Department of Energy, Office of Science, Advanced Scientific Computing Research and Basic Energy Sciences.

Institute for scientific computing research;fiscal year 1999 annual report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keyes, D

2000-03-28

Large-scale scientific computation, and all of the disciplines that support it and help to validate it, have been placed at the focus of Lawrence Livermore National Laboratory by the Accelerated Strategic Computing Initiative (ASCI). The Laboratory operates the computer with the highest peak performance in the world and has undertaken some of the largest and most compute-intensive simulations ever performed. Computers at the architectural extremes, however, are notoriously difficult to use efficiently. Even such successes as the Laboratory's two Bell Prizes awarded in November 1999 only emphasize the need for much better ways of interacting with the results of large-scalemore » simulations. Advances in scientific computing research have, therefore, never been more vital to the core missions of the Laboratory than at present. Computational science is evolving so rapidly along every one of its research fronts that to remain on the leading edge, the Laboratory must engage researchers at many academic centers of excellence. In FY 1999, the Institute for Scientific Computing Research (ISCR) has expanded the Laboratory's bridge to the academic community in the form of collaborative subcontracts, visiting faculty, student internships, a workshop, and a very active seminar series. ISCR research participants are integrated almost seamlessly with the Laboratory's Center for Applied Scientific Computing (CASC), which, in turn, addresses computational challenges arising throughout the Laboratory. Administratively, the ISCR flourishes under the Laboratory's University Relations Program (URP). Together with the other four Institutes of the URP, it must navigate a course that allows the Laboratory to benefit from academic exchanges while preserving national security. Although FY 1999 brought more than its share of challenges to the operation of an academic-like research enterprise within the context of a national security laboratory, the results declare the challenges well met and well worth the continued effort. A change of administration for the ISCR occurred during FY 1999. Acting Director John Fitzgerald retired from LLNL in August after 35 years of service, including the last two at helm of the ISCR. David Keyes, who has been a regular visitor in conjunction with ASCI scalable algorithms research since October 1997, overlapped with John for three months and serves half-time as the new Acting Director.« less

Retrieval practice in the form of online homework improved information retention more when spaced 5 days rather than 1 day after class in two physiology courses.

PubMed

Cadaret, Caitlin N; Yates, Dustin T

2018-06-01

Studies have shown that practicing temporally spaced retrieval of previously learned information via formal assessments increases student retention of the information. Our objective was to determine the impact of online homework administered as a first retrieval practice 1 or 5 days after introduction of physiology topics on long-term information retention. Students in two undergraduate courses, Anatomy and Physiology (ASCI 240) and Animal Physiological Systems (ASCI 340), were presented with information on a specific physiological system during each weekly laboratory and then completed an online homework assignment either 1 or 5 days later. Information retention was assessed via an in-class quiz the following week and by a comprehensive final exam at semester's end (4-13 wk later). Performance on homework assignments was generally similar between groups for both courses. Information retention at 1 wk did not differ due to timing of homework in either course. In both courses, however, students who received homework 5 days after class performed better on final exam questions relevant to that week's topic compared with their day 1 counterparts. These findings indicate that the longer period between introducing physiology information in class and assigning the first retrieval practice was more beneficial to long-term information retention than the shorter period, despite seemingly equivalent benefits in the shorter term. Since information is typically forgotten over time, we speculate that the longer interval necessitates greater retrieval effort in much the same way as built-in desirable difficulties, thus allowing for stronger conceptual connections and deeper comprehension.

Pentium Pro inside. 1; A treecode at 430 Gigaflops on ASCI Red

NASA Technical Reports Server (NTRS)

Warren, M. S.; Becker, D. J.; Sterling, T.; Salmon, J. K.; Goda, M. P.

1997-01-01

As an entry for the 1997 Gordon Bell performance prize, we present results from two methods of solving the gravitational N-body problem on the Intel Teraflops system at Sandia National Laboratory (ASCI Red). The first method, an O(N2) algorithm, obtained 635 Gigaflops for a 1 million particle problem on 6800 Pentium Pro processors. The second solution method, a tree-code which scales as O(N log N), sustained 170 Gigaflops over a continuous 9.4 hour period on 4096 processors, integrating the motion of 322 million mutually interacting particles in a cosmology simulation, while saving over 100 Gigabytes of raw data. Additionally, the tree-code sustained 430 Gigaflops on 6800 processors for the first 5 time-steps of that simulation. This tree-code solution is approximately 105 times more efficient than the O(N2) algorithm for this problem. As an entry for the 1997 Gordon Bell price/performance prize, we present two calculations from the disciplines of astrophysics and fluid dynamics. The simulations were performed on two 16 Pentium Pro processor Beowulf-class computers (Loki and Hyglac) constructed entirely from commodity personal computer technology, at a cost of roughly $50k each in September, 1996. The price of an equivalent system in August 1997 is less than $30. At Los Alamos, Loki performed a gravitational tree-code N-body simulation of galaxy formation using 9.75 million particles, which sustained an average of 879 Mflops over a ten day period, and produced roughly 10 Gbytes of raw data.

Unstructured LES of Reacting Multiphase Flows in Realistic Gas Turbine Combustors

NASA Technical Reports Server (NTRS)

Ham, Frank; Apte, Sourabh; Iaccarino, Gianluca; Wu, Xiao-Hua; Herrmann, Marcus; Constantinescu, George; Mahesh, Krishnan; Moin, Parviz

2003-01-01

As part of the Accelerated Strategic Computing Initiative (ASCI) program, an accurate and robust simulation tool is being developed to perform high-fidelity LES studies of multiphase, multiscale turbulent reacting flows in aircraft gas turbine combustor configurations using hybrid unstructured grids. In the combustor, pressurized gas from the upstream compressor is reacted with atomized liquid fuel to produce the combustion products that drive the downstream turbine. The Large Eddy Simulation (LES) approach is used to simulate the combustor because of its demonstrated superiority over RANS in predicting turbulent mixing, which is central to combustion. This paper summarizes the accomplishments of the combustor group over the past year, concentrating mainly on the two major milestones achieved this year: 1) Large scale simulation: A major rewrite and redesign of the flagship unstructured LES code has allowed the group to perform large eddy simulations of the complete combustor geometry (all 18 injectors) with over 100 million control volumes; 2) Multi-physics simulation in complex geometry: The first multi-physics simulations including fuel spray breakup, coalescence, evaporation, and combustion are now being performed in a single periodic sector (1/18th) of an actual Pratt & Whitney combustor geometry.

Scytalidium parasiticum sp. nov., a New Species Parasitizing on Ganoderma boninense Isolated from Oil Palm in Peninsular Malaysia.

PubMed

Goh, Yit Kheng; Goh, Teik Khiang; Marzuki, Nurul Fadhilah; Tung, Hun Jiat; Goh, You Keng; Goh, Kah Joo

2015-06-01

A mycoparasite, Scytalidium parasiticum sp. nov., isolated from the basidiomata of Ganoderma boninense causing basal stem rot of oil palm in Johor, Malaysia, is described and illustrated. It is distinct from other Scytalidium species in having smaller asci and ascospores (teleomorphic stage), longer arthroconidia (anamorphic stage), hyaline to yellowish chlamydospores, and producing a fluorescent pigment. The phylogenetic position of S. parasiticum was determined by sequence analyses of the internal transcribed spacers and the small-subunit ribosomal RNA gene regions. A key to identify Scytalidium species with teleomorphic stage is provided.

Scytalidium parasiticum sp. nov., a New Species Parasitizing on Ganoderma boninense Isolated from Oil Palm in Peninsular Malaysia

PubMed Central

Goh, Teik Khiang; Marzuki, Nurul Fadhilah; Tung, Hun Jiat; Goh, You Keng; Goh, Kah Joo

2015-01-01

A mycoparasite, Scytalidium parasiticum sp. nov., isolated from the basidiomata of Ganoderma boninense causing basal stem rot of oil palm in Johor, Malaysia, is described and illustrated. It is distinct from other Scytalidium species in having smaller asci and ascospores (teleomorphic stage), longer arthroconidia (anamorphic stage), hyaline to yellowish chlamydospores, and producing a fluorescent pigment. The phylogenetic position of S. parasiticum was determined by sequence analyses of the internal transcribed spacers and the small-subunit ribosomal RNA gene regions. A key to identify Scytalidium species with teleomorphic stage is provided. PMID:26190917

Therans-3-enoic acids ofAster alpinus andArctium minus seed oils.

PubMed

Morris, L J; Marshall, M O; Hammond, E W

1968-01-01

Thetrans-3-enoic acids ofAster alpinus (dwarf aster, rock aster) andArctium minus (burdock) seed oils have been isolated and characterized.Arctium seed oil containstrans-3,cis-9,cis-12-octadecatrienoic acid (9.9%), andAster oil containstrans-3-hexadecenoic (7.1%),rans-3-octadecenoic (1.9%),trans-3,cis-9-octadecadienoic (3.0%),a ndtrans-3,cis-9,cis-12-octadecatrienoic (13.7%) acids.Aster oil also has an epoxy acid as a minor constituent (ca. 2.0%), which has been identified ascis-9,10-epoxy-cis-12-octadecenoic acid.

Terascale Visualization: Multi-resolution Aspirin for Big-Data Headaches

NASA Astrophysics Data System (ADS)

Duchaineau, Mark

2001-06-01

Recent experience on the Accelerated Strategic Computing Initiative (ASCI) computers shows that computational physicists are successfully producing a prodigious collection of numbers on several thousand processors. But with this wealth of numbers comes an unprecedented difficulty in processing and moving them to provide useful insight and analysis. In this talk, a few simulations are highlighted where recent advancements in multiple-resolution mathematical representations and algorithms have provided some hope of seeing most of the physics of interest while keeping within the practical limits of the post-simulation storage and interactive data-exploration resources. A whole host of visualization research activities was spawned by the 1999 Gordon Bell Prize-winning computation of a shock-tube experiment showing Richtmyer-Meshkov turbulent instabilities. This includes efforts for the entire data pipeline from running simulation to interactive display: wavelet compression of field data, multi-resolution volume rendering and slice planes, out-of-core extraction and simplification of mixing-interface surfaces, shrink-wrapping to semi-regularize the surfaces, semi-structured surface wavelet compression, and view-dependent display-mesh optimization. More recently on the 12 TeraOps ASCI platform, initial results from a 5120-processor, billion-atom molecular dynamics simulation showed that 30-to-1 reductions in storage size can be achieved with no human-observable errors for the analysis required in simulations of supersonic crack propagation. This made it possible to store the 25 trillion bytes worth of simulation numbers in the available storage, which was under 1 trillion bytes. While multi-resolution methods and related systems are still in their infancy, for the largest-scale simulations there is often no other choice should the science require detailed exploration of the results.

Metschnikowia drakensbergensis sp. nov. and Metschnikowia caudata sp. nov., endemic yeasts associated with Protea flowers in South Africa.

PubMed

de Vega, Clara; Guzmán, Beatriz; Steenhuisen, Sandy-Lynn; Johnson, Steven D; Herrera, Carlos M; Lachance, Marc-André

2014-11-01

In a taxonomic study of yeasts recovered from nectar of flowers and associated insects in South Africa, 11 strains were found to represent two novel species. Morphological and physiological characteristics and sequence analyses of the large-subunit rRNA gene D1/D2 region, as well as the actin, RNA polymerase II and elongation factor 2 genes, showed that the two novel species belonged to the genus Metschnikowia. Metschnikowia drakensbergensis sp. nov. (type strain EBD-CdVSA09-2(T) =CBS 13649(T) =NRRL Y-63721(T); MycoBank no. MB809688; allotype EBD-CdVSA10-2(A) =CBS13650(A) =NRRL Y-63720(A)) was recovered from nectar of Protea roupelliae and the beetle Heterochelus sp. This species belongs to the large-spored Metschnikowia clade and is closely related to Metschnikowia proteae, with which mating reactions and single-spored asci were observed. Metschnikowia caudata sp. nov. (type strain EBD-CdVSA08-1(T) =CBS 13651(T) =NRRL Y-63722(T); MycoBank no. MB809689; allotype EBD-CdVSA57-2(A) =CBS 13729(A) =NRRL Y-63723(A)) was isolated from nectar of Protea dracomontana, P. roupelliae and P. subvestita and a honeybee, and is a sister species to Candida hainanensis and Metschnikowia lopburiensis. Analyses of the four sequences demonstrated the existence of three separate phylotypes. Intraspecies matings led to the production of mature asci of unprecedented morphology, with a long, flexuous tail. A single ascospore was produced in all compatible crosses, regardless of sequence phylotype. The two species appear to be endemic to South Africa. The ecology and habitat specificity of these novel species are discussed in terms of host plant and insect host species. © 2014 IUMS.

Gene Expression of Pneumocystis murina after Treatment with Anidulafungin Results in Strong Signals for Sexual Reproduction, Cell Wall Integrity, and Cell Cycle Arrest, Indicating a Requirement for Ascus Formation for Proliferation.

PubMed

Cushion, Melanie T; Ashbaugh, Alan; Hendrix, Keeley; Linke, Michael J; Tisdale, Nikeya; Sayson, Steven G; Porollo, Aleksey

2018-05-01

The echinocandins are a class of antifungal agents that target β-1,3-d-glucan (BG) biosynthesis. In the ascigerous Pneumocystis species, treatment with these drugs depletes the ascus life cycle stage, which contains BG, but large numbers of forms which do not express BG remain in the infected lungs. In the present study, the gene expression profiles of Pneumocystis murina were compared between infected, untreated mice and mice treated with anidulafungin for 2 weeks to understand the metabolism of the persisting forms. Almost 80 genes were significantly up- or downregulated. Like other fungi exposed to echinocandins, genes associated with sexual replication, cell wall integrity, cell cycle arrest, and stress comprised the strongest upregulated signals in P. murina from the treated mice. The upregulation of the P. murina β-1,3-d-glucan endohydrolase and endo-1,3-glucanase was notable and may explain the disappearance of the existing asci in the lungs of treated mice since both enzymes can degrade BG. The biochemical measurement of BG in the lungs of treated mice and fluorescence microscopy with an anti-BG antibody supported the loss of BG. Downregulated signals included genes involved in cell replication, genome stability, and ribosomal biogenesis and function and the Pneumocystis -specific genes encoding the major surface glycoproteins (Msg). These studies suggest that P. murina attempted to undergo sexual replication in response to a stressed environment and was halted in any type of proliferative cycle, likely due to a lack of BG. Asci appear to be a required part of the life cycle stage of Pneumocystis , and BG may be needed to facilitate progression through the life cycle via sexual replication. Copyright © 2018 Cushion et al.

The Intergradation, Genetic Interchangeability and Interpretation of Gene Conversion Spectrum Types

PubMed Central

Lamb, Bernard C.; Ghikas, Aglaia

1979-01-01

In the Pasadena strains of Ascobolus immersus, the gene conversion propperties of 29 induced (nine UV, nine NG, and 11 ICR-170) and nine spontaneous white-ascospore mutations have been studied. Each mutant was crossed to three types of derived wild-type strains; single mutants often gave very different conversion results in the three types of crosses, with any or all of the following changes in: percentage with post-meiotic segregation among aberrant-ratio asci; percentage with conversion to wild type among aberrant-ratio asci; and in total conversion frequency. — These results are compared with those of Leblon (1972 a, b) from Ascobolus immersus and Yu-Sun, Wickramaratne and Whitehouse (1977) from Sordaria brevicollis. It is shown that conversion spectrum types are not necessarily distinct, but can completely intergrade, on the criteria of both post-meiotic segregation frequency and direction of correction. Genetic differences between strains in the present work resulted in much interchangeability of spectrum types for the same mutation in different crosses; e.g., from type C in one cross to type B/D type in another cross, although the mutation is presumably of the same molecular type (addition or deletion frame shift, or base substitution) in each cross. These changes of conversion properties for a given mutation in different crosses mean that previous interpretations of spectrum types in terms of specific conversion properties for various molecular types of mutation are inapplicable, or inadequate on their own, to explain the present data. Other factors, such as heterozygous cryptic mutations or conversion control genes, are probably involved. Because of asymmetric hybrid DNA formation, correction properties may differ from observed conversion properties. PMID:17248926

Absence of Interference in Association with Gene Conversion in SORDARIA FIMICOLA, and Presence of Interference in Association with Ordinary Recombination

PubMed Central

Kitani, Y.

1978-01-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus. PMID:17176535

Absence of interference in association with gene conversion in Sordaria fimicola, and presence of interference in association with ordinary recombination.

PubMed

Kitani, Y

1978-07-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.

Handbook for Forecasters in the Mediterranean. Part 2. Regional Forecasting Aids for the Mediterranean Basin.

DTIC Science & Technology

1980-12-01

38 V-i 2 Table V-4. Forecasting rules for stations and anchorages. Sigonella Rules 39-42 Valletta Rules 43-45 Taranto Rules 46-48 Argostolion Rule 49...Lampedusa 16 490 Lecce 16 332 Luga/ Valletta 16 597 Messina 16 420 Pal asci a 16 334 Pantel 1 eri a 16 470 Quargle 60 580 Si gonel I a 16 459 S. Maria Di...8217 Pantelleria Gea S.a Bay 蚦 4 53( 480 Lampedusa *. Cazzo Spadaro52 49.0 " 597 •~ 55• 5 5• ,/ • . Luga/ Valletta . • " El Qued -Guemar 559 580 󈧢 Figure

Phylogeny of Penicillium and the segregation of Trichocomaceae into three families

PubMed Central

Houbraken, J.; Samson, R.A.

2011-01-01

Species of Trichocomaceae occur commonly and are important to both industry and medicine. They are associated with food spoilage and mycotoxin production and can occur in the indoor environment, causing health hazards by the formation of β-glucans, mycotoxins and surface proteins. Some species are opportunistic pathogens, while others are exploited in biotechnology for the production of enzymes, antibiotics and other products. Penicillium belongs phylogenetically to Trichocomaceae and more than 250 species are currently accepted in this genus. In this study, we investigated the relationship of Penicillium to other genera of Trichocomaceae and studied in detail the phylogeny of the genus itself. In order to study these relationships, partial RPB1, RPB2 (RNA polymerase II genes), Tsr1 (putative ribosome biogenesis protein) and Cct8 (putative chaperonin complex component TCP-1) gene sequences were obtained. The Trichocomaceae are divided in three separate families: Aspergillaceae, Thermoascaceae and Trichocomaceae. The Aspergillaceae are characterised by the formation flask-shaped or cylindrical phialides, asci produced inside cleistothecia or surrounded by Hülle cells and mainly ascospores with a furrow or slit, while the Trichocomaceae are defined by the formation of lanceolate phialides, asci borne within a tuft or layer of loose hyphae and ascospores lacking a slit. Thermoascus and Paecilomyces, both members of Thermoascaceae, also form ascospores lacking a furrow or slit, but are differentiated from Trichocomaceae by the production of asci from croziers and their thermotolerant or thermophilic nature. Phylogenetic analysis shows that Penicillium is polyphyletic. The genus is re-defined and a monophyletic genus for both anamorphs and teleomorphs is created (Penicillium sensu stricto). The genera Thysanophora, Eupenicillium, Chromocleista, Hemicarpenteles and Torulomyces belong in Penicillium s. str. and new combinations for the species belonging to these genera are proposed. Analysis of Penicillium below genus rank revealed the presence of 25 clades. A new classification system including both anamorph and teleomorph species is proposed and these 25 clades are treated here as sections. An overview of species belonging to each section is presented. Taxonomic novelties: New sections, all in Penicillium: sect. Sclerotiora Houbraken & Samson, sect. Charlesia Houbraken & Samson, sect. Thysanophora Houbraken & Samson,sect. Ochrosalmonea Houbraken & Samson, sect. Cinnamopurpurea Houbraken & Samson, Fracta Houbraken & Samson, sect. Stolkia Houbraken & Samson, sect. Gracilenta Houbraken & Samson, sect. Citrina Houbraken & Samson, sect. Turbata Houbraken & Samson, sect. Paradoxa Houbraken & Samson, sect. Canescentia Houbraken & Samson. New combinations: Penicillium asymmetricum (Subramanian & Sudha) Houbraken & Samson, P. bovifimosum (Tuthill & Frisvad) Houbraken & Samson, P. glaucoalbidum (Desmazières) Houbraken & Samson, P. laeve (K. Ando & Manoch) Houbraken & Samson, P. longisporum (Kendrick) Houbraken & Samson, P. malachiteum (Yaguchi & Udagawa) Houbraken & Samson, P. ovatum (K. Ando & Nawawi) Houbraken & Samson, P. parviverrucosum (K. Ando & Pitt) Houbraken & Samson, P. saturniforme (Wang & Zhuang) Houbraken & Samson, P. taiwanense (Matsushima) Houbraken & Samson. New names: Penicillium coniferophilum Houbraken & Samson, P. hennebertii Houbraken & Samson, P. melanostipe Houbraken & Samson, P. porphyreum Houbraken & Samson. PMID:22308045

Training a Spinal Cord Injury Rehabilitation Team in Motivational Interviewing

PubMed Central

Lusilla-Palacios, Pilar; Castellano-Tejedor, Carmina

2015-01-01

Background. An acute spinal cord injury (ASCI) is a severe condition that requires extensive and very specialized management of both physical and psychological dimensions of injured patients. Objective. The aim of the part of the study reported here was twofold: (1) to describe burnout, empathy, and satisfaction at work of these professionals and (2) to explore whether a tailored program based on motivational interviewing (MI) techniques modifies and improves such features. Methods. This paper presents findings from an intervention study into a tailored training for professionals (N = 45) working in a spinal cord injury (SCI) unit from a general hospital. Rehabilitation professionals' empathy skills were measured with the Jefferson Scale of Physician Empathy (JSPE), burnout was measured with the Maslach Burnout Inventory (MBI), and additional numeric scales were used to assess the perceived job-related stress and perceived satisfaction with job. Results. Findings suggest that professionals are performing quite well and they refer to satisfactory empathy, satisfaction at work, and no signs of burnout or significant stress both before and after the training. Conclusions. No training effect was observed in the variables considered in the study. Some possible explanations for these results and future research directions are discussed in depth in this paper. The full protocol of this study is registered in ClinicalTrials.gov (identifier: NCT01889940). PMID:26770827

Hot Chips and Hot Interconnects for High End Computing Systems

NASA Technical Reports Server (NTRS)

Saini, Subhash

2005-01-01

I will discuss several processors: 1. The Cray proprietary processor used in the Cray X1; 2. The IBM Power 3 and Power 4 used in an IBM SP 3 and IBM SP 4 systems; 3. The Intel Itanium and Xeon, used in the SGI Altix systems and clusters respectively; 4. IBM System-on-a-Chip used in IBM BlueGene/L; 5. HP Alpha EV68 processor used in DOE ASCI Q cluster; 6. SPARC64 V processor, which is used in the Fujitsu PRIMEPOWER HPC2500; 7. An NEC proprietary processor, which is used in NEC SX-6/7; 8. Power 4+ processor, which is used in Hitachi SR11000; 9. NEC proprietary processor, which is used in Earth Simulator. The IBM POWER5 and Red Storm Computing Systems will also be discussed. The architectures of these processors will first be presented, followed by interconnection networks and a description of high-end computer systems based on these processors and networks. The performance of various hardware/programming model combinations will then be compared, based on latest NAS Parallel Benchmark results (MPI, OpenMP/HPF and hybrid (MPI + OpenMP). The tutorial will conclude with a discussion of general trends in the field of high performance computing, (quantum computing, DNA computing, cellular engineering, and neural networks).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal /Fluid Team

The SIERRA Low Mach Module: Fuego along with the SIERRA Participating Media Radiation Module: Syrinx, henceforth referred to as Fuego and Syrinx, respectively, are the key elements of the ASCI fire environment simulation project. The fire environment simulation project is directed at characterizing both open large-scale pool fires and building enclosure fires. Fuego represents the turbulent, buoyantly-driven incompressible flow, heat transfer, mass transfer, combustion, soot, and absorption coefficient model portion of the simulation software. Syrinx represents the participating-media thermal radiation mechanics. This project is an integral part of the SIERRA multi-mechanics software development project. Fuego depends heavily upon the coremore » architecture developments provided by SIERRA for massively parallel computing, solution adaptivity, and mechanics coupling on unstructured grids.« less

Harmonize Pipeline and Archiving Aystem: PESSTO@IA2 Use Case

NASA Astrophysics Data System (ADS)

Smareglia, R.; Knapic, C.; Molinaro, M.; Young, D.; Valenti, S.

2013-10-01

Italian Astronomical Archives Center (IA2) is a research infrastructure project that aims at coordinating different national and international initiatives to improve the quality of astrophysical data services. IA2 is now also involved in the PESSTO (Public ESO Spectroscopic Survey of Transient Objects) collaboration, developing a complete archiving system to store calibrated post processed data (including sensitive intermediate products), a user interface to access private data and Virtual Observatory (VO) compliant web services to access public fast reduction data via VO tools. The archive system shall rely on the PESSTO Marshall to provide file data and its associated metadata output by the PESSTO data-reduction pipeline. To harmonize the object repository, data handling and archiving system, new tools are under development. These systems must have a strong cross-interaction without increasing the complexities of any single task, in order to improve the performances of the whole system and must have a sturdy logic in order to perform all operations in coordination with the other PESSTO tools. MySQL Replication technology and triggers are used for the synchronization of new data in an efficient, fault tolerant manner. A general purpose library is under development to manage data starting from raw observations to final calibrated ones, open to the overriding of different sources, formats, management fields, storage and publication policies. Configurations for all the systems are stored in a dedicated schema (no configuration files), but can be easily updated by a planned Archiving System Configuration Interface (ASCI).

Speciation in the large-spored Metschnikowia clade and establishment of a new species, Metschnikowia borealis comb. nov.

PubMed

Marinoni, Gaëlle; Lachance, Marc-André

2004-03-01

The reproductive boundaries among species in the large-spored Metschnikowia clade were studied by prototrophic recombinant selection, electrophoretic karyotyping, mitochondrial DNA restriction analysis, and DNA sequence analysis. Inviable ascospores arose from crosses between the two varieties of Metschnikowia continentalis, indicating that they should be recognized as separate species. Prototrophic recombinants were recovered from crosses between auxotrophic mutants of Metschnikowia borealis, M. continentalis, Metschnikowia lochheadii, Metschnikowia sp. UWO(PS)00-154.1, and Candida ipomoeae, showing that some genetic exchange is possible in spite of the sterility of the asci formed in interspecific crosses. Metschnikowia hawaiiensis, although capable of ascus formation when its h(-) mating type is crossed with the h(+) mating type of the other species, did not give rise to recombinants. In the other species, some recombinants acquired the ability to form asci directly from single cells. These often contained the chromosomes of both parents, suggesting formation of allodiploid hybrids. Other recombinants behaved as haploids and were similar to one parent except for having inherited the selectable wild-type allele from the other parent. In most, but not all cases, inheritance of the mitochondrial genome was uniparental and correlated with the inheritance of the nuclear chromosome complement. In some cases, what appeared to be a recombinant mitochondrial genome was observed. Phylogenies derived from the sequences of various DNA regions were not congruent, indicating that hybridization may have taken place in nature as the large-spored species diverged from their common ancestor. Further evidence that C. ipomoeae arose from a natural recombination event was obtained, but a pair of Metschnikowia species that might represent derived forms of the parents could not be identified conclusively. C. ipomoeae and most of its closely related Metschnikowia species contained a group-II intron in the mitochondrial small-subunit ribosomal gene. The intron was absent in M. borealis, M. hawaiiensis, and other species in the genus Metschnikowia.

Status of Simulations for the Cyclotron Laboratory at the Institute for Nuclear Research and Nuclear Energy

NASA Astrophysics Data System (ADS)

Asova, G.; Goutev, N.; Tonev, D.; Artinyan, A.

2018-05-01

The Institute for Nuclear Research and Nuclear Energy is preparing to operate a high-power cyclotron for production of radioisotopes for nuclear medicine, research in radiochemistry, radiobiology, nuclear physics, solid state physics. The cyclotron is a TR24 produced by ASCI, Canada, capable to deliver proton beams in the energy range of 15 to 24 MeV with current as high as 400 µA. Multiple extraction lines can be fed. The primary goal of the project is the production of PET and SPECT isotopes as 18F, 67,68Ga, 99mTc, etc. This contribution reports the status of the project. Design considerations for the cyclotron vault will be discussed for some of the target radioisotopes.

Saturnispora bothae sp. nov., isolated from rotting wood.

PubMed

Morais, Camila G; Lara, Carla A; Borelli, Beatriz M; Cadete, Raquel M; Moreira, Juliana D; Lachance, Marc-André; Rosa, Carlos A

2016-10-01

Two strains representing a novel species of the genus Saturnispora were isolated from rotting wood samples collected in an Atlantic Rainforest site in Brazil. Analyses of the sequences of the D1/D2 domains of the rRNA gene showed that this novel species belongs to a subclade in the Saturnispora clade formed by Saturnispora sanitii, Saturnispora sekii, Saturnispora silvae and Saturnisporasuwanaritii. The novel species differed in D1/D2 sequences by 60 or more nucleotide substitutions from these species. The strains produced asci with one to four hemispherical ascospores. A novel species named Saturnispora bothae sp. nov. is proposed to accommodate these isolates. The type strain is UFMG-CM-Y292T (=CBS 13484T). The MycoBank number is MB 817127.

Multiphysics Application Coupling Toolkit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, Michael T.

2013-12-02

This particular consortium implementation of the software integration infrastructure will, in large part, refactor portions of the Rocstar multiphysics infrastructure. Development of this infrastructure originated at the University of Illinois DOE ASCI Center for Simulation of Advanced Rockets (CSAR) to support the center's massively parallel multiphysics simulation application, Rocstar, and has continued at IllinoisRocstar, a small company formed near the end of the University-based program. IllinoisRocstar is now licensing these new developments as free, open source, in hopes to help improve their own and others' access to infrastructure which can be readily utilized in developing coupled or composite software systems;more » with particular attention to more rapid production and utilization of multiphysics applications in the HPC environment. There are two major pieces to the consortium implementation, the Application Component Toolkit (ACT), and the Multiphysics Application Coupling Toolkit (MPACT). The current development focus is the ACT, which is (will be) the substrate for MPACT. The ACT itself is built up from the components described in the technical approach. In particular, the ACT has the following major components: 1.The Component Object Manager (COM): The COM package provides encapsulation of user applications, and their data. COM also provides the inter-component function call mechanism. 2.The System Integration Manager (SIM): The SIM package provides constructs and mechanisms for orchestrating composite systems of multiply integrated pieces.« less

28 CFR 70.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Revision of budget and program plans. 70... Revision of budget and program plans. (a) The budget plan is the financial expression of the project or... from budget and program plans, and request prior approvals for budget and program plan revisions, in...

45 CFR 2543.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Revision of budget and program plans. 2543.25... Revision of budget and program plans. (a) The budget plan is the financial expression of the project or... deviations from budget and program plans, and request prior approvals for budget and program plan revisions...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strohmaier, Erich; Meuer, Hans W.; Dongarra, Jack

20th Edition of TOP500 List of World's Fastest Supercomputers Released MANNHEIM, Germany; KNOXVILLE, Tenn.;&BERKELEY, Calif. In what has become a much-anticipated event in the world of high-performance computing, the 20th edition of the TOP500 list of the world's fastest supercomputers was released today (November 15, 2002). The Earth Simulator supercomputer installed earlier this year at the Earth Simulator Center in Yokohama, Japan, is with its Linpack benchmark performance of 35.86 Tflop/s (trillions of calculations per second) retains the number one position. The No.2 and No.3 positions are held by two new, identical ASCI Q systems at Los Alamos National Laboratorymore » (7.73Tflop/s each). These systems are built by Hewlett-Packard and based on the Alpha Server SC computer system.« less

SIERRA Low Mach Module: Fuego User Manual Version 4.46.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal/Fluid Team

2017-09-01

The SIERRA Low Mach Module: Fuego along with the SIERRA Participating Media Radiation Module: Syrinx, henceforth referred to as Fuego and Syrinx, respectively, are the key elements of the ASCI fire environment simulation project. The fire environment simulation project is directed at characterizing both open large-scale pool fires and building enclosure fires. Fuego represents the turbulent, buoyantly-driven incompressible flow, heat transfer, mass transfer, combustion, soot, and absorption coefficient model portion of the simulation software. Syrinx represents the participating-media thermal radiation mechanics. This project is an integral part of the SIERRA multi-mechanics software development project. Fuego depends heavily upon the coremore » architecture developments provided by SIERRA for massively parallel computing, solution adaptivity, and mechanics coupling on unstructured grids.« less

SIERRA Low Mach Module: Fuego Theory Manual Version 4.44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal /Fluid Team

2017-04-01

The SIERRA Low Mach Module: Fuego along with the SIERRA Participating Media Radiation Module: Syrinx, henceforth referred to as Fuego and Syrinx, respectively, are the key elements of the ASCI fire environment simulation project. The fire environment simulation project is directed at characterizing both open large-scale pool fires and building enclosure fires. Fuego represents the turbulent, buoyantly-driven incompressible flow, heat transfer, mass transfer, combustion, soot, and absorption coefficient model portion of the simulation software. Syrinx represents the participating-media thermal radiation mechanics. This project is an integral part of the SIERRA multi-mechanics software development project. Fuego depends heavily upon the coremore » architecture developments provided by SIERRA for massively parallel computing, solution adaptivity, and mechanics coupling on unstructured grids.« less

SIERRA Low Mach Module: Fuego Theory Manual Version 4.46.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sierra Thermal/Fluid Team

The SIERRA Low Mach Module: Fuego along with the SIERRA Participating Media Radiation Module: Syrinx, henceforth referred to as Fuego and Syrinx, respectively, are the key elements of the ASCI fire environment simulation project. The fire environment simulation project is directed at characterizing both open large-scale pool fires and building enclosure fires. Fuego represents the turbulent, buoyantly-driven incompressible flow, heat transfer, mass transfer, combustion, soot, and absorption coefficient model portion of the simulation software. Syrinx represents the participating-media thermal radiation mechanics. This project is an integral part of the SIERRA multi-mechanics software development project. Fuego depends heavily upon the coremore » architecture developments provided by SIERRA for massively parallel computing, solution adaptivity, and mechanics coupling on unstructured grids.« less

45 CFR 309.35 - What are the procedures for review of a Tribal IV-D program application, plan or plan amendment?

Code of Federal Regulations, 2010 CFR

2010-10-01

...-D program application, plan or plan amendment? 309.35 Section 309.35 Public Welfare Regulations... ENFORCEMENT (IV-D) PROGRAM Tribal IV-D Program Application Procedures § 309.35 What are the procedures for review of a Tribal IV-D program application, plan or plan amendment? (a) The Secretary will promptly...

Program Planning in Health Professions Education

ERIC Educational Resources Information Center

Schmidt, Steven W.; Lawson, Luan

2018-01-01

In this chapter, the major concepts from program planning in adult education will be applied to health professions education (HPE). Curriculum planning and program planning will be differentiated, and program development and planning will be grounded in a systems thinking approach.

20 CFR 632.255 - Program planning.

Code of Federal Regulations, 2010 CFR

2010-04-01

... that may be characterized as planning and design but not program operation. (c) Expenses incurred in... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Program planning. 632.255 Section 632.255... EMPLOYMENT AND TRAINING PROGRAMS Summer Youth Employment and Training Programs § 632.255 Program planning. (a...

34 CFR 74.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 34 Education 1 2010-07-01 2010-07-01 false Revision of budget and program plans. 74.25 Section 74... Requirements Financial and Program Management § 74.25 Revision of budget and program plans. (a) The budget plan...) Recipients are required to report deviations from budget and program plans, and request prior approvals for...

Lawrence Berkeley Laboratory Institutional Plan, FY 1993--1998

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1992-10-01

The FY 1993--1998 Institutional Plan provides an overview of the Lawrence Berkeley Laboratory mission, strategic plan, scientific initiatives, research programs, environment and safety program plans, educational and technology transfer efforts, human resources, and facilities needs. The Strategic Plan section identifies long-range conditions that can influence the Laboratory, potential research trends, and several management implications. The Initiatives section identifies potential new research programs that represent major long-term opportunities for the Laboratory and the resources required for their implementation. The Scientific and Technical Programs section summarizes current programs and potential changes in research program activity. The Environment, Safety, and Health section describesmore » the management systems and programs underway at the Laboratory to protect the environment, the public, and the employees. The Technology Transfer and Education programs section describes current and planned programs to enhance the nation's scientific literacy and human infrastructure and to improve economic competitiveness. The Human Resources section identifies LBL staff composition and development programs. The section on Site and Facilities discusses resources required to sustain and improve the physical plant and its equipment. The Resource Projections are estimates of required budgetary authority for the Laboratory's ongoing research programs. The plan is an institutional management report for integration with the Department of Energy's strategic planning activities that is developed through an annual planning process. The plan identifies technical and administrative directions in the context of the National Energy Strategy and the Department of Energy's program planning initiatives. Preparation of the plan is coordinated by the Office for Planning and Development from information contributed by the Laboratory's scientific and support divisions.« less

Program planning for the community teaching hospital medical library.

PubMed Central

McCorkel, J; Cook, V

1985-01-01

To respond to the increasing demand for information from medical educators and clinicians and to persuade administrators to purchase the newly available microcomputer library systems, medical librarians in community teaching hospitals may find it useful to engage in intermediate term (for example, five-year) program planning. To increase the probability that the plan which emerges will be implemented, the planning process should fit the organizational nexus. Planning involves needs assessment, prioritized program elements, a written plan, and facilities planning (if applicable), which lead to program implementation. Components of a model program plan are presented. PMID:4027443

Effect of strategic planning education on attitudes and perceptions of independent community pharmacy owners/managers.

PubMed

Harrison, Donald L

2007-01-01

To assess the impact of formal education program participation on the attitudes and perceptions of independent community pharmacy owners/managers toward strategic planning. Cross-sectional study. United States; June 4-July 30, 2004. Nationwide random sample of 1,250 owners/managers of independent community pharmacies. Mailed survey. Strategic planning formal education program participation. Comprehensiveness of strategic planning. Attitudes and perceptions of owners/managers of independent community pharmacies toward strategic planning. A total of 527 (42.1%) usable questionnaires were returned. Only 124 (23.5%) respondents indicated that they participated in a formal strategic planning education program. However, of the 141 (26.85%) respondents who indicated that they had conducted strategic planning for their community pharmacy, 111 (89.5%) had participated in a formal strategic planning education program. A significant association was detected between formal education program participation and the conducting of strategic planning (P< or =0.0001). Significant differences were observed for all attitudes and perceptions of independent community pharmacy owners/managers toward strategic planning based on program participation (P< or =0.0001). Finally, respondents who indicated that they had participated in a formal education program had a significantly higher comprehensiveness of strategic planning rating than those respondents who did not participate in an educational program (P< or =0.0001). A significant association exists between formal strategic planning education program participation and the conducting of strategic planning by owner/managers of independent community pharmacies, and those participating in such programs have significantly different attitudes and perceptions toward the conducting of strategic planning and have a significantly higher comprehensiveness of strategic planning rating.

Lawrence Berkeley Laboratory Institutional Plan, FY 1993--1998

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chew, Joseph T.; Stroh, Suzanne C.; Maio, Linda R.

1992-10-01

The FY 1993--1998 Institutional Plan provides an overview of the Lawrence Berkeley Laboratory mission, strategic plan, scientific initiatives, research programs, environment and safety program plans, educational and technology transfer efforts, human resources, and facilities needs. The Strategic Plan section identifies long-range conditions that can influence the Laboratory, potential research trends, and several management implications. The Initiatives section identifies potential new research programs that represent major long-term opportunities for the Laboratory and the resources required for their implementation. The Scientific and Technical Programs section summarizes current programs and potential changes in research program activity. The Environment, Safety, and Health section describesmore » the management systems and programs underway at the Laboratory to protect the environment, the public, and the employees. The Technology Transfer and Education programs section describes current and planned programs to enhance the nation`s scientific literacy and human infrastructure and to improve economic competitiveness. The Human Resources section identifies LBL staff composition and development programs. The section on Site and Facilities discusses resources required to sustain and improve the physical plant and its equipment. The Resource Projections are estimates of required budgetary authority for the Laboratory`s ongoing research programs. The plan is an institutional management report for integration with the Department of Energy`s strategic planning activities that is developed through an annual planning process. The plan identifies technical and administrative directions in the context of the National Energy Strategy and the Department of Energy`s program planning initiatives. Preparation of the plan is coordinated by the Office for Planning and Development from information contributed by the Laboratory`s scientific and support divisions.« less

Implementing corporate wellness programs: a business approach to program planning.

PubMed

Helmer, D C; Dunn, L M; Eaton, K; Macedonio, C; Lubritz, L

1995-11-01

1. Support of key decision makers is critical to the successful implementation of a corporate wellness program. Therefore, the program implementation plan must be communicated in a format and language readily understood by business people. 2. A business approach to corporate wellness program planning provides a standardized way to communicate the implementation plan. 3. A business approach incorporates the program planning components in a format that ranges from general to specific. This approach allows for flexibility and responsiveness to changes in program planning. 4. Components of the business approach are the executive summary, purpose, background, ground rules, approach, requirements, scope of work, schedule, and financials.

14 CFR 1260.125 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Revision of budget and program plans. 1260....125 Revision of budget and program plans. (a) The budget plan is the financial expression of the... required to report deviations from budget and program plans, and request prior approvals for budget and...

First record of Talaromyces udagawae in soil related to decomposing human remains in Argentina.

PubMed

Tranchida, María C; Centeno, Néstor D; Stenglein, Sebastián A; Cabello, Marta N

2016-01-01

The morphologic features of Talaromyces udagawae Stolk and Samson are here described and illustrated. This teleomorphic Ascomycota fungus was isolated from soil obtained in Buenos Aires province (Argentina) from beneath a human cadaver in an advanced state of decomposition. After washing and serial dilution of the soil along with moist-chamber techniques for fungal cultivation, T. udagawae formed very restricted colonies of bright yellow color on different growth media with 8-ascospored asci. The ascospores were ellipsoidal and ornamented. The anamorphic state was not observed. Molecular-genetic techniques identified the species. The present record is the first of the species in Argentina, pointing it as a tool to identify soils where cadaver decomposition occurs. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

49 CFR 613.200 - Statewide transportation planning and programming.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 7 2012-10-01 2012-10-01 false Statewide transportation planning and programming. 613.200 Section 613.200 Transportation Other Regulations Relating to Transportation (Continued... Transportation Planning and Programming § 613.200 Statewide transportation planning and programming. The...

49 CFR 613.200 - Statewide transportation planning and programming.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 7 2014-10-01 2014-10-01 false Statewide transportation planning and programming. 613.200 Section 613.200 Transportation Other Regulations Relating to Transportation (Continued... Transportation Planning and Programming § 613.200 Statewide transportation planning and programming. The...

49 CFR 613.200 - Statewide transportation planning and programming.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 7 2013-10-01 2013-10-01 false Statewide transportation planning and programming. 613.200 Section 613.200 Transportation Other Regulations Relating to Transportation (Continued... Transportation Planning and Programming § 613.200 Statewide transportation planning and programming. The...

49 CFR 613.200 - Statewide transportation planning and programming.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 7 2010-10-01 2010-10-01 false Statewide transportation planning and programming. 613.200 Section 613.200 Transportation Other Regulations Relating to Transportation (Continued... Transportation Planning and Programming § 613.200 Statewide transportation planning and programming. The...

49 CFR 613.200 - Statewide transportation planning and programming.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 7 2011-10-01 2011-10-01 false Statewide transportation planning and programming. 613.200 Section 613.200 Transportation Other Regulations Relating to Transportation (Continued... Transportation Planning and Programming § 613.200 Statewide transportation planning and programming. The...

24 CFR 84.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Revision of budget and program... and Program Management § 84.25 Revision of budget and program plans. (a) The budget plan is the... required to report deviations from budget and program plans, and request prior approvals for budget and...

Evaluation Planning, Evaluation Management, and Utilization of Evaluation Results within Adult Literacy Campaigns, Programs and Projects (with Implications for Adult Basic Education and Nonformal Education Programs in General). A Working Paper.

ERIC Educational Resources Information Center

Bhola, H. S.

Addressed to professionals involved in program evaluation, this working paper covers various aspects of evaluation planning, including the following: planning as a sociotechnical process, steps in evaluation planning, program planning and implementation versus evaluation planning and implementation, the literacy system and its subsystems, and some…

43 CFR 12.925 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Revision of budget and program plans. 12... Organizations Post-Award Requirements § 12.925 Revision of budget and program plans. (a) The budget plan is the...) Recipients are required to report deviations from budget and program plans, and request prior approvals for...

Using the Program Sustainability Assessment Tool to Assess and Plan for Sustainability

PubMed Central

Mainor, Avia; Moreland-Russell, Sarah; Maier, Ryan C.; Brossart, Laura; Luke, Douglas A.

2014-01-01

Implementing and growing a public health program that benefits society takes considerable time and effort. To ensure that positive outcomes are maintained over time, program managers and stakeholders should plan and implement activities to build sustainability capacity within their programs. We describe a 3-part sustainability planning process that programs can follow to build their sustainability capacity. First, program staff and stakeholders take the Program Sustainability Assessment Tool to measure their program’s sustainability across 8 domains. Next, managers and stakeholders use results from the assessment to inform and prioritize sustainability action planning. Lastly, staff members implement the plan and keep track of progress toward their sustainability goals. Through this process, staff can more holistically address the internal and external challenges and pressures associated with sustaining a program. We include a case example of a chronic disease program that completed the Program Sustainability Assessment Tool and engaged in program sustainability planning. PMID:24456644

45 CFR 309.35 - What are the procedures for review of a Tribal IV-D program application, plan or plan amendment?

Code of Federal Regulations, 2014 CFR

2014-10-01

...) The effective date of a plan or plan amendment may not be earlier than the first day of the fiscal... program application, plan or plan amendment? 309.35 Section 309.35 Public Welfare Regulations Relating to... of a Tribal IV-D program application, plan or plan amendment? (a) The Secretary will promptly review...

20 CFR 632.255 - Program planning.

Code of Federal Regulations, 2011 CFR

2011-04-01

... EMPLOYMENT AND TRAINING PROGRAMS Summer Youth Employment and Training Programs § 632.255 Program planning. (a)(1) In developing the summer program, the Native American grantee shall coordinate the summer plan..., except that 45 days prior to the beginning of the summer program and 45 days after the summer program...

20 CFR 632.255 - Program planning.

Code of Federal Regulations, 2012 CFR

2012-04-01

... EMPLOYMENT AND TRAINING PROGRAMS Summer Youth Employment and Training Programs § 632.255 Program planning. (a)(1) In developing the summer program, the Native American grantee shall coordinate the summer plan..., except that 45 days prior to the beginning of the summer program and 45 days after the summer program...

Logistics planning for phased programs.

NASA Technical Reports Server (NTRS)

Cook, W. H.

1973-01-01

It is pointed out that the proper and early integration of logistics planning into the phased program planning process will drastically reduce these logistics costs. Phased project planning is a phased approach to the planning, approval, and conduct of major research and development activity. A progressive build-up of knowledge of all aspects of the program is provided. Elements of logistics are discussed together with aspects of integrated logistics support, logistics program planning, and logistics activities for phased programs. Continuing logistics support can only be assured if there is a comprehensive sequential listing of all logistics activities tied to the program schedule and a real-time inventory of assets.

Project MOVE Program Planning Kit.

ERIC Educational Resources Information Center

Farris, Charlotte J.

This program planning kit contains information and activities on evaluation, change, leadership, and sex stereotyping which provided the basis for planning Project MOVE (Maximizing Options in Vocational Education) programs but which can be generalized and adapted for use in planning other programs. Assumptions ano guidelines based upon theory and…

Lawrence Berkeley Laboratory, Institutional Plan FY 1994--1999

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1993-09-01

The Institutional Plan provides an overview of the Lawrence Berkeley Laboratory mission, strategic plan, scientific initiatives, research programs, environment and safety program plans, educational and technology transfer efforts, human resources, and facilities needs. For FY 1994-1999 the Institutional Plan reflects significant revisions based on the Laboratory`s strategic planning process. The Strategic Plan section identifies long-range conditions that will influence the Laboratory, as well as potential research trends and management implications. The Initiatives section identifies potential new research programs that represent major long-term opportunities for the Laboratory, and the resources required for their implementation. The Scientific and Technical Programs section summarizesmore » current programs and potential changes in research program activity. The Environment, Safety, and Health section describes the management systems and programs underway at the Laboratory to protect the environment, the public, and the employees. The Technology Transfer and Education programs section describes current and planned programs to enhance the nation`s scientific literacy and human infrastructure and to improve economic competitiveness. The Human Resources section identifies LBL staff diversity and development program. The section on Site and Facilities discusses resources required to sustain and improve the physical plant and its equipment. The new section on Information Resources reflects the importance of computing and communication resources to the Laboratory. The Resource Projections are estimates of required budgetary authority for the Laboratory`s ongoing research programs. The Institutional Plan is a management report for integration with the Department of Energy`s strategic planning activities, developed through an annual planning process.« less

FTA multi-year research program plan (FY 2009 - FY 2013).

DOT National Transportation Integrated Search

2008-09-01

The Multi-Year Research Program Plan (Program Plan), prepared by the Federal Transit Administrations (FTA) Office of : Research, Demonstration, and Innovation (TRI), is part of FTAs strategic planning process. It provides descriptive : summarie...

Systems design study of the Pioneer Venus spacecraft. Volume 2. Preliminary program development plan

NASA Technical Reports Server (NTRS)

1973-01-01

The preliminary development plan for the Pioneer Venus program is presented. This preliminary plan treats only developmental aspects that would have a significant effect on program cost. These significant development areas were: master program schedule planning; test planning - both unit and system testing for probes/orbiter/ probe bus; ground support equipment; performance assurance; and science integration Various test planning options and test method techniques were evaluated in terms of achieving a low-cost program without degrading mission performance or system reliability. The approaches studied and the methodology of the selected approach are defined.

7 CFR 1710.407 - Business plan.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 11 2014-01-01 2014-01-01 false Business plan. 1710.407 Section 1710.407 Agriculture... Conservation Loan Program § 1710.407 Business plan. An Eligible EE Program must have a business plan for implementing the program. The business plan is expected to have a global perspective on the borrower's energy...

Contracts and Management Services FY 1996 Site Support Program Plan: WBS 6.10.14. Revision 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knoll, J.M. Jr.

1995-09-01

This is the Contracts and Management Services site support program plan for the US DOE Hanford site. The topics addressed in the program plan include a mission statement, program objectives, planning assumptions, program constraints, work breakdown structure, milestone list, milestone description sheets, and activity detail including cost accounting narrative summary, approved funding budget, and activity detailed description.

2 CFR 215.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false Revision of budget and program plans. 215.25 Section 215.25 Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved... Program Management § 215.25 Revision of budget and program plans. (a) The budget plan is the financial...

75 FR 70061 - Dealer Floor Plan Pilot Program Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-16

... SMALL BUSINESS ADMINISTRATION Dealer Floor Plan Pilot Program Meeting AGENCY: U.S. Small Business... location, date, time, and agenda for a meeting regarding the Dealer Floor Plan Pilot Program established in... Plan Pilot Program meeting will be held on November 16, 2010 from approximately 9 a.m. to 12 p.m...

Ready to sell our program. Anybody who is interested in learning Indonesian experience is invited to take part in the BKKBN's international training program.

PubMed

Suyono, H

1996-01-01

The Indonesian Family Planning Program was officially launched in 1970 when President Suharto developed the National Family Planning Coordinating Board (BKKBN) to administrate the national family planning program. The inauguration of the family planning program came at the heels of a special demand by the people with very strong support of the ulama. The program was subsequently developed and expanded into remote areas in 1976. In 1992, a family-based approach to family planning was implemented in which every village family was made responsible for family planning. The program is based upon a very strong political commitment at the highest level as well as at the provincial, district, subdistrict, and village levels; it continuously innovates; every community can name its family planning program as it likes; and there is constant feedback to the community. Indonesia's family planning program strategies are as follows: it is suggested that couples in which the wife is aged 20-30 years have only two children; it is recommended that women over age 30 have no more children due to the comparatively high risks of pregnancy at that age; considerable effort is given to encourage youths to not become pregnant and bear children; numerous chairmen of small community family planning groups are appointed; and social and cultural conditions have been created in which people work for family planning activities. People interested in learning from the Indonesian experience in family planning may participate in the BKKBN's international training program.

30 CFR 75.161 - Plans for training programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Plans for training programs. 75.161 Section 75... Provision] § 75.161 Plans for training programs. Each operator must submit to the district manager, of the Coal Mine Safety and Health District in which the mine is located, a program or plan setting forth what...

Beyond Instruction. Comprehensive Program Planning for Business and Education. Jossey-Bass Business and Management Series.

ERIC Educational Resources Information Center

Rothwell, William J.; Cookson, Peter S.

This book introduces key issues in program planning as practiced in business and educational settings. Two chapters in part 1 introduce two foundational models--Lifelong Education Program Planning (LEPP) model and Contingency-Based Program Planning--and provide background on models designed by Houle, Knowles, Boyle, and Nadler. Parts 2-5 focus on…

Planning for Life. A Compendium of Nationally Recognized Career Planning Programs.

ERIC Educational Resources Information Center

National Consortium of State Career Guidance Supervisors, Columbus, OH.

This compendium, which is designed to provide readers with a variety of career planning (CP) program ideas, contains abstracts summarizing 10 elementary, middle, and high school CP programs identified as exemplary by a national review team. Explained in chapter 1 are the primary objectives of the Planning for Life program, which is jointly…

20 CFR 653.112 - State agency program budget plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false State agency program budget plans. 653.112... State agency program budget plans. (a) Each State agency, in its annual program budget plan, shall... and Budget under control number 1205-0039) (Pub. L. No. 96-511, 94 Stat. 2812 (44 U.S.C. 3501 et seq...

Advanced rural transportation systems (ARTS) : rural intelligent transportation systems (ITS) : program plan

DOT National Transportation Integrated Search

1996-08-01

This Program Plan for the Advanced Rural Transportation Systems (ARTS) implements the goals and objectives established in the U.S. Department of Transportations (USDOTs) Strategic Plan for the ARTS. This Program Plan proposes five years (FY 97...

TOP500 Supercomputers for June 2003

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strohmaier, Erich; Meuer, Hans W.; Dongarra, Jack

2003-06-23

21st Edition of TOP500 List of World's Fastest Supercomputers Released MANNHEIM, Germany; KNOXVILLE, Tenn.;&BERKELEY, Calif. In what has become a much-anticipated event in the world of high-performance computing, the 21st edition of the TOP500 list of the world's fastest supercomputers was released today (June 23, 2003). The Earth Simulator supercomputer built by NEC and installed last year at the Earth Simulator Center in Yokohama, Japan, with its Linpack benchmark performance of 35.86 Tflop/s (teraflops or trillions of calculations per second), retains the number one position. The number 2 position is held by the re-measured ASCI Q system at Los Alamosmore » National Laboratory. With 13.88 Tflop/s, it is the second system ever to exceed the 10 Tflop/smark. ASCIQ was built by Hewlett-Packard and is based on the AlphaServerSC computer system.« less

Freshwater ascomycetes: Alascospora evergladensis, a new genus and species from the Florida Everglades.

PubMed

Raja, Huzefa A; Violi, Helen A; Shearer, Carol A

2010-01-01

Alascospora evergladensis, a freshwater ascomycete collected from submerged dead petioles of Nymphaea odorata during a survey of aquatic fungi along a phosphorus gradient in the Florida Everglades, is described and illustrated as a new genus and species in the Pleosporales (Pleosporomycetidae, Dothideomycetes). The new fungus is unique among genera in the Pleosporales based on a combination of morphological characters that include light brown, translucent, membranous, ostiolate ascomata with dark, amorphous material irregularly deposited on the peridium, especially around the ostiole; globose, fissitunicate, thick-walled asci; septate pseudoparaphyses; and 1-septate ascospores that are hyaline when young, and surrounded by a hyaline gelatinous sheath that is wing-shaped in outline on each side of the ascospore. The sheath is distinctive in that it first expands in water and is translucent, then condenses and darkens around older ascospores, giving them a dark brown, verruculose appearance.

Multi-locus phylogeny of Pleosporales: a taxonomic, ecological and evolutionary re-evaluation

PubMed Central

Zhang, Y.; Schoch, C.L.; Fournier, J.; Crous, P.W.; de Gruyter, J.; Woudenberg, J.H.C.; Hirayama, K.; Tanaka, K.; Pointing, S.B.; Spatafora, J.W.; Hyde, K.D.

2009-01-01

Five loci, nucSSU, nucLSU rDNA, TEF1, RPB1 and RPB2, are used for analysing 129 pleosporalean taxa representing 59 genera and 15 families in the current classification of Pleosporales. The suborder Pleosporineae is emended to include four families, viz. Didymellaceae, Leptosphaeriaceae, Phaeosphaeriaceae and Pleosporaceae. In addition, two new families are introduced, i.e. Amniculicolaceae and Lentitheciaceae. Pleomassariaceae is treated as a synonym of Melanommataceae, and new circumscriptions of Lophiostomataceae s. str., Massarinaceae and Lophiotrema are proposed. Familial positions of Entodesmium and Setomelanomma in Phaeosphaeriaceae, Neophaeosphaeria in Leptosphaeriaceae, Leptosphaerulina, Macroventuria and Platychora in Didymellaceae, Pleomassaria in Melanommataceae and Bimuria, Didymocrea, Karstenula and Paraphaeosphaeria in Montagnulaceae are clarified. Both ecological and morphological characters show varying degrees of phylogenetic significance. Pleosporales is most likely derived from a saprobic ancestor with fissitunicate asci containing conspicuous ocular chambers and apical rings. Nutritional shifts in Pleosporales likely occured from saprotrophic to hemibiotrophic or biotrophic. PMID:20169024

Pichia insulana sp. nov., a novel cactophilic yeast from the Caribbean

PubMed Central

Ganter, Philip F.; Cardinali, Gianluigi; Boundy-Mills, Kyria

2010-01-01

A novel species of ascomycetous yeast, Pichia insulana sp. nov., is described from necrotic tissue of columnar cacti on Caribbean islands. P. insulana is closely related to and phenotypically very similar to Pichia cactophila and Pichia pseudocactophila. There are few distinctions between these taxa besides spore type, host preference and locality. Sporogenous strains of P. insulana that produce asci with four hat-shaped spores have been found only on Curaçao, whereas there was no evidence of sporogenous P. cactophila from that island. In addition, sequences of the D1/D2 fragment of the large-subunit rDNA from 12 Curaçao strains showed consistent differences from the sequences of the type strains of P. cactophila and P. pseudocactophila. The type strain of P. insulana is TSU00-106.5T (=CBS 11169T =UCD-FST 09-160T). PMID:19661524

Case of Contamination by Listeria Monocytogenes in Mozzarella Cheese

PubMed Central

Tolli, Rita; Bossù, Teresa; Rodas, Eda Maria Flores; Di Giamberardino, Fabiola; Di Sirio, Alessandro; Vita, Silvia; De Angelis, Veronica; Bilei, Stefano; Sonnessa, Michele; Gattuso, Antonietta; Lanni, Luigi

2014-01-01

Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control). In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination. PMID:27800317

Ultrastructure of developing ascospores in Sordaria brevicollis.

PubMed

Hackett, C J; Chen, K C

1976-05-01

The ultrastructure of ascospore wall formation in the pyrenomycete Sordaria brevicollis was studied in developing asci at progressive time intervals. From early spore delimitation through final stage of maturation, the wall of the ascospore differentiated into four composite layers, the periascosporium the delineation ascosporium, the subascosproium, and the endoascosproium, While ascospores were at the hyaline stage of development,they possessed only the periascosporium and delineation ascosporium as their wall components. At about 7 to 8 days from the initiation of the cross, the spores developed a yellow color, and this coloration was always associated with the elaboration of the subascorsporium just internal to the ascosporium. Asthe spores continued to progressively darken in color, the subascosporium was seen to increase in complexity, electron density, and thickness. Soon after the formation of the subascosporium, the endoascosporium began to develop de novo and was, therefore, the last wall layer formed as the spore approached maturity.

Meiotic aneuploidy: its origins and induction following chemical treatment in Sordaria brevicollis.

PubMed

Bond, D J; McMillan, L

1979-08-01

A system suitable for the detection of meiotic aneuploidy is described in which various different origins of the aneuploidy can be distinguished. Aneuploid meiotic products are detected as black disomic spores held in asci containing all the products of a single meiosis. Aneuploidy may result from nondisjunction or from a meiosis in which an extra replica of one of the chromosomes has been generated in some other way, e.g., extra replication. By using this system it has been shown that pFPA treatment increase aneuploidy, primarily through an effect on nondisjunction. Preliminary results with trifluralin have indicated that this compound, too, may increase aneuploidy. There is a good possibility that the system can be further developed to permit a more rapid screening using a random plating method; this will allow a more efficient two-part analysis of the effects of compounds under test.

The temporal response of recombination events to gamma radiation of meiotic cells in Sordaria brevicollis.

PubMed

Lewis, L A

1982-01-01

The temporal frequencies of different stages of prophase I were determined cytologically in Sordaria brevicollis (Olive and Fantini) as the basis for ascertaining the degree of synchrony in meiosis in this ascomycete. Croziers, karyogamy-zygotene and pachytene asci were shown to be in significant majorities at three distinct periods of the meiotic cycle. The response of recombination frequency to ionizing radiation was examined for the entire meiotic cycle. Three radiosensitive periods were determined. This response, which correlated temporally with each of the three peaks in ascal frequency, is interpreted as showing that the meiotic cycle of this organism is divided into periods of recombination commitment (radiation reduced frequencies) during the pre-meiotic S phase and recombination consummation (radiation induced frequencies) during zygotene and pachytene. The results are discussed in the context of the time at which recombination is consummated in eukaryotes such as yeast and Drosophila.

The NIE Home-Based Early Education Program.

ERIC Educational Resources Information Center

Gruskin, Susan

The initial plans for the National Institute of Education (NIE) program in early childhood education are described. The first part of the document contains a discussion of the relationship between planned NIE programs and existing early childhood federal programs. In both planned and existing programs, disadvantaged children are the primary…

25 CFR 87.9 - Programming aspects of plans.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 25 Indians 1 2014-04-01 2014-04-01 false Programming aspects of plans. 87.9 Section 87.9 Indians... JUDGMENT FUNDS § 87.9 Programming aspects of plans. In assessing any tribal programming proposal the... such reservation residents; the nature of recent programming affecting the subject tribe or group and...

25 CFR 87.9 - Programming aspects of plans.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 25 Indians 1 2013-04-01 2013-04-01 false Programming aspects of plans. 87.9 Section 87.9 Indians... JUDGMENT FUNDS § 87.9 Programming aspects of plans. In assessing any tribal programming proposal the... such reservation residents; the nature of recent programming affecting the subject tribe or group and...

25 CFR 87.9 - Programming aspects of plans.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 25 Indians 1 2012-04-01 2011-04-01 true Programming aspects of plans. 87.9 Section 87.9 Indians... JUDGMENT FUNDS § 87.9 Programming aspects of plans. In assessing any tribal programming proposal the... such reservation residents; the nature of recent programming affecting the subject tribe or group and...

45 CFR 235.62 - State plan requirements for training programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

... (ASSISTANCE PROGRAMS), ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATION OF FINANCIAL ASSISTANCE PROGRAMS § 235.62 State plan requirements for training programs. A State... 45 Public Welfare 2 2010-10-01 2010-10-01 false State plan requirements for training programs. 235...

25 CFR 87.9 - Programming aspects of plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false Programming aspects of plans. 87.9 Section 87.9 Indians... JUDGMENT FUNDS § 87.9 Programming aspects of plans. In assessing any tribal programming proposal the... such reservation residents; the nature of recent programming affecting the subject tribe or group and...

25 CFR 87.9 - Programming aspects of plans.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 25 Indians 1 2011-04-01 2011-04-01 false Programming aspects of plans. 87.9 Section 87.9 Indians... JUDGMENT FUNDS § 87.9 Programming aspects of plans. In assessing any tribal programming proposal the... such reservation residents; the nature of recent programming affecting the subject tribe or group and...

Manual for Preparing Individualized Education Programs.

ERIC Educational Resources Information Center

Baylor, Terrill D.

Presented are guidelines for developing an individualized program and services plan, an individual implementation plan, and daily activity and strategy plans for handicapped students. Instructions are outlined for utilizing forms related to planning and implementation of individualized education programs. Appended are sample forms. (SBH)

Measuring the Implementation Fidelity of Student Affairs Programs: A Critical Component of the Outcomes Assessment Cycle

ERIC Educational Resources Information Center

Gerstner, Jerusha J.; Finney, Sara J.

2013-01-01

Implementation fidelity assessment provides a means of measuring the alignment between the planned program and the implemented program. Unfortunately, the implemented program can differ from the planned program, resulting in ambiguous inferences about the planned program's effectiveness (i.e., it is uncertain if poor results are due to an…

Training at a faith-based institution matters for obstetrics and gynecology residents: results from a regional survey.

PubMed

Guiahi, Maryam; Westhoff, Carolyn L; Summers, Sondra; Kenton, Kimberly

2013-06-01

Prior data suggest that opportunities in family planning training may be limited during obstetrics and gynecology (Ob-Gyn) residency training, particularly at faith-based institutions with moral and ethical constraints, although this aspect of the Ob-Gyn curriculum has not been formally studied to date. We compared Ob-Gyn residents' self-rated competency and intentions to provide family planning procedures at faith-based versus those of residents at non-faith-based programs. We surveyed residents at all 20 Ob-Gyn programs in Illinois, Indiana, Iowa, and Wisconsin from 2008 to 2009. Residents were queried about current skills and future plans to perform family planning procedures. We examined associations based on program and residents' personal characteristics and performed multivariable logistic regression analysis. A total of 232 of 340 residents (68%) from 17 programs (85%) returned surveys. Seven programs were faith-based. Residents from non-faith-based programs were more likely to be completely satisfied with family planning training (odds ratio [OR]  =  3.4, 95% confidence limit [CI], 1.9-6.2) and to report they "understand and can perform on own" most procedures. Most residents, regardless of program type, planned to provide all surveyed family planning services. Despite similar intentions to provide family planning procedures after graduation, residents at faith-based training programs were less satisfied with their family planning training and rate their ability to perform family planning services lower than residents at non-faith-based training programs.

How Strategic Planning Keeps You Sane when Delivering Distance Programs

ERIC Educational Resources Information Center

MacNeil, Dixie; Luzius, Kim; Dunkin, Sonya

2010-01-01

This paper details the advantages of creating a strategic plan in the development and delivery of distance programs at the authors' own institution. The steps involved in the planning process and the three key elements of a successful strategic plan are addressed. The key elements include a program plan explaining the roles/responsibilities of…

Comparison of optimization algorithms in intensity-modulated radiation therapy planning

NASA Astrophysics Data System (ADS)

Kendrick, Rachel

Intensity-modulated radiation therapy is used to better conform the radiation dose to the target, which includes avoiding healthy tissue. Planning programs employ optimization methods to search for the best fluence of each photon beam, and therefore to create the best treatment plan. The Computational Environment for Radiotherapy Research (CERR), a program written in MATLAB, was used to examine some commonly-used algorithms for one 5-beam plan. Algorithms include the genetic algorithm, quadratic programming, pattern search, constrained nonlinear optimization, simulated annealing, the optimization method used in Varian EclipseTM, and some hybrids of these. Quadratic programing, simulated annealing, and a quadratic/simulated annealing hybrid were also separately compared using different prescription doses. The results of each dose-volume histogram as well as the visual dose color wash were used to compare the plans. CERR's built-in quadratic programming provided the best overall plan, but avoidance of the organ-at-risk was rivaled by other programs. Hybrids of quadratic programming with some of these algorithms seems to suggest the possibility of better planning programs, as shown by the improved quadratic/simulated annealing plan when compared to the simulated annealing algorithm alone. Further experimentation will be done to improve cost functions and computational time.

User-Side Subsidy Programs for Special Needs Transportation : A Planning Handbook

DOT National Transportation Integrated Search

1983-06-01

This handbook, first of a series, provides guidance for designing and implementing a user-side subsidy program. The book is divided into two parts--Program Planning and Program Implementation. The Planning section covers six areas--Goals and Objectiv...

Multi-dimensional multi-species modeling of transient electrodeposition in LIGA microfabrication.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, Gregory Herbert; Chen, Ken Shuang

2004-06-01

This report documents the efforts and accomplishments of the LIGA electrodeposition modeling project which was headed by the ASCI Materials and Physics Modeling Program. A multi-dimensional framework based on GOMA was developed for modeling time-dependent diffusion and migration of multiple charged species in a dilute electrolyte solution with reduction electro-chemical reactions on moving deposition surfaces. By combining the species mass conservation equations with the electroneutrality constraint, a Poisson equation that explicitly describes the electrolyte potential was derived. The set of coupled, nonlinear equations governing species transport, electric potential, velocity, hydrodynamic pressure, and mesh motion were solved in GOMA, using themore » finite-element method and a fully-coupled implicit solution scheme via Newton's method. By treating the finite-element mesh as a pseudo solid with an arbitrary Lagrangian-Eulerian formulation and by repeatedly performing re-meshing with CUBIT and re-mapping with MAPVAR, the moving deposition surfaces were tracked explicitly from start of deposition until the trenches were filled with metal, thus enabling the computation of local current densities that potentially influence the microstructure and frictional/mechanical properties of the deposit. The multi-dimensional, multi-species, transient computational framework was demonstrated in case studies of two-dimensional nickel electrodeposition in single and multiple trenches, without and with bath stirring or forced flow. Effects of buoyancy-induced convection on deposition were also investigated. To further illustrate its utility, the framework was employed to simulate deposition in microscreen-based LIGA molds. Lastly, future needs for modeling LIGA electrodeposition are discussed.« less

Towards Accurate Application Characterization for Exascale (APEX)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammond, Simon David

Sandia National Laboratories has been engaged in hardware and software codesign activities for a number of years, indeed, it might be argued that prototyping of clusters as far back as the CPLANT machines and many large capability resources including ASCI Red and RedStorm were examples of codesigned solutions. As the research supporting our codesign activities has moved closer to investigating on-node runtime behavior a nature hunger has grown for detailed analysis of both hardware and algorithm performance from the perspective of low-level operations. The Application Characterization for Exascale (APEX) LDRD was a project concieved of addressing some of these concerns.more » Primarily the research was to intended to focus on generating accurate and reproducible low-level performance metrics using tools that could scale to production-class code bases. Along side this research was an advocacy and analysis role associated with evaluating tools for production use, working with leading industry vendors to develop and refine solutions required by our code teams and to directly engage with production code developers to form a context for the application analysis and a bridge to the research community within Sandia. On each of these accounts significant progress has been made, particularly, as this report will cover, in the low-level analysis of operations for important classes of algorithms. This report summarizes the development of a collection of tools under the APEX research program and leaves to other SAND and L2 milestone reports the description of codesign progress with Sandia’s production users/developers.« less

5 CFR 720.205 - Agency plans.

Code of Federal Regulations, 2011 CFR

2011-01-01

... the Federal civil service system and a description of recruitment programs developed to increase... program plans and should be developed with full consideration of the agency's overall recruiting and...) AFFIRMATIVE EMPLOYMENT PROGRAMS Federal Equal Opportunity Recruitment Program § 720.205 Agency plans. (a) Each...

Influence of PPB on Capital Budgeting.

ERIC Educational Resources Information Center

Ellis, Arthur E.

This talk is divided into two parts: Part one covers Planning, Programming and Budgeting for Capital Programs. Part two is a brief description of the Coho Salmon Program and how Program Planning and Budgeting in both the operation program and the capital phase was used to develop the Salmon Fishing Industry in Michigan. The planning process…

FY 1987 current fiscal year work plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This Current Year Work Plan presents a detailed description of the activities to be performed by the Joint Integration Office during FY87. It breaks down the activities into two major work areas: Program Management and Program Analysis. Program Management is performed by the JIO by providing technical planning and guidance for the development of advanced TRU waste management capabilities. This includes equipment/facility design, engineering, construction, and operations. These functions are integrated to allow transition from interim storage to final disposition. JIO tasks include program requirements identification, long-range technical planning, budget development, program planning document preparation, task guidance, task monitoring, informationmore » gathering and task reporting to DOE, interfacing with other agencies and DOE lead programs, integrating public involvement with program efforts, and preparation of program status reports for DOE. Program Analysis is performed by the JIO to support identification and assessment of alternatives, and development of long-term TRU waste program capabilities. This work plan includes: system analyses, requirements analyses, interim and procedure development, legislative and regulatory analyses, dispatch and traffic analyses, and data bases.« less

Alabama Commission on Higher Education 1986 Annual Report.

ERIC Educational Resources Information Center

Alabama State Commission on Higher Education, Montgomery.

The 1986 annual report outlines planning and coordination activities and student financial aid programs. The following planning and coordination activities are considered: statewide planning and facilities planning, a new program approval procedure, approval of off-campus offerings, studies of the state's engineering programs and needs and allied…

7 CFR 3430.1007 - Planning activities.

Code of Federal Regulations, 2012 CFR

2012-01-01

... ADMINISTRATIVE PROVISIONS Sun Grant Program § 3430.1007 Planning activities. (a) Required plan. The Centers and... program. Proposals submitted to the Sun Grant Program must be sufficiently detailed and of high enough...

7 CFR 3430.1007 - Planning activities.

Code of Federal Regulations, 2013 CFR

2013-01-01

... ADMINISTRATIVE PROVISIONS Sun Grant Program § 3430.1007 Planning activities. (a) Required plan. The Centers and... program. Proposals submitted to the Sun Grant Program must be sufficiently detailed and of high enough...

7 CFR 3430.1007 - Planning activities.

Code of Federal Regulations, 2011 CFR

2011-01-01

... ADMINISTRATIVE PROVISIONS Sun Grant Program § 3430.1007 Planning activities. (a) Required plan. The Centers and... program. Proposals submitted to the Sun Grant Program must be sufficiently detailed and of high enough...

7 CFR 3430.1007 - Planning activities.

Code of Federal Regulations, 2014 CFR

2014-01-01

... ADMINISTRATIVE PROVISIONS Sun Grant Program § 3430.1007 Planning activities. (a) Required plan. The Centers and... program. Proposals submitted to the Sun Grant Program must be sufficiently detailed and of high enough...

Performance-based planning and programming guidebook.

DOT National Transportation Integrated Search

2013-09-01

"Performance-based planning and programming (PBPP) refers to the application of performance management principles within the planning and programming processes of transportation agencies to achieve desired performance outcomes for the multimodal tran...

49 CFR 613.100 - Metropolitan transportation planning and programming.

Code of Federal Regulations, 2014 CFR

2014-10-01

... programming. 613.100 Section 613.100 Transportation Other Regulations Relating to Transportation (Continued... Metropolitan Transportation Planning and Programming § 613.100 Metropolitan transportation planning and programming. The regulations in 23 CFR 450, subpart C, shall be followed in complying with the requirements of...

49 CFR 613.100 - Metropolitan transportation planning and programming.

Code of Federal Regulations, 2013 CFR

2013-10-01

... programming. 613.100 Section 613.100 Transportation Other Regulations Relating to Transportation (Continued... Metropolitan Transportation Planning and Programming § 613.100 Metropolitan transportation planning and programming. The regulations in 23 CFR 450, subpart C, shall be followed in complying with the requirements of...

49 CFR 613.100 - Metropolitan transportation planning and programming.

Code of Federal Regulations, 2012 CFR

2012-10-01

... programming. 613.100 Section 613.100 Transportation Other Regulations Relating to Transportation (Continued... Metropolitan Transportation Planning and Programming § 613.100 Metropolitan transportation planning and programming. The regulations in 23 CFR 450, subpart C, shall be followed in complying with the requirements of...

49 CFR 613.100 - Metropolitan transportation planning and programming.

Code of Federal Regulations, 2010 CFR

2010-10-01

... programming. 613.100 Section 613.100 Transportation Other Regulations Relating to Transportation (Continued... Metropolitan Transportation Planning and Programming § 613.100 Metropolitan transportation planning and programming. The regulations in 23 CFR 450, subpart C, shall be followed in complying with the requirements of...

49 CFR 613.100 - Metropolitan transportation planning and programming.

Code of Federal Regulations, 2011 CFR

2011-10-01

... programming. 613.100 Section 613.100 Transportation Other Regulations Relating to Transportation (Continued... Metropolitan Transportation Planning and Programming § 613.100 Metropolitan transportation planning and programming. The regulations in 23 CFR 450, subpart C, shall be followed in complying with the requirements of...

[Diversification is the financial alternative for family planning].

PubMed

Castro Villamil, R

1991-12-01

During the 1960s, when family planning services were institutionalized in Colombia by PROFAMILIA, abundant foreign assistance was readily available. Few questions were asked about the longterm funding of family planning programs or the need for financial self-sufficiency. The emphasis was on program development without great attention to costs. Beginning around the early 1980s, international donors began to place a higher priority and greater investment in the incipient family planning programs of less developed countries. At present a greater number and higher quality of services are being demanded from PROFAMILIA at the lowest possible cost. Efficiency has replaced efficacy as the overriding goal. PROFAMILIA, due to its excellent results, has lost priority in the eyes of international donors. It has therefore reoriented its financing strategies toward a short, medium, and long term plan to reduce its financial dependence on international donor agencies. Self-sufficiency could be increased through various means, including total government subsidy, charging fees for services and materials sufficient to cover program costs, establishing services and marketing programs aside from family planning programs for the specific purpose of obtaining funds to cover program deficits, or establishing accounting and operational controls to reduce costs through greater efficiency. But large government subsidies are unlikely in a time of budgetary constraints, and raising fees for family planning users would exclude a large number of low-income clients from the family planning program. Cost reduction and implementation of diversified programs should therefore be emphasized for the present. The diversified program should be related to family planning so that use can be made of idle resources. PROFAMILIA has emphasized surgical procedures and medical consultations to utilize clinic facilities more fully and to increase income without increasing fixed costs. In 1990, foreign donations accounted for 47.3% of PROFAMILIA income and PROFAMILIA contributed the rest. 18.1% came from family planning activities, 20.2% from surgical procedures, consultations, sales of medications, and laboratory services, and 20.2% from service contracts, national donations, interest, and other sources. In the same year, family planning programs accounted for 68.9% of expenditures, diversification programs for 11.5%, technical assistance for 8.6%, and administration for 11%. The income and expenditure data indicate that the diversification programs make a significant financial contribution to the family planning program, at the same time reducing dependency on international donor agencies.

49 CFR 659.19 - System safety program plan: contents.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 7 2012-10-01 2012-10-01 false System safety program plan: contents. 659.19... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAIL FIXED GUIDEWAY SYSTEMS; STATE SAFETY OVERSIGHT Role of the State Oversight Agency § 659.19 System safety program plan: contents. The system safety plan shall...

49 CFR 659.19 - System safety program plan: contents.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 7 2011-10-01 2011-10-01 false System safety program plan: contents. 659.19... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAIL FIXED GUIDEWAY SYSTEMS; STATE SAFETY OVERSIGHT Role of the State Oversight Agency § 659.19 System safety program plan: contents. The system safety plan shall...

49 CFR 659.19 - System safety program plan: contents.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 7 2013-10-01 2013-10-01 false System safety program plan: contents. 659.19... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAIL FIXED GUIDEWAY SYSTEMS; STATE SAFETY OVERSIGHT Role of the State Oversight Agency § 659.19 System safety program plan: contents. The system safety plan shall...

49 CFR 659.19 - System safety program plan: contents.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 7 2014-10-01 2014-10-01 false System safety program plan: contents. 659.19... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAIL FIXED GUIDEWAY SYSTEMS; STATE SAFETY OVERSIGHT Role of the State Oversight Agency § 659.19 System safety program plan: contents. The system safety plan shall...

49 CFR 659.19 - System safety program plan: contents.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 7 2010-10-01 2010-10-01 false System safety program plan: contents. 659.19... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAIL FIXED GUIDEWAY SYSTEMS; STATE SAFETY OVERSIGHT Role of the State Oversight Agency § 659.19 System safety program plan: contents. The system safety plan shall...

34 CFR 200.27 - Development of a schoolwide program plan.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Development of a schoolwide program plan. (a)(1) A school operating a schoolwide program must develop a comprehensive plan to improve teaching and learning throughout the school. (2) The school must develop the comprehensive plan in consultation with the LEA and its school support team or other technical assistance...

34 CFR 200.27 - Development of a schoolwide program plan.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Development of a schoolwide program plan. (a)(1) A school operating a schoolwide program must develop a comprehensive plan to improve teaching and learning throughout the school. (2) The school must develop the comprehensive plan in consultation with the LEA and its school support team or other technical assistance...

34 CFR 200.27 - Development of a schoolwide program plan.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Development of a schoolwide program plan. (a)(1) A school operating a schoolwide program must develop a comprehensive plan to improve teaching and learning throughout the school. (2) The school must develop the comprehensive plan in consultation with the LEA and its school support team or other technical assistance...

34 CFR 200.27 - Development of a schoolwide program plan.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Development of a schoolwide program plan. (a)(1) A school operating a schoolwide program must develop a comprehensive plan to improve teaching and learning throughout the school. (2) The school must develop the comprehensive plan in consultation with the LEA and its school support team or other technical assistance...

A Guide to Program Planning Vol. II.

ERIC Educational Resources Information Center

Allen, Earl, Sr.

This booklet is a simplified guide for program planning and is intended to complement a somewhat lengthier companion booklet on program evaluation. It spells out in outline fashion the basic elements and steps involved in the planning process. Brief sections focus in turn on different phases of the planning process, including problem…

ISS Payload Operations: The Need for and Benefit of Responsive Planning

NASA Technical Reports Server (NTRS)

Nahay, Ed; Boster, Mandee

2000-01-01

International Space Station (ISS) payload operations are controlled through implementation of a payload operations plan. This plan, which represents the defined approach to payload operations in general, can vary in terms of level of definition. The detailed plan provides the specific sequence and timing of each component of a payload's operations. Such an approach to planning was implemented in the Spacelab program. The responsive plan provides a flexible approach to payload operations through generalization. A responsive approach to planning was implemented in the NASA/Mir Phase 1 program, and was identified as a need during the Skylab program. The current approach to ISS payload operations planning and control tends toward detailed planning, rather than responsive planning. The use of detailed plans provides for the efficient use of limited resources onboard the ISS. It restricts flexibility in payload operations, which is inconsistent with the dynamic nature of the ISS science program, and it restricts crew desires for flexibility and autonomy. Also, detailed planning is manpower intensive. The development and implementation of a responsive plan provides for a more dynamic, more accommodating, and less manpower intensive approach to planning. The science program becomes more dynamic and responsive as the plan provides flexibility to accommodate real-time science accomplishments. Communications limitations and the crew desire for flexibility and autonomy in plan implementation are readily accommodated with responsive planning. Manpower efficiencies are accomplished through a reduction in requirements collection and coordination, plan development, and maintenance. Through examples and assessments, this paper identifies the need to transition from detailed to responsive plans for ISS payload operations. Examples depict specific characteristics of the plans. Assessments identify the following: the means by which responsive plans accommodate the dynamic nature of science programs and the crew desire for flexibility; the means by which responsive plans readily accommodate ISS communications constraints; manpower efficiencies to be achieved through use of responsive plans; and the implications of responsive planning relative to resource utilization efficiency.

National Civil Applications Program: strategic plan vision for 2005

USGS Publications Warehouse

,

2004-01-01

The National Mapping Division (NMD) has developed this comprehensive strategic plan to chart the course of the National Civil Applications Program (NCAP) over the next 5 years. To meet the challenges of the future, the NCAP is changing its program emphases, methods of responding to customer needs, and business practices. The NCAP Strategic Plan identifies the new direction for the program through a series of strategic thrusts and goals for managers to use in formulating plans, establishing program emphases, and determining resource needs and allocations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, Barbara L.

The annual program report provides detailed information about all aspects of the SNL/CA Environmental Planning and Ecology Program for a given calendar year. It functions as supporting documentation to the SNL/CA Environmental Management System Program Manual. The 2005 program report describes the activities undertaken during the past year, and activities planned in future years to implement the Planning and Ecology Program, one of six programs that supports environmental management at SNL/CA.

Individualized Program Planning (IPP): ECS to Grade 12. Programming for Students with Special Needs

ERIC Educational Resources Information Center

Online Submission, 2006

2006-01-01

This resource is a revision of the teaching resource Individualized Program Plans (1995), Book 3 (ED392232) in the Programming for Students with Special Needs series. It aims to create a bridge between the product, the process and the underlying vision of Individualized Program Planning (IPP). The Standards for Special Education (Amended June…

23 CFR 450.208 - Coordination of planning process activities.

Code of Federal Regulations, 2013 CFR

2013-04-01

... RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and Programming § 450.208... transportation operators to support statewide transportation planning and programming priorities and decisions...

23 CFR 450.208 - Coordination of planning process activities.

Code of Federal Regulations, 2014 CFR

2014-04-01

... RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and Programming § 450.208... transportation operators to support statewide transportation planning and programming priorities and decisions...

23 CFR 450.208 - Coordination of planning process activities.

Code of Federal Regulations, 2012 CFR

2012-04-01

... RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and Programming § 450.208... transportation operators to support statewide transportation planning and programming priorities and decisions...

Site support program plan for ICF Kaiser Hanford Company

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dieterle, S.E.

1996-09-27

The Fiscal Year (FY) 1997 Inftastructure Program Site Support Program Plan (SSPP) addresses the mission objectives, workscope, work breakdown structures (WBS), management approach, and resource requirements for the Infrastructure Program. Attached to the plan are appendices that provide more detailed information associated with scope definition.

Health plans' disease management programs: extending across the medical and behavioral health spectrum?

PubMed

Merrick, Elizabeth Levy; Horgan, Constance M; Garnick, Deborah W; Hodgkin, Dominic; Morley, Melissa

2008-01-01

Although the disease management industry has expanded rapidly, there is little nationally representative data regarding medical and behavioral health disease management programs at the health plan level. National estimates from a survey of private health plans indicate that 90% of health plan products offered disease management for general medical conditions such as diabetes but only 37% had depression programs. The frequency of specific depression disease management activities varied widely. Program adoption was significantly related to product type and behavioral health contracting. In health plans, disease management has penetrated more slowly into behavioral health and depression program characteristics are highly variable.

Health Plans' Disease Management Programs: Extending across the Medical and Behavioral Health Spectrum?

PubMed Central

Merrick, Elizabeth Levy; Horgan, Constance M.; Garnick, Deborah W.; Hodgkin, Dominic; Morley, Melissa

2015-01-01

While the disease management industry has expanded rapidly, there is little nationally representative data regarding medical and behavioral health disease management programs at the health plan level. National estimates from a survey of private health plans indicate that 90% of health plan products offered disease management for general medical conditions such as diabetes, but only 37% had depression programs. The frequency of specific depression disease management activities varied widely. Program adoption was significantly related to product type and behavioral health contracting. In health plans, disease management has penetrated more slowly into behavioral health, and depression program characteristics are highly variable. PMID:18806594

Program Planning Concepts in Solid Waste Management

ERIC Educational Resources Information Center

Brown, Sanford M., Jr.

1972-01-01

Presents a brief review of the program planning process, and uses the example of a solid waste program to illustrate what has or has not been accomplished through the use of the planning process. (LK)

22 CFR 518.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Financial and Program Management § 518.25 Revision of budget and program plans. (a) The budget plan is the financial expression of the project or program as approved during the...

Quality assurance program plan for radionuclide airborne emissions monitoring

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boom, R.J.

1995-12-01

This Quality Assurance Program Plan identifies quality assurance program requirements and addresses the various Westinghouse Hanford Company organizations and their particular responsibilities in regards to sample and data handling of radiological airborne emissions. This Quality Assurance Program Plan is prepared in accordance with and to written requirements.

Scheduling language and algorithm development study. Volume 2, phase 2: Introduction to plans programming. [user guide

NASA Technical Reports Server (NTRS)

Cochran, D. R.; Ishikawa, M. K.; Paulson, R. E.; Ramsey, H. R.

1975-01-01

A user guide for the Programming Language for Allocation and Network Scheduling (PLANS) is presented. Information is included for the construction of PLANS programs. The basic philosophy of PLANS is discussed, and access and update reference techniques are described along with the use of tree structures.

24 CFR 984.201 - Action Plan.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Action Plan. 984.201 Section 984... § 984.201 Action Plan. (a) Requirement for Action Plan. A PHA must have a HUD-approved Action Plan that... program is a mandatory or voluntary program. (b) Development of Action Plan. The Action Plan shall be...

24 CFR 984.201 - Action Plan.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Action Plan. 984.201 Section 984... § 984.201 Action Plan. (a) Requirement for Action Plan. A PHA must have a HUD-approved Action Plan that... program is a mandatory or voluntary program. (b) Development of Action Plan. The Action Plan shall be...

Phase C/D program development plan. Volume 1: Program plan

NASA Technical Reports Server (NTRS)

1971-01-01

The Phase C/D definition of the Modular Space Station has been developed. The modular approach selected during the option period was evaluated, requirements were defined, and program definition and preliminary design were accomplished. The Space Station Project is covered in depth, the research applications module is limited to a project-level definition, and the shuttle operations are included for interface requirements identification, scheduling, and costing. Discussed in detail are: (1) baseline program and project descriptions; (2) phase project planning; (3) modular space station program schedule; (4) program management plan; (5) operations; (6) facilities; (7) logistics; and (8) manpower.

U.S. Climate Change Science Program. Vision for the Program and Highlights of the Scientific Strategic Plan

NASA Technical Reports Server (NTRS)

2003-01-01

The vision document provides an overview of the Climate Change Science Program (CCSP) long-term strategic plan to enhance scientific understanding of global climate change.This document is a companion to the comprehensive Strategic Plan for the Climate Change Science Program. The report responds to the Presidents direction that climate change research activities be accelerated to provide the best possible scientific information to support public discussion and decisionmaking on climate-related issues.The plan also responds to Section 104 of the Global Change Research Act of 1990, which mandates the development and periodic updating of a long-term national global change research plan coordinated through the National Science and Technology Council.This is the first comprehensive update of a strategic plan for U.S. global change and climate change research since the origal plan for the U.S. Global Change Research Program was adopted at the inception of the program in 1989.

The Role of Public-Sector Family Planning Programs in Meeting the Demand for Contraception in Sub-Saharan Africa.

PubMed

Bongaarts, John; Hardee, Karen

2017-06-01

Commonly used indicators of contraceptive behavior in a population-modern contraceptive prevalence (mCPR), unmet need for contraception, demand for contraception and demand satisfied-are not well-suited for evaluating the progress made by government family planning programs in helping women and men achieve their reproductive goals. Trends in these measures in 26 Sub-Saharan African countries between 1990 and 2014 were examined. Trends in a proposed new indicator, the public-sector family planning program impact score (PFPI), and its relationship to mCPR and the family planning effort score were also assessed. Case studies were used to review public family planning program development and implementation in four countries (Nigeria, Ethiopia, Rwanda and Kenya). The four commonly used indicators capture the extent to which women use family planning and to which demand is satisfied, but shed no direct light on the role of family planning programs. PFPI provides evidence that can be used to hold governments accountable for meeting the demand for family planning, and was closely related to policy developments in the four case-study countries. PFPI provides a useful addition to the indicators currently used to assess progress in reproductive health and family planning programs.

Software for Optimizing Plans Involving Interdependent Goals

NASA Technical Reports Server (NTRS)

Estlin, Tara; Gaines, Daniel; Rabideau, Gregg

2005-01-01

A computer program enables construction and optimization of plans for activities that are directed toward achievement of goals that are interdependent. Goal interdependence is defined as the achievement of one or more goals affecting the desirability or priority of achieving one or more other goals. This program is overlaid on the Automated Scheduling and Planning Environment (ASPEN) software system, aspects of which have been described in a number of prior NASA Tech Briefs articles. Unlike other known or related planning programs, this program considers interdependences among goals that can change between problems and provides a language for easily specifying such dependences. Specifications of the interdependences can be formulated dynamically and provided to the associated planning software as part of the goal input. Then an optimization algorithm provided by this program enables the planning software to reason about the interdependences and incorporate them into an overall objective function that it uses to rate the quality of a plan under construction and to direct its optimization search. In tests on a series of problems of planning geological experiments by a team of instrumented robotic vehicles (rovers) on new terrain, this program was found to enhance plan quality.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, Barbara L.

The annual program report provides detailed information about all aspects of the Sandia National Laboratories, California (SNL/CA) Environmental Planning and Ecology Program for a given calendar year. It functions as supporting documentation to the SNL/CA Environmental Management System Program Manual. The 2006 program report describes the activities undertaken during the past year, and activities planned in future years to implement the Planning and Ecology Program, one of six programs that supports environmental management at SNL/CA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, Barbara L.

The annual program report provides detailed information about all aspects of the Sandia National Laboratories, California (SNL/CA) Environmental Planning and Ecology Program for a given calendar year. It functions as supporting documentation to the SNL/CA Environmental Management System Program Manual. The program report describes the activities undertaken during the past year, and activities planned in future years to implement the Planning and Ecology Program, one of six programs that supports environmental management at SNL/CA.

Lightning Mapper Sensor Lens Assembly S.O. 5459: Project Management Plan

NASA Technical Reports Server (NTRS)

Zeidler, Janet

1999-01-01

Kaiser Electro-Optics, Inc. (KEO) has developed this Project Management Plan for the Lightning Mapper Sensor (LMS) program. KEO has integrated a team of experts in a structured program management organization to meet the needs of the LMS program. The project plan discusses KEO's approach to critical program elements including Program Management, Quality Assurance, Configuration Management, and Schedule.

Proceedings of the HEA Title II-B Institute on Continuing Education Program Planning for Library Staffs in the Southwest, March 17-28, 1975.

ERIC Educational Resources Information Center

Foos, Donald D., Comp.

The proceedings of the Institute on Continuing Education Program Planning for Library Staffs in the Southwest contain historical and state-of-the-art information, needs assessments, program planning information, program descriptions and the Continuing Education for Library Staff program. The continuing education needs of medical, school, special,…

78 FR 7476 - Airport Improvement Program

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-01

... of Airport Planning and Programming, Financial Assistance Division has updated and significantly.... San Martin, Manager, Airports Financial Assistance Division, Office of Airport Planning and... Airports, Airport Planning and Programming, Routing Symbol APP-501, 800 Independence Avenue SW., Room 619...

Columbia River Basin Fish and Wildlife Program Annual Implementation Work Plan for Fiscal Year 1993.

DOE Office of Scientific and Technical Information (OSTI.GOV)

United States. Bonneville Power Administration; Northwest Power Planning Council; Columbia Basin Fish and Wildlife Authority

1992-09-01

The Columbia River Basin Fish and Wildlife Program (Program) was developed by the Northwest Power Planning Council (Council) in accordance with Public Law 96-501, the Pacific Northwest Electric Power Planning and Conservation Act (Act). The purpose of the Program is to guide the Bonneville Power Administration (BPA) and other Federal agencies in carrying out their responsibilities to protect, mitigate, and enhance fish and wildlife of the Columbia River Basin. The Annual Implementation World Plan (AIWP) presents BPA`s plans for implementing the Program during fiscal year (FY) 1993. The FY 1993 AIWP emphasizes continuation of 143 ongoing or projecting ongoing Programmore » projects, tasks, or task orders, most of which involve protection, mitigation, or enhancement of anadromous fishery resources. The FY 1993 AIWP also contains three new Program projects or tasks that are planned to start in FY 1993.« less

Definition study of a Variable Cycle Experimental Engine (VCEE) and associated test program and test plan

NASA Technical Reports Server (NTRS)

Allan, R. D.

1978-01-01

The Definition Study of a Variable Cycle Experimental Engine (VCEE) and Associated Test Program and Test Plan, was initiated to identify the most cost effective program for a follow-on to the AST Test Bed Program. The VCEE Study defined various subscale VCE's based on different available core engine components, and a full scale VCEE utilizing current technology. The cycles were selected, preliminary design accomplished and program plans and engineering costs developed for several program options. In addition to the VCEE program plans and options, a limited effort was applied to identifying programs that could logically be accomplished on the AST Test Bed Program VCE to extend the usefulness of this test hardware. Component programs were provided that could be accomplished prior to the start of a VCEE program.

Multicenter Collaborative Quality Assurance Program for the Province of Ontario, Canada: First-Year Results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Létourneau, Daniel, E-mail: daniel.letourneau@rmp.uh.on.ca; Department of Radiation Oncology, University of Toronto, Toronto, Ontario; McNiven, Andrea

2013-05-01

Purpose: The objective of this work was to develop a collaborative quality assurance (CQA) program to assess the performance of intensity modulated radiation therapy (IMRT) planning and delivery across the province of Ontario, Canada. Methods and Materials: The CQA program was designed to be a comprehensive end-to-end test that can be completed on multiple planning and delivery platforms. The first year of the program included a head-and-neck (H and N) planning exercise and on-site visit to acquire dosimetric measurements to assess planning and delivery performance. A single dosimeter was used at each institution, and the planned to measured dose agreementmore » was evaluated for both the H and N plan and a standard plan (linear-accelerator specific) that was created to enable a direct comparison between centers with similar infrastructure. Results: CQA program feasibility was demonstrated through participation of all 13 radiation therapy centers in the province. Planning and delivery was completed on a variety of infrastructure (treatment planning systems and linear accelerators). The planning exercise was completed using both static gantry and rotational IMRT, and planned-to-delivered dose agreement (pass rates) for 3%/3-mm gamma evaluation were greater than 90% (92.6%-99.6%). Conclusions: All centers had acceptable results, but variation in planned to delivered dose agreement for the same planning and delivery platform was noted. The upper end of the range will provide an achievable target for other centers through continued quality improvement, aided by feedback provided by the program through the use of standard plans and simple test fields.« less

10 CFR 420.17 - Optional elements of State Energy Program plans.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 3 2012-01-01 2012-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or...

10 CFR 420.17 - Optional elements of State Energy Program plans.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 3 2011-01-01 2011-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or...

10 CFR 420.17 - Optional elements of State Energy Program plans.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or...

10 CFR 420.17 - Optional elements of State Energy Program plans.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 3 2013-01-01 2013-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or...

10 CFR 420.17 - Optional elements of State Energy Program plans.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 3 2014-01-01 2014-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or...

41 CFR 105-72.305 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Management § 105-72.305 Revision of budget and program plans. (a) The budget plan is the financial expression... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Revision of budget and program plans. 105-72.305 Section 105-72.305 Public Contracts and Property Management Federal Property...

Electrician Cluster, STEP Training Plan. Skills Training and Education Program.

ERIC Educational Resources Information Center

Alabama State Dept. of Postsecondary Education, Montgomery.

This guide is a training plan for the electrical skills cluster of the Skills Training and Education Program (STEP), an open-entry, open-exit program funded by the Job Training Partnership Act (JTPA). In the STEP training plan, each task has its own lesson plan guide. This manual contains the following information: definitions, instructions for…

29 CFR 1608.7 - Affirmative action plans or programs under State or local law.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 29 Labor 4 2011-07-01 2011-07-01 false Affirmative action plans or programs under State or local... OPPORTUNITY COMMISSION AFFIRMATIVE ACTION APPROPRIATE UNDER TITLE VII OF THE CIVIL RIGHTS ACT OF 1964, AS AMENDED § 1608.7 Affirmative action plans or programs under State or local law. Affirmative action plans...

29 CFR 1608.7 - Affirmative action plans or programs under State or local law.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 4 2010-07-01 2010-07-01 false Affirmative action plans or programs under State or local... OPPORTUNITY COMMISSION AFFIRMATIVE ACTION APPROPRIATE UNDER TITLE VII OF THE CIVIL RIGHTS ACT OF 1964, AS AMENDED § 1608.7 Affirmative action plans or programs under State or local law. Affirmative action plans...

Environmental Education in Graduate Professional Degrees: The Case of Urban Planning

ERIC Educational Resources Information Center

White, Stacey Swearingen; Mayo, James M.

2005-01-01

Environmental education (EE) is a prominent aspect of graduate-level master's programs in urban and regional planning. This article draws on the results of a survey of 66 environmental planning educators in urban and regional planning programs to show what types of EE are most prevalent in these graduate professional programs and in planning…

Clerical Cluster, STEP Training Plan. Skills Training and Education Program.

ERIC Educational Resources Information Center

Alabama State Dept. of Postsecondary Education, Montgomery.

This guide is a training plan for the clerical skills cluster of the Skills Training and Education Program (STEP), an open-entry, open-exit program funded by the Job Training Partnership Act (JTPA). In the STEP training plan, each task has its own lesson plan guide. This manual contains the following information: definitions, instructions for…

25 CFR 20.202 - What is a tribal redesign plan?

Code of Federal Regulations, 2010 CFR

2010-04-01

... SOCIAL SERVICES PROGRAMS Welfare Reform § 20.202 What is a tribal redesign plan? If you are a tribe administering a general assistance program, you can develop and submit to us a tribal redesign plan to change the way that you administer the program. (a) A tribal redesign plan allows a tribe to: (1) Change...

Public Relations for Brazilian Libraries: Process, Principles, Program Planning, Planning Techniques and Suggestions.

ERIC Educational Resources Information Center

Kies, Cosette N.

A brief overview of the functions of public relations in libraries introduces this manual, which provides an explanation of the public relations (PR) process, including fact-finding, planning, communicating, evaluating, and marketing; some PR principles; a 10-step program that could serve as a model for planning a PR program; a discussion of PR…

45 CFR 287.70 - What are the plan requirements for the NEW Program?

Code of Federal Regulations, 2010 CFR

2010-10-01

... Tribe will deliver work activities and services. (d) The format is left to the discretion of each NEW... 45 Public Welfare 2 2010-10-01 2010-10-01 false What are the plan requirements for the NEW Program... SERVICES THE NATIVE EMPLOYMENT WORKS (NEW) PROGRAM Plan Requirements § 287.70 What are the plan...

45 CFR 287.70 - What are the plan requirements for the NEW Program?

Code of Federal Regulations, 2011 CFR

2011-10-01

... Tribe will deliver work activities and services. (d) The format is left to the discretion of each NEW... 45 Public Welfare 2 2011-10-01 2011-10-01 false What are the plan requirements for the NEW Program... SERVICES THE NATIVE EMPLOYMENT WORKS (NEW) PROGRAM Plan Requirements § 287.70 What are the plan...

High performance computing and communications: FY 1997 implementation plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-12-01

The High Performance Computing and Communications (HPCC) Program was formally authorized by passage, with bipartisan support, of the High-Performance Computing Act of 1991, signed on December 9, 1991. The original Program, in which eight Federal agencies participated, has now grown to twelve agencies. This Plan provides a detailed description of the agencies` FY 1996 HPCC accomplishments and FY 1997 HPCC plans. Section 3 of this Plan provides an overview of the HPCC Program. Section 4 contains more detailed definitions of the Program Component Areas, with an emphasis on the overall directions and milestones planned for each PCA. Appendix A providesmore » a detailed look at HPCC Program activities within each agency.« less

23 CFR 1200.25 - Improvement plan.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Implementation and Management of the Highway Safety Program § 1200.25 Improvement plan. If a review of the Annual... improvement plan. This plan will detail strategies, program activities, and funding targets to meet the...

NASA earth science and applications division: The program and plans for FY 1988-1989-1990

NASA Technical Reports Server (NTRS)

1988-01-01

Described here are the Division's research goals, priorities and emphases for the next several years and an outline of longer term plans. Included are highlights of recent accomplishments, current activities in FY 1988, research emphases in FY 1989, and longer term future plans. Data and information systems, the Geodynamics Program, the Land Processes Program, the Oceanic Processes Program, the Atmospheric Dynamics and Radiation Program, the Atmospheric Chemistry Program, and space flight programs are among the topic covered.

Autonomous Vehicle Mission Planning Using AI (Artificial Intelligence) Techniques.

DTIC Science & Technology

1985-12-01

it uses are declarative patterns that encode facts about how goals may give rise to - . plans. The program processes a story a sentence at a time...the planning process. By separating the knowledge about how to plan from the specific domain knowledge, an understander can use this knowledge about how ...path planning program developed in a previous thesis effort will be incorporated into the overall program in order to demonstrate the operating system

Strategic plan, 1985

NASA Technical Reports Server (NTRS)

1985-01-01

The Lewis Strategic Plan was updated for 1985 and beyond. Major programs for the space station, the advanced turboprop, the Advanced Communications Technology Satellite (ACTS), and the Altitude Wind Tunnel were begun or greatly expanded during 1984. In parallel, The Lewis aeropropulsion research and technology program was extensively evaluated and reviewed; a reduced and reoriented program emerged. The thrusts and implementation plans for these programs are described as they pertain to the individual directorates. Other key accomplishments and plans are summarized.

7 CFR 1210.311 - Programs and projects.

Code of Federal Regulations, 2010 CFR

2010-01-01

... PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.311 Programs and projects. Programs and projects mean those research, development, advertising, or promotion programs or projects...

San Diego transit five year plan update : FY 1982-1986

DOT National Transportation Integrated Search

1981-07-01

The Five Year Plan Update constitutes the annual revision to the operating plan and capital program for the following five year planning period, presents its adopted budget and a specific operating plan and capital program for FY 1982 as well as less...

SDDOT transportation systems management & operations program plan.

DOT National Transportation Integrated Search

2016-06-01

The objective of this project is the development of a comprehensive Transportation Systems Management and : Operations (TSM&O) Program Plan for the South Dakota Department of Transportation. This plan guides : business planning and strategic decision...

Tank waste remediation system multi-year work plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The Tank Waste Remediation System (TWRS) Multi-Year Work Plan (MYWP) documents the detailed total Program baseline and was constructed to guide Program execution. The TWRS MYWP is one of two elements that comprise the TWRS Program Management Plan. The TWRS MYWP fulfills the Hanford Site Management System requirement for a Multi-Year Program Plan and a Fiscal-Year Work Plan. The MYWP addresses program vision, mission, objectives, strategy, functions and requirements, risks, decisions, assumptions, constraints, structure, logic, schedule, resource requirements, and waste generation and disposition. Sections 1 through 6, Section 8, and the appendixes provide program-wide information. Section 7 includes a subsectionmore » for each of the nine program elements that comprise the TWRS Program. The foundation of any program baseline is base planning data (e.g., defendable product definition, logic, schedules, cost estimates, and bases of estimates). The TWRS Program continues to improve base data. As data improve, so will program element planning, integration between program elements, integration outside of the TWRS Program, and the overall quality of the TWRS MYWP. The MYWP establishes the TWRS baseline objectives to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The TWRS Program will complete the baseline mission in 2040 and will incur costs totalling approximately 40 billion dollars. The summary strategy is to meet the above objectives by using a robust systems engineering effort, placing the highest possible priority on safety and environmental protection; encouraging {open_quotes}out sourcing{close_quotes} of the work to the extent practical; and managing significant but limited resources to move toward final disposition of tank wastes, while openly communicating with all interested stakeholders.« less

Tank waste remediation system multi-year work plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-09-01

The Tank Waste Remediation System (TWRS) Multi-Year Work Plan (MYWP) documents the detailed total Program baseline and was constructed to guide Program execution. The TWRS MYWP is one of two elements that comprise the TWRS Program Management Plan. The TWRS MYWP fulfills the Hanford Site Management System requirement for a Multi-Year Program Plan and a Fiscal-Year Work Plan. The MYWP addresses program vision, mission, objectives, strategy, functions and requirements, risks, decisions, assumptions, constraints, structure, logic, schedule, resource requirements, and waste generation and disposition. Sections 1 through 6, Section 8, and the appendixes provide program-wide information. Section 7 includes a subsectionmore » for each of the nine program elements that comprise the TWRS Program. The foundation of any program baseline is base planning data (e.g., defendable product definition, logic, schedules, cost estimates, and bases of estimates). The TWRS Program continues to improve base data. As data improve, so will program element planning, integration between program elements, integration outside of the TWRS Program, and the overall quality of the TWRS MYWP. The MYWP establishes the TWRS baseline objectives to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The TWRS Program will complete the baseline mission in 2040 and will incur costs totalling approximately 40 billion dollars. The summary strategy is to meet the above objectives by using a robust systems engineering effort, placing the highest possible priority on safety and environmental protection; encouraging {open_quotes}out sourcing{close_quotes} of the work to the extent practical; and managing significant but limited resources to move toward final disposition of tank wastes, while openly communicating with all interested stakeholders.« less

Domestic, international family planning programs at risk.

PubMed

Turnbull, W; Kaeser, L

1998-02-01

The US government has subsidized family planning services domestically and abroad for three decades. For most of that period, the support has been provided with the broad-based backing of both US lawmakers and the general public. However, recent polling indicates that public support for family planning programs remains strong, but not necessarily among legislators. Since Republicans gained control of the US House of Representatives in 1995, a well-organized opposition to government-subsidized family planning has developed. The House leadership has launched attacks to defund and abolish Title X, the core domestic family planning program, and the US Agency for International Development's (USAID) population assistance program. Although these attempts failed, a parallel strategy is being pursued to raise anxieties about the programs and chip away at members' support for them. Family planning supporters in Congress and the White House are on the defensive. Rather than fighting for funding increases and new program initiatives, family planning advocates have been forced to try to just hold their ground. Even though they rest intact, Title X and USAID funding has suffered and the programs' base of congressional support has been seriously compromised. With the current Republican domination of the House, Title X and USAID face an uncertain future.

Dynamics of a Successful Planned Giving Program Utilizing Shared Leadership at Historically Black Colleges and Universities (HBCUs)

ERIC Educational Resources Information Center

Baldwin, Robin Lynn Brunty

2013-01-01

The purpose of this study was to evaluate the dynamics of a successful planned giving program utilizing shared leadership at Historically Black Colleges and Universities (HBCUs). This information will assist the leadership in determining if and how a successful planned giving program can be established for HBCUs. It is possible for planned gifts…

An Economic History of Medicare Part C

PubMed Central

Mcguire, Thomas G; Newhouse, Joseph P; Sinaiko, Anna D

2011-01-01

Context: Twenty-five years ago, private insurance plans were introduced into the Medicare program with the stated dual aims of (1) giving beneficiaries a choice of health insurance plans beyond the fee-for-service Medicare program and (2) transferring to the Medicare program the efficiencies and cost savings achieved by managed care in the private sector. Methods: In this article we review the economic history of Medicare Part C, known today as Medicare Advantage, focusing on the impact of major changes in the program's structure and of plan payment methods on trends in the availability of private plans, plan enrollment, and Medicare spending. Additionally, we compare the experience of Medicare Advantage and of employer-sponsored health insurance with managed care over the same time period. Findings: Beneficiaries' access to private plans has been inconsistent over the program's history, with higher plan payments resulting in greater choice and enrollment and vice versa. But Medicare Advantage generally has cost more than the traditional Medicare program, an overpayment that has increased in recent years. Conclusions: Major changes in Medicare Advantage's payment rules are needed in order to simultaneously encourage the participation of private plans, the provision of high-quality care, and to save Medicare money. PMID:21676024

50 CFR 86.130 - What does the State program plan do?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false What does the State program plan do? 86.130 Section 86.130 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE... GRANT (BIG) PROGRAM How States Will Complete the State Program Plans § 86.130 What does the State...

Homemaker-Home Health Aide Program. A Challenge to Vocational Education. A Modified Competency Based Pilot Training Program.

ERIC Educational Resources Information Center

Holton, Hazel S.

This curriculum guide is designed to be used by vocational educators in planning, developing, coordinating, and implementing homemaker-health aide programs. It is divided into three parts. Covered first are various aspects of program planning, including planning and organization, the role of the adult educator and the adult learner, and…

Strategies for Action: An Outline of Factors Which Influence Decisions on Program Plans.

ERIC Educational Resources Information Center

Bogue, E. G.

This paper discusses strategies which can help the admissions officer/registrar be more effective in having his program plans transformed into reality. The program planning process is considered from three prospectives beginning with a brief discussion of the current state of program development in higher education. It is conjectured that the…

Think Warm Thoughts: Plan Ahead for Summertime Information Literacy Programs! The College Connection

ERIC Educational Resources Information Center

Kasowitz-Scheer, Abby

2009-01-01

It's winter! While it is frosty outside, one can at least think warm thoughts by starting now to plan ahead for summer information literacy programs. This article is designed to provide some ideas for planning next summer's reading, sleuthing, and research programs. It features a variety of programs organized by academic librarians this past…

Theory and models for planning and evaluating institutional influenza prevention and control programs.

PubMed

Russell, Margaret L; Thurston, Wilfreda E; Henderson, Elizabeth A

2003-10-01

Low rates of staff influenza vaccine coverage occur in many health care facilities. Many programs do not offer vaccination to physicians or to volunteers, and some programs do not measure coverage or do so only for a subset of staff. The use of theory in planning and evaluation may prevent these problems and lead to more effective programs. We discuss the use of theory in the planning and evaluation of health programs and demonstrate how it can be used for the evaluation and planning of a hospital or nursing home influenza control program. The application of theory required explicit statement of the goals of the program and examination of the assumptions underlying potential program activities. This indicated that staff should probably be considered as employees, volunteers, physicians, and contractors of the facility. It also directed attention to evidence-based strategies for increasing vaccination rates. The application of a program planning model to a problem of institutional influenza prevention may prevent planners from excluding important target populations and failing to monitor the important indicators of program success.

76 FR 19683 - Conservation Program Recipient Reporting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-08

... regulation that has application or plan due dates after October 1, 2010. The Watershed Operations and Flood Prevention Program, Emergency Watersheds Protection Program, Healthy Forests Reserve Program, Agricultural Management Assistance Program, and the Conservation Stewardship Program have application or plan due dates...

Metrication report to the Congress

NASA Technical Reports Server (NTRS)

1991-01-01

NASA's principal metrication accomplishments for FY 1990 were establishment of metrication policy for major programs, development of an implementing instruction for overall metric policy and initiation of metrication planning for the major program offices. In FY 1991, development of an overall NASA plan and individual program office plans will be completed, requirement assessments will be performed for all support areas, and detailed assessment and transition planning will be undertaken at the institutional level. Metric feasibility decisions on a number of major programs are expected over the next 18 months.

20 CFR 632.17 - Planning process.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Planning process. 632.17 Section 632.17... EMPLOYMENT AND TRAINING PROGRAMS Program Planning, Application and Modification Procedures § 632.17 Planning process. (a) Each Native American grantee shall establish a planning process for the development of its...

Ernest Orlando Lawrence Berkeley National Laboratory institutional plan, FY 1996--2001

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-11-01

The FY 1996--2001 Institutional Plan provides an overview of the Ernest Orlando Lawrence Berkeley National Laboratory mission, strategic plan, core business areas, critical success factors, and the resource requirements to fulfill its mission in support of national needs in fundamental science and technology, energy resources, and environmental quality. The Laboratory Strategic Plan section identifies long-range conditions that will influence the Laboratory, as well as potential research trends and management implications. The Core Business Areas section identifies those initiatives that are potential new research programs representing major long-term opportunities for the Laboratory, and the resources required for their implementation. It alsomore » summarizes current programs and potential changes in research program activity, science and technology partnerships, and university and science education. The Critical Success Factors section reviews human resources; work force diversity; environment, safety, and health programs; management practices; site and facility needs; and communications and trust. The Resource Projections are estimates of required budgetary authority for the Laboratory`s ongoing research programs. The Institutional Plan is a management report for integration with the Department of Energy`s strategic planning activities, developed through an annual planning process. The plan identifies technical and administrative directions in the context of the national energy policy and research needs and the Department of Energy`s program planning initiatives. Preparation of the plan is coordinated by the Office of Planning and Communications from information contributed by the Laboratory`s scientific and support divisions.« less

COMPENSATORY EDUCATION PROGRAM. NEWSLETTER.

ERIC Educational Resources Information Center

Fresno City Unified School District, CA.

TWO NEWSLETTERS FROM THE COMPENSATORY EDUCATION PROGRAM IN FRESNO INCLUDED PLANS FOR THE PLANNING GRANT PROGRAM, THE BASIC PROGRAM, AND THE INTENSIVE PROGRAM. THE BASIC PROGRAM SHOULD REDUCE PUPIL-TEACHER RATIO, PROVIDE PRESCHOOL PROJECTS THROUGH THE USE OF EITHER SCHOOL FACILITIES OR PRIVATE FACILITIES, PROVIDE REMEDIAL AND CORRECTIVE PROGRAMS IN…

Developing Your Evaluation Plans: A Critical Component of Public Health Program Infrastructure.

PubMed

Lavinghouze, S Rene; Snyder, Kimberly

A program's infrastructure is often cited as critical to public health success. The Component Model of Infrastructure (CMI) identifies evaluation as essential under the core component of engaged data. An evaluation plan is a written document that describes how to monitor and evaluate a program, as well as how to use evaluation results for program improvement and decision making. The evaluation plan clarifies how to describe what the program did, how it worked, and why outcomes matter. We use the Centers for Disease Control and Prevention's (CDC) "Framework for Program Evaluation in Public Health" as a guide for developing an evaluation plan. Just as using a roadmap facilitates progress on a long journey, a well-written evaluation plan can clarify the direction your evaluation takes and facilitate achievement of the evaluation's objectives.

42 CFR 422.4 - Types of MA plans.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 3 2011-10-01 2011-10-01 false Types of MA plans. 422.4 Section 422.4 Public...) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM General Provisions § 422.4 Types of MA plans. (a) General rule. An MA plan may be a coordinated care plan, a combination of an MA MSA plan and a contribution into an...

42 CFR 422.4 - Types of MA plans.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 3 2013-10-01 2013-10-01 false Types of MA plans. 422.4 Section 422.4 Public...) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM General Provisions § 422.4 Types of MA plans. (a) General rule. An MA plan may be a coordinated care plan, a combination of an MA MSA plan and a...

42 CFR 422.4 - Types of MA plans.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 3 2014-10-01 2014-10-01 false Types of MA plans. 422.4 Section 422.4 Public...) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM General Provisions § 422.4 Types of MA plans. (a) General rule. An MA plan may be a coordinated care plan, a combination of an MA MSA plan and a...

42 CFR 422.4 - Types of MA plans.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 3 2012-10-01 2012-10-01 false Types of MA plans. 422.4 Section 422.4 Public...) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM General Provisions § 422.4 Types of MA plans. (a) General rule. An MA plan may be a coordinated care plan, a combination of an MA MSA plan and a...

49 CFR 659.25 - Annual review of system safety program plan and system security plan.

Code of Federal Regulations, 2010 CFR

2010-10-01

... system security plan. 659.25 Section 659.25 Transportation Other Regulations Relating to Transportation... and system security plan. (a) The oversight agency shall require the rail transit agency to conduct an annual review of its system safety program plan and system security plan. (b) In the event the rail...

Space Station Freedom operations planning

NASA Technical Reports Server (NTRS)

Accola, Anne L.; Keith, Bryant

1989-01-01

The Space Station Freedom program is developing an operations planning structure which assigns responsibility for planning activities to three tiers of management. The strategic level develops the policy, goals and requirements for the program over a five-year horizon. Planning at the tactical level emphasizes program integration and planning for a two-year horizon. The tactical planning process, architecture, and products have been documented and discussed with the international partners. Tactical planning includes the assignment of user and system hardware as well as significant operational events to a time increment (the period of time from the arrival of one Shuttle to the manned base to the arrival of the next). Execution-level planning emphasizes implementation, and each organization produces detailed plans, by increment, that are specific to its function.

45 CFR 74.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-10-01

... ADMINISTRATIVE REQUIREMENTS FOR AWARDS AND SUBAWARDS TO INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, OTHER NONPROFIT ORGANIZATIONS, AND COMMERCIAL ORGANIZATIONS Post-Award Requirements Financial and Program Management § 74.25 Revision of budget and program plans. (a) The budget plan is the financial expression of...

40 CFR 30.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-07-01

... FEDERAL ASSISTANCE UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Financial and Program Management § 30.25 Revision of budget and program plans. (a) The budget plan is the financial...

7 CFR 22.304 - Multiyear planning and programming.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 1 2012-01-01 2012-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...

7 CFR 22.304 - Multiyear planning and programming.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 1 2014-01-01 2014-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...

7 CFR 22.304 - Multiyear planning and programming.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 1 2013-01-01 2013-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...

Mathematics: Program Assessment and Improvement Planning Manual.

ERIC Educational Resources Information Center

Whitman, Nancy C.; And Others

This document provides a model for assessing a school's mathematics program and planning for program improvement. A systematic process for instructional improvement focuses upon students' needs and the identification of successful instructional strategies to meet these needs. The improvement plan and the implementation of intervention strategies…

7 CFR 22.304 - Multiyear planning and programming.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 1 2010-01-01 2010-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...

Instructional Program Planning for Outdoor Education.

ERIC Educational Resources Information Center

Garbutt, Barbara; And Others

A guide on instructional program planning for outdoor education, prepared for Oakland County (Michigan) teachers, contains suggestions for program planning and lists information sources on suitable outdoor activities. The purpose of outdoor education is defined as being: "to enrich, vitalize and complement content areas of the school…

7 CFR 22.304 - Multiyear planning and programming.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 1 2011-01-01 2011-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...

42 CFR 457.50 - State plan.

Code of Federal Regulations, 2010 CFR

2010-10-01

... CHILDREN'S HEALTH INSURANCE PROGRAMS (SCHIPs) ALLOTMENTS AND GRANTS TO STATES Introduction; State Plans for Child Health Insurance Programs and Outreach Strategies § 457.50 State plan. The State plan is a... 42 Public Health 4 2010-10-01 2010-10-01 false State plan. 457.50 Section 457.50 Public Health...

5 CFR 720.304 - Agency plan.

Code of Federal Regulations, 2012 CFR

2012-01-01

...) AFFIRMATIVE EMPLOYMENT PROGRAMS Disabled Veterans Affirmative Action Program § 720.304 Agency plan. (a) Plan... advancement of disabled veterans. (1) Each agency must review its plan on an annual basis, together with its... advancement of disabled veterans. OPM must be informed when headquarters offices require plans at the field or...

42 CFR 495.336 - Health information technology planning advance planning document requirements (HIT PAPD).

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 5 2011-10-01 2011-10-01 false Health information technology planning advance... STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to the Medicaid Program § 495.336 Health information technology planning advance planning document requirements...

42 CFR 495.336 - Health information technology planning advance planning document requirements (HIT PAPD).

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 5 2013-10-01 2013-10-01 false Health information technology planning advance... STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to the Medicaid Program § 495.336 Health information technology planning advance planning document requirements...

42 CFR 495.336 - Health information technology planning advance planning document requirements (HIT PAPD).

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 5 2012-10-01 2012-10-01 false Health information technology planning advance... STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to the Medicaid Program § 495.336 Health information technology planning advance planning document requirements...

42 CFR 495.336 - Health information technology planning advance planning document requirements (HIT PAPD).

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 5 2014-10-01 2014-10-01 false Health information technology planning advance... STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to the Medicaid Program § 495.336 Health information technology planning advance planning document requirements...

7 CFR 633.9 - Conservation plan.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 6 2010-01-01 2010-01-01 false Conservation plan. 633.9 Section 633.9 Agriculture... AGRICULTURE LONG TERM CONTRACTING WATER BANK PROGRAM § 633.9 Conservation plan. (a) The program participant... conservation plan for the acreage designated under an agreement. (b) The conservation plan is the basis for the...

Planning for Impact: A Guide to Planning Effective Family Program.

ERIC Educational Resources Information Center

Hardy, James M.

A document intended to provide program planning guidelines for Young Men's Christian Associations (YMCAs) desirous of working with families, recommends adherence to eight principles and following of five steps. The principles involve planning before action, fact finding and analysis, clear delineation of operational objectives, planning at all…

42 CFR 495.336 - Health information technology planning advance planning document requirements (HIT PAPD).

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Health information technology planning advance... STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to the Medicaid Program § 495.336 Health information technology planning advance planning document requirements...

Space tug point design study. Volume 4: Program requirements

NASA Technical Reports Server (NTRS)

1973-01-01

A study was conducted to determine the configuration of a space tug and to predict the performance parameters. The program plans and planning data generated in support of the tug development program are presented. The preliminary plans and supporting planning data emphasize the following requirements: (1) maintenance and refurbishment, (2) technology development, (3) production, (4) test facilities, (5) quality control, and (6) scheduling.

Preparation of the Program Objectives Memorandum: A Selective Examination of Procedures in the Department of the Navy.

DTIC Science & Technology

1986-06-01

THE NAVY DEPARTMENT: AN OVERVIEW OF THE PROCESS ---------------------- 21 A. THE DOD CONTEXT ------------------------------ 23 1. The Planning ...Process in Summary ----------- 74 a. Program Planning (August-January) ------------ 74 b. Programming (January-April) ---------------- 77 c. Final POM...Input--------------------------------126 7. Department of the Navy Consolidated Planning and Programming Guidance -------------- 130 8. Defense Guidance

VOC-PLAN: Individual Vocational Education Plan (A Quick, Efficient and Creative Way to Generate Vocational I.E.P.s), Users Manual and Preview Manual.

ERIC Educational Resources Information Center

Robinson, Jim; Seabolt, Pete

This User's Manual is intended to accompany VOC-PLAN, a computer (Apple) program designed to assist in the preparation of an Individualized Vocational Education Program (IVEP) for handicapped, disadvantaged, or regular vocational secondary and postsecondary students. The program is presented in standard IEP (Individualized Education Program)…

Evaluation of the ADOT small area transportation studies and planning assistance for rural areas programs.

DOT National Transportation Integrated Search

2014-03-01

The Planning Assistance for Rural Areas (PARA) program, sponsored by the Arizona Department of Transportations : (ADOT) Multimodal Planning Division (MPD), dedicates funding and staff to conduct multimodal transportation planning : studies for loc...

UPWP Unified Planning Work Program

DOT National Transportation Integrated Search

1995-05-01

The Unified Plannrng Work Program (UPWP) iS the planning document that guides the MPO staff in fulfilling its planning responstbilities for the upcoming year. Comprised of tasks that can be changed as the planning needs change. It is intended to serv...

Momentum: "Developing Masterful Marketing Plans."

ERIC Educational Resources Information Center

Meservey, Lynne D.

1988-01-01

Describes how directors can plan and develop a written marketing plan which can increase enrollment at child care centers. Components of successful marketing plans include parent retention; program merchandising; staff and director training; sales promotions; networking; and enrichment programs/fundraising. (NH)

Lunar-Ultraviolet Telescope Experiment (LUTE) integrated program plan

NASA Technical Reports Server (NTRS)

Smith, Janice F. (Compiler); Forrest, Larry

1993-01-01

A detailed Lunar Ultraviolet Telescope Experiment (LUTE) program plan representing major decisions and tasks leading to those decisions for program execution are presented. The purpose of this task was to develop an integrated plan of project activities for the LUTE project, and to display the plan as an integrated network that shows the project activities, all critical interfaces, and schedules. The integrated network will provide the project manager with a frame work for strategic planning and risk management throughout the life of the project.

NASA Year 2000 (Y2K) Program Plan

NASA Technical Reports Server (NTRS)

1998-01-01

NASA initiated the Year 2000 (Y2K) program in August 1996 to address the challenges imposed on Agency software, hardware, and firmware systems by the new millennium. The Agency program is centrally managed by the NASA Chief Information Officer, with decentralized execution of program requirements at each of the nine NASA Centers, Headquarters and the Jet Propulsion Laboratory. The purpose of this Program Plan is to establish Program objectives and performance goals; identify Program requirements; describe the management structure; and detail Program resources, schedules, and controls. Project plans are established for each NASA Center, Headquarters, and the Jet Propulsion Laboratory.

78 FR 25760 - Proposed Information Collection; Urban Park and Recreation Recovery Program Grants

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-02

...--renovate or redesign existing close-to- home recreation facilities. Innovation--specific activities that... existing programs. Planning--development of a Recovery Action Program plan. The information collection... recreation system goals. Citizen involvement in the development of the Action Plan is required and may...

38 CFR 49.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (CONTINUED) UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Financial and Program Management § 49.25 Revision of budget and program plans. (a) The budget plan is the financial expression of...

A Capital Assets Preservation Program.

ERIC Educational Resources Information Center

Heiman, Ralph

1989-01-01

New York State officials have created an efficient capital planning system that is a prescribed set of procedures and actions within a program planning manual and two software modules. The program is a series of logical steps that school districts must take to successfully implement their preservation plans. (MLF)

An Aid for Planning Programs in Career Education.

ERIC Educational Resources Information Center

Illinois State Board of Vocational Education and Rehabilitation, Springfield. Div. of Vocational and Technical Education.

Offered as an aid for developing sequential occupational education programs, the publication presents a concept in career education planning beginning with kindergarten and continuing through adult years. Career education goals are defined, and steps in planning sequential programs are outlined as follows: (1) organization of the occupational…

49 CFR 266.3 - Rail Service Assistance Program.

Code of Federal Regulations, 2010 CFR

2010-10-01

... construction assistance; (6) Planning assistance; and (7) Program operations assistance. (b) Special limitations on planning assistance and program operation assistance. (1) A State is eligible to receive up to $100,000, or 5 percent of its entitlement, whichever is greater, as planning assistance; and (2) A...

Indonesia's family planning program works toward self-sufficiency.

PubMed

Kunii, C

1989-07-01

Started in 1970, the Indonesian Family Planning Program is doing very well. It is coordinated by the National Family Planning Coordinating Board (BKKBN). Many new acceptors are being enrolled daily. Its aim is to reduce to 1971 fertility rate of 50% in 1990. Strategy factors are listed. The following paper, "BKKBN and the Expanding Role of Private Sector Family Planning Services and Commercial Contraceptive Sales in Indonesia," by Dr. Haryono Suyono is introduced. Another article, "A breakthrough in Family Planning Promotional Strategy," by Mr. Sumarsono is also introduced. This article deals with the marketing aspect of Indonesia's family planning program.

Payment policy and the growth of Medicare Advantage.

PubMed

Zarabozo, Carlos; Harrison, Scott

2009-01-01

This paper reviews recent trends in Medicare Advantage, examining program costs, access to plans, enrollment, plan bids, and benchmarks. We find that current policy has favored the growth of particular types of plans. Bid data show that plans are paid, on average, 113 percent of what expenditures would have been under the traditional Medicare program. Although some of the plan payments are used to finance extra benefits for enrollees, paying plans at higher than fee-for-service levels could affect the sustainability of the Medicare program and result in increased costs for all taxpayers and beneficiaries.

Compare and Contrast Program Planning Models

ERIC Educational Resources Information Center

Baskas, Richard S.

2011-01-01

This paper will examine the differences and similarities between two program planning models, Tyler and Caffarella, to reveal their strengths and weaknesses. When adults are involved in training sessions, there are various program planning models that can be used, depending on the goal of the training session. Researchers developed these models…

40 CFR 52.1690 - Small business technical and environmental compliance assistance program.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (CONTINUED) New York § 52.1690 Small business technical and environmental compliance assistance program. On January 11, 1993, the New York State Department of Environmental Conservation submitted a plan for the... Assistance Program for incorporation in the New York state implementation plan. This plan meets the...

40 CFR 52.2732 - Small business technical and environmental compliance assistance program.

Code of Federal Regulations, 2014 CFR

2014-07-01

... (CONTINUED) Puerto Rico § 52.2732 Small business technical and environmental compliance assistance program. On November 16, 1992, the Puerto Rico Environmental Quality Board submitted a plan for the... Assistance Program for incorporation in the Puerto Rico state implementation plan. This plan meets the...

40 CFR 52.2732 - Small business technical and environmental compliance assistance program.

Code of Federal Regulations, 2011 CFR

2011-07-01

... (CONTINUED) Puerto Rico § 52.2732 Small business technical and environmental compliance assistance program. On November 16, 1992, the Puerto Rico Environmental Quality Board submitted a plan for the... Assistance Program for incorporation in the Puerto Rico state implementation plan. This plan meets the...

40 CFR 52.2732 - Small business technical and environmental compliance assistance program.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (CONTINUED) Puerto Rico § 52.2732 Small business technical and environmental compliance assistance program. On November 16, 1992, the Puerto Rico Environmental Quality Board submitted a plan for the... Assistance Program for incorporation in the Puerto Rico state implementation plan. This plan meets the...

78 FR 63464 - William D. Ford Federal Direct Loan Program Repayment Plan Selection Form; Extension of Public...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-24

... DEPARTMENT OF EDUCATION William D. Ford Federal Direct Loan Program Repayment Plan Selection Form; Extension of Public Comment Period; Correction AGENCY: Department of Education. ACTION: Correction notice... entitled, ``William D. Ford Federal Direct Loan Program Repayment Plan Selection Form''. ED is extending...

15 CFR 14.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-01-01

... ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, OTHER NON-PROFIT, AND COMMERCIAL ORGANIZATIONS Post-Award Requirements Financial and Program Management § 14.25 Revision of budget and program plans. (a) The budget plan is the financial expression of the project or...

22 CFR 145.25 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Section 145.25 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Financial and Program Management § 145.25 Revision of budget and program plans. (a) The budget plan is the...

A Descriptive and Evaluative Analysis of Program Planning Literature, 1950-1983.

ERIC Educational Resources Information Center

Sork, Thomas J.; Buskey, John H.

1986-01-01

Literature that presents a complete program planning model was described and analyzed using explicitly defined and uniformly applied descriptive and evaluative dimensions. Several observations about the current state of the program planning literature are made, and recommendations designed to strengthen the literature are offered. (Author/CT)

Pre- and Post-Planned Evaluation: Which Is Preferable?

ERIC Educational Resources Information Center

Strasser, Stephen; Deniston, O. Lynn

1978-01-01

Factors involved in pre-planned and post-planned evaluation of program effectiveness are compared: (1) reliability and cost of data; (2) internal and external validity; (3) obtrusiveness and threat; (4) goal displacement and program direction. A model to help program administrators decide which approach is more appropriate is presented. (Author/MH)

FIREFAMILY: Fire planning with historic weather data.

Treesearch

William A. Main; Robert J. Straub; Donna M. Paananen

1982-01-01

This user's guide will help fire managers interpret the output from FIREFAMILY, a computer program that uses historic weather data for fire planning. The guide describes options within the program and explains various tables and graphs necessary for planning. It also provides details which computer specialists need to run the program.

OCCUPATIONAL EDUCATION--PLANNING AND PROGRAMMING. VOLUME TWO.

ERIC Educational Resources Information Center

KOTZ, ARNOLD

ADDITIONAL POSITION PAPERS BASED ON INFORMATION GATHERED IN THE RECONNAISSANCE SURVEYS OF PLANNING AND PROGRAMING IN OCCUPATIONAL EDUCATION, REPORTED IN VOLUME ONE (VT 005 041), ARE PRESENTED. PART IV, CONCERNED WITH PROGRAM STRUCTURE AND BUDGETING AND THEIR RELATION TO THE PLANNING PROCESS, INCLUDES THE PAPERS--(1) "CURRENT POLICIES AND…

10 CFR 600.315 - Revision of budget and program plans.

Code of Federal Regulations, 2010 CFR

2010-01-01

....315 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS FINANCIAL ASSISTANCE RULES... Requirements § 600.315 Revision of budget and program plans. (a) The budget plan is the financial expression of the project or program as approved during the award process. It includes the sum of the Federal and...

7 CFR 225.5 - Payments to State agencies and use of Program funds.

Code of Federal Regulations, 2010 CFR

2010-01-01

... the State Program management and administration plan and any other information available to FNS. If a... Program management and administration plan. (3) Funding assurance. At the time FNS approves the State's management and administration plan, the State shall be assured of receiving State administrative funding...

7 CFR 225.5 - Payments to State agencies and use of Program funds.

Code of Federal Regulations, 2011 CFR

2011-01-01

... the State Program management and administration plan and any other information available to FNS. If a... Program management and administration plan. (3) Funding assurance. At the time FNS approves the State's management and administration plan, the State shall be assured of receiving State administrative funding...

A Comparison of Traditional Worksheet and Linear Programming Methods for Teaching Manure Application Planning.

ERIC Educational Resources Information Center

Schmitt, M. A.; And Others

1994-01-01

Compares traditional manure application planning techniques calculated to meet agronomic nutrient needs on a field-by-field basis with plans developed using computer-assisted linear programming optimization methods. Linear programming provided the most economical and environmentally sound manure application strategy. (Contains 15 references.) (MDH)

7 CFR 1219.50 - Budgets, programs, plans, and projects.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Budgets, programs, plans, and projects. 1219.50... Order Budgets, Expenses, and Assessments § 1219.50 Budgets, programs, plans, and projects. (a) The Board shall submit to the Secretary, on a fiscal period basis, annual budgets of its anticipated expenses and...

Strategic Plan. Volume 2

NASA Technical Reports Server (NTRS)

2002-01-01

The Mission of the NSBRI will be to lead a National effort for accomplishing the integrated, critical path, biomedical research necessary to support the long term human presence, development, and exploration of space and to enhance life on Earth by applying the resultant advances in human knowledge and technology acquired through living and working in space. To carry out this mission, the NSBRI focuses its activities on three Strategic Programs: Strategic Program 1: Countermeasure Research Strategic Program 2: Education, Training and Outreach Strategic Program 3: Cooperative Research and Development. This document contains the detailed Team Strategic Plans for the 11 research teams focused on Strategic Program 1, and the Education and Outreach Team focused on Strategic Program 2. There is overlap and integration among the Programs and Team Strategic Plans, as described in each of the Plans.

42 CFR 457.65 - Effective date and duration of State plans and plan amendments.

Code of Federal Regulations, 2010 CFR

2010-10-01

... HEALTH AND HUMAN SERVICES (CONTINUED) STATE CHILDREN'S HEALTH INSURANCE PROGRAMS (SCHIPs) ALLOTMENTS AND GRANTS TO STATES Introduction; State Plans for Child Health Insurance Programs and Outreach Strategies... 42 Public Health 4 2010-10-01 2010-10-01 false Effective date and duration of State plans and plan...

7 CFR 23.13 - Plan of Work.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 1 2011-01-01 2011-01-01 false Plan of Work. 23.13 Section 23.13 Agriculture Office of the Secretary of Agriculture STATE AND REGIONAL ANNUAL PLANS OF WORK Regional Program § 23.13 Plan of Work. (a) A Regional Plan of Work for carrying out the programs authorized to be funded under...

Development of an Operational Model for the Application of Planning-Programming-Budgeting Systems in Local School Districts. Program Budgeting Note 1, Introduction to Program Budgeting.

ERIC Educational Resources Information Center

State Univ. of New York, Buffalo. Western New York School Study Council.

Although the public is best served by governmental agencies which have integrated the major functions of planning, managing, and budgeting, it can be asserted that the planning function is paramount. A review of the evolution of public agency administration in the U.S. reveals that until recent years the planning function has been largely…

The Lincoln Parish Family Planning Program and Its Implications for Reducing Reproductive Wastage in the Rural Poor.

ERIC Educational Resources Information Center

Beasley, Joseph D.; And Others

The Lincoln Parish Family Planning Program, a 1968 pilot study designed in cooperation with the Louisiana State Board of Health, is described. The major purpose of the program was to design a program of medical care for the rural poor which would provide mothers in Lincoln Parish with information and services needed to plan family size. Sections…

Results from a national survey on chronic care management by health plans.

PubMed

Mattke, Soeren; Higgins, Aparna; Brook, Robert

2015-05-01

The growing burden of chronic disease necessitates innovative approaches to help patients and to ensure the sustainability of our healthcare system. Health plans have introduced chronic care management models, but systematic data on the type and prevalence of different approaches are lacking. Our goal was to conduct a systematic examination of chronic care management programs offered by health plans in the commercial market (ie, in products sold to employers and individuals. We undertook a national survey of a representative sample of health plans (70 plans, 36% response rate) and 6 case studies on health plans' programs to improve chronic care in the commercial market. The data underwent descriptive and bivariate analyses. All plans, regardless of size, location, and ownership, offer chronic care management programs, which identify eligible members from claims data and match them to interventions based on overall risk and specific care gaps. Plans then report information on care gaps to providers and offer self-management support to their members. While internal evaluations suggest that the interventions improve care and reduce cost, plans report difficulties in engaging members and providers. To overcome those obstacles, plans are integrating their programs into provider work flow, collaborating with providers on care redesign and leveraging patient support technologies. Our study shows that chronic care management programs have become a standard component of the overall approach used by health plans to manage the health of their members.

Strategic Planning for Collegiate Athletics.

ERIC Educational Resources Information Center

Yow, Deborah A.; Migliore, R. Henry; Bowden, William W.; Stevens, Robert E.; Loudon, David L.

This book presents strategies for planning and managing athletic programs. It helps college athletic administrators analyze their organization's environment, set objectives, decide on specific actions, and obtain feedback. Chapter 1, "Perspectives on Planning for Athletics Programs," discusses what planning is and why it is important.…

25 CFR 170.402 - What is the tribal role in transportation planning?

Code of Federal Regulations, 2010 CFR

2010-04-01

... RESERVATION ROADS PROGRAM Planning, Design, and Construction of Indian Reservation Roads Program Facilities... transportation related meetings; (9) Performing transportation planning for operational and maintenance...

25 CFR 170.401 - What is BIA's role in transportation planning?

Code of Federal Regulations, 2010 CFR

2010-04-01

... RESERVATION ROADS PROGRAM Planning, Design, and Construction of Indian Reservation Roads Program Facilities... maintenance facilities; and (p) Researching rights-of-way documents for project planning. ...

Techniques for overcoming community resistance to family planning programs.

PubMed

Palley, H A

1968-01-01

Methods of overcoming resistance to publicly subsidized family planning programs are discussed. The main sources of opposition include groups that oppose family planning for moral reasons, and those who object to the spending of government funds to provide services and information. Such opposition can be weakened by indicating that family planning clinics fulf: 11 important medical needs. Presenting social justification for family planning can help to lower oppostion. In order to secure participation in the programs by low income groups it is essential to have community leaders involved in policy decisions and to use indigenous community paraprofessionals in the clinics. A coalition of representatives of the poor community and the health and welfare system, aided by the community organization, can lead to an effective family planning program.

Large Eddy Simulation of Engineering Flows: A Bill Reynolds Legacy.

NASA Astrophysics Data System (ADS)

Moin, Parviz

2004-11-01

The term, Large eddy simulation, LES, was coined by Bill Reynolds, thirty years ago when he and his colleagues pioneered the introduction of LES in the engineering community. Bill's legacy in LES features his insistence on having a proper mathematical definition of the large scale field independent of the numerical method used, and his vision for using numerical simulation output as data for research in turbulence physics and modeling, just as one would think of using experimental data. However, as an engineer, Bill was pre-dominantly interested in the predictive capability of computational fluid dynamics and in particular LES. In this talk I will present the state of the art in large eddy simulation of complex engineering flows. Most of this technology has been developed in the Department of Energy's ASCI Program at Stanford which was led by Bill in the last years of his distinguished career. At the core of this technology is a fully implicit non-dissipative LES code which uses unstructured grids with arbitrary elements. A hybrid Eulerian/ Largangian approach is used for multi-phase flows, and chemical reactions are introduced through dynamic equations for mixture fraction and reaction progress variable in conjunction with flamelet tables. The predictive capability of LES is demonstrated in several validation studies in flows with complex physics and complex geometry including flow in the combustor of a modern aircraft engine. LES in such a complex application is only possible through efficient utilization of modern parallel super-computers which was recognized and emphasized by Bill from the beginning. The presentation will include a brief mention of computer science efforts for efficient implementation of LES.

Focus on training at CAFS.

PubMed

Azorbo, S; Muna, C

1993-01-01

The training and technical assistance programs of the Center for African Family Studies (CAFS), which is part of the International Planned Parenthood Federation for the African Region, were described. Programs included service delivery, management development, family life education, family planning communication, and research monitoring and evaluation. Several courses were offered: a week-long contraceptive technology update course for trainers and supervisors of family planning programs. Management training needs were filled through a 6-week middle level management course, a 2-week senior level management course, a 4-week community based family planning program course, a 6-week financial management of family planning and reproductive health programs course, and a 5-week course in leadership skills for management of women and health programs. Family life education courses were offered under the CAFS Women and Health Program for teachers, curriculum developers, youth leaders, and those working with young people for 3 weeks. Course issues of discussion included population and development, the family in contemporary African life, and policy legislation and laws to promote young people's health and social psychological and ethical aspects of adolescent sexuality. Family planning communication training programs were directed to strengthening IEC knowledge and skills over a 4-week period for senior and middle level personnel. The 3-week press course aimed to train journalists in print and electronic media for French-speaking countries who could gain cover population and family planning issues. The family planning research and evaluation course over 4 weeks aimed to increase the knowledge and skills of health personnel in project design, implementation, monitoring, and evaluation, in order to conduct assessment of program effectiveness. The course was directed to senior and middle level manager researchers, population project directors, and personnel of women-centered projects.

[Thinking about several problems of the research of our family planning strategy].

PubMed

Shi, H

1989-03-01

On the basis of 1982 census data, it is estimated that from 1987-1997 13 million women will enter the age of marriage and child-bearing each year. The tasks of keeping the population size around 1.2 billion by the year 2000 is arduous. Great efforts have to be made to continue encouraging one child/couple, and to pursue the current plans and policies and maintain strict control over fertility. Keeping population growth in pace with economic growth, environment, ecological balance, availability of per capita resources, education programs, employment capability, health services, maternal and child care, social welfare and social security should be a component of the long term development strategy of the country. Family planning is a comprehensive program which involves long cycles and complicated factors, viewpoints of expediency in guiding policy and program formulation for short term benefits are inappropriate. The emphasis of family planning program strategy should be placed on the rural areas where the majority of population reside. Specifically, the major aspects of strategic thrusts should be the linkage between policy implementation and reception, between family planning publicity and changes of ideation on fertility; the integrated urban and rural program management relating to migration and differentiation of policy towards minority population and areas in different economic development stages. In order to achieve the above strategies, several measures are proposed. (1) strengthening family planning program and organization structure; (2) providing information on population and contraception; (3) establishing family planning program network for infiltration effects; (4) using government financing, taxation, loan, social welfare and penalty to regulate fertility motivations; (5) improving the system of target allocation and data reporting to facilitate program implementation; (6) strengthening population projection and policy research; (7) and strengthening training of family planning personnel to improve program efficiency.

Ames Research Center FY 2000 Implementation Plan: Leading Technology into the New Millennium

NASA Technical Reports Server (NTRS)

2000-01-01

This document presents the implementation plan for Ames Research Center (ARC) within the overall framework of the NASA Strategic Plan. It describes how ARC intends to implement its Center of Excellence responsibilities, Agency assigned missions, Agency and Enterprise lead programs, and other roles in support of NASA's vision and mission. All Federal agencies are required by the 1993 Government Performance and Results Act to implement a long-term strategic planning process that includes measurable outcomes and strict accountability. At NASA, this planning process is shaped by the Space Act of 1958, annual appropriations, and other external mandates, as well as by customer requirements. The resulting Strategic Plan sets the overall architecture for what we do, identifies who our customers are, and directs where we are going and why. The Strategic Plan is the basis upon which decisions regarding program implementation and resource deployment are made. Whereas the strategic planning process examines the long-term direction of the organization and identifies a specific set of goals, the implementation planning process examines the detailed performance of the organization and allocates resources toward meeting these goals. It is the purpose of this implementation document to provide the connection between the NASA Strategic Plan and the specific programs and support functions that ARC employees perform. This connection flows from the NASA Strategic Plan, through the various Strategic Enterprise plans to the ARC Center of Excellence, primary missions, Lead Center programs, program support responsibilities, and ultimately, to the role of the individual ARC employee.

The need for coherence between waterfowl harvest and habitat management

USGS Publications Warehouse

Runge, M.C.; Johnson, F.A.; Anderson, M.G.; Koneff, M.D.; Reed, E.T.; Mott, S.E.

2006-01-01

Two of the most significant management efforts affecting waterfowl populations in North America are the North American Waterfowl Management Plan (the Plan) and Federal harvest management programs. Both the Plan and harvest management are continental in scope, involve an extensive group of stakeholders, and rely on adaptive processes of biological planning, implementation, and evaluation. The development of these programs has occurred independently, however, and there has been little explicit recognition that both harvest and habitat effects should be considered for coherent management planning and evaluation. For example, the harvest strategy can affect whether population objectives of the Plan are met, irrespective of the success of the Plan's habitat conservation efforts. Conversely, habitat conservation activities under the Plan can influence harvest potential and, therefore, the amount of hunting opportunity provided. It seems increasingly clear that the Plan's waterfowl population objectives can only be useful for conservation planning and evaluation if they are accompanied by an explicit specification of the harvest strategy and environmental conditions under which they are to be achieved. This clarification also is necessary to ensure that Plan population objectives are not attained solely through the reduction of hunting opportunity. We believe then that it is imperative that these key waterfowl-management programs work to harmonize their objectives. Harvest management programs and the Plan ought to be working toward the same ends, but that is not possible so long as the mutually reinforcing relationship of these programs is obscured by ambiguities in their management objectives.

Strategic planning: the first step in the planning process.

PubMed

Gelinas, Marc A

2003-01-01

Strategic planning is a systematic process through which an organization builds commitment among key stakeholders to goals and priorities which are essential to its mission and vision, and responsive to the operating environment. Strategic planning is the first step in a comprehensive planning process that also includes business planning and implementation planning. If all three steps are carried out in sequence, strategic planning can be a very effective means of educating the stakeholders about where the cancer program is and where it is going, gaining support and commitment for the direction that the cancer program will take, and assuring that everyone's expectations can be managed effectively. Unfortunately, some organizations and cancer program leaders misunderstand the process. Too often, strategic planning is used as a stand-alone activity. This article will describe what strategic planning is, how it should smoothly lead into business planning and implementation planning, and how to avoid the pitfalls that sometimes arise during the strategic planning effort.

The components of action planning and their associations with behavior and health outcomes.

PubMed

Lorig, Kate; Laurent, Diana D; Plant, Kathryn; Krishnan, Eswar; Ritter, Philip L

2014-03-01

Based on the works of Kiesler and Bandura, action plans have become important tools in patient self-management programs. One such program, shown effective in randomized trials, is the Internet Chronic Disease Self-Management Program. An implementation of this program, Healthy Living Canada, included detailed information on action plans and health-related outcome measures. Action plans were coded by type, and associations between action plans, confidence in completion and completion were examined. Numbers of Action Plans attempted and competed and completion rates were calculated for participants and compared to six-month changes in outcomes using regression models. Five of seven outcome measures significantly improved at six-months. A total of 1136 action plans were posted by 254 participants in 12 workshops (mean 3.9 out of 5 possible); 59% of action plans involved exercise, 16% food, and 14% role management. Confidence of completion was associated with completion. Action plan completion measures were associated with improvements in activity limitation, aerobic exercise, and self-efficacy. Baseline self-efficacy was associated with at least partial completion of action plans. Action planning appears to be an important component of self-management interventions, with successful completion associated with improved health and self-efficacy outcomes.

Guidance system operations plan for manned CM earth orbital missions using program SKYLARK 1. Section 4: Operational modes

NASA Technical Reports Server (NTRS)

Dunbar, J. C.

1972-01-01

The operational modes for the guidance system operations plan for Program SKYLARK 1 are presented. The procedures control the guidance and navigation system interfaces with the flight crew and the mission control center. The guidance operational concept is designed to comprise a set of manually initiated programs and functions which may be arranged by the flight crew to implement a large class of flight plans. This concept will permit both a late flight plan definition and a capability for real time flight plan changes.

International Photovoltaic Program Plan. Volume II. Appendices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costello, D.; Koontz, R.; Posner, D.

1979-12-01

This second volume of a two-part report on the International Photovoltaic Program Plan contains appendices summarizing the results of analyses conducted in preparation of the plan. These analyses include compilations of relevant statutes and existing Federal programs; strategies designed to expand the use of photovoltaics abroad; information on the domestic photovoltaic plan and its impact on the proposed international plan; perspectives on foreign competition; industry views on the international photovoltaic market and ideas about how US government actions could affect this market; international financing issues; and information on issues affecting foreign policy and developing countries.

40 CFR 52.1119 - Identification of plan-conditional approval.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Implementation Plan Revision for a Small Business Technical and Environmental Compliance Assistance Program dated... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Identification of plan-conditional... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS (CONTINUED) Massachusetts § 52.1119...

40 CFR 52.1519 - Identification of plan-conditional approval.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Implementation Plan Revision for a Small Business Technical and Environmental compliance Assistance Program dated... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Identification of plan-conditional... PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS (CONTINUED) New Hampshire § 52.1519...

Developing guidelines for incorporating managing demand into WSDOT planning and programming: transportation demand management guidance for corridor planning studies.

DOT National Transportation Integrated Search

2016-02-01

The Washington State Department of Transportation (WSDOT) regional planning programs address current and forecasted deficiencies of State highways through the conduct of corridor studies. This Guidance for the conduct of corridor planning studies is ...

45 CFR 1386.36 - Final disapproval of the State plan or plan amendments.

Code of Federal Regulations, 2010 CFR

2010-10-01

... OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Federal Assistance to State Developmental Disabilities Councils § 1386.36 Final disapproval of the State plan or plan...

Federal Employees Health Benefits Program: Enrollment Options Following the Termination of a Plan or Plan Option. Final rule.

PubMed

2015-10-28

The U.S. Office of Personnel Management (OPM) is issuing a final rule to amend the Federal Employees Health Benefits (FEHB) Program regulations regarding enrollment options following the termination of a plan or plan option.

44 CFR 9.15 - Planning programs affecting land use.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Planning programs affecting..., DEPARTMENT OF HOMELAND SECURITY GENERAL FLOODPLAIN MANAGEMENT AND PROTECTION OF WETLANDS § 9.15 Planning... flood hazards and floodplain management and wetlands protection; and (b) Prescribes planning procedures...

Some factors affecting acceptance of family planning in Manus.

PubMed

Avue, B; Freeman, P

1991-12-01

This paper examines selected factors affecting the acceptance and delivery of modern family planning from health centres in Manus. A survey was carried out of mothers attending Maternal and Child Health clinics and a written questionnaire was given to health workers. The survey of mothers demonstrated the importance of the husband's approval for contraceptive practice and showed that knowledge about traditional methods of family planning is widespread. The health workers' questionnaire demonstrated a high level of dissatisfaction with the current family planning program delivered by health clinics: 45% found the program ineffective; 68% wrote that health workers' attitudes discouraged mothers from attending for family planning. The perceived and actual benefits and costs of children and the role of men should be assessed locally before planning future family planning programs. Widespread retraining and motivating of health workers is essential if improved coverage is to be achieved through health services. The efficacy of alternative methods of delivery of family planning such as local community-based and social marketing programs should also be investigated.

The crucial role of the private sector.

PubMed

Barberis, M; Paxman, J M

1986-12-01

Private support for the development of family planning programs continues to grow and now includes industries that provide family planning services, commercial outlets that distribute contraceptives, community groups that help to build demand, private medical practitioners who include contraception as a part of health care, organizations that provide technical and financial assistance to developing country programs, pharmaceutical firms, and foundations that underwrite contraceptive research. Although the mix of private and public programs differs from country to country, these 2 family planning programs complement each other and often work in close partnership. The private sector has the advantages of being able to pioneer innovative programs the public sector is unwilling or unable to pursue, to bring foreign financial and technical assistance to developing countries without political implications, and to achieve financially self-sustaining family planning efforts that are linked to other development efforts. In many countries, the private sector has been instrumental in developing a national family planning program and in eliminating barriers to family planning in countries with restrictive laws and policies. The private sector has been especially important in pioneering grassroots programs that improve the status of women through education, health care, training, and economic opportunity.

40 CFR 93.101 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded or Approved Under Title 23.... Transportation improvement program (TIP) means a transportation improvement program developed by a metropolitan... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) DETERMINING...

The Galaxy Plan in Industrial Education. [Materials] Developed in The Experienced Teacher Fellowship Program.

ERIC Educational Resources Information Center

McClea, Kenneth R., Ed.; And Others

These materials inform school administrators of the rationale of the Detroit Galaxy Plan and provide procedures for implementing the Plan. This program of occupational education for secondary Grades 7 through 12 is planned for students who intend to enter college, apprenticeships, or employment after high school. The Plan, developed by 24…

7 CFR 23.6 - Plan of Work.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 1 2011-01-01 2011-01-01 false Plan of Work. 23.6 Section 23.6 Agriculture Office of the Secretary of Agriculture STATE AND REGIONAL ANNUAL PLANS OF WORK State Program § 23.6 Plan of Work. (a) A State Annual Plan of Work for carrying out the programs authorized under title V shall be...

7 CFR 23.6 - Plan of Work.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 1 2010-01-01 2010-01-01 false Plan of Work. 23.6 Section 23.6 Agriculture Office of the Secretary of Agriculture STATE AND REGIONAL ANNUAL PLANS OF WORK State Program § 23.6 Plan of Work. (a) A State Annual Plan of Work for carrying out the programs authorized under title V shall be...

6. Monitoring and the Northwest Forest Plan

Treesearch

Leslie M. Reid

1994-01-01

Abstract - Monitoring will ensure that the Northwest Forest Plan is implemented as intended, determine whether the plan is achieving its intended objectives, and provide information needed to improve the plan. The credibility of the Forest Plan rests on the credibility of its monitoring program. If the monitoring program is to succeed, it must focus on well-defined...

76 FR 17159 - Office of New Reactors; Final Interim Staff Guidance on Standard Review Plan, Section 17.4...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-28

... Interim Staff Guidance on Standard Review Plan, Section 17.4, ``Reliability Assurance Program'' AGENCY... design reliability assurance program (RAP). This ISG updates the guidance provided to the staff in Standard Review Plan (SRP), Section 17.4, ``Reliability Assurance Program,'' of NUREG-0800, ``Standard...

Successful Family Planning Programs. Draper World Population Fund Report, No. 4, Summer 1977.

ERIC Educational Resources Information Center

Piotrow, Phyllis T., Ed.

This publication describes successful family planning programs throughout the world. Discussed in detail are programs in Colombia, Mauritius, Maharashtra, the People's Republic of China, Sri Lanka, and the United States. Photographs illustrate the articles and, in some cases, family planning vital statistics are given. The Draper World Population…

Planning Effective Educational Programs for Adult Learners

ERIC Educational Resources Information Center

Shi, Hong

2017-01-01

Educational program planning is a complex ongoing process and planners should reflect on and consider for all of the involved factors, context, and people. The purpose of this study is to analyze how to plan effective educational programs for adult learners. Adult education is a developmental process and interacts with broad social events. Adult…

The Arthropod-Borne Animal Diseases Research Laboratory: Research Program: Update and Current Status

USDA-ARS?s Scientific Manuscript database

The ABADRL has three 5-year project plans under two ARS National Research Programs. One project plan under the Animal Health National Program is entitled “Countermeasures to control and eradicate Rift Valley fever (RVF)”. Research objectives in this plan are 1) to determine the vector competence of ...

25 CFR 170.403 - What IRR Program funds can be used for transportation planning?

Code of Federal Regulations, 2010 CFR

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false What IRR Program funds can be used for transportation planning? 170.403 Section 170.403 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM Planning, Design, and Construction of Indian Reservation Roads...

10 CFR 603.885 - Updated program plans and budgets.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Updated program plans and budgets. 603.885 Section 603.885... program plans and budgets. In addition to reports on progress to date, a TIA may include a provision... effort and a revised budget if there is a significant change from the initial budget. ...

Planning and Equipping School Lunchrooms. Bulletin, 1946, No. 19

ERIC Educational Resources Information Center

US Office of Education, Federal Security Agency, 1946

1946-01-01

In many schools, plans are underway to expand facilities to include necessary space and equipment for providing adequate school lunch programs. This bulletin furnishes basic materials on which school people may plan space and equipment for new school lunch programs or appraise existing programs to determine what improvements in arrangement or…

A Peer-Based Financial Planning & Education Service Program: An Innovative Pedagogic Approach

ERIC Educational Resources Information Center

Goetz, Joseph W.; Durband, Dorothy B.; Halley, Ryan E.; Davis, Kimberlee

2011-01-01

This paper presents a peer-based financial planning and education program as a strategy to address the lack of financial literacy among college students and provide an experiential learning opportunity for students majoring in financial planning or other financial services-related disciplines. Benefits of such programs to campus communities are…

LDRD FY 2014 Program Plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anita Gianotto; Dena Tomchak

As required by DOE Order 413.2B the FY 2014 Program Plan is written to communicate ares of investment and approximate amounts being requested for the upcoming fiscal year. The program plan also includes brief highlights of current or previous LDRD projects that have an opportunity to impact our Nation's current and future energy challenges.

Understanding Program Planning Theory and Practice in a Feminist Community-Based Organization

ERIC Educational Resources Information Center

Bracken, Susan J.

2011-01-01

The purpose of this article is to discuss feminist-program-planning issues, drawing from a critical ethnographic study of a Latin American feminist community-based organization. The research findings discuss the centrality of feminist identity to understanding and analyzing day-to-day program-planning process issues within a feminist…

Laboratory Directed Research and Development Program FY2011

DOE Office of Scientific and Technical Information (OSTI.GOV)

none, none

2012-04-27

Berkeley Lab's research and the Laboratory Directed Research and Development (LDRD) program support DOE's Strategic Themes that are codified in DOE's 2006 Strategic Plan (DOE/CF-0010), with a primary focus on Scientific Discovery and Innovation. For that strategic theme, the Fiscal Year (FY) 2011 LDRD projects support each one of the three goals through multiple strategies described in the plan. In addition, LDRD efforts support the four goals of Energy Security, the two goals of Environmental Responsibility, and Nuclear Security (unclassified fundamental research that supports stockpile safety and nonproliferation programs). Going forward in FY 2012, the LDRD program also supports themore » Goals codified in the new DOE Strategic Plan of May, 2011. The LDRD program also supports Office of Science strategic plans, including the 20-year Scientific Facilities Plan and the Office of Science Strategic Plan. The research also supports the strategic directions periodically under consideration and review by the Office of Science Program Offices, such as LDRD projects germane to new research facility concepts and new fundamental science directions. Brief summares of projects and accomplishments for the period for each division are included.« less

Verrucostoma, a new genus in the bionectriaceae from the Bonin Islands, Japan.

PubMed

Hirooka, Yuuri; Kobayashi, Takao; Ono, Tsuyoshi; Rossman, Amy Y; Chaverri, Priscila

2010-01-01

Verrucostoma freycinetiae gen. et sp. nov. is described and illustrated from specimens on dead leaves of Freycinetia boninensis (Pandanaceae) collected in Hahajima, Bonin (Ogasawara) Islands, Japan. The genus is characterized by pale orange perithecia with protuberances around the perithecial apex, no color change in 3% potassium hydroxide and lactic acid, unitunicate asci, spinulose ascospores and an Acremonium-like anamorph. Morphological characters were compared with other genera in the Bionectriaceae and Nectriaceae (Hypocreales). Verrucostoma is morphologically similar to Bionectria (Bionectriaceae) from which it differs in the formation of conspicuous protuberances around the perithecial apex and the Acremonium-like anamorph. Moreover molecular analyses of Verrucostoma and other members of the Bionectriaceae and Nectriaceae based on alpha-actin, large subunit nuclear ribosomal DNA and RNA polymerase II subunit 1 sequences support the conclusions based on morphological data. Our results confirm that V. freycinetiae is distinct from other genera among the Nectria-like fungi and represents a new genus belonging to the Bionectriaceae.

Identification and differentiation of species and strains of Arthrobacter and Microbacterium barkeri isolated from smear cheeses with Amplified Ribosmal DNA Restriction Analysis (ARDRA) and pulsed field gel electrophoresis (PFGE).

PubMed

Hoppe-Seyler, T S; Jaeger, B; Bockelmann, W; Noordman, W H; Geis, A; Heller, K J

2003-09-01

ARDRA (Amplified Ribosomal-DNA Restriction Analysis) was used to differentiate among species and genera of Arthrobacter and Microbacteria. Species-specific restriction patterns of PCR-products were obtained with NciI for Arthrobacter citreus (DSM 20133T), A. sulfureus (DSM 20167T), A. globiformis (DSM 20124T) and A. nicotianae strains (DSM 20123T, MGE 10D, CA13, CA14, isolate 95293, 95294, and 95299), A. rhombi CCUG 38813T, and CCUG 38812, and Microbacterium barkeri strains (DSM 30123T, MGE 10D, CA12 and CA15, isolate 95292, and isolate 95207). All yellow pigmented coryneforme bacteria isolated from the smear of surface ripened cheeses were identified as either A. nicotianae or M. barkeri strains. Using pulsed field gel electrophoresis (PFGE) strain specific restriction pattern for all Arthrobacter species and Microbacteria tested were obtained with restriction enzymes AscI and SpeI.

Evolutionary Dynamics of Spore Killers

PubMed Central

Nauta, M. J.; Hoekstra, R. F.

1993-01-01

Spore killing in ascomycetes is a special form of segregation distortion. When a strain with the Killer genotype is crossed to a Sensitive type, spore killing is expressed by asci with only half the number of ascospores as usual, all surviving ascospores being of the Killer type. Using population genetic modeling, this paper explores conditions for invasion of Spore killers and for polymorphism of Killers, Sensitives and Resistants (which neither kill, nor get killed), as found in natural populations. The models show that a population with only Killers and Sensitives can never be stable. The invasion of Killers and stable polymorphism only occur if Killers have some additional advantage during the process of spore killing. This may be due to the effects of local sib competition or some kind of ``heterozygous'' advantage in the stage of ascospore formation or in the short diploid stage of the life cycle. This form of segregation distortion appears to be essentially different from other, well-investigated forms, and more field data are needed for a better understanding of spore killing. PMID:8293989

Osteomyelitis caused by Neosartorya pseudofischeri.

PubMed Central

Padhye, A A; Godfrey, J H; Chandler, F W; Peterson, S W

1994-01-01

The first case of osteomyelitis caused by Neosartorya pseudofischeri is reported. The patient, a 77-year-old male with a history of silicosis and tuberculosis, on X-ray examination revealed lytic lesions of L2 and L3 vertebrae suspicious for metastatic lesions. Histologic examination of biopsy specimens from vertebral bodies showed short, distorted, extra- and intracellular, hyaline hyphal fragments. The culture from the biopsy tissue produced numerous, evanescent asci containing eight ellipsoidal ascospores with two distinctive equatorial bands ca. 1 micron wide. When examined by a scanning electron microscope, ascospores exhibited a convex surface ornamented with raised flaps of tissue, in shape resembling triangular projections or long ridge lines. The conidial state (anamorph) was identified as Aspergillus thermomutatus on the basis of conidial columns which were smaller and less tightly packed as well as of a lighter shade of green than those observed in Aspergillus fumigatus. On the basis of the morphologic features of the ascospores, the teleomorph was identified as N. pseudofischeri. Images PMID:7852580

Establishing confidence in complex physics codes: Art or science?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trucano, T.

1997-12-31

The ALEGRA shock wave physics code, currently under development at Sandia National Laboratories and partially supported by the US Advanced Strategic Computing Initiative (ASCI), is generic to a certain class of physics codes: large, multi-application, intended to support a broad user community on the latest generation of massively parallel supercomputer, and in a continual state of formal development. To say that the author has ``confidence`` in the results of ALEGRA is to say something different than that he believes that ALEGRA is ``predictive.`` It is the purpose of this talk to illustrate the distinction between these two concepts. The authormore » elects to perform this task in a somewhat historical manner. He will summarize certain older approaches to code validation. He views these methods as aiming to establish the predictive behavior of the code. These methods are distinguished by their emphasis on local information. He will conclude that these approaches are more art than science.« less

Cloning and expression of two chitin deacetylase genes of Saccharomyces cerevisiae.

PubMed

Mishra, C; Semino, C E; McCreath, K J; de la Vega, H; Jones, B J; Specht, C A; Robbins, P W

1997-03-30

Chitin deacetylase (EC 3.5.1.41), which hydrolyses the N-acetamido groups of N-acetyl-D-glucosamine residues in chitin, has been demonstrated in crude extracts from sporulating Saccharomyces cerevisiae. Two S. cerevisiae open reading frames (ORFs), identified by the Yeast Genome Project, have protein sequence homology to a chitin deacetylase from Mucor rouxii. Northern blot hybridizations show each ORF was transcribed in diploid cells after transfer to sporulation medium and prior to formation of asci. Each ORF was cloned in a vector under transcriptional control of the GAL 1, 10 promoter and introduced back into haploid strains of S. cerevisiae. Chitin deacetylase activity was detected by in vitro assays from vegetative cells grown in galactose. Chemical analysis of these cells also demonstrated the synthesis of chitosam in vivo. Both recombinant chitin deacetylases showed similar qualitative and quantitative activities toward chitooligosaccharides in vitro. A diploid strain deleted to both ORFs, when sporulated, did not show deacetylase activity. The mutant spores were hypersensitive to lytic enzymes (Glusulase or Zymolyase).

Chromosome mechanics of fungi under spaceflight conditions--tetrad analysis of two-factor crosses between spore color mutants of Sordaria macrospora.

PubMed

Hahn, A; Hock, B

1999-01-01

Spore color mutants of the fungus Sordaria macrospora Auersw. were crossed under spaceflight conditions on the space shuttle to MIR mission S/MM 05 (STS-81). The arrangement of spores of different colors in the asci allowed conclusions on the influence of spaceflight conditions on sexual recombination in fungi. Experiments on a 1-g centrifuge in space and in parallel on the ground were used for controls. The samples were analyzed microscopically on their return to earth. Each fruiting body was assessed separately. Statistical analysis of the data showed a significant increase in gene recombination frequencies caused by the heavy ion particle stream in space radiation. The lack of gravity did not influence crossing-over frequencies. Hyphae of the flown samples were assessed for DNA strand breaks. No increase in damage was found compared with the ground samples. It was shown that S. macrospora is able to repair radiation-induced DNA strand breaks within hours.

Genetic Recombination at the Buff Spore Color Locus in SORDARIA BREVICOLLIS. II. Analysis of Flanking Marker Behavior in Crosses between Buff Mutants.

PubMed

Sang, H; Whitehouse, H L

1983-02-01

Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, with a crossover distal to the site of the second mutant present in the cross. Similarly, segregation at a distal site may be associated with a crossover distal to the site or, with lower frequency, with a crossover proximal to the site of the proximal mutant present in the cross. Crossovers between the alleles were rare. This evidence for the relationship between hybrid DNA and crossing over is discussed in terms of current models for the mechanism of recombination.

Isolation of total RNA from yeast cell cultures.

PubMed

Ares, Manuel

2012-10-01

This article describes two procedures for isolating total RNA from yeast cell cultures. The first allows the convenient isolation of total RNA from early log-phase cultures (vegetative cells). RNA isolated in this way is intact and sufficiently pure for use in microarray experiments, primer extension, and RNase protection mapping. With additional treatment to remove contaminating genomic DNA, the preparation is suitable for reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), cDNA library construction, high-throughput sequencing of RNA, or other manipulations. However, compared to vegetative cells, the isolation of RNA from cells late in meiosis (asci and ascospores) requires additional effort. This is because a tough cell wall composed of heavily cross-linked polysaccharides and proteins is built around the four spores during meiosis and ascospore development. Therefore, an alternative protocol is presented for extracting RNA from cells late in meiosis. This alternative may also be preferable for cells from stationary cultures or from yeast strains and other fungal species isolated from the environment.

7 CFR 1207.311 - Programs and projects.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.311 Programs and projects. Programs and...

7 CFR 1207.311 - Programs and projects.

Code of Federal Regulations, 2014 CFR

2014-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.311 Programs and projects. Programs and...

7 CFR 1207.311 - Programs and projects.

Code of Federal Regulations, 2013 CFR

2013-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.311 Programs and projects. Programs and...

7 CFR 1207.311 - Programs and projects.

Code of Federal Regulations, 2012 CFR

2012-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.311 Programs and projects. Programs and...

Integrated environmental planning in the Philippines: A case study of the Palawan Integrated Environmental Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganapin, D.J. Jr.

1987-01-01

Integrated environmental planning was analyzed using the case of the Palawan Integrated Environmental Program in the Philippines. The study explores the relationship between development and environmental planning and evaluates the importance of organizational coordination and timing in the integration of these two concerns. Factors affecting the accomplishment of the objectives of integrated environmental planning were also studied. Two planning phases of the Palawan Integrated Environmental Program were observed using the case study approach. Observations of various planning participants-consultants, middle level agency personnel, heads of local agencies-were also considered. The integration of environmental considerations in development planning was found to bemore » beneficial to both environmental and development concerns. The experience showed that such integration requiring tight organizational coordination and the proper timing of activities and outputs. The success of the Palawan Integrated Environmental Program was also found to depend on effective communication, the political functionality of the government, the leadership of its executives, the presence of appropriate structures of authority, sufficiency of funds and manpower and the availability of appropriate environmental planning techniques. Recommendations are provided to further strengthen the integration of environmental considerations in development planning and increase the effectiveness of integrated environmental programs.« less

The requirements and feasibility of business planning in the office of space and terrestrial applications

NASA Technical Reports Server (NTRS)

Greenberg, J. S.; Miller, B. P.

1979-01-01

The feasibility of applying strategic business planning techniques which are developed and used in the private sector to the planning of certain projects within the NASA Office of Space and Terrestrial Applications was assessed. The methods of strategic business planning that are currently in use in the private sector are examined. The typical contents of a private sector strategic business plan and the techniques commonly used to develop the contents of the plan are described, along with modifications needed to apply these concepts to public sector projects. The current long-range planning process in the Office of Space and Terrestrial Applications is reviewed and program initiatives that might be candidates for the use of strategic business planning techniques are identified. In order to more fully illustrate the information requirements of a strategic business plan for a NASA program, a sample business plan is prepared for a hypothetical Operational Earth Resources Satellite program.

Revised research plan for the U.S. Climate Change Science Program

DOT National Transportation Integrated Search

2008-05-01

The U.S. Climate Change Science Program (CCSP) released its Strategic Plan in 2003.This Revised Research Plan, in compliance with Section 104(a) of the Global Change Research Act of 1990, is an update to the 2003 Strategic Plan. It reflects both scie...

77 FR 64422 - Approval and Promulgation of Air Quality Implementation Plans; Illinois; Greif Packaging, LLC...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-22

... Promulgation of Air Quality Implementation Plans; Illinois; Greif Packaging, LLC Adjusted Standard AGENCY...) 408-2279. 4. Mail: Doug Aburano, Chief, Attainment Planning and Maintenance Section, Air Programs.... 5. Hand Delivery: Doug Aburano, Chief, Attainment Planning and Maintenance Section, Air Programs...

Formulating New Directions with Strategic Marketing Planning.

ERIC Educational Resources Information Center

Crompton, John L.

1983-01-01

This article describes both a short- and long-term strategic marketing planning approach for the parks and recreation manager. Both plans involve a needs assessment, objective development, marketing plans, and evaluations. Also discussed is a continuum of stragetic program options ranging from developing new programs to terminating existing…

15 CFR 923.13 - Energy facility planning process.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Energy facility planning process. 923... RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Uses Subject to Management § 923.13 Energy facility planning process. The management program must contain a planning process for energy facilities...

15 CFR 923.13 - Energy facility planning process.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 15 Commerce and Foreign Trade 3 2012-01-01 2012-01-01 false Energy facility planning process. 923... RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Uses Subject to Management § 923.13 Energy facility planning process. The management program must contain a planning process for energy facilities...

15 CFR 923.13 - Energy facility planning process.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 15 Commerce and Foreign Trade 3 2013-01-01 2013-01-01 false Energy facility planning process. 923... RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Uses Subject to Management § 923.13 Energy facility planning process. The management program must contain a planning process for energy facilities...

15 CFR 923.13 - Energy facility planning process.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 15 Commerce and Foreign Trade 3 2011-01-01 2011-01-01 false Energy facility planning process. 923... RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Uses Subject to Management § 923.13 Energy facility planning process. The management program must contain a planning process for energy facilities...

15 CFR 923.13 - Energy facility planning process.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 15 Commerce and Foreign Trade 3 2014-01-01 2014-01-01 false Energy facility planning process. 923... RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Uses Subject to Management § 923.13 Energy facility planning process. The management program must contain a planning process for energy facilities...

Using Program Data to Improve Access to Family Planning and Enhance the Method Mix in Conflict-Affected Areas of the Democratic Republic of the Congo

PubMed Central

Ho, Lara S; Wheeler, Erin

2018-01-01

Unmet need for family planning in the conflict-affected area of eastern Democratic Republic of the Congo (DRC) has been reported to be as high as 38%, and women in such conflict settings are often the most at risk for maternal mortality. The International Rescue Committee implements the Family Planning and Post-Abortion Care in Emergencies program in 3 provinces of eastern DRC to provide women and couples access to family planning, including long-acting reversible contraceptives (LARCs). This article presents routine program data from June 2011 through December 2013 from 2 health zones as well as results from a qualitative assessment of family planning clients and of male and female non-users, conducted in 2013. It then describes how these findings were used to make program adjustments to improve access to family planning services and client informed choice and assesses the effects of the program design changes on family planning uptake and method mix using routine program data from January 2014 through December 2016. Between 2011 and 2013, 8,985 clients adopted family planning, with an average 14 clients adopting a method per facility, per month. The method mix remained stable during this period, with implants dominating at 48%. Barriers to uptake identified from the qualitative research were both supply- and demand-related, including misconceptions about certain modern contraceptive methods on the part of providers, users, and other community members. The program implemented several program changes based on the assessment findings, including clinical coaching and supportive supervision to improve provider skills and attitudes, introduction of immediate postpartum insertion of the intrauterine device (IUD) and the levonorgestrel-releasing intrauterine system (LNG-IUS), and behavior change communication campaigns to raise awareness about family planning. After these program changes, the mean number of clients adopting modern family planning per facility, per month increased from 14 to 37 and the percentage of family planning adopters choosing LARCs increased from 50% to 66%. While implants continued to be the most dominant method, reaching 60% of the method mix in 2016, the percentage of clients adopting IUDs increased each year, from 3% in 2014 to 13% in 2016. In total, 39,399 clients started family planning methods during the post-program design change period (2014–2016). Our experience in eastern DRC demonstrates that women and their partners affected by conflict want family planning, and that it is feasible to deliver the full range of modern contraceptive methods when programs are adapted and sensitive to the local context. PMID:29602870

[How to expand and improve the coverage of family planning services: a Latin American viewpoint].

PubMed

Trias, M

1992-12-01

It is probably not possible to implant a family planning program that will have a reasonable demographic impact in areas lacking awareness of the disadvantages of overly high fertility. Rural-urban migration, increasing educational levels, women's labor force participation, and declining infant mortality are all factors that have been found to correlate with demand for family planning services. It has been recognized since the Bucharest World Population Conference in 1974 that development and family planning are both required for the fertility transition to begin. Where these conditions exist, a family planning program appropriate to the needs, limitations, preferences, and expectations of the target population has an excellent chance of success. Expanded and improved coverage results from tailoring programs to the specific groups served. Most programs are directed toward women. It has been found most effective to provide services for men in separate sessions. It is also useful to distinguish between services for adolescents, who require more information and fewer services, for mature women who require more services than information, and for premenopausal women whose needs for information and services are both declining. Contraceptive preferences vary with social class, but family planning programs in developing countries should concentrate on the lower middle and lower classes which comprise 80% of the population. Rural areas and marginal urban areas require special attention. In order to provide services that will attract all potential users, the maximum possible variety of methods should be available. A family planning program offering a variety of methods throughout the country and financially accessible to the population should be successful. Family planning programs, whether public or private, require adequate financial resources and the support or at least tolerance of the government. Knowledge of contraception is now almost universal. A major challenge of family planning programs is to prompt women who say they want to limit their reproduction but who do not practice family planning to adopt a method. Program leadership and interpersonal relations with clients should be competent. The experience of PROFAMILIA in Colombia suggests that charging fees for all services offered by the family planning program is a positive feature allowing the client to avoid feeling like a charity recipient and the program to account for materials and services more easily. Goals and objective indicators stimulate performance and allow progress to be assessed. It is recommended that client education focus on a synthesis of information concerning available methods and provision of somewhat greater detail on the method chosen. Integration of services is usually an enemy of family planning because, despite theoretical advantages, it usually means neglect of family planning in favor of curative care.

The Office of Space Science and Applications strategic plan, 1990: A strategy for leadership in space through excellence in space science and applications

NASA Technical Reports Server (NTRS)

1990-01-01

A strategic plan for the U.S. space science and applications program during the next 5 to 10 years was developed and published in 1988. Based on the strategies developed by the advisory committees of both the National Academy of Science and NASA, the plan balances major, moderate, and small mission initiatives, the utilization of the Space Station Freedom, and the requirements for a vital research base. The Office of Space Science and Applications (OSSA) strategic plan is constructed around five actions: establish a set of programmatic themes; establish a set of decision rules; establish a set of priorities for missions and programs within each theme; demonstrate that the strategy will yield a viable program; and check the strategy for consistency within resource constraints. The OSSA plan is revised annually. This OSSA 1990 Strategic Plan refines the 1989 Plan and represents OSSA's initial plan for fulfilling its responsibilities in two major national initiatives. The Plan is now built on interrelated, complementary strategies for the core space science and applications program, for the U.S. Global Change Research Program, and for the Space Exploration Initiative. The challenge is to make sure that the current level of activity is sustained through the end of this century and into the next. The 1990 Plan presents OSSA's strategy to do this.

Fact Sheet: Risk Management Plan (RMP) Audit Program

EPA Pesticide Factsheets

Risk management programs, which consist of a hazard assessment, a prevention program, and an emergency response program; must be periodically audited to assess whether the plans are adequate or need to be revised to comply with the regulation.

DO FAMILY PLANNING PROGRAMS DECREASE POVERTY? EVIDENCE FROM PUBLIC CENSUS DATA

PubMed Central

Bailey, Martha J.; Malkova, Olga; Norling, Johannes

2014-01-01

This paper provides new evidence that family planning programs are associated with a decrease in the share of children and adults living in poverty. Our research design exploits the county roll-out of U.S. family planning programs in the late 1960s and early 1970s and examines their relationship with poverty rates in the short and longer-term in public census data. We find that cohorts born after federal family planning programs began were less likely to live in poverty in childhood and that these same cohorts were less likely to live in poverty as adults. PMID:25346655

Future Orbital Power Systems Technology Requirements

NASA Technical Reports Server (NTRS)

1978-01-01

NASA is actively involved in program planning for missions requiring several orders of magnitude, more energy than in the past. Therefore, a two-day symposium was held to review the technology requirements for future orbital power systems. The purpose of the meeting was to give leaders from government and industry a broad view of current government supported technology efforts and future program plans in space power. It provided a forum for discussion, through workshops, to comment on current and planned programs and to identify opportunities for technology investment. Several papers are presented to review the technology status and the planned programs.

Rural-Urban Differences in Awareness and Use of Family Planning Services Among Adolescent Women in California.

PubMed

Yarger, Jennifer; Decker, Martha J; Campa, Mary I; Brindis, Claire D

2017-04-01

The purpose of this study was to compare awareness and use of family planning services by rural and urban program site among a sample of adolescent women before participation in the federal Personal Responsibility Education Program in California. We conducted a secondary analysis of survey data collected from youth before participation in California's Personal Responsibility Education Program. Bivariate and multivariate analyses were conducted for a sample of 4,614 females ages 14-18 years to compare awareness and use of family planning services between participants at rural and urban program sites, controlling for the program setting and participant demographic, sexual, and reproductive characteristics. Overall, 61% of participants had heard of a family planning provider in their community, and 24% had visited a family planning provider. Awareness and use of family planning services were lower among rural participants than urban participants. After adjusting for the program setting and participant characteristics, rural participants were less likely to know about a family planning provider in their community (odds ratio, .64; 95% confidence interval, .50-.81) or receive family planning services (odds ratio, .76; 95% confidence interval, .58-.99) than urban participants. Findings suggest that adolescents in rural areas face greater barriers to accessing family planning services than adolescents in urban areas. Targeted efforts to increase awareness and use of family planning services among adolescents in rural areas and among other underserved populations are needed. Copyright © 2016 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Generating AN Optimum Treatment Plan for External Beam Radiation Therapy.

NASA Astrophysics Data System (ADS)

Kabus, Irwin

1990-01-01

The application of linear programming to the generation of an optimum external beam radiation treatment plan is investigated. MPSX, an IBM linear programming software package was used. All data originated from the CAT scan of an actual patient who was treated for a pancreatic malignant tumor before this study began. An examination of several alternatives for representing the cross section of the patient showed that it was sufficient to use a set of strategically placed points in the vital organs and tumor and a grid of points spaced about one half inch apart for the healthy tissue. Optimum treatment plans were generated from objective functions representing various treatment philosophies. The optimum plans were based on allowing for 216 external radiation beams which accounted for wedges of any size. A beam reduction scheme then reduced the number of beams in the optimum plan to a number of beams small enough for implementation. Regardless of the objective function, the linear programming treatment plan preserved about 95% of the patient's right kidney vs. 59% for the plan the hospital actually administered to the patient. The clinician, on the case, found most of the linear programming treatment plans to be superior to the hospital plan. An investigation was made, using parametric linear programming, concerning any possible benefits derived from generating treatment plans based on objective functions made up of convex combinations of two objective functions, however, this proved to have only limited value. This study also found, through dual variable analysis, that there was no benefit gained from relaxing some of the constraints on the healthy regions of the anatomy. This conclusion was supported by the clinician. Finally several schemes were found that, under certain conditions, can further reduce the number of beams in the final linear programming treatment plan.

PLANNING, PROGRAMMING, DESIGNING THE COMMUNITY COLLEGE, PROCEEDINGS OF A CONFERENCE SPONSORED BY THE COLLEGE OF ARCHITECTURE AND URBAN PLANNING AND THE CENTER FOR THE DEVELOPMENT OF COMMUNITY COLLEGE EDUCATION (UNIVERSITY OF WASHINGTON, APRIL 24-25, 1967).

ERIC Educational Resources Information Center

SONDALLE, MARVIN P.

PARTICIPANTS AT THIS CONFERENCE DEFINED THE ESSENTIAL MAJOR STEPS IN FACILITY PLANNING FOR A NEW CAMPUS AS SITE SELECTION, FINANCIAL PROGRAMMING, CAMPUS PLANNING, AND CONSTRUCTION. THEY ALSO AGREED THAT THE COLLEGE ADMINISTRATION AND THE ARCHITECTURAL STAFF MUST WORK TOGETHER AT EVERY STAGE OF THE PROGRAM. PRESENT TECHNIQUES OF ENROLLMENT…

7 CFR 23.13 - Plan of Work.

Code of Federal Regulations, 2010 CFR

2010-01-01

... multi-State organizations or bodies for those activities of the Regional Rural Development Centers which... of the Secretary of Agriculture STATE AND REGIONAL ANNUAL PLANS OF WORK Regional Program § 23.13 Plan of Work. (a) A Regional Plan of Work for carrying out the programs authorized to be funded under...

45 CFR 1321.17 - Content of State plan.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON AGING, OLDER AMERICANS PROGRAMS GRANTS TO STATE AND COMMUNITY PROGRAMS ON AGING State Agency Responsibilities § 1321.17 Content of State plan. To... each planning and service area and of area agencies on aging designated for each planning and service...

45 CFR 1321.17 - Content of State plan.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON AGING, OLDER AMERICANS PROGRAMS GRANTS TO STATE AND COMMUNITY PROGRAMS ON AGING State Agency Responsibilities § 1321.17 Content of State plan. To... each planning and service area and of area agencies on aging designated for each planning and service...

45 CFR 1321.17 - Content of State plan.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON AGING, OLDER AMERICANS PROGRAMS GRANTS TO STATE AND COMMUNITY PROGRAMS ON AGING State Agency Responsibilities § 1321.17 Content of State plan. To... each planning and service area and of area agencies on aging designated for each planning and service...

Andrews University Master Plan for Campus Expansion and the Development Program, 1977-1985.

ERIC Educational Resources Information Center

Smoot, Joseph G.

Described in detail in this partly promotional, partly informational publication are the history of campus planning, new master plan, and new capital programs of this Seventh Day Adventist institution. Numerous maps, photographs, and tables of financial and statistical data illustrate the plan. (MSE)

National Data Program for the Marine Environment Technical Development Plan. Final Report, Volume Two.

ERIC Educational Resources Information Center

System Development Corp., Santa Monica, CA.

A national data program for the marine environment is recommended. Volume 2 includes: (1) objectives, scope, and methodology; (2) summary of the technical development plan; (3) agency development plans - Great Lakes and coastal development and (4) marine data network development plans. (Author)

40 CFR 68.180 - Emergency response program.

Code of Federal Regulations, 2011 CFR

2011-07-01

... activities and the emergency response plan is coordinated. (c) The owner or operator shall list other Federal... (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.180 Emergency response program... written emergency response plan? (2) Does the plan include specific actions to be taken in response to an...

40 CFR 68.180 - Emergency response program.

Code of Federal Regulations, 2013 CFR

2013-07-01

... activities and the emergency response plan is coordinated. (c) The owner or operator shall list other Federal... (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.180 Emergency response program... written emergency response plan? (2) Does the plan include specific actions to be taken in response to an...

40 CFR 68.180 - Emergency response program.

Code of Federal Regulations, 2012 CFR

2012-07-01

... activities and the emergency response plan is coordinated. (c) The owner or operator shall list other Federal... (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.180 Emergency response program... written emergency response plan? (2) Does the plan include specific actions to be taken in response to an...

40 CFR 68.180 - Emergency response program.

Code of Federal Regulations, 2014 CFR

2014-07-01

... activities and the emergency response plan is coordinated. (c) The owner or operator shall list other Federal... (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.180 Emergency response program... written emergency response plan? (2) Does the plan include specific actions to be taken in response to an...

The Missouri Career Development and Teacher Excellence Plan: An Initial Study of Missouri's Career Ladder Program. A Technical Report.

ERIC Educational Resources Information Center

Schofer, Richard C.; And Others

The Missouri Plan provides for direct participation of teachers in the planning, development, and implementation of the district career ladder plan. This study analyzed the appropriateness of the Missouri teacher incentive plan. In particular, the study sought to determine why districts did or did not choose to implement career ladder programs;…

Strategic plan for bioenergy research, 1998--2003, the Canadian Forest Service five-year plan: Implementing the Canadian bioenergy research strategy (in English;French)

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1998-10-01

This document supersedes the previous one, taking into account changes that have taken place in the CFS Science and Technology (S and T) program structure and organization, and in the structure of the Program of Energy Research and Development, the source of funding for CFS bioenergy research. It explains the rationale and overall objective for the bioenergy research program and briefly reviews the accomplishments to date. It indicates the planning context within which the program operates, states the specific objectives for the period of the plan, and details the strategic priorities developed for this period. Finally, it outlines the implementationmore » process for the plan.« less

34 CFR 611.2 - What management plan must be included in a Teacher Quality Enhancement Grants Program application?

Code of Federal Regulations, 2010 CFR

2010-07-01

... TEACHER QUALITY ENHANCEMENT GRANTS PROGRAM General Provisions § 611.2 What management plan must be... 34 Education 3 2010-07-01 2010-07-01 false What management plan must be included in a Teacher Quality Enhancement Grants Program application? 611.2 Section 611.2 Education Regulations of the Offices...

An Education and Development Program for Michigan's State Health Planning Advisory Council.

ERIC Educational Resources Information Center

Michigan State Office of Health and Medical Affairs, Lansing.

The report describes a Federally supported education and development program conducted during the 1973-74 fiscal year for members of the Michigan State Health Planning Advisory Council. The program sought to increase: (1) the council members' awareness of and insight into the comprehensive health planning process, (2) their knowledge of the health…

25 CFR 170.404 - What happens when a tribe uses its IRR Program construction funds for transportation planning?

Code of Federal Regulations, 2010 CFR

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false What happens when a tribe uses its IRR Program construction funds for transportation planning? 170.404 Section 170.404 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER INDIAN RESERVATION ROADS PROGRAM Planning, Design, and Construction...

Planning Student Flow with Linear Programming: A Tunisian Case Study.

ERIC Educational Resources Information Center

Bezeau, Lawrence

A student flow model in linear programming format, designed to plan the movement of students into secondary and university programs in Tunisia, is described. The purpose of the plan is to determine a sufficient number of graduating students that would flow back into the system as teachers or move into the labor market to meet fixed manpower…

Forest and farmland conservation effects of Oregon's (USA) land-use planning program.

Treesearch

Jeffrey D. Kline

2005-01-01

Oregon's land-use planning program is often cited as an exemplary approach to forest and farmland conservation, but analyses of its effectiveness are limited. This article examines Oregon's land-use planning program using detailed spatial data describing building densities in western Oregon. An empirical model describes changes in building densities on forest...

Study of solid rocket motor for space shuttle booster, Volume 3: Program acquisition planning

NASA Technical Reports Server (NTRS)

1972-01-01

The program planning acquisition functions for the development of the solid propellant rocket engine for the space shuttle booster is presented. The subjects discussed are: (1) program management, (2) contracts administration, (3) systems engineering, (4) configuration management, and (5) maintenance engineering. The plans for manufacturing, testing, and operations support are included.

32 CFR 37.885 - May I require updated program plans?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 1 2011-07-01 2011-07-01 false May I require updated program plans? 37.885 Section 37.885 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND... Financial and Programmatic Reporting § 37.885 May I require updated program plans? In addition to reports on...

32 CFR 37.885 - May I require updated program plans?

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 1 2013-07-01 2013-07-01 false May I require updated program plans? 37.885 Section 37.885 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND... Financial and Programmatic Reporting § 37.885 May I require updated program plans? In addition to reports on...

32 CFR 37.885 - May I require updated program plans?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false May I require updated program plans? 37.885 Section 37.885 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND... Financial and Programmatic Reporting § 37.885 May I require updated program plans? In addition to reports on...

32 CFR 37.885 - May I require updated program plans?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 1 2012-07-01 2012-07-01 false May I require updated program plans? 37.885 Section 37.885 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND... Financial and Programmatic Reporting § 37.885 May I require updated program plans? In addition to reports on...

32 CFR 37.885 - May I require updated program plans?

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 1 2014-07-01 2014-07-01 false May I require updated program plans? 37.885 Section 37.885 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND... Financial and Programmatic Reporting § 37.885 May I require updated program plans? In addition to reports on...

FY 1986 current fiscal year work plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This Current Year Work Plan presents in detail a description of the activities to be performed by the Joint Integration Office/RI during FY86. It breaks down the activities into two major work areas: Program Management and Program Analysis. Program Management is performed by the JIO/RI by providing technical planning and guidance for the development of advanced TRU waste management capabilities. This includes equipment/facility design, engineering, construction, and operations. These functions are integrated to allow transition from interim storage to final disposition. JIO/RI tasks include program requirements identification, long-range technical planning, budget development, program planning document preparation, task guidance development, taskmore » monitoring, task progress information gathering and reporting to DOE, interfacing with other agencies and DOE lead programs, integrating public involvement with program efforts, and preparation of reports for DOE detailing program status. Program Analysis is performed by the JIO/RI to support identification and assessment of alternatives, and development of long-term TRU waste program capabilities. These analyses include short term analyses in response to DOE information requests, along with performing an RH Cost/Schedule Optimization report. System models will be developed, updated, and upgraded as needed to enhance JIO/RI's capability to evaluate the adequacy of program efforts in various fields. A TRU program data base will be maintained and updated to provide DOE with timely responses to inventory related questions.« less

28 CFR 524.23 - Program reviews.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Program reviews. 524.23 Section 524.23... TRANSFER CLASSIFICATION OF INMATES Youth Corrections Act (YCA) Programs § 524.23 Program reviews. Staff shall conduct periodic reviews of the inmate's program plan and shall modify the plan in accordance with...

75 FR 43510 - Office of Innovation and Improvement; Overview Information; Charter Schools Program (CSP) Grants...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-26

... Schools Program (CSP) Grants to Non-State Educational Agencies for Planning, Program Design, and..., program design, and implementation, and non-SEA grants for dissemination provide funds for these purposes.... Non-SEA eligible applicants that propose to use grant funds for planning, program design, and...

Social Policy Planning Programs and Prospects.

ERIC Educational Resources Information Center

Todd, Frederick W.

This study, a monitor of four experimental training programs in the field of social policy planning, has as its purpose to assess program development and outcomes and to relate any significant findings useful in educational program development for social policy professionals. The programs are discussed at two levels: individually in terms of their…

Agricultural Extension--Programming the Work.

ERIC Educational Resources Information Center

Smith, G. A.

This paper outlines the concept of "program" and one set of elements that are considered to make up the program planning process in agricultural extension, and an example of practical program planning in Rhodesia is given. Although there is a wide variety of meanings attached to the term "program" in adult education, it has…

7 CFR 1207.311 - Programs and projects.

Code of Federal Regulations, 2010 CFR

2010-01-01

... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POTATO RESEARCH AND PROMOTION PLAN Potato Research and Promotion Plan Definitions § 1207.311 Programs and projects. Programs and projects mean those research, development, advertising or promotion programs or projects developed by the...

Steps to a HealthierUS Cooperative Agreement Program: foundational elements for program evaluation planning, implementation, and use of findings.

PubMed

MacDonald, Goldie; Garcia, Danyael; Zaza, Stephanie; Schooley, Michael; Compton, Don; Bryant, Terry; Bagnol, Lulu; Edgerly, Cathy; Haverkate, Rick

2006-01-01

The Steps to a HealthierUS Cooperative Agreement Program (Steps Program) enables funded communities to implement chronic disease prevention and health promotion efforts to reduce the burden of diabetes, obesity, asthma, and related risk factors. At both the national and community levels, investment in surveillance and program evaluation is substantial. Public health practitioners engaged in program evaluation planning often identify desired outcomes, related indicators, and data collection methods but may pay only limited attention to an overarching vision for program evaluation among participating sites. We developed a set of foundational elements to provide a vision of program evaluation that informs the technical decisions made throughout the evaluation process. Given the diversity of activities across the Steps Program and the need for coordination between national- and community-level evaluation efforts, our recommendations to guide program evaluation practice are explicit yet leave room for site-specific context and needs. Staff across the Steps Program must consider these foundational elements to prepare a formal plan for program evaluation. Attention to each element moves the Steps Program closer to well-designed and complementary plans for program evaluation at the national, state, and community levels.

10 CFR 603.885 - Updated program plans and budgets.

Code of Federal Regulations, 2011 CFR

2011-01-01

... program plans and budgets. In addition to reports on progress to date, a TIA may include a provision requiring the recipient to annually prepare an updated technical plan for future conduct of the research...

Developing an interdisciplinary certificate program in transportation planning.

DOT National Transportation Integrated Search

2010-09-01

This project develops and implements a graduate certificate in transportation planning. Texas A&M : University (A&M) currently offers instruction in transportation through its Master of Urban Planning (MUP) : and Civil Engineering (CE) programs; howe...

Generalizable Skills in Individualized Vocational Program Planning for Special Needs Students.

ERIC Educational Resources Information Center

Stodden, Robert A.; Boone, Rosalie

1986-01-01

The authors address planning issues and suggest methods of interagency cooperation, integration of generalizable skills in individualized educational planning/programming, developing goals and objectives, and using student assessment and evaluation information. (CT)

Problem identification for Virginia's highway safety plan.

DOT National Transportation Integrated Search

1982-01-01

Problem identification is recognized as an important component of highway safety planning. Under the NHTSA/FHWA concept, problem identification is the first step in program planning and in the development of effective countermeasure programs. The ann...

75 FR 65385 - Advisory Committee for Polar Programs; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-22

... Antarctic Program review; Strategic Planning; planning for a Polar Research Vessel. Dated: October 19, 2010... research community, to provide advice to the Director of OPP on issues related to long-range planning...

How to Convince Parents to Stop Spanking Their Children.

PubMed

Hudnut-Beumler, Julia; Smith, Ashley; Scholer, Seth J

2018-02-01

English- and Spanish-speaking parents of 1- to 5-year-old children were invited to view 5-10 minutes of parent training program, "Play Nicely," as part of the well-child checkup. Key measures were parents' plans to change how they discipline and, if they planned to use less spanking, how the program worked in their situation. Of 197 parents who participated, 128 (65.0%) planned to change how they discipline. Nineteen parents (9.6%) reported that they planned to spank less. The most common reasons for parents to plan to spank less were that the program taught other discipline options (12/19, 63.2%) and that the program taught that spanking was not recommended as a form of discipline (6/19, 31.6%). The majority of parents report that the program works because it offers alternatives to spanking. This study has implications for the development of parent training programs and the primary prevention of child abuse, violence, and other health problems.

Characterizing the Breadth and Depth of Volunteer Water Monitoring Programs in the United States.

PubMed

Stepenuck, Kristine F; Genskow, Kenneth D

2018-01-01

A survey of 345 volunteer water monitoring programs in the United States was conducted to document their characteristics, and perceived level of support for data to inform natural resource management or policy decisions. The response rate of 86% provided information from 46 states. Programs represented a range of ages, budgets, objectives, scopes, and level of quality assurance, which influenced data uses and perceived support by sponsoring agency administrators and external decision makers. Most programs focused on rivers, streams, and lakes. Programs had not made substantial progress to develop EPA or state-approved quality assurance plans since 1998, with only 48% reporting such plans. Program coordinators reported feeling slightly more support for data to be used for management as compared to policy decisions. Programs with smaller budgets may be at particular risk of being perceived to lack credibility due to failure to develop quality assurance plans. Over half of programs identified as collaborative, in that volunteers assisted scientists in program design, data analysis and/or dissemination of results. Just under a third were contributory, in which volunteers primarily collected data in a scientist-defined program. Recommendations to improve perceived data credibility, and to augment limited budgets include developing quality assurance plans and gaining agency approval, and developing partnerships with other organizations conducting monitoring in the area to share resources and knowledge. Funding agencies should support development of quality assurance plans to help ensure data credibility. Service providers can aid in plan development by providing training to program staff over time to address high staff turnover rates.

Characterizing the Breadth and Depth of Volunteer Water Monitoring Programs in the United States

NASA Astrophysics Data System (ADS)

Stepenuck, Kristine F.; Genskow, Kenneth D.

2018-01-01

A survey of 345 volunteer water monitoring programs in the United States was conducted to document their characteristics, and perceived level of support for data to inform natural resource management or policy decisions. The response rate of 86% provided information from 46 states. Programs represented a range of ages, budgets, objectives, scopes, and level of quality assurance, which influenced data uses and perceived support by sponsoring agency administrators and external decision makers. Most programs focused on rivers, streams, and lakes. Programs had not made substantial progress to develop EPA or state-approved quality assurance plans since 1998, with only 48% reporting such plans. Program coordinators reported feeling slightly more support for data to be used for management as compared to policy decisions. Programs with smaller budgets may be at particular risk of being perceived to lack credibility due to failure to develop quality assurance plans. Over half of programs identified as collaborative, in that volunteers assisted scientists in program design, data analysis and/or dissemination of results. Just under a third were contributory, in which volunteers primarily collected data in a scientist-defined program. Recommendations to improve perceived data credibility, and to augment limited budgets include developing quality assurance plans and gaining agency approval, and developing partnerships with other organizations conducting monitoring in the area to share resources and knowledge. Funding agencies should support development of quality assurance plans to help ensure data credibility. Service providers can aid in plan development by providing training to program staff over time to address high staff turnover rates.

The Situation Analysis Study of the family planning program in Kenya.

PubMed

Miller, R A; Ndhlovu, L; Gachara, M M; Fisher, A A

1991-01-01

A new, relatively "quick and clean" operations research approach called a "situation analysis" was developed for examining the strengths and weaknesses of the family planning program of Kenya. Field research teams visited a stratified random sample of 99 of the Ministry of Health's approximately 775 service delivery points. Observation techniques and interviewing were used to collect information on program components and on the quality of care provided to new family planning clients during the observation day. As late as 1986, the Kenya program was rated "weak" and "poor" in the international literature. The Kenya Situation Analysis Study found a functioning, integrated maternal and child health/family planning program serving large numbers of clients, with an emphasis on oral contraceptives and Depo-Provera (and an underemphasis on permanent methods). Although a number of program problems were revealed by the study, overall, in terms of performance, a rating of "moderate" is suggested as more appropriate for Kenya's national family planning program today. In terms of the quality of care, a "moderate to moderate-high" rating is suggested.

Endocrine Disruptor Screening Program (EDSP) Comprehensive Management Plans

EPA Pesticide Factsheets

The EDSP Comprehensive Management Plan describes the technical review processes that will be used in implementing this program and how the agency intends to factor technology advancements into the program.

20 CFR 631.40 - State program operational plan.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false State program operational plan. 631.40 Section 631.40 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR PROGRAMS... Federal-State Unemployment Compensation System, the Trade Adjustment Assistance Program, the State...

45 CFR 1304.51 - Management systems and procedures.

Code of Federal Regulations, 2011 CFR

2011-10-01

... program planning that includes consultation with the program's governing body, policy groups, and program... SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION FOR CHILDREN, YOUTH AND FAMILIES, HEAD...-income families with young children. Program planning must include: (i) An assessment of community...

Selenide isotope generator for the Galileo mission. Reliability program plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1978-10-01

The reliability program plan for the Selenide Isotope Generator (SIG) program is presented. It delineates the specific tasks that will be accomplished by Teledyne Energy Systems and its suppliers during design, development, fabrication and test of deliverable Radioisotopic Thermoelectric Generators (RTG), Electrical Heated Thermoelectric Generators (ETG) and associated Ground Support Equipment (GSE). The Plan is formulated in general accordance with procedures specified in DOE Reliability Engineering Program Requirements Publication No. SNS-2, dated June 17, 1974. The Reliability Program Plan presented herein defines the total reliability effort without further reference to Government Specifications. The reliability tasks to be accomplished are delineatedmore » herein and become the basis for contract compliance to the extent specified in the SIG contract Statement of Work.« less

Columbia River Basin Fish and Wildlife Program Work Plan for Fiscal Year 1989.

DOE Office of Scientific and Technical Information (OSTI.GOV)

United States. Bonneville Power Administration. Division of Fish and Wildlife.

1988-11-01

The FY 1989 Columbia River Basin Fish and Wildlife Program Work Plan (Work Plan) presents Bonneville Power Administration's plans for implementing the Columbia River Basin Fish and Wildlife Program (Program) in FY 1989. The Work Plan focuses on individual Action Items found in the 1987 Program for which Bonneville Power Administration (BPA) has determined that it has authority and responsibility to implement. Each of the entries in the Work Plan includes objectives, background, and progress to date in achieving those objectives, and a summary of plans for implementation in FY 1989. Most Action Items are implemented through one or moremore » BPA-funded projects. Each Action Item entry is followed by a list of completed, ongoing, and planned projects, along with objectives, results, schedules, and milestones for each project. The FY 1989 Work Plan emphasizes continuation of 113 projects, most of which involve protection, mitigation, or enhancement of anadromous fishery resources. BPA also plans to start 20 new projects in FY 1989. The number of ongoing FY 1988 projects to be continued in FY 1989 and the number of new projects planned to start in FY 1989 are based on current (September 7, 1988) procurement expectations. Several projects presently in BPA's procurement process are expected to be contracted by September 30, 1988, the last day of FY 1988. Although these projects have not yet started, they have been listed in the Work Plan as ongoing FY 1988 projects, based on projected start dates in late September 1988. Throughout the Work Plan, those projects with projected start dates in September 1988 have been noted.« less

Estimating family planning program effects on U.S. fertility rates.

PubMed

Cutright, P; Jaffe, F S

1977-08-01

An evaluation was undertaken of the effects on U. S. fertility rates of the national family planning program. 1968-1969 family planning enrollment data were linked to 1970 census data in the same areas to derive an objective measure of the impact of organized clinical family planning programs on the 1969-70 fertility rates of subgroups of women defined by age, race, marital status, economic status, and racial composition of their area. Multivariate modelling was used to control for spurious effects of irrelevant variables. Results of the multivariate modelling show significant reductions of marital fertility among the low socioeconomic groups served by the program; no effects were exhibited by groups not served. Cumulative fertility of all groups, black and white, at all age and socioeconomic levels was affected by the program. A plausible explanation for these results lies in antecedent factors which led to the presence or absence of family planning clinics in any particular area in 1969 and its 1969 enrollment level. Communities more favorably disposed to provision of birth control services would have been more likely than other areas to apply for federal funding of family planning programs when it became available in the middle 1960s. Due to an earlier start, their programs were flourishing by 1969.

Administrative and Technical Support for the U.S. Army Medical Research and Development Command Joint Working Group on Medical Chemical Defense

DTIC Science & Technology

1989-08-01

microproces;qor databaAing systems for monitoring project and contract reports and program technology trans. fers, coordinating and providing administratIvo ...The JWGD 3 annual planning process generally included: - Program review by the JWGD’ membership at quarterly meetings, which consisted of the review...Office developed the program planning and budget documents associated with the planning process outlined above. Program project databases and

Integrating the Department of Defense Military Services’ Technology Development Programs to Improve Time, Cost, and Technical Quality Parameters

DTIC Science & Technology

2007-03-01

the DoD in general and across the SR, DD(X), and FCS programs in particular. The findings of this study show that through careful planning and...FCS programs in particular. The findings of this study show that through careful planning and coordinated technology transition, DoD acquisition...careful planning and coordinated technology transition, DoD acquisition programs can indeed leverage the technology development efforts of the three

Program definition and assessment overview. [for thermal energy storage project management

NASA Technical Reports Server (NTRS)

Gordon, L. H.

1980-01-01

The implementation of a program level assessment of thermal energy storage technology thrusts for the near and far term to assure overall coherent energy storage program is considered. The identification and definition of potential thermal energy storage applications, definition of technology requirements, and appropriate market sectors are discussed along with the necessary coordination, planning, and preparation associated with program reviews, workshops, multi-year plans and annual operating plans for the major laboratory tasks.

Unified planning work program federal fiscal year 2008

DOT National Transportation Integrated Search

2008-01-01

This Unified Planning Work Program (UPWP) contains information about surface-transportation planning projects that will be conducted in the Boston metropolitan region during the period of October 1, 2007, through September 30, 2008 (federal fiscal ye...

FY 95 engineering work plan for the design reconstitution implementation action plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bigbee, J.D.

Design reconstitution work is to be performed as part of an overall effort to upgrade Configuration Management (CM) at TWRS. WHC policy is to implement a program that is compliant with DOE-STD-1073-93, Guide for Operational Configuration Management Program. DOE-STD-1073 requires an adjunct program for reconstituting design information. WHC-SD-WM-CM-009, Design Reconstitution Program Plan for Waste Tank Farms and 242-A Evaporator of Tank Waste Remediation System, is the TWRS plan for meeting DOE-STD-1073 design reconstitution requirements. The design reconstitution plan is complex requiring significant time and effort for implementation. In order to control costs, and integrate the work into other TWRS activities,more » a Design Reconstitution Implementation Action Plan (DR IAP) will be developed, and approved by those organizations having ownership or functional interest in this activity.« less

Population and population policy in Pakistan.

PubMed

Mauldin, W P

1963-02-01

Pakistan is a divided country with different religious groups represented. Since independence in 1941, the Muslim population has increased more rapidly than the Hindu population, the West Pakistan population more rapidly and steadily than the East Pakistan population. In the late 1950s the Pakistan government initiated a family planning program. The program has trained medical and paramedical personnel in family planning, added family planning services to existing medical centers, planned for a National Research Institute of Family Planning, employed mobile units to reach outlying areas, conducted limited clinical studies on some contraceptives, and used mass media advertising. Only India and Japan are doing more with government-sponsored family planning. A weak organizational structure and an inadequate number of trained personnel are the main weakness of the program. It is too early to assess the success of the program. A 10-point reduction in annual birth rates will be considered successful.

78 FR 48679 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Public...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-09

... (GPRA) and HHS, to guide financial and program planning and evaluation, and to respond to inquiries... identifier HHS-OS-19606-30D for reference. Information Collection Request Title: Family Planning Annual...) administers and oversees the Title X Family Planning Program. The Family Planning Annual Report (FPAR) is an...

78 FR 29370 - Agency Information Collection Activities; Proposed Collection; Public Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-20

... HHS, to guide financial and program planning and evaluation, and to respond to inquiries about the... identifier HHS-OS-19606-60D for reference. Information Collection Request Title: Family Planning Annual...) administers and oversees the Title X Family Planning Program. The Family Planning Annual Report (FPAR) is an...

Succession Planning: A Doctoral Program Partnership for Emerging Community College Leaders

ERIC Educational Resources Information Center

Luna, Gaye

2010-01-01

This article describes a doctoral program partnership between a university and a community college district that addresses the need of employment-planning strategies for building leadership capacity in the community college system. Succession planning information is provided as a foundational framework to plan for the next generation of community…

42 CFR 422.455 - Special rules for MA Regional Plans.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Special rules for MA Regional Plans. 422.455... SERVICES (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Special Rules for MA Regional Plans § 422.455 Special rules for MA Regional Plans. (a) Coverage of entire MA region. The service area for an MA...

42 CFR 422.455 - Special rules for MA Regional Plans.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 3 2012-10-01 2012-10-01 false Special rules for MA Regional Plans. 422.455... SERVICES (CONTINUED) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM Special Rules for MA Regional Plans § 422.455 Special rules for MA Regional Plans. (a) Coverage of entire MA region. The service area...

42 CFR 422.455 - Special rules for MA Regional Plans.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 3 2011-10-01 2011-10-01 false Special rules for MA Regional Plans. 422.455... SERVICES (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Special Rules for MA Regional Plans § 422.455 Special rules for MA Regional Plans. (a) Coverage of entire MA region. The service area for an MA...

42 CFR 422.455 - Special rules for MA Regional Plans.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 3 2014-10-01 2014-10-01 false Special rules for MA Regional Plans. 422.455... SERVICES (CONTINUED) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM Special Rules for MA Regional Plans § 422.455 Special rules for MA Regional Plans. (a) Coverage of entire MA region. The service area...

42 CFR 422.455 - Special rules for MA Regional Plans.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 3 2013-10-01 2013-10-01 false Special rules for MA Regional Plans. 422.455... SERVICES (CONTINUED) MEDICARE PROGRAM (CONTINUED) MEDICARE ADVANTAGE PROGRAM Special Rules for MA Regional Plans § 422.455 Special rules for MA Regional Plans. (a) Coverage of entire MA region. The service area...

Planning Communities: Citizens in Two Border Towns Learn To Plan Their Own Initiatives.

ERIC Educational Resources Information Center

Henkel, David

1998-01-01

The University of New Mexico's Community and Regional Planning Program worked with two border towns that share water resources--Columbus (New Mexico) and Puerto Palomas (Chihuahua, Mexico)--to help them prepare a community comprehensive plan needed for water-project funding. The program conducted action research involving local schools and people…

Planned Change in Teacher Education: Unfreezing the Status Quo through the Integration of Technology.

ERIC Educational Resources Information Center

Bell, Edwin D.; Ireh, Madu

This study examined planned change in Winston-Salem State University's teacher education program. An external review of the School of Education indicated a weakness in program planning and curriculum design. This review stimulated planned change initiative to strengthen teacher education. Factors influencing the internal environment of teacher…

41 CFR 101-26.506 - Interior planning and design services.

Code of Federal Regulations, 2010 CFR

2010-07-01

... SOURCES AND PROGRAM 26.5-GSA Procurement Programs § 101-26.506 Interior planning and design services. In... various phases of interior planning and design. These services will be provided either directly or through... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Interior planning and...

23 CFR 450.216 - Development and content of the statewide transportation improvement program (STIP).

Code of Federal Regulations, 2011 CFR

2011-04-01

... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and... research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the State's discretion, State planning and research projects funded with National Highway System, Surface Transportation Program, and/or...

23 CFR 450.216 - Development and content of the statewide transportation improvement program (STIP).

Code of Federal Regulations, 2012 CFR

2012-04-01

... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and... research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the State's discretion, State planning and research projects funded with National Highway System, Surface Transportation Program, and/or...

23 CFR 450.216 - Development and content of the statewide transportation improvement program (STIP).

Code of Federal Regulations, 2010 CFR

2010-04-01

... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and... research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the State's discretion, State planning and research projects funded with National Highway System, Surface Transportation Program, and/or...

23 CFR 450.216 - Development and content of the statewide transportation improvement program (STIP).

Code of Federal Regulations, 2014 CFR

2014-04-01

... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and... research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the State's discretion, State planning and research projects funded with National Highway System, Surface Transportation Program, and/or...

23 CFR 450.216 - Development and content of the statewide transportation improvement program (STIP).

Code of Federal Regulations, 2013 CFR

2013-04-01

... TRANSPORTATION PLANNING AND RESEARCH PLANNING ASSISTANCE AND STANDARDS Statewide Transportation Planning and... research projects funded under 23 U.S.C. 505 and 49 U.S.C. 5305(e); (4) At the State's discretion, State planning and research projects funded with National Highway System, Surface Transportation Program, and/or...

50 CFR 86.133 - What are the plan standards?

Code of Federal Regulations, 2012 CFR

2012-10-01

... 50 Wildlife and Fisheries 9 2012-10-01 2012-10-01 false What are the plan standards? 86.133 Section 86.133 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR...) PROGRAM How States Will Complete the State Program Plans § 86.133 What are the plan standards? You must...

50 CFR 86.133 - What are the plan standards?

Code of Federal Regulations, 2014 CFR

2014-10-01

... 50 Wildlife and Fisheries 9 2014-10-01 2014-10-01 false What are the plan standards? 86.133 Section 86.133 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR... (BIG) PROGRAM How States Will Complete the State Program Plans § 86.133 What are the plan standards...

NASA Strategic Plan

NASA Technical Reports Server (NTRS)

1996-01-01

The aforementioned strategic decisions and the overarching direction for America's aeronautics and space program are addressed in the Strategic Plan. Our Strategic Plan is critical to our ability to meet the challenges of this new era and deliver a vibrant aeronautics and space program that strengthens and inspires the Nation. The Plan is our top-level strategy.

The MAP program: building the digital terrain model.

Treesearch

R.H. Twito; R.W. Mifflin; R.J. McGaughey

1987-01-01

PLANS, a software package for integrated timber-harvest planning, uses digital terrain models to provide the topographic data needed to fit harvest and transportation designs to specific terrain. MAP, an integral program in the PLANS package, is used to construct the digital terrain models required by PLANS. MAP establishes digital terrain models using digitizer-traced...

RBS Career Education. Evaluation Planning Manual. Education Is Going to Work.

ERIC Educational Resources Information Center

Kershner, Keith M.

Designed for use with the Research for Better Schools career education program, this evaluation planning manual focuses on procedures and issues central to planning the evaluation of an educational program. Following a statement on the need for evaluation, nine sequential steps for evaluation planning are discussed. The first two steps, program…

7 CFR 1209.40 - Programs, plans, and projects.

Code of Federal Regulations, 2010 CFR

2010-01-01

... requirements for quality control, grade standards, supply management programs, or other programs that would..., plan, or project, no reference to a brand name, trade name, or State or regional identification of any...

QA program plan plutonium stabilization and handling project W-460

DOE Office of Scientific and Technical Information (OSTI.GOV)

SCHULTZ, J.W.

This Quality Assurance Program Plan (QAPP) identifies Project Quality Assurance (QA) program requirements for all parties participating in the design, procurement, demolition, construction, installation, inspection and testing for Project W-460.

A System for the Exchange of Information on Instructional Materials: An Evaluation for Planned Change in Australian Education.

ERIC Educational Resources Information Center

Watt, Michael G.

This evaluation project presents a plan for a program to establish a clearinghouse for exchanging qualitative and quantitative data on instructional materials used in Australian schools. A range of elements necessary to plan a program suited to Australian requirements and conditions was investigated. Focus was on: the program's mission,…

Intelligent transportation systems Professional Capacity Building Program : planning and deploying ITS : six white papers describing current and planned programs of five transportation associations and four university ITS Research Centers of Excellence

DOT National Transportation Integrated Search

1997-12-01

In the fall of 1997, the ITS Professional Capacity Building Program initiated the development of six White Papers to briefly describe the current status of, and plans for future education and training activities of six organizations engaged in ...

National Program Plan for Research and Development in Solar Heating and Cooling. Interim Report.

ERIC Educational Resources Information Center

Energy Research and Development Administration, Washington, DC. Div. of Solar Energy.

This report presents the Energy Research and Development Administration (ERDA) program plan for solar heating and cooling of buildings and for agricultural and industrial process applications. An overview of the program plan is followed by a description of the ten paths to the solar heating and cooling of buildings and a brief discussion of the…

Customizing for clients: developing a library liaison program from need to plan.

PubMed

Tennant, M R; Butson, L C; Rezeau, M E; Tucker, P J; Boyle, M E; Clayton, G

2001-01-01

Building on the experiences of librarian representatives to curriculum committees in the colleges of dentistry, medicine, and nursing, the Health Science Center Libraries (HSCL) Strategic Plan recommended the formation of a Library Liaison Work Group to create a formal Library Liaison Program to serve the six Health Science Center (HSC) colleges and several affiliated centers and institutes. The work group's charge was to define the purpose and scope of the program, identify models of best practice, and recommend activities for liaisons. The work group gathered background information, performed an environmental scan, and developed a philosophy statement, a program of liaison activities focusing on seven primary areas, and a forum for liaison communication. Hallmarks of the plan included intensive subject specialization (beyond collection development), extensive communication with users, and personal information services. Specialization was expected to promote competence, communication, confidence, comfort, and customization. Development of the program required close coordination with other strategic plan implementation teams, including teams for collection development, education, and marketing. This paper discusses the HSCL's planning process and the resulting Library Liaison Program. Although focusing on an academic health center, the planning process and liaison model may be applied to any library serving diverse, subject-specific user populations.

Customizing for clients: developing a library liaison program from need to plan*

PubMed Central

Tennant, Michele R.; Butson, Linda C.; Rezeau, Michelle E.; Tucker, Prudence J.; Boyle, Marian E.; Clayton, Greg

2001-01-01

Building on the experiences of librarian representatives to curriculum committees in the colleges of dentistry, medicine, and nursing, the Health Science Center Libraries (HSCL) Strategic Plan recommended the formation of a Library Liaison Work Group to create a formal Library Liaison Program to serve the six Health Science Center (HSC) colleges and several affiliated centers and institutes. The work group's charge was to define the purpose and scope of the program, identify models of best practice, and recommend activities for liaisons. The work group gathered background information, performed an environmental scan, and developed a philosophy statement, a program of liaison activities focusing on seven |primary areas, and a forum for liaison communication. Hallmarks of the plan included intensive subject specialization (beyond collection development), extensive communication with users, and personal information services. Specialization was expected to promote competence, communication, confidence, comfort, and customization. Development of the program required close coordination with other strategic plan implementation teams, including teams for collection development, education, and marketing. This paper discusses the HSCL's planning process and the resulting Library Liaison Program. Although focusing on an academic health center, the planning process and liaison model may be applied to any library serving diverse, subject-specific user populations. PMID:11209807

Project Planning and Reporting

NASA Technical Reports Server (NTRS)

1982-01-01

Project Planning Analysis and Reporting System (PPARS) is automated aid in monitoring and scheduling of activities within project. PPARS system consists of PPARS Batch Program, five preprocessor programs, and two post-processor programs. PPARS Batch program is full CPM (Critical Path Method) scheduling program with resource capabilities. Can process networks with up to 10,000 activities.

Environmental restoration and waste management: Robotics technology development program: Robotics 5-year program plan. [Contains glossary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This plan covers robotics Research, Development, Demonstration, Testing, activities in the Program for the next five years. These activities range from bench-scale R D to fullscale hot demonstrations at DOE sites. This plan outlines applications of existing technology to near-term needs, the development and application of enhanced technology for longer-term needs, and an initiation of advanced technology development to meet those needs beyond the five-year plan. The objective of the Robotic Technology Development (RTDP) is to develop and apply robotics technologies that will enable Environmental Restoration and Waste Management operations at DOE sites to be safer, faster and cheaper. Fivemore » priority DOE sites were visited in March 1990 to identify needs for robotics technology in ER WM operations. This 5-Year Program Plan for the RTDP detailed annual plans for robotics technology development based on identified needs. This 5-Year Program Plan discusses the overall approach to be adopted by the RTDP to aggressively develop robotics technology and contains discussions of the Program Management Plan, Site Visit and Needs Summary, Approach to Needs-Directed Technical Development, Application-Specific Technical Development, and Cross-Cutting and Advanced Technology. Integrating application-specific ER WM needs, the current state of robotics technology, and the potential benefits (in terms of faster, safer, and cheaper) of new technology, the Plan develops application-specific road maps for robotics RDDT E for the period FY 1991 through FY 1995. In addition, the Plan identifies areas where longer-term research in robotics will have a high payoff in the 5- to 20-year time frame. 12 figs.« less

A Technology Plan for Enabling Commercial Space Business

NASA Technical Reports Server (NTRS)

Lyles, Garry M.

1997-01-01

The National Aeronautics and Space Administration's (NASA) Advanced Space Transportation Program is a customer driven, focused technology program that supports the NASA Strategic Plan and considers future commercial space business projections. The initial cycle of the Advanced Space Transportation Program implementation planning was conducted from December 1995 through February 1996 and represented increased NASA emphasis on broad base technology development with the goal of dramatic reductions in the cost of space transportation. The second planning cycle, conducted in January and February 1997, updated the program implementation plan based on changes in the external environment, increased maturity of advanced concept studies, and current technology assessments. The program has taken a business-like approach to technology development with a balanced portfolio of near, medium, and long-term strategic targets. Strategic targets are influenced by Earth science, space science, and exploration objectives as well as commercial space markets. Commercial space markets include those that would be enhanced by lower cost transportation as well as potential markets resulting in major increases in space business induced by reductions in transportation cost. The program plan addresses earth-to-orbit space launch, earth orbit operations and deep space systems. It also addresses all critical transportation system elements; including structures, thermal protection systems, propulsion, avionics, and operations. As these technologies are matured, integrated technology flight experiments such as the X-33 and X-34 flight demonstrator programs support near-term (one to five years) development or operational decisions. The Advanced Space Transportation Program and the flight demonstrator programs combine business planning, ground-based technology demonstrations and flight demonstrations that will permit industry and NASA to commit to revolutionary new space transportation systems beginning at the turn of the century and continuing far into the future.

WAG 2 remedial investigation and site investigation site-specific work plan/health and safety checklist for the soil and sediment task. Environmental Restoration Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holt, V.L.; Burgoa, B.B.

1993-12-01

This document is a site-specific work plan/health and safety checklist (WP/HSC) for a task of the Waste Area Grouping 2 Remedial Investigation and Site Investigation (WAG 2 RI&SI). Title 29 CFR Part 1910.120 requires that a health and safety program plan that includes site- and task-specific information be completed to ensure conformance with health- and safety-related requirements. To meet this requirement, the health and safety program plan for each WAG 2 RI&SI field task must include (1) the general health and safety program plan for all WAG 2 RI&SI field activities and (2) a WP/HSC for that particular field task.more » These two components, along with all applicable referenced procedures, must be kept together at the work site and distributed to field personnel as required. The general health and safety program plan is the Health and Safety Plan for the Remedial Investigation and Site Investigation of Waste Area Grouping 2 at the Oak Ridge National Laboratory, Oak Ridge, Tennessee (ORNL/ER-169). The WP/HSCs are being issued as supplements to ORNL/ER-169.« less

Outdoor Education Manual.

ERIC Educational Resources Information Center

Gooyers, Cobina; And Others

Designed for teachers to provide students with an awareness of the world of nature which surrounds them, the manual presents the philosophy of outdoor education, goals and objectives of the school program, planning for outdoor education, the Wildwood Programs, sequential program planning for students, program booking and resource list. Content…

7 CFR 1210.331 - Programs and projects.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., effectuation and administration of appropriate programs or projects for advertising and other sales promotion...; (d) A prohibition on advertising or other promotion programs that make any reference to private brand... PROMOTION PLAN Watermelon Research and Promotion Plan Research and Promotion § 1210.331 Programs and...

77 FR 66087 - Federal Perkins Loan Program, Federal Family Education Loan Program, and William D. Ford Federal...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-01

...The Secretary amends the Federal Perkins Loan (Perkins Loan) program, Federal Family Education Loan (FFEL) program, and William D. Ford Federal Direct Loan (Direct Loan) program regulations. These final regulations implement a new Income-Contingent Repayment (ICR) plan in the Direct Loan program based on the President's ``Pay As You Earn'' repayment initiative, incorporate recent statutory changes to the Income-Based Repayment (IBR) plan in the Direct Loan and FFEL programs, and streamline and add clarity to the total and permanent disability (TPD) discharge process for borrowers in loan programs under title IV of the Higher Education Act of 1965, as amended (HEA). These final regulations implementing a new ICR plan and the statutory changes to the IBR plan will assist borrowers in repaying their loans while the changes to the TPD discharge process will reduce burden for borrowers who are disabled and seeking a discharge of their title IV debt.

77 FR 60116 - Notice of Proposed Information Collection Requests; State Plan for Vocational Rehabilitation...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-02

... Rehabilitation Services Administration a State Plan for the Vocational Rehabilitation (VR) Services program and... approved VR State Plan and SE supplement form the basis upon which a state participates in programs under...

Third World Experience of Education for Planning: Africa.

ERIC Educational Resources Information Center

Tetteh, Austin

1980-01-01

Presented is an overview of the development of planning education at the undergraduate, graduate, and professional levels in Africa. Future needs include greater program flexibility and more help for developing countries to establish their own planning education programs. (WB)

41 CFR 101-26.506-1 - Types of service.

Code of Federal Regulations, 2010 CFR

2010-07-01

... PROGRAM 26.5-GSA Procurement Programs § 101-26.506-1 Types of service. GSA interior planning and design...; softline space plans; development of an interior design program (to include finish materials, furniture and...

Research and technology operating plan summary: Fiscal year 1975 research and technology program. [space programs, energy technology, and aerospace sciences

NASA Technical Reports Server (NTRS)

1975-01-01

Summaries are presented of Research and Technology Operating Plans currently in progress throughout NASA. Citations and abstracts of the operating plans are presented along with a subject index, technical monitor index, and responsible NASA organization index. Research programs presented include those carried out in the Office of Aeronautics and Space Technology, Office of Energy Programs, Office of Applications, Office of Space Sciences, Office of Tracking and Data Acquisition, and the Office of Manned Space Flight.

FFTF-cycle 10 program and future plan

NASA Astrophysics Data System (ADS)

Kohyama, Akira

1988-04-01

Brief outlines are provided of the FFTF cycle 10 program and future plans in consideration. The primary objective of the Japan-US collaboration program is to enable predictions of material behavior in MFRs to be made from data obtained in other irradiation environments. Major program goals are outlined.

Integrated Technology Plan for the Civil Space Program, 1991

NASA Technical Reports Server (NTRS)

1991-01-01

The purpose of the Integrated Technology Plan (ITP) is to serve as a strategic plan for the OAST space research and technology (R&T) program, and as a strategic planning framework for other NASA and national participants in advocating and conducting technology developments that support future U.S. civil space missions. The ITP begins with a discussion of the national policy and NASA organization which establishes the overall framework for civil space R&T planning. The second chapter provides a top-level review of the potential users of civil space R&T, their strategic mission plans, and the technologies they have identified as needed to achieve those plans. The overall methodology used to develop a civil space technology strategy is discussed. The technical details of the 1991 strategic plan are described, ending with a review of civil space R&T priorities. The fourth chapter describes how the strategic plan is annually translated into the OAST Space R&T Program, with a summary of the fiscal year 1992 program. The ITP concludes with a discussion of requirements for technology development coordination and strategies for facilitating the transfer of civil space technology to the private sector. Several appendices also are attached that provide further information regarding budget implications of the strategic plan, organizational roles, and other topics.

FY 2011 Educational Facilities Master Plan & the FY 2011-2016 Capital Improvements Program

ERIC Educational Resources Information Center

Montgomery County Public Schools, 2010

2010-01-01

The FY 2011 Educational Facilities Master Plan (Master Plan) and FY 2011-2016 Capital Improvements Program (CIP) reflect the adopted actions of the Montgomery County (Maryland) Council and integrate the facilities planning process with the annual capital budget and the six-year CIP. The CIP is developed in accordance with the Board of Education…

Career Exploration Occupational Information for the Junior High/Middle School. A Planning Curriculum Guide.

ERIC Educational Resources Information Center

Lawson, Dorothy M.; McDonald, Dorothea V.

Materials contained in this guide are designed to be used in planning a comprehensive career education program and for developing individual career education units for grades 6-9. Section 1 is the planning guide and contains strategies for organizing, planning, and implementing a program, developing staff inservice, conducting a needs assessment,…

A Planning Model for the Development of Programs for Abused and Neglected Children in Rural Areas.

ERIC Educational Resources Information Center

Chamberlain, William A.

Described are planning steps involved in developing programs for abused and neglected children in rural areas. Among barriers cited are economic factors and resistance to social planning. Emphasized is the need for congruence among local and regional agencies and organizations. Analyzed are six planning stages: entry, in which consultants gain…

10 CFR 905.1 - What are the purposes of the Energy Planning and Management Program?

Code of Federal Regulations, 2010 CFR

2010-01-01

... Resource Planning, allows customers of the Western Area Power Administration (Western) to meet the objectives of section 114 of EPAct through integrated resource planning or by other means, such as attaining... purposes of the Energy Planning and Management Program (EPAMP) are to meet the objectives of Section 114 of...

National ITS Program Plan Intelligent Transportation Systems Volume I

DOT National Transportation Integrated Search

1995-03-01

ADVANCED TRAVELER INFORMATION SYSTEMS OR ATIS : THE PURPOSE OF THE NATIONAL ITS PROGRAM PLAN IS TO GUIDE THE DEVELOPMENT AND DEPLOYMENT OF INTELLIGENT TRANSPORTATION SYSTEMS (ITS) IN THE UNITED STATES. THIS, THE FIRST EDITION OF THE PLAN WAS A JOINT ...

Interim guidance for implementing SAFETEA-LU provisions on planning, environment, and air quality for FHWA authorities

DOT National Transportation Integrated Search

2007-02-14

This final rule revises the regulations governing the development of metropolitan transportation plans and programs for urbanized areas, State transportation plans and programs and the regulations for Congestion Management Systems. The revision resul...

Transportation Planning and Research : ANNUAL WORK PROGRAM AND COST ESTIMATE, 2018

DOT National Transportation Integrated Search

2018-01-01

This document is the section-by-section ANNUAL WORK PROGRAM AND COST ESTIMATE for the agency whose MISSION is to provide excellence in transportation planning through an inclusive and comprehensive planning process that provides products, services, a...

National ITS Program Plan Executive Summary

DOT National Transportation Integrated Search

1995-03-01

THE PURPOSE OF THE NATIONAL ITS PROGRAM PLAN IS TO GUIDE THE DEVELOPMENT AND DEPLOYMENT OF INTELLIGENT TRANSPORTATION SYSTEMS (ITS) IN THE UNITED STATES. THIS FIRST EDITION OF THE PLAN WAS A JOINT EFFORT OF ITS AMERICA AND THE UNITED STATES DEPARTMEN...

Creating a Marketing Plan.

ERIC Educational Resources Information Center

Sevier, Robert A.

1989-01-01

A guide to developing a college marketing plan defines key marketing terms, outlines the development of a plan (including institutional analysis, market research, strategy formation and execution, and program evaluation), and provides a list of important principles with which to operate a program. (MSE)

Outcomes of a career planning and development program for registered nurses.

PubMed

Hall, Linda McGillis; Waddell, Janice; Donner, Gail; Wheeler, Mary M

2004-01-01

The impact of a career planning and development program (CPDP) for registered nurses (RNs) on nurse and system outcomes was examined. The CPDP was effective as participants were able to create a career vision and individualized career plan.

Louisiana Airport System Plan Five-Year Capital Improvement Program.

DOT National Transportation Integrated Search

1992-07-01

The Louisiana Airport System Plan (LASP) Five-Year-Capital Improvement Program (CIP) is a development plan for all commercial service, reliever, and general aviation airports in Louisiana. It is a detailed listing of potential projects based on the a...

California Community College Family and Consumer Sciences Program Plan, 1996. Including: Directory of Professional and Trade Organizations, Directory of Family and Consumer Sciences and Related Program Areas and Program Coordinators.

ERIC Educational Resources Information Center

California Community Colleges, Sacramento. Office of the Chancellor.

Intended as a resource for California community colleges and districts in assessing and improving family and consumer science (FCS) programs, this program plan provides information on current trends affecting the delivery of FCS programs and guidelines for assessing and developing new comprehensive or specialized programs. Following letters of…

Continental United States Military Housing Inspection National Capital Region

DTIC Science & Technology

2015-08-13

that was flaking, peeling, or chalking. JBAB did not have an asbestos management program, plan, or an appointed asbestos program manager...housing partner to ensure inspection and maintenance plan is achieved; and • Implement an asbestos management plan and appoint an asbestos program...select environmental health and safety requirements, such as those for drinking water, radon, asbestos , and lead based paint. We conducted this

A Preservation Program for the Colorado State University Libraries. The Final Report of the ARL/OMS Preservation Planning Program.

ERIC Educational Resources Information Center

Green, Stephen; And Others

This final report is a product of a Preservation Planning Program (PPP) self-study conducted by the Colorado State University Library (CSUL) working with the Association of Research Libraries' (ARL) Office of Management Studies (OMS). Designed to put self-help tools into the hands of library staff responsible for developing plans and procedures…

A Supplement to the Component Four Implementation Booklet. Broad Goal Definition in Emerald School District. SPECS: School Planning, Evaluation, and Communication System.

ERIC Educational Resources Information Center

Nagle, John M.; Walker, Harold E.

The School Planning, Evaluation, and Communication System (SPECS) is an overall design for districtwide program assessment and development. It is both a way of interrelating planning and evaluation of individual programs and a way of comparing the outcomes of all district programs with the district's community-defined educational goals. This…

A PLAN FOR EXPANSION AND DEVELOPMENT OF EDUCATION DEPARTMENTS OF FLORIDA DIVISION OF CORRECTIONS, IN COOPERATION WITH FLORIDA STATE UNIVERSITY ADULT EDUCATION DEPARTMENT.

ERIC Educational Resources Information Center

ENDWRIGHT, D.K.

THE PLAN FOR EXPANSION AND DEVELOPMENT OF EDUCATION PROGRAMS IN CORRECTIVE INSTITUTIONS IS ORGANIZED INTO FIVE TIMED PHASES TO BE COMPLETED IN THREE YEARS. A CHART REPRESENTING THE PROGRAM, AFFILIATED RESEARCH AND AGENCIES DELINEATES PLANNED ACTIVITIES. PHASE ONE (15 WEEKS) WILL SURVEY EXISTING PROGRAMS (VOCATIONAL AND ACADEMIC FACILITIES,…

Monitored execution of robot plans produced by STRIPS.

NASA Technical Reports Server (NTRS)

Fikes, R. E.

1972-01-01

We describe PLANEX1, a plan executor for the Stanford Research Institute robot system. The problem-solving program STRIPS creates a plan consisting of a sequence of actions, and PLANEX1 program carries out the plan by executing the actions. PLANEX1 is designed so that it executes only that portion of the plan necessary for completing the task, reexecutes any portion of the plan that has failed to achieve the desired results, and initiates replanning in situations where the plan can no longer be effective in completing the task. The scenario for an example plan execution is given.

Institutional plan. Fiscal year, 1997--2002

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-10-01

The Institutional Plan is the culmination of Argonne`s annual planning cycle. The document outlines what Argonne National Laboratory (ANL) regards as the optimal development of programs and resources in the context of national research and development needs, the missions of the Department of Energy and Argonne National Laboratory, and pertinent resource constraints. It is the product of ANL`s internal planning process and extensive discussions with DOE managers. Strategic planning is important for all of Argonne`s programs, and coordination of planning for the entire institution is crucial. This Institutional Plan will increasingly reflect the planning initiatives that have recently been implemented.