Science.gov

Sample records for aseptic sternal pseudoarthrosis

  1. Aseptic technique.

    PubMed

    Bykowski, Tomasz; Stevenson, Brian

    2008-11-01

    This chapter describes common laboratory procedures that can reduce the risk of culture contaminations (sepsis), collectively referred as "aseptic technique." Two major strategies of aseptic work are described: using a Bunsen burner and a laminar flow hood. Both methods are presented in the form of general protocols applicable to a variety of laboratory tasks such as pipetting and dispensing aliquots, preparing growth media, and inoculating, passaging, and spreading microorganisms on petri dishes.

  2. Sternal Talon, a novel repair for sternal dehiscence.

    PubMed

    Subramaniam, Thavakumar; Keita, Luther; Veerasingam, Dave

    2015-06-01

    Sternal dehiscence is a recognised complication after median sternotomy, occurring in 0.5-5% of cases with or without infection. A 72-year-old man presenting with collapse and ventricular tachycardia was investigated for a possible acute cardiac event 2 years after coronary artery bypass grafting for ischemic heart disease. Work-up chest X-ray showed displacement of all sternal wires, and computed tomography (CT) performed to investigate further showed sternal dehiscence with right ventricle wall herniation through the defect and sternal wire breakdown. A decision was made after discussion with the patient to repair the defect using 3 Sternal Talon devices and 2 sternal wires. The patient made an uncomplicated recovery, and the outpatient clinic review after discharge home showed satisfactory and stable sternal union. We report a case of non-infected sternal dehiscence managed successfully with the Sternal Talon without long-term complications.

  3. Tuberculous sternal osteomyelitis.

    PubMed

    Cataño, Juan Carlos; Galeano, Daniela; Botero, Juan Camilo

    2014-10-01

    A 32-year-old female patient with systemic lupus erythematosus presented with 1 month of nocturnal subjective fevers, night sweats, poor appetite, malaise, 8-kg weight loss, and a 6-cm painful sternal mass. She had normal vital signs with a physical examination notable only for the presence of a fluctuating sternal mass. A computed tomographic scan of the thorax showed a 67 × 32 × 27-mm sternal mass associated with severe sternal osteomyelitis (Fig. 1); then a surgical drainage was performed, and abundant caseous material was removed, leaving a penrose drain (Fig. 2). Histologic examination of the bone tissue revealed extensive necrosis and granulomas with multinucleated giant cells. The bone, secretion, and soft tissue were negative for acid-fast bacillae on Ziehl-Neelsen stain; but culture grew Mycobacterioum tuberculosis, and she was started on 4 first-line antituberculosis medications, showing rapid symptomatic improvement, and was discharged 4 weeks after admission (Fig. 3).

  4. Sternal exploration or closure

    MedlinePlus

    ... M, Austin K, Coulen C, Boyle D. Implementing evidence-based practice findings to decrease postoperative sternal wound infections following open heart surgery. Journal of Cardiovascular Nursing . October 2005;20(5): ...

  5. Sternal wound infections.

    PubMed

    Mauermann, William J; Sampathkumar, Priya; Thompson, Rodney L

    2008-09-01

    Deep sternal wound infections (DSWI) continue to be a relatively uncommon event occurring in about 1%-2% of all patients undergoing cardiac surgery. However, the sheer number of cardiac surgery patients and the relatively high mortality associated with DSWIs makes them of clinical relevance. This review will describe the current incidence of DSWIs and their associated morbidity and mortality as well as risk factors for the development of this complication. The microbiology of DSWIs will be reviewed and strategies to prevent these complications will be discussed with a focus on interventions that may be undertaken by the clinical anesthesiologist.

  6. Salmonella typhi sternal wound infection.

    PubMed

    Sfeir, Maroun; Youssef, Pierre; Mokhbat, Jacques E

    2013-12-01

    Samonella typhi usually causes gastrointestinal infections. Few reports in the literature described skin and soft tissue infections related to Salmonella species, especially in immunocompetent patients. Our case exhibited sternal abscess growing Salmonella typhi.

  7. Pathogenicity of Aseptic Bursaphelenchus xylophilus

    PubMed Central

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity. PMID:22662271

  8. Pathogenicity of aseptic Bursaphelenchus xylophilus.

    PubMed

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity.

  9. MDCT evaluation of sternal variations: Pictorial essay

    PubMed Central

    Duraikannu, Chary; Noronha, Olma V; Sundarrajan, Pushparajan

    2016-01-01

    Sternal variations and anomalies have been identified in the past during autopsy or cadaveric studies. Recently, an increasing number of minor sternal variations have been reported with the advent of multidetector computed tomography (CT). Although there are many sternal variations that occur with varying appearance and prevalence, most of them are not recognized or are underreported during routine imaging of thorax. Identification of sternal variations is important to differentiate from pathological conditions and to prevent fatal complications prior to sternal interventions like marrow aspiration or acupuncture. This article aims to describe the minor and asymptomatic sternal variations by multidetector CT and their clinical significance. PMID:27413263

  10. Nitinol thermoreactive clips for secondary sternal closure in cases of noninfective sternal dehiscence.

    PubMed

    Gucu, Arif; Toktas, Faruk; Eris, Cuneyt; Ata, Yusuf; Turk, Tamer

    2012-01-01

    Postoperative sternal dehiscence is a potentially catastrophic sequela to median sternotomy that can cause not only chest-wall discomfort and pulmonary dysfunction but infection, both superficial and mediastinal. Nitinol thermoreactive clips use a novel material in the treatment of sternal dehiscence. We sought to determine whether the use of these clips is an effective remedy for noninfective sternal dehiscence. From January 2008 through December 2011, we retrospectively studied the data on 10 patients whose sternums had been closed with nitinol thermoreactive clips after the development of noninfective sternal dehiscence. Diagnosis was made on the bases of clinical criteria, chest radiography, and microbiological investigation. There was no control group. No procedure-related sequelae occurred. There was no recurrent sternal instability and dehiscence, sternal-related hemorrhage, superficial wound infection, or mediastinal infection. We believe that the use of nitinol thermoreactive clips is a safe, easy, and efficient method of secondary sternal closure for noninfective sternal dehiscence.

  11. Sternal wrapping for the prevention of sternal morbidity in elderly osteoporotic patients undergoing median sternotomy.

    PubMed

    Kirbas, Ahmet; Celik, Sezai; Gurer, Onur; Yildiz, Yahya; Isik, Omer

    2011-01-01

    Osteoporosis, a major risk factor for sternum-related morbidity after median sternotomy, is quite prevalent among the elderly. In this prospective study, we investigated the potential of sternal protection by use of the "sternal wrapping method" in elderly osteoporotic patients who were undergoing median sternotomy.For this study, we chose 100 elderly osteoporotic patients who were scheduled to undergo median sternotomy. During surgery, we wrapped the sternal edges with polyvinyl chloride tubing in 50 patients (group 1) and omitted the sternal wrapping in the remaining 50 patients (group 2). We then compared the groups with regard to postoperative pain, bleeding, early and late sternum-related morbidity, sternal fractures, and duration of hospitalization.Sternal wrapping was associated with fewer sternal fractures, less chest pain, and shorter hospital stays. Overall sternal morbidity was significantly less common among patients with sternal wrapping (4% vs. 20%, P = 0.03); however, the difference in individual rates for early and late dehiscence or deep sternal infection did not reach statistical significance.Sternal wrapping using polyvinyl chloride tubes provides mechanical protection and, apparently, less postoperative chest pain and shorter hospitalizations. Probably, it reduces sternum-related complications, particularly in high-risk patients. Its benefits, however, should be confirmed in larger studies.

  12. Failure analysis of explanted sternal wires.

    PubMed

    Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che

    2005-05-01

    To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires.

  13. Handling difficult materials: Aseptic packaging

    SciTech Connect

    Lieb, K.

    1994-03-01

    Since aseptic packages, or drink boxes, were introduced in the US in the early 1980s, they have been praised for their convenience and berated for their lack of recyclability. As a result, aseptic packaging collection has been linked with that of milk cartons to increase the volume. The intervening years since the introduction of aseptic packaging have seen the drink box industry aggressively trying to create a recycling market for the boxes. Communities and schools have initiated programs, and recycling firms have allocated resources to see whether recycling aseptic packaging can work. Drink boxes are now recycled in 2.3 million homes in 15 states, and in 1,655 schools in 17 states. They are typically collected in school and curbside programs with other polyethylene coated (laminated) paperboard products such a milk cartons, and then baled and shipped to five major paper companies for recycling at eight facilities.

  14. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  15. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here.

  16. Repair of Inferior Sternal Cleft Using Bilateral Sternal Bar Turnover Flaps in a Patient with Pentalogy of Cantrell

    PubMed Central

    Yeow, Vincent Kok-Leng

    2014-01-01

    We report a case of sternal reconstruction using bilateral sternal bar turnover flaps in a 4-year-old boy with an inferior sternal cleft, as part of Cantrell's pentad. When the patient was 10 months old, he underwent sternal reconstruction using a resorbable poly-L-lactic-polyglycolic acid plate in the first stage when there was insufficient autogenous tissue to provide a reliable reconstruction. Bilateral sternal bar turnover was performed in the second stage at 4 years of age. This operative technique is described in this report. This novel technique provides a robust, dynamic, and reliable reconstruction for inferior sternal defects. PMID:24511499

  17. Bilateral congenital pseudoarthrosis of the clavicles in a newborn

    PubMed Central

    Kalagiri, Ram R.; Hemingway, Martha; Beeram, Madhava R.

    2016-01-01

    Bilateral congenital pseudoarthrosis of the clavicles is extremely rare. We report a case of this entity presenting in the neonatal period. We highlight the importance of the differential diagnosis when clavicular fracture shows no evidence of healing or occurs bilaterally. PMID:27695169

  18. Analysis of Sternal Fixation Results According to Plate Type in Sternal Fracture

    PubMed Central

    Byun, Chun Sung; Park, Il Hwan; Hwang, Wan Jin; Lee, Yeiwon; Cho, Hyun Min

    2016-01-01

    Background Sternal fractures are relatively rare, and caused mainly by blunt anterior chest wall trauma. In most cases, sternal fractures are treated conservatively. However, if the patient exhibits problematic symptoms such as intractable chest wall pain or bony crepitus due to sternal instability, surgical correction is indicated. But no consensus exists regarding the most appropriate surgical method. We analyzed the results of surgical fixation in cases of sternal fracture in order to identify which surgical method led to the best outcomes. Methods We retrospectively reviewed the medical records of patients with sternal fractures from December 2008 to December 2011, and found 19 patients who underwent open reduction and internal fixation of the sternum with a longitudinal plate (L-group) or a T-shaped plate (T-group). We investigated patients’ characteristics, clinical details regarding each case of chest trauma, the presence of other associated injuries, the type of open reduction and fixation, whether a combined operation was performed, and postoperative complications. Results Of the 19 patients, 10 patients (52.6%) were male, and their average age was 56.8 years (range, 32 to 82 years). Seven patients (36.8%) had isolated sternal fractures, while 12 (63.2%) had other associated injuries. Seven patients (36.8%) were in the L-group and 12 patients (63.2%) were in the T-group. Three patients in the L-group (42.9%) showed a loosening of the fixation. In all patients in the T-group, the fracture exhibited stable alignment. Conclusion Open reduction and internal fixation with a T-shaped plate in sternal fractures is a safer and more efficient treatment method than treatment with a longitudinal plate, especially in patients with a severely displaced sternum or anterior flail chest, than a longitudinal plate. PMID:27733996

  19. Cabled butterfly closure: a novel technique for sternal closure.

    PubMed

    Jolly, Shashank; Flom, Beau; Dyke, Cornelius

    2012-10-01

    Impaired sternal wound healing remains problematic after median sternotomy and can lead to significant morbidity after cardiac surgical procedures. Although metal plating systems exist for closing the sternum, their use is limited by expense and practicality, and simple wire closure remains the most common technique to close the sternum. We describe a cabling technique for sternal closure that is secure, uses standard sternal wire, and may be used on every patient. We have used the technique routinely in 291 patients with no sternal dehiscence or wound healing problems.

  20. Surgical Repair of a Superior Sternal Cleft in an Infant

    PubMed Central

    Klein, Tobias; Kellner, Maximilian; Boemers, Thomas Michael; Mack-Detlefsen, Birte

    2015-01-01

    Sternal cleft is a rare congenital malformation with little more than 100 cases published worldwide. Incomplete sternal clefting in a female newborn is the most frequent form seen. First-line treatment is the surgical defect closure in the neonatal period. Presurgical examination has to focus on common associated malformations, in particular cardiac defects. The surgical repair of sternal cleft itself shows satisfying functional and cosmetic results with low complication rates. We present the case of a 4-month-old male infant with a superior sternal cleft. PMID:26788449

  1. Computed Tomographic Evaluation of Presumptively Normal Canine Sternal Lymph Nodes.

    PubMed

    Iwasaki, Ryota; Mori, Takashi; Ito, Yusuke; Kawabe, Mifumi; Murakmi, Mami; Maruo, Kohji

    The sternal lymph nodes receive drainage from a wide variety of structures in the thoraco-abdominal region. Evaluation of these lymph nodes is essential, especially in cancer patients. Computed tomography (CT) can detect sternal lymph nodes more accurately than radiography or ultrasonography, and the criteria of the sternal lymphadenopathy are unknown. The purpose of this retrospective study was to describe the CT characteristics of the sternal lymph nodes in dogs considered unlikely to have lymphadenopathy. The ratio of the short axis dimension of the sternal lymph nodes to the thickness of the second sternebra was also investigated. At least one sternal lymph node was identified in each of the 152 dogs included in the study. The mean long axis and short axis dimensions were 0.700 cm and 0.368 cm, respectively. The mean ratio of the sternal lymph nodes to the second sternebrae was 0.457, and the 95% prediction interval ranged from 0.317 to 0.596 (almost a fixed value independent of body weight). These findings will be useful when evaluating sternal lymphadenopathy using CT.

  2. Congenital medium sternal cleft with partial ectopia cordis repair.

    PubMed

    Sousa, Paulo Rego; Antunes, Sónia; Couto, Alexandra; Santos, Gonçalo Cassiano; Leal, Luis Gagp; Magalhães, Manuel Pedro

    2009-01-01

    Congenital sternal malformation is a rare anomaly often diagnosed as an asymptomatic condition at birth. The authors report a clinical case of a full-term female neonate with congenital sternal cleft and partial ectopia cordis. Successful surgical repair was accomplished at 6 days of age. When surgery is performed shortly after birth, the procedure is easier and better results are achieved.

  3. Embryology, sternal clefts, ectopia cordis, and Cantrell's pentalogy.

    PubMed

    Engum, Scott A

    2008-08-01

    Sternal clefts, ectopia cordis, and Cantrell's pentalogy continue to be very rare congenital anomalies in pediatric surgery. Unfortunately, these conditions present as neonatal emergencies and demand early surgical intervention. This article reviews the embryological development of the chest wall, specific sternal defect anomalies, along with available methods of treatment.

  4. Primary Closure of A Sternal Cleft in A Neonate

    PubMed Central

    Ramdial, Shaal; Pillay, Desigan; Madaree, Anil

    2016-01-01

    A three day old neonate was referred to our department with a problem of a sternal cleft. Sternal clefts are often associated with a myriad of other abnormalities ranging from mild to severe. We present our experience with such a problem, and review the current literature concerning it. PMID:27853697

  5. Amoxicillin-induced acute aseptic meningitis.

    PubMed

    Prieto-González, Sergio; Escoda, Rosa; Coloma, Emmanuel; Grau, Josep M

    2011-03-01

    A 58-year-old man presented to the hospital with fever and headache after amoxicillin intake. Physical examination, laboratory, and a cranial CT scan were unremarkable. Cerebrospinal fluid (CSF) testing revealed lymphocytic pleocytosis. After discontinuation of amoxicillin and symptomatic care, the patient quickly improved. Interestingly, he had had two prior episodes of aseptic meningitis that were probably also related to the administration of amoxicillin. Aseptic meningitis can be caused by multiple non-infectious conditions including drugs, malignancy, and autoimmune diseases. We report a case associated with amoxicillin that meets the criteria of drug-induced aseptic meningitis. Considering the wide utilization of amoxicillin, healthcare providers should be aware of it as a possible cause of drug-induced aseptic meningitis.

  6. Brucella melitensis sternal osteomyelitis following median sternotomy.

    PubMed

    Chin, Yoon T; Krishnan, Monica; Burns, Phillipa; Qamruddin, Ahmed; Hasan, Ragheb; Dodgson, Andrew R

    2014-09-01

    Human brucellosis, a zoonotic infection, may present with a range of symptoms but is rarely described as a cause of surgical site infections. We present the first reported case of Brucella melitensis causing sternal osteomyelitis of a midline sternotomy for a coronary artery bypass graft. The operation was performed in a non-endemic country but the patient had travelled to Syria immediately before surgery, where the infection was assumed to have been acquired. The infection resolved following treatment with doxycycline, rifampicin and gentamicin. We review the literature for surgical site infections related to Brucella species and discuss the infection control implications. Human brucellosis has the potential to cause surgical site infections and it should be in the differential diagnosis of any patient with a relevant exposure history presenting with a febrile illness and musculoskeletal findings.

  7. Aseptic laboratory techniques: plating methods.

    PubMed

    Sanders, Erin R

    2012-05-11

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak

  8. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  9. Closing the cleft over a throbbing heart: neonatal sternal cleft

    PubMed Central

    J, Ashok Raja; G, Mathevan; K, Mathiarasan; P, Ramasubramaniam

    2014-01-01

    Sternal cleft is a rare anomaly comprising 0.5% of chest wall malformations. We present a case of a neonate with a ‘V’-shaped upper partial sternal cleft at birth. A hyperpigmented cutaneous nevi was present over the cleft. Primary approximation and closure of the defect was performed at 1 week of life. We discuss the presentation and management, and review the literature. PMID:25100810

  10. [Early reconstruction of congenital pseudoarthrosis of the tibia with free vascularized fibular grafts].

    PubMed

    Fernández Gómez, E; Castro Torre, M; González-Herranz, P; Delgado Sotorrío, C; Rodríguez Lorenzo, A

    2012-04-01

    Congenital pseudoarthrosis of the tibia (CPT) is an uncommon disease presenting a tibial nonunion since birth and frequently associated to neurofibromatosis type 1. Surgical management by wide excision of the pseudoarthrosis and sustitution of the defect with vascularized bone in an early stage has proven to be the most effective technique in terms of bone consolidation. We present a clinical case of a 22-month-old patient with CPT treated successfully by reconstruction with a free vascularized fibula graft with an excellent functional result.

  11. Complete sternal cleft associated with right clavicular, manubrial, and thyroid hypoplasia, pectus deformity, and spinal anomalies.

    PubMed

    Golden, Eleza T; Alazraki, Adina; Loewen, Jonathan; Braithwaite, Kiery

    2016-01-01

    Sternal cleft anomalies are rare. Associated anomalies include pentalogy of Cantrell and posterior fossa abnormalities, hemangiomas, arteriopathy, cardiac anomalies, eye abnormalities, and sternal defects syndrome. There is only a single report of complete sternal cleft, pectus excavatum, and right clavicular hypoplasia in an adult. Thyroid hemiagenesis is also very rare. To our knowledge, this is the first case of complete sternal cleft, pectus deformity, and right clavicular hypoplasia in a child and the first case with right thyroid hemiagenesis.

  12. Pericardial Tamponade: a Rare Complication of Sternal Bone Marrow Biopsy

    PubMed Central

    Santavy, Petr; Troubil, Martin; Lonsky, Vladimir

    2013-01-01

    Injury of the heart with concomitant pericardial tamponade as a result of sternal bone marrow biopsy is rare. An 80-year-old man was admitted with dehydration and non-specified abdominal pain to the regional hospital. Sternal aspiration biopsy was performed because of anemia and thrombocytopenia. Later on, because of the back pain, general weakness and blood pressure drop, an echocardiography examination was indicated. Pericardial fluid collection was found. Anticipated ascending aortic dissection was excluded on computed tomography scan, but pericardial fluid collection was confirmed. Transfer to our cardiac surgical facility ensued. Limited heart tamponade was affirmed on echocardiography and surgery was immediately indicated. Blood effusion was found in upper mediastinal fat tissue and 300 mL of blood were evacuated from opened pericardial space. Stab wound by sternal biopsy needle at the upper part of ascending aorta was repaired by pledgeted suture. Postoperative course was uneventful. PMID:24179668

  13. Congenital sternal foramen in a stillborn Holstein calf.

    PubMed

    Azizi, Shahrzad; Bakhtiary, Mohsen Khosravi; Goodarzi, Mehdi

    2012-01-01

    Congenital sternal foramen is an anomaly whose occurrence is rare in human but is especially unusual in animals. This defect was formed when fusion of multiple ossification centers was incomplete. It may be associated with other lesions in body organs especially cardiac anomalies. In the present study, we report a very rare case of congenital sternal foramen in a Holstein calf. The oval defect was like a gunshot wound and located at the lower third of the sternum. Apparently, the rest of skeleton system seems normal. The awareness of the anomaly is important for better diagnosis and treatment of diseases.

  14. Congenital sternal foramen in a stillborn Holstein calf

    PubMed Central

    Azizi, Shahrzad; Bakhtiary, Mohsen Khosravi; Goodarzi, Mehdi

    2012-01-01

    Congenital sternal foramen is an anomaly whose occurrence is rare in human but is especially unusual in animals. This defect was formed when fusion of multiple ossification centers was incomplete. It may be associated with other lesions in body organs especially cardiac anomalies. In the present study, we report a very rare case of congenital sternal foramen in a Holstein calf. The oval defect was like a gunshot wound and located at the lower third of the sternum. Apparently, the rest of skeleton system seems normal. The awareness of the anomaly is important for better diagnosis and treatment of diseases. PMID:23569841

  15. Pulmonary agenesis associated with dextrocardia, sternal defects, and ectopic kidney.

    PubMed

    Eroglu, Atilla; Alper, Fatih; Turkyilmaz, Atila; Karaoglanoglu, Nurettin; Okur, Adnan

    2005-12-01

    Pulmonary agenesis is a rare embryological defect, usually unilateral, and is associated with skeletal, cardiovascular, and other anomalies. A 22-month-old girl was admitted to our clinic with recurrent pulmonary infections. A chest X-ray and multidetector computed tomography (MDCT) revealed pulmonary agenesis with dextrocardia, sternal defects, and a right pelvic ectopic kidney. We report on the first known case of right-sided pulmonary agenesis combined with isolated dextrocardia, sternal defects, and an ectopic kidney. The importance of MDCT for the diagnosis of pulmonary agenesis and associated other anomalies is demonstrated.

  16. Early acute aseptic iritis after cataract extraction.

    PubMed

    Allen, H F; Grove, A S

    1976-01-01

    Severe iritis which occurs within the first five days after cataract extraction may be categorized as (1) bacterial endophthalmitis, (2) toxic iritis, or (3) aseptic iritis. These entities can sometimes be distinguished because of their clinical features. If bacterial endophthalmitis is suspected, anterior chamber paracentesis should be considered and appropriate antibiotic treatment should be initiated. Acute iritis may result from the introduction of toxic agents into the eye, and may follow the use of products sterilized with ethylene oxide. Early acute aseptic iritis probably occurs more often than has previously been recognized. Response to intensive anti-inflammatory treatment is usually prompt and dramatic. The judicious use of cryoextraction and the careful manipulation of intraocular tissues may minimize the incidence and the severity of postoperative inflammation.

  17. Sternal fracture due to airbag injury: case report.

    PubMed

    Kapisiz, Nazmiye Selçuk; Ozpolat, Berkant; Kapisiz, Fahri; Yücel, Ertan

    2010-03-01

    Although airbags reduce the overall risk of injury and death from motor vehicle accidents, the airbag may cause injuries during deployment. We present a case of apparently isolated sternal fracture caused by airbag deployment during a motor vehicle crash and we discuss the ultrasonographic diagnosis. We also examine the mechanism of injury caused by the airbag.

  18. [Particle disease--aseptic loosening of the total hip endoprosthesis].

    PubMed

    Kolundzić, Robert; Orlić, Dubravko

    2008-01-01

    Total hip arthroplasty (THA) improves the ability and quality of life in patients with hip dysfunction due to different causes. Aseptic loosening is the major cause of the late hip endoprosthesis failure. It results from aseptic inflammatory reaction induced by the implant wear debris accumulating at the prosthesis interface, and is mediated by numerous cellular and humoral factors. Due to presence of wear debris we call aseptic loosening of the total hip endoprosthesis as "particle disease". In the most important of factors affecting the risk of aseptic instability include patient's age, sex, body mass index, underlying morbidity (reason for THA), endoprosthetic material and surgeon's skill. However, taken together, all these factors explain only a minor part of variability of this phenomenon. Factors that are decisive for the occurrence of aseptic instability are still largely unknown. The existence of "individual disposition" for development of aseptic instability that is not determined by demographic or biomechanical factors is well recognized.

  19. Sterile versus non-sterile glove use and aseptic technique.

    PubMed

    Flores, Ashley

    There is evidence indicating that improvements in infection control practice can reduce the incidence of healthcare-associated infection. This article explores the evidence base for glove use and aseptic technique. There is a lack of evidence regarding the influence of sterile versus clean gloves in clinical care. Therefore in practice, clean and aseptic techniques are often used interchangeably. Nurses must learn to select clean or aseptic technique, and therefore clean or sterile gloves, using a risk assessment protocol. Regular audits of aseptic technique and education are needed to improve care.

  20. Control of the aseptic processing environment.

    PubMed

    Frieben, W R

    1983-11-01

    Methods used by industry with applications to hospital pharmacy for maintaining an aseptic environment in production of sterile pharmaceutical products are discussed. A major source of product contamination is airborne microorganisms. The laminar-airflow workbench with a high-efficiency particulate air filter provides an ultraclean environment for preparation of sterile products. However, the workbench does not guarantee sterility of products and is not effective if not properly installed and maintained or if the operator uses poor aseptic technique. The laminar-airflow workbench should be tested for leaks, airflow velocity, and airflow patterns when installed, and the workbench should be checked periodically thereafter. The workbench should be placed in a cleanroom where traffic and air disturbances that might affect the laminar airflow are eliminated. A major source of airborne microbial contamination in cleanrooms is people. Personnel movement through an area and presence of personnel without lint-free, nonshedding protective garments increase the levels of microbial contaminants in an area. The transport of nonsterile products (bottles, boxes, paper products) into a cleanroom should be minimized. The cleanroom itself should be sanitized and should be immaculate. Microbial or particulate monitoring should be conducted in the cleanroom using a quantitative method, and corrective-action limits should be set. Hospital pharmacists should examine industrial sterile-processing techniques and apply them to the preparation of sterile products.

  1. Primary repair of sternal cleft with a double osteochondroplasty flap

    PubMed Central

    Ballouhey, Quentin; Armendariz, Mateo; Vacquerie, Virginie; Marcheix, Pierre Sylvain; Berenguer, Daniel; Mouliès, Dominique; Fourcade, Laurent

    2013-01-01

    Sternal cleft is a rare congenital malformation affecting the anterior part of the chest wall. Surgical closure is recommended. It should be done early during the neonatal period because of the chest's flexibility. Associated abnormalities may have been previously excluded. Different surgical repairs have been described, but none has been proved to be superior to the others. We present the description of 2 cases managed with an original surgical technique. After dissecting the two sternal bars, they were approximated with several intercostal sutures under close cardiac and respiratory monitoring. A double perichondrium flap technique was then used and resulted in a double perichondrium layer. This technique is suitable for most cases and offers satisfying anatomical restoring and cosmetic results. PMID:23956263

  2. La tuberculose sternale: à propos de 2 cas

    PubMed Central

    Ouarssani, Aziz; Atoini, Fouad; Ait Lhou, Fatima; Idrissi Rguibi, Mustapha

    2012-01-01

    La tuberculose ostéoarticulaire touche surtout le rachis. L’atteinte sternale est rare, elle représente moins de 1% des ostéomyélites tuberculeuses. L’abcès froid compliqué par une fracture pathologique constitue le mode de révélation le plus fréquent. Le traitement chirurgical assure l’évacuation des abcès et permet le diagnostique histologique et bactériologique. On rapporte deux cas de tuberculose sternale âgés respectivement de 45 ans et de 10ans, colligés au service de pneumologie, l’examen histologique et bactériologique ont permis d’affirmer le diagnostic de tuberculose, et le traitement antibacillaire a permis une évolution favorable .A la lumière de ces observations, les auteurs proposent de faire une mise au point sur l’ostéite sternale tuberculeuse. PMID:22514767

  3. [Study on drawing aseptic gas in diluting drugs].

    PubMed

    Fan, Z C; Yu, F Y; Zou, F S

    1996-07-01

    In this study, the gas was drawn from sealed aseptic bottles, the blue flame of an alcohol lamp, and the air of the same treatment room. And the gas was put into aseptic solutions of 10% glucose separately and dripped. Then the samples were taken for bacteriaculture at appointed time-points. Meanwhile, the gases were drawn and put into aseptic solutions of 10% glucose separately. Then deactived penicillines were diluted with the solutions separately. Finally, the penicillines were mixed with 10% glucose and dripped. The samples were taken for bacteria-culture in the same way. The results showed that there was no colony existed in the gas from the sealed aseptic bottles and the flame of the alcohol lamp. However, colonies existed in the samples from the air of the treatment room. It is suggested that sealed aseptic gas should be drawn and kept for use in diluting drugs.

  4. Sternal bands for closure of midline sternotomy leads to better wound healing.

    PubMed

    Bhattacharya, Susmit; Sau, Indrajit; Mohan, Man; Hazari, Kunal; Basu, Rajarshi; Kaul, Ajay

    2007-01-01

    Midline sternotomy is the most common incision for cardiac surgery, but problems of wound healing and sternal instability are still matters of concern. The use of stainless steel wires only was compared with the use of wires plus sternal bands for closure of midline sternotomy wounds in a 2-year period. Of 370 patients in whom only stainless steel wires were used, 14 (3.78%) required re-operation for dehiscence. Only 3 (0.76%) of 395 patients in whom sternal bands were also used, required re-operation for dehiscence. The difference was highly significant. It was concluded that use of sternal bands leads to a more stable union.

  5. Incidental detection of superior sternal cleft on Technetium-99m methylene diphosphonate bone scan

    PubMed Central

    Aland, Nusrat IJ; Pawar, Shwetal Uday; Tilve, Gundu Hari

    2013-01-01

    A sternal cleft is an extremely rare developmental anomaly, which results from failure of fusion of sternal bars which contribute to the formation of the sternum. Most cases are diagnosed in early childhood, where it is associated with serious other midline defects. A sternal cleft is seen as a photopenic area on technetium-99m methylene diphosphonate bone scan and can be confused with other conditions. We report an extremely rare case of isolated upper sternal cleft in a 45-years-old male, found incidentally on Tc-99m MDP bone scan. PMID:24163521

  6. Extracorporeal shockwaves versus surgery in the treatment of pseudoarthrosis of the carpal scaphoid.

    PubMed

    Notarnicola, A; Moretti, L; Tafuri, S; Gigliotti, S; Russo, S; Musci, L; Moretti, B

    2010-08-01

    The peculiar anatomical characteristics and precarious vascularization of the carpal scaphoid are responsible for a difficult healing of fractures and a fairly frequent subsequent evolution to pseudoarthrosis. Recently, extracorporeal shockwaves therapy (ESWT) has yielded encouraging results in the treatment of pseudoarthrosis of various bone segments. We report a retrospective study comparing the results of application of three sessions of shockwaves therapy (SW) with energy flux density (EFD) impulses of 0.09 (SD = 0.02) mJ/mm(2) ESWT emitted by an electromagnetic generator in 58 patients (group I) affected by pseudoarthrosis of the carpal scaphoid, with the results of surgical treatment consisting of stabilization and bone graft according to the Matti-Russe technique, performed in 60 subjects (controls, group II). There were no statistically significant differences in the mean duration of the pseudoarthrosis (p = 0.46), sex distribution (p = 0.41) and mean age at recruitment (p = 0.95) between the two patient groups. Posttreatment clinical-functional assessment, based on the Mayo Wrist Score, showed a significantly improved score, rising from 28-74.6 in group I already after 2 mo (p < 0.001), with 86.3% of the results judged as satisfactory or excellent; in group II the mean score rose from 27.5-74.2 after 2 mo, with 83.4% of the results judged as satisfactory or excellent (p < 0.001). At the same two-months follow-up (FU), radiographic consolidation was shown in 75.9% of patients in group I and 76.7% in group II. These improvements persisted at the subsequent controls at six and 12 mo in both groups. The Mayo Wrist Score and X-rays did not show statistically significant differences at the various FU visits in the two groups (p > 0.05). On the basis of our data, we can conclude that the results of ESWT are comparable with those of surgical stabilization and bone graft in the treatment of scaphoid pseudoarthrosis. In view of their minimal invasiveness, shockwaves

  7. [Treatment of pseudoarthrosis of long bones by surgical stabilization and a transfer of in-vitro cultivated bone marrow interstitial cells].

    PubMed

    Niedźwiedzki, T; Dabrowski, Z; Bonczar, M

    2000-01-01

    The paper presents the results of surgical stabilization of pseudoarthrosis of long bone augmented by a transfer of in vitro cultivated bone marrow interstitium cells in 4 patients. In three cases a Zespol external fixation device was applied without opening the pseudoarthrosis. One patient was treated by open reduction of the bone fragments with the use of frozen spongiose bone grafts. The mean age of the patients was 30.2 years. In two cases the pseudoarthrosis had developed in the tibia, in the remaining two cases it developed in the ulna. The pseudoarthrosis was present for a mean time of 2.5 years. In all cases healing of the pseudoarthrosis was observed after a mean time of 3.7 months.

  8. Sex estimation from sternal measurements using multidetector computed tomography.

    PubMed

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-12-01

    We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation.

  9. Sex Estimation From Sternal Measurements Using Multidetector Computed Tomography

    PubMed Central

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-01-01

    Abstract We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation. Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30–60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090

  10. Invasive Scedosporium sternal osteomyelitis following lung transplant: Cured.

    PubMed

    Denton, E J; Smibert, O; Gooi, J; Morrissey, C O; Snell, G; McGiffin, D; Paraskeva, M

    2016-06-01

    Scedosporium is an important pathogen in cystic fibrosis (CF) and post-transplant but rarely causes invasive infection. Treatment remains challenging, particularly due to inherent resistance to multiple antifungal agents. We present a young man with CF who developed invasive sternal and rib infection 10-months following lung transplant. The infection has been clinically and radiologically cured with extensive surgery and triazole therapy. This case highlights the importance of adjunctive surgery in addition to prolonged triazole treatment to manage invasive Scedosporium infections in immunosuppressed patients.

  11. Sternal force-displacement relationship during cardiopulmonary resuscitation.

    PubMed

    Gruben, K G; Guerci, A D; Halperin, H R; Popel, A S; Tsitlik, J E

    1993-05-01

    A viscoelastic model is presented to describe the dynamic response of the human chest to cyclic loading during manual cardiopulmonary resuscitation (CPR). Sternal force and displacement were measured during 16 clinical resuscitation attempts and during compressions on five CPR training manikins. The model was developed to describe the clinical data and consists of the parallel combination of a spring and dashpot. The human chests' elastic and damping properties were both augmented with increasing displacement. The manikins' elastic properties were stiffer and both elastic and damping properties were less dependent on displacement than the humans'.

  12. Congenital pseudoarthrosis of the tibia: healing by lengthening over a rod without compression of the nonunion. A preliminary report.

    PubMed

    Muhammad Abdul Jamil, Muhammad Kamal; Abdul Rashid, Abdul Halim; Ibrahim, Sharaf

    2013-05-01

    This preliminary report is on two patients with congenital pseudoarthrosis of the tibia who had a persistent nonunion following intramedullary rodding and bone grafting. We do not advocate repeated surgery to achieve union. When limb length discrepancy becomes greater than 5 cm, we proceeded with an Ilizarov procedure with the primary aim of equalizing limb length rather than achieving union. Healing of the pseudoarthrosis occurred in both patients after lengthening over the intramedullary rod without compression of the nonunion site. We believe that union occurs because of hyperaemia during the lengthening. This approach minimizes the repeated surgeries that are usually needed and thus ensures a more normal childhood without frequent hospitalizations.

  13. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery.

    PubMed

    Chen, Jenny X; Alkire, Blake C; Lam, Allen C; Curry, William T; Holbrook, Eric H

    2016-10-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics.

  14. Aseptic practice recommendations for circulating operating theatre nurses.

    PubMed

    Aholaakko, Teija-Kaisa; Metsälä, Eija

    Aseptic practices prevent exposure of a surgical wound to microbes, operating theatre environment and personnel. The circulating nurse assists the operating theatre personnel and supervises aseptic practices preventing surgical site infections. In the absence of analytical tools, few studies exist on intraoperative nursing-related aseptic practices. This study introduces recommendations to assess the role of the circulating nurse in aseptic practices. The authors used international recommendations and research findings to construct a 20-item self-report instrument with a demonstrated reliability across the scale. The authors structured the scale based on three phases: establishment; maintenance; and disestablishment of a sterile operating field. The tool was tested among operating theatre and day surgery nurses, and compared the differences in the mean acceptance rates of aseptic practice recommendations based on background characteristics. College-level nurses and nurses with 15 or more years' work experience accepted the recommendations at higher levels than bachelor-level nurses and nurses with less work experience. Continual assessment of the evidence base and comprehensive evaluation represent important components in further developing the tool. A reasonable number of items covering clinical practice are necessary for assessing the effectiveness and cost-effectiveness of aseptic practices, and a larger response rate is needed to validate the tool in future.

  15. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery

    PubMed Central

    Chen, Jenny X.; Alkire, Blake C.; Lam, Allen C.; Curry, William T.; Holbrook, Eric H.

    2016-01-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics. PMID:27722072

  16. The Association between Blunt Cardiac Injury and Isolated Sternal Fracture

    PubMed Central

    McMaster, Jason; Desai, Pathik J.; Desai, Sapan S.; Kuy, SreyRam; Mata, Maggy; Cooper, Jamie

    2014-01-01

    The treatment of isolated sternal fractures (ISF) throughout the world is heterogeneous. This study aimed to identify the incidence, morbidity, and mortality associated with isolated fractures of the sternum and describe current practice for diagnosis and management of ISF and cardiac injury at a level I trauma center in the UK. A retrospective cohort study of adult patients (>16 years) with ISF presenting from 2006 to 2010 was conducted. Eighty-eight patients with ISF were identified. Most patients (88%, 77) were admitted to hospital with 66% (58) of them discharged within 48 hours. Two (2%) patients had an ER EKG with abnormality but both resolved to normal sinus rhythm within 6 hours of follow-up. Serum CEs were drawn from 55 (63%) patients with only 2 (2%) having a rise in serum troponin >0.04; however, in both of these patients troponin quickly normalized. Six (7%) patients underwent echocardiograms without significant findings. In all 88 patients with ISF, no cases of clinically significant cardiac injury were identified. Patients presenting with an isolated sternal fracture with no changes on EKG or chest X-ray do not warrant an admission to hospital and may be discharged from the ER. PMID:24653859

  17. Complete sternal cleft — A rare congenital malformation and its repair in a 3-month-old boy: A case report

    PubMed Central

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S.; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  18. Primary repair of sternal cleft in infancy using combined periosteal flap and sliding osteochondroplasty

    PubMed Central

    Muthialu, Nagarajan

    2013-01-01

    Sternal clefts are rare congenital malformations of the chest wall. Immediate correction in neonates or in infancy is beneficial in terms of providing skeletal cover with little or no need for any prosthetic material for reconstruction. In the absence of internal midline defects, one should aim to provide complete correction when the chest wall is still compliant, and cardiorespiratory compromise is expected to be least after correction. We report on 2 children who underwent primary sternal-cleft repair using a periosteal advancement flap along with mobilization of lateral sternal bars after sliding osteotomy of corresponding ribs. PMID:23427313

  19. Sternal stress fracture in a middle-aged woman.

    PubMed

    Lee, Justin; Fields, Karl Bertrand

    2017-02-07

    A middle-aged premenopausal woman presented with 3 months of right chest wall pain after beginning a new weight training programme. Examination was significant only for mild-to-moderate tenderness to palpation over the right pectoral muscle and sternoclavicular joint. In-office musculoskeletal ultrasound scan, chest X-ray and shoulder X-rays were unremarkable. Subsequent MRI of the chest wall showed oedema in the sternum at the level of the sternoclavicular joint consistent with a sternal stress fracture. She was started on calcium and vitamin D supplementation and told to rest for 6 weeks. After this she began to gradually increase her activity and was pain free after 4 months.

  20. Cat scratch disease complicated with aseptic meningitis and neuroretinitis.

    PubMed

    Pinto Jr, Vitor Laerte; Curi, André Land; Pinto, Adriana da Silva; Nunes, Estevão Portela; Teixeira, Maria de Lourdes Benamor; Rozental, Tatiana; Favacho, Alexsandra Rodrigues; Castro, Elba Lemos de; Bóia, Márcio Neves

    2008-04-01

    Cat scratch disease (CSD) is a self limited condition characterized by fever, lymph node enlargement and less often eye involvement. Central nervous system involvement by Bartonella henselae infection is possibly an important cause of morbidity; its role as an agent of aseptic meningitis is unknown. We report a case of a 40 years-old man with CSD accompanied by aseptic meningitis and neuroretinitis. Serum indirect immmunofluorescence (IFI) assays for B. henselae were positive and the cerebrospinal fluid (CSF) analysis showed mononuclear pleocytosis and increased level of protein. Serological tests for other etiologies were negative. The patient responded well to antibiotic therapy with oral doxycicline plus rifampin and in the 12th day of hospitalization evolved to total regression of the headache and partial regression of the visual loss. Clinicians should consider CSD as a differential diagnosis when assessing previously healthy patients with aseptic meningitis associated with regional lymphadenopathy and epidemiological history of feline contact.

  1. Laparoscopic greater omentum harvesting with split-thickness skin grafting for sternal wound dehiscence.

    PubMed

    Barragan, Barnard A; Halldorsson, Ari O; Wachtel, Mitchell S; Frezza, Eldo E

    2006-09-01

    Sternal wound dehiscence is a serious complication occasionally requiring soft tissue coverage. The greater omentum typically has been used as a last resort because of the underlying morbidity from a laparotomy. We present a case in which a laparoscopically created omental flap with subsequent split-thickness skin grafting was used to correct a large soft tissue defect that occurred after sternal wound dehiscence developed. A nonambulatory 49-year-old man who underwent coronary artery bypass grafting developed sternal wound dehiscence. Because a large soft tissue defect developed after multiple debridements, soft tissue coverage was required. A laparoscopically harvested omental flap spared this man's upper extremity musculature and provided a soft tissue bed for split-thickness skin grafting. This case helps to establish the role of laparoscopically harvested omentum. If the results suggested by this case are confirmed in a large series, omental flaps should be considered as options of first choice in the management of sternal wound dehiscence.

  2. Sternal fractures and delayed cardiac tamponade due to a severe blunt chest trauma.

    PubMed

    Liang, Huai-min; Chen, Qiu-lin; Zhang, Er-yong; Hu, Jia

    2016-04-01

    Sternal fractures caused by blunt chest trauma are associated with an increased incidence of cardiac injury. Reports of the incidence of cardiac injury associated with sternal fracture range from 18% to 62%. Delayed cardiac tamponade is a rare phenomenon that appears days or weeks after injury. Moreover, after nonpenetrating chest trauma, cardiac tamponade is very rare and occurs in less than 1 of 1000. This case describes a patient who had delayed cardiac tamponade 17 days after a severe blunt chest trauma.

  3. Fixation of sternal fracture using absorbable plating system, three years follow-up

    PubMed Central

    Katballe, Niels; Pilegaard, Hans

    2015-01-01

    Sternal fractures occur due to severe chest wall trauma in a small number of patients. They are often conservatively treated. The surgical intervention, although controversial, is indicated in case of deformity, severe pain, and ventilatory complications. We report the first case where absorbable plate has been used to fix a traumatic fracture in a 42-year-old female. After 3 years, the patient is still free of symptoms and CT scanning reveals intact sternal bone structure. PMID:26101659

  4. Risk factors for deep sternal wound infection after sternotomy: a prospective, multicenter study.

    PubMed

    1996-06-01

    Several risk factors for deep sternal wound infection after sternotomy remain unclear. To assess and compare risk factors among units, a prospective study included 1830 patients in 10 units during a 4-month period: 960 underwent coronary artery bypass grafting and 870 underwent other procedures. According to the Centers for Disease Control and Prevention definitions, 2.3% of patients (42/1830) acquired a deep sternal wound infection. Independent risk factors for deep sternal wound infection were obesity, coronary artery bypass grafting, reoperation, and postoperative inotropic support. Independent risk factors after coronary artery bypass grafting were obesity, bilateral internal thoracic artery grafting, reoperation, and postoperative inotropic support. In all five of the units usually performing bilateral internal thoracic artery graftings, this procedure was associated with high risk of deep sternal wound infection. Duration of operation was a major risk factor in comparison of the unit with the highest risk of deep sternal wound infection with the other nine units; this suggests that parameters related to the perioperative period were involved. Multicenter surveillance is useful to determine reliable risk factors for deep sternal wound infection, to define a high-risk population before operation, and to assess unit-specific risk factors.

  5. Pseudoarthrosis and fracture: interaction between severe vitamin D deficiency and primary hyperparathyroidism.

    PubMed

    Rastogi, Ashu; Bhadada, Sanjay Kumar; Bhansali, Anil

    2013-11-01

    A young woman with severe vitamin D deficiency presented with proximal muscle weakness, fragility fracture and pseudoarthrosis. On evaluation, she was found to have hypercalcaemia, a single parathyroid adenoma and an undetectable 25-hydroxyvitamin D level. She received parenteral cholecalciferol and subsequently underwent curative parathyroidectomy. Postoperatively, she had hungry bone syndrome, which she gradually recovered from with calcium and calcitriol replacement. Notably, her calcium levels were in the lower limit of normal range and associated with elevated alkaline phosphatase levels at postoperative Day 14. Follow-up for the next four years showed that the patient had remarkable symptomatic and radiological improvements. In this report, we discuss the pathophysiological interactions between vitamin D deficiency and associated primary hyperparathyroidism.

  6. Isolation and Characterization of Multipotential Mesenchymal Stromal Cells from Congenital Pseudoarthrosis of the Tibia: Case Report.

    PubMed

    Diaz-Solano, Dylana; Wittig, Olga; Mota, Jose D; Cardier, Jose E

    2015-10-01

    Congenital pseudoarthrosis of the tibia (CPT) is an uncommon disease whose etiology and pathogenesis is unknown. Several evidences suggest that decreased osteogenic capacities, impaired local vascularization, and microenvironment alterations may play a role in the pathogenesis of CPT. Additionally, it is not clear if the pathogenesis of this disease is related to the absence of cells with osteogenic capacity of differentiation. In this work, a two-year-old patient diagnosed with CPT underwent an orthopedic surgery to promote bone union in a pseudoarthrosis lesion. Tissue from CPT lesion was excised, and histological evaluation and tissue culture were performed. Histologic analysis of the soft CPT lesion showed the presence of highly cellular fibrous tissue, vascularization, and abundant extracellular matrix. Fusiform cells of mesenchymal appearance were observed but osteoblasts, osteoclasts, chondrocytes, and adipose cells were not found. There was no evidence of osteogenesis. CPT tissue cultured as explants showed, after one month of culture, evidence of osteogenesis, chondrogenesis, and adipogenesis. Cells isolated from explants of CPT tissue showed a fibroblast-like morphology and expressed the mesenchymal stromal cell (MSC) markers: CD105, CD73, and CD90 (CPT-MSC). Functional analysis showed that CPT-MSC differentiate, in vitro, into osteogenic, chondrogenic, and adipocytic cells. CPT-MSC expressed osteocalcin and agrecan. CPT-MSC produced collagen in the presence of ascorbic acid. MSC from BM of normal individuals were used as control. In summary, our results indicate that CPT tissue contains MSC with osteogenic capacity of differentiation. It is possible that CPT microenvironment may contribute to impair the osteogenic capacity of differentiation of CPT-MSC.

  7. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  8. Cervical myelopathy caused by atlas osteochondroma and pseudoarthrosis between the osteochondroma and lamina of the axis: case report.

    PubMed

    Miyakoshi, Naohisa; Hongo, Michio; Kasukawa, Yuji; Shimada, Yoichi

    2010-01-01

    A 58-year-old man presented with a 6-month history of progressive cervical myelopathy. Magnetic resonance imaging and computed tomography of the cervical spine revealed a bone tumor arising from the posterior arch of the atlas and osteophytes at a pseudoarthrosis between the tumor and the lamina of the axis, resulting in marked spinal cord compression. The patient's symptoms resolved after en bloc resection of the tumor and removal of the osteophytes. The histological diagnosis was osteochondroma. The primary cause of myelopathy in the present case was osteochondroma arising from the posterior arch of the atlas, but the osteophyte formations appearing at the pseudoarthrosis between the atlas osteochondroma and the lamina of the axis might also have contributed to the symptoms, which appeared when the patient was in his late 50s.

  9. An unconventional indication of the Sauve' - Kapandji procedure in a radial shaft pseudoarthrosis and chronic DRUJ dislocation: a case report.

    PubMed

    Theodorakis, E; Fanelli, M; Ottolenghi, P; Pappalardo, S

    2013-01-01

    We present a 42-years-old male who developed a radial shaft pseudoartrosis and a chronic DRUJ dislocation/instability, following a Galeazzi fracture. He presented to our Office with a severe inability of wrist and forearm motion. A Sauve'-Kapandji procedure was adopted, performing a lateral approach to the ulna and grafting the excised ulnar block to retrieve radial length at the pseudoarthrosis level. Cancellous bone grafts from the iliac crest were also applied and mixed with autologous platelet rich plasma to promote callus formation. The goal was to create an intentional pseudoarthrosis of the distal ulna combined with a DRUJ arthrodesis, in order to resolve instability and regain forearm pronation/supination. We obtained bone healing, an excellent clinical recovery, and the patient returned to all his previous activities six months after surgery. To our knowledge, this is the first reported case of a radial shaft psudoarthrosis treated with the Sauve'-Kapandji technique.

  10. Aseptic meningitis due to Frater type virus in Ontario.

    PubMed

    KELEN, A; LESIAK, J; LABZOFFSKY, N A

    1963-07-06

    During the summer and fall of 1959 and 1960 a virus was isolated on 14 occasions from the stool or cerebrospinal fluid or both of 12 patients with a clinical picture of non-paralytic poliomyelitis or aseptic meningitis. The patients were from eight different localities in Ontario. The isolated virus was not neutralized by antisera to any of the known enteroviruses, reoviruses or adenoviruses, nor did antiserum to the isolate neutralize any of these viruses. Antiserum to Frater virus, however, did neutralize this isolate and in turn was itself neutralized by antiserum to this virus. Frater virus was isolated in Scotland from cases of aseptic meningitis during the same period in 1959 and 1960. In Ontario this virus was not encountered before 1959. Isolation of the virus from cerebrospinal fluid and demonstration of immunological response in the patients establish its etiological significance. Biological characteristics indicate that it belongs to the Echo group.

  11. Causes of Aseptic Persistent Pain after Total Knee Arthroplasty

    PubMed Central

    Lim, Hong-An; Seon, Jong-Keun; Park, Kyung-Soon; Shin, Young-Joo; Yang, Hong-Yeol

    2017-01-01

    Background Persistent pain after total knee arthroplasty (TKA) is dissatisfying to the patient and frustrating to the surgeon. The purpose of this study is to evaluate the aseptic causes and clinical course of intractable pain following TKA. Methods Of the total 2,534 cases of primary TKA reviewed, 178 cases were classified as having aseptic persistent pain that was not resolved within 1 year after surgery. Except for the cases with periprosthetic fracture (56 knees), 122 cases of aseptic painful TKA were divided into two groups: intra-articular group (83 knees) and extra-articular group (39 knees). Results In the intra-articular group, the main reasons for pain were aseptic loosening (n = 40), polyethylene wear (n = 16), instability (n = 10), recurrent hemarthrosis (n = 5), patellar maltracking (n = 4), tendon ruptures (n = 4), and stiffness (n = 2). In the extraarticular group, 10 knees (25.6%) were found to have nerve entrapment in the spine, 6 knees (15.4%) were found to have hip osteoarthritis or femoral head avascular necrosis. The reasons for persistent knee pain in the remaining 23 knees (59.0%) still remain elusive. Conclusions Persistent pain after TKA originated from pathology of extra-articular origin in a considerable number of cases in this study. Therefore, it is important to perform thorough preoperative evaluations to reduce pain resulting from extra-articular causes. Furthermore, meticulous surgical procedures and optimal alignment are required to reduce pain of intra-articular origin related to implant wear, instability, and patellar maltracking. PMID:28261427

  12. Clinical decision rules to distinguish between bacterial and aseptic meningitis

    PubMed Central

    Dubos, F; Lamotte, B; Bibi‐Triki, F; Moulin, F; Raymond, J; Gendrel, D; Bréart, G; Chalumeau, M

    2006-01-01

    Background Clinical decision rules have been derived to distinguish between bacterial and aseptic meningitis in the emergency room to avoid unnecessary antibiotic treatments and hospitalisations. Aims To evaluate the reproducibility and to compare the diagnostic performance of five clinical decision rules. Methods All children hospitalised for bacterial meningitis between 1995 and 2004 or aseptic meningitis between 2000 and 2004 have been included in a retrospective cohort study. Sensitivity and specificity were calculated by applying each rule to the patients. The best rule was a priori defined as the one yielding 100% sensitivity for bacterial meningitis, the highest specificity, and the greatest simplicity for a bedside application. Results Among the 166 patients included, 20 had bacterial meningitis and 146 had aseptic meningitis. Although three rules achieved 100% sensitivity (95% CI 84–100), one had a significantly lower specificity (13%, 95% CI 8–19) than those of the other two rules (57%, 95% CI 48–65; and 66%, 95% CI 57–73), which were not statistically different. The ease of manual computation of the rule developed by Nigrovic et al (a simple list of five items: seizure, blood neutrophil count, cerebrospinal fluid (CSF) Gram stain, CSF protein, CSF neutrophil count) was higher than the one developed by Bonsu and Harper. Conclusion On our population, the rule derived by Nigrovic et al had the best balance between accuracy and simplicity of manual computation and could help to avoid two thirds of unnecessary antibiotic treatments and hospitalisations. PMID:16595647

  13. Anesthetic management in a case of congenital sternal cleft diagnosed incidentally on the operating table

    PubMed Central

    Gupta, Priyamvada; Kumar, Alok; Jethava, D. D.; Jethava, Durga

    2014-01-01

    Congenital absence of sternum, also known as sternal cleft, is a rare anomaly. It is due to impaired organogenesis leading to nonfusion of sternal bars. It may be of two types- complete or incomplete. It may be associated with other congenital malformations viz., cardiac, anorectal etc., or may be a part of Cantrell's pentalogy. Besides cosmetic concerns, mediastinal structures are at increased risk to damage in case of trauma to the anterior chest wall. Due to restricted mediastinal space, there may be restrictive pulmonary dysfunctions and unstable hemodynamics. It usually presents in the neonatal period or early infancy, rarely in adult age. The defect should be surgically closed as early as possible. If cardiac arrest occurs due to any reason, the only option is open cardiac massage. We report a case of complete congenital sternal cleft accidentally diagnosed on the operation table, while preparing the patient for diagnostic laparotomy. The patient was retrospectively assessed for the presence of other congenital malformations. PMID:25886344

  14. Sternal reconstruction by extracellular matrix: a rare case of phaces syndrome

    PubMed Central

    Molinaro, Francesco; Cerchia, Elisa; Di Crescenzo, Vincenzo Giuseppe; Luzzi, Luca; Bulotta, Anna Lavinia; Gotti, Giuseppe; Messina, Mario

    2016-01-01

    Abstract Congenital defects of the sternum are rare and due to a failure of midline development and fusion of the sternal bones. Surgical correction of a sternal cleft should be preferred during infancy for functional reasons. Chest wall reconstruction represented a complex problem in the last decades. We report our successful outcome of sternal reconstruction in a rare case of PHACES syndrome, in which the patient was submitted to reconstruction of the sternum and complete closure of the thoracic defect by the employ of an extracellular matrix XCM Biologic tissue matrix. We promote the use of extracellular matrix in surgical reconstruction of chest defects for its maneuverability, plasticity, tolerability and the possibility of growing with the children’s chest getting a good compliance and optimal cosmetic results.

  15. A meta-analysis of platelet gel for prevention of sternal wound infections following cardiac surgery

    PubMed Central

    Kirmani, Bilal H.; Jones, Siôn G.; Datta, Subir; McLaughlin, Edward K.; Hoschtitzky, Andreas J.

    2017-01-01

    Deep sternal wound infection and bleeding are devastating complications following cardiac surgery, which may be reduced by topical application of autologous platelet gel. Systematic review identified seven comparative studies involving 4,692 patients. Meta-analysis showed significant reductions in all sternal wound infections (odds ratio 3.48 [1.08–11.23], p=0.04) and mediastinitis (odds ratio 2.69 [1.20–6.06], p=0.02) but not bleeding. No adverse events relating to the use of topical platelet-rich plasma were reported. The use of autologous platelet gel in cardiac surgery appears to provide significant reductions in serious sternal wound infections, and its use is unlikely to be associated with significant risk. PMID:27177403

  16. Pectoralis Muscle Flap Repair Reduces Paradoxical Motion of the Chest Wall in Complex Sternal Wound Dehiscence

    PubMed Central

    Zeitani, Jacob; Russo, Marco; Pompeo, Eugenio; Sergiacomi, Gian Luigi; Chiariello, Luigi

    2016-01-01

    Background The aim of the study was to test the hypothesis that in patients with chronic complex sternum dehiscence, the use of muscle flap repair minimizes the occurrence of paradoxical motion of the chest wall (CWPM) when compared to sternal rewiring, eventually leading to better respiratory function and clinical outcomes during follow-up. Methods In a propensity score matching analysis, out of 94 patients who underwent sternal reconstruction, 20 patients were selected: 10 patients underwent sternal reconstruction with bilateral pectoralis muscle flaps (group 1) and 10 underwent sternal rewiring (group 2). Eligibility criteria included the presence of hemisternum diastases associated with multiple (≥3) bone fractures and radiologic evidence of synchronous chest wall motion (CWSM). We compared radiologically assessed (volumetric computed tomography) ventilatory mechanic indices such as single lung and global vital capacity (VC), diaphragm excursion, synchronous and paradoxical chest wall motion. Results Follow-up was 100% complete (mean 85±24 months). CWPM was inversely correlated with single lung VC (Spearman R=−0.72, p=0.0003), global VC (R=−0.51, p=0.02) and diaphragm excursion (R=−0.80, p=0.0003), whereas it proved directly correlated with dyspnea grade (Spearman R=0.51, p=0.02) and pain (R=0.59, p=0.005). Mean CWPM and single lung VC were both better in group 1, whereas there was no difference in CWSM, diaphragm excursion and global VC. Conclusion Our study suggests that in patients with complex chronic sternal dehiscence, pectoralis muscle flap reconstruction guarantees lower CWPM and greater single-lung VC when compared with sternal rewiring and it is associated with better clinical outcomes with less pain and dyspnea. PMID:27733997

  17. Reconstruction of Chest Wall by Cryopreserved Sternal Allograft after Resection of Aneurysmal Bone Cyst of Sternum

    PubMed Central

    Sheikhy, Kambiz; Abbasi Dezfouli, Azizollah

    2017-01-01

    A 20-year-old female was referred to our hospital due to deformity and bulging in anterior aspect of chest wall in sternal area. Chest X-ray and CT scan confirmed a large mass with destruction of sternum. Pathologic diagnosis after incisional biopsy was compatible with aneurysmal bone cyst. We resected sternum completely and reconstructed large anterior defect by a cryopreserved sternal allograft. In follow-up of patient there was no unstability of chest wall with good cosmetic result. PMID:28299230

  18. Feedback to the field: an assessment of sternal intraosseous (IO) infusion.

    PubMed

    Harcke, H Theodore; Crawley, Geoffrey; Mazuchowski, Edward

    2011-01-01

    Intraosseous vascular infusion (IO) is a recognized alternative to peripheral intravenous infusion when access is inadequate. The sternum and proximal tibia are the preferred sites. A review of 98 cases at autopsy revealed successful sternal IO placement in 78 cases (80%). Assuming a worst case scenario for placement (pin mark and no tip in bone [17 cases] and tip present and not in the sternum [3 cases]), attempts were unsuccessful in 20 cases (20%). We draw no specific conclusions regarding sternal IO use, but hope that personnel placing these devices and those providing medical training can use the information.

  19. Cryptococcal sternal osteomyelitis in a healthy woman: a review of Cryptococcus neoformans.

    PubMed

    Jain, Deepali; Najjar, Mazen; Azher, Qazi; Bachuwa, Ghassan

    2013-04-25

    Cryptococcus, an opportunistic yeast, known to afflict immune-compromised patients is often overlooked in immune-competent patients. This has led to increasing morbidity and mortality worldwide. We present a case of Cryptococcus causing sternal osteomyelitis in an immune-competent individual. Till date no case of Cryptococcus causing sternal osteomyelitis in an immune-competent patient has been reported in the English literature since 1946-2011. With the rising incidence of Cryptococcus infection it should be included among the list of infections causing osteomyelitis. Early detection and prompt treatment can decrease both morbidity and mortality.

  20. Congenital Sternal Cleft along with Persistent Left-Sided Superior Vena Cava: A Rare Presentation

    PubMed Central

    Saha, Anindya Kumar; Sardar, Syamal Kumar; Sur, Amitava

    2013-01-01

    Congenital sternal cleft is a rare abnormality resulting from fusion failure of sternum. It occurs in isolation or along with defects of abdominal wall, diaphragm, pericardium, and heart. Early surgical correction is required to protect the underlying structures for risk of cardiac compression. Here we report a case of 20-day female child presenting with congenital sternal cleft associated with multiple congenital heart disease and left-sided superior vena cava. She was operated by the cardiothoracic surgical team successfully and is doing well on followup. We discuss this rare case, imaging studies, and surgical strategy. PMID:23841006

  1. Clinical translation of a Mesenchymal Stromal Cell-based therapy developed in a large animal model and two case studies of the treatment of atrophic pseudoarthrosis.

    PubMed

    Prat, Salvi; Gallardo-Villares, Santiago; Vives, Marian; Carreño, Ana; Caminal, Marta; Oliver-Vila, Irene; Chaverri, Daniel; Blanco, Margarita; Codinach, Margarita; Huguet, Pere; Ramírez, José; Pinto, Javier A; Aguirre, Màrius; Coll, Ruth; Garcia-López, Joan; Granell-Escobar, Fernando; Vives, Joaquim

    2016-09-29

    Pseudoarhtrosis is a relatively frequent complication of fractures, in which the lack of mechanical stability and biological stimuli results in the failure of bone union, most frequently in humerus and tibia. Treatment of recalcitrant pseudoarthrosis relies on the achievement of satisfactory mechanical stability combined with adequate local biology. Herein we present two cases of atrophic pseudoarthrosis that received a Tissue Engineering Product (TEP) composed of autologous Bone Marrow-derived Mesenchymal Stromal Cells (BM-MSC) combined with deantigenised trabecular bone particles from tissue bank. Feasibility of the treatment and osteogenic potential of the cell-based medicine was first demonstrated in an ovine model of critical size segmental tibial defect. Clinical grade autologous BM-MSC were produced following a Good Manufacturing Practice-compliant bioprocess. Results were successful in one case, with pseudoarthrosis resolution, and inconclusive in the other one. The first patient presented atrophic pseudoarthrosis of the humeral diaphysis and was treated with osteosynthesis and TEP resulting in satisfactory consolidation at month 6. The second case presented a recalcitrant pseudoarthrosis of the proximal tibia and the Masquelet technique was followed before filling the defect with the TEP. This patient presented a neuropathic pain syndrome unrelated to the treatment that forced the amputation of the extremity three months later. In this case, the histological analysis of the tissue formed at the defect site evidenced neovascularisation but no overt bone remodelling activity. We conclude that the use of expanded autologous BM-MSC to treat pseudoarthrosis was demonstrated feasible and safe, provided that no clinical complications were reported, and early signs of effectiveness were observed.

  2. Idiopathic Facial Aseptic Granuloma: Review of an Evolving Clinical Entity.

    PubMed

    Zitelli, Kristine B; Sheil, Amy T; Fleck, Robert; Schwentker, Ann; Lucky, Anne W

    2015-01-01

    Idiopathic facial aseptic granuloma (IFAG), originally termed pyodermite froide du visage, describes a generally asymptomatic facial nodule presenting in childhood with clinical resemblance to pyoderma or cystic, granulomatous, or vascular lesions. Clinical understanding is constantly evolving, with recent observations indicating that IFAG may represent a subtype of childhood rosacea. We present a case of IFAG associated with eyelid chalazions in a 19-month-old boy. Although his clinical course paralleled previously reported IFAG cases, we observed a unique ultrasound variation during initial diagnostic examination. Further delineation of clinical, imaging, and histologic properties of IFAG may reveal insights into etiologic associations and ideal management.

  3. Aseptic Meningitis Caused by Lassa Virus: Case Series Report.

    PubMed

    Okokhere, Peter O; Bankole, Idowu A; Iruolagbe, Christopher O; Muoebonam, Benard E; Okonofua, Martha O; Dawodu, Simeon O; Akpede, George O

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications.

  4. Oligophilic Bacteria as Tools To Monitor Aseptic Pharmaceutical Production Units

    PubMed Central

    Nagarkar, Parag P.; Ravetkar, Satish D.; Watve, Milind G.

    2001-01-01

    The bacterial loads of air, surfaces, and personnel in clean rooms are routinely monitored using a set of standard media. Bacteria that can grow on these media are a tiny fraction of the total numbers in any environment. A substantial proportion of bacteria long thought to be unculturable were recently shown to be oligophilic. Oligophile counts in clean rooms in our studies exceeded the standard plate counts by up to 2 orders of magnitude. They responded to disinfection routines in ways similar to the responses of conventional bacteria. We suggest that oligophiles are better tools than conventional bacteria for environmental monitoring in aseptic pharmaceutical production units. PMID:11229934

  5. Primary repair of a large incomplete sternal cleft in an asymptomatic infant with Prolene mesh.

    PubMed

    Baqain, Eyad B; Lataifeh, Isam M; Khriesat, Wadah M; Fraiwan, Nayef M; Armooti, Mohamed A

    2008-10-01

    A cleft of the sternum is a rare congenital anomaly, often diagnosed as an asymptomatic condition at birth. We present a case of a large incomplete sternal cleft in a full-term baby boy. Surgical repair of the sternum with the use of Prolene mesh was performed during the neonatal period without cardiac compression.

  6. Pain control for sternal fracture using an ultrasound-guided hematoma block.

    PubMed

    Wilson, Sharon R; Price, Daniel D; Penner, Erik

    2010-04-01

    In this case report, an ultrasound-guided hematoma block was performed in the Emergency Department (ED) for immediate and effective pain control in a patient suffering from a sternal fracture. This technique of anesthesia may allow safer and more effective analgesia and a more rapid discharge from the hospital or ED in selected cases.

  7. Sternal closure by rigid plate fixation in off-pump coronary artery bypass grafting: a comparative study.

    PubMed

    Matsuyama, Katsuhiko; Kuinose, Masahiko; Koizumi, Nobusato; Iwasaki, Tomoaki; Toguchi, Kayo; Ogino, Hitoshi

    2016-06-01

    Sternal instability or dehiscence results in serious sternal wound infection. We sought to assess the early outcomes with such a plating system for sternal closure in comparison to the conventional wiring technique in off-pump coronary artery bypass grafting (CABG). Patients who underwent off-pump CABG were enrolled. Thirty-one patients received plate sternal fixation. A total of 64 patients who underwent off-pump CABG by a single surgeon at our hospital from July 2013 to December 2014 were enrolled. Thirty-one patients received plate sternal fixation (Plate group), while 33 received conventional wire closure (Wire group). The early outcomes, including the pain score and analgesic usage count were compared. Dietary intake was also recorded to assess the duration of appetite loss. At discharge, the largest sternal displacement was measured on computed tomography. In the Plate group, the pain scores were significantly lower on post-operative day 5-8 and POD 9-12 from those in the Wire group. The analgesic usage count on POD 9-12 was significantly lower in the Plate group. The duration of appetite loss and hospital stay was significantly shorter in the Plate group. The displacement in both the anterior-posterior and lateral directions was significantly smaller in the Plate group. Sternal closure by rigid plate fixation contributes to a more rapid post-operative recovery through reduced pain.

  8. Triclosan-coated sutures and sternal wound infections: a prospective randomized clinical trial.

    PubMed

    Steingrimsson, S; Thimour-Bergström, L; Roman-Emanuel, C; Scherstén, H; Friberg, Ö; Gudbjartsson, T; Jeppsson, A

    2015-12-01

    Surgical site infection is a common complication following cardiac surgery. Triclosan-coated sutures have been shown to reduce the rate of infections in various surgical wounds, including wounds after vein harvesting in coronary artery bypass grafting patients. Our purpose was to compare the rate of infections in sternotomy wounds closed with triclosan-coated or conventional sutures. A total of 357 patients that underwent coronary artery bypass grafting were included in a prospective randomized double-blind single-center study. The patients were randomized to closure of the sternal wound with either triclosan-coated sutures (Vicryl Plus and Monocryl Plus, Ethicon, Inc., Somerville, NJ, USA) (n = 179) or identical sutures without triclosan (n = 178). Patients were followed up after 30 days (clinical visit) and 60 days (telephone interview). The primary endpoint was the prevalence of sternal wound infection according to the Centers for Disease Control and Prevention (CDC) criteria. The demographics in both groups were comparable, including age, gender, body mass index, and rate of diabetes and smoking. Sternal wound infection was diagnosed in 43 patients; 23 (12.8%) sutured with triclosan-coated sutures compared to 20 (11.2%) sutured without triclosan (p = 0.640). Most infections were superficial (n = 36, 10.1%), while 7 (2.0%) were deep sternal wound infections. There were 16 positive cultures in the triclosan group and 17 in the non-coated suture group (p = 0.842). The most commonly identified main pathogens were Staphylococcus aureus (45.4%) and coagulase-negative staphylococci (36.4%). Skin closure with triclosan-coated sutures did not reduce the rate of sternal wound infection after coronary artery bypass grafting. (clinicaltrials.gov: NCT01212315).

  9. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.

  10. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  11. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening.

    PubMed

    Loria, Maria Paola; Dambra, Porzia; Moretti, Biagio; Patella, Vittorio; Capuzzimati, Laura; Cavallo, Elsa; Nettis, Eustachio; Pesce, Vito; Dell'Osso, Adriana; Simone, Carmelo; Tursi, Alfredo

    2004-01-01

    Cytokines, which have been demonstrated in synovial fluids during various joint diseases, play an important role in mediating synovial inflammation and in regulating the immune response of many inflammatory processes. We studied synovial fluid, serum, and synovial fragments obtained from 33 patients--10 affected by serious gonarthrosis re-quiring a prosthetic implant, 8 with knee prosthesis aseptic loosening, and (as controls) 15 affected by degenerative meniscopathies--to evaluate the degree of inflammation and level of interleukins (IL-2, IL-4, IL-6, IL-10) and interferon gamma secretion. Histological analysis revealed slightly more infiltration by inflammatory cells in the synovial tissue of patients with gonarthrosis and knee prosthesis aseptic loosening than in that of the control group, with a high prevalence of macrophages. Moreover, we observed enhanced production of the studied cytokines, especially in synovial fluid as compared to serum, indicating that in the pathological conditions examined the inflammatory events are mainly localized. Because the role of these cytokines is to modulate inflammation, better knowledge of the involvement of cells and their soluble mediators in articular damage could guide immunomodulating treatment.

  12. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  13. Associations between Meteorological Factors and Aseptic Meningitis in Six Metropolitan Provinces of the Republic of Korea

    PubMed Central

    Joshi, Yadav Prasad; Kim, Eun-Hye; Kim, Jong-Hun; Kim, Ho; Cheong, Hae-Kwan

    2016-01-01

    We assessed the association between climate factors and a number of aseptic meningitis cases in six metropolitan provinces of the Republic of Korea using a weekly number of cases from January 2002 to December 2012. Generalized linear quasi-Poisson models were applied to estimate the effects of climate factors on the weekly number of aseptic meningitis cases. We used generalized additive and generalized additive mixed models to assess dose–response relationships. A 1 °C increase in mean temperature was associated with an 11.4% (95% confidence interval (CI): 9.6%–13.3%) increase in aseptic meningitis with a 0-week lag; a 10 mm rise in rainfall was associated with an 8.0% (95% CI: 7.2%–8.8%) increase in aseptic meningitis with a 7-week lag; and a 1 mJ/m2 increase of solar radiation was associated with a 5.8% (95% CI: 3.0%–8.7%) increase in aseptic meningitis with a 10-week lag. Nino3 showed positive effects in all lags, and its one unit increase was associated with an 18.9% (95% CI: 15.3%–22.6%) increase of aseptic meningitis at lag 9. The variability in the relationship between climate factors and aseptic meningitis could be used to initiate preventive measures for climate determinants of aseptic meningitis. PMID:27916923

  14. Recurrent aseptic encephalitis in periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) syndrome.

    PubMed

    Frye, Richard E

    2006-05-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenitis (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA.

  15. Surgical Fixation of Sternal Fractures: Preoperative Planning and a Safe Surgical Technique Using Locked Titanium Plates and Depth Limited Drilling

    PubMed Central

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th.; Mauerer, Andreas; Hennig, Friedrich F.; Buder, Thomas

    2015-01-01

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture’s morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology. PMID

  16. Surgical fixation of sternal fractures: preoperative planning and a safe surgical technique using locked titanium plates and depth limited drilling.

    PubMed

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th; Mauerer, Andreas; Hennig, Friedrich F; Buder, Thomas

    2015-01-05

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture's morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology.

  17. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  18. Aseptic Meningitis Caused by Lassa Virus: Case Series Report

    PubMed Central

    Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363

  19. Aseptic multiplication of banana from excised floral apices.

    PubMed

    Cronauer, S S; Krikorian, A D

    1985-08-01

    Most economically important bananas and plantains are large triploid seedless herbs that must be propagated vegetatively by removing small side shoots or "suckers" from the parent plant or by planting seed pieces of larger corms. Consequently, multiplication of stock material is time consuming, Recently, the rapid production of young banana plantlets suitable for use as "seed" material has been described. Vegetative shoot apices were isolated and multiplied using aseptic tissue culture techniques. Although these multiplication systems, once established, can produce thousands of plants in a relatively short period of time, their establishment necessitates the initial sacrifice of an individual specimen, which may not always be desirable or prudent should a limited parent stock be available. We describe here the production and multiplication of rooted banana plantlets from the isolation and culture of terminal floral apices.

  20. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-05-31

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  1. Degradation of 316L stainless steel sternal wire by steam sterilization.

    PubMed

    Shih, Chun-Che; Su, Yea-Yang; Chen, Lung-Ching; Shih, Chun-Ming; Lin, Shing-Jong

    2010-06-01

    Sterilization is an important step prior to the implantation of medical devices inside the human body. In this work we studied the influence of steam sterilization cycles on the oxide film properties of stainless steel sternal wire. Characterization techniques such as open- circuit potential, potentiodynamic measurement, electrochemical impedance spectroscopy, cathodic stripping, transmission electron microscopy, atomic force microscopy and scanning electron microscopy were employed to investigate the cycles of steam sterilization on the corrosion behavior of sternal wire. The results showed that the oxide properties are a function of the number of steam sterilization cycles and deteriorate as the number of cycles increases. Steam sterilization might damage the implant integrity and heavy metals could be released to the surrounding tissues due to deterioration of the oxide film.

  2. Prophylactic antibiotic administration for post cardiothoracic surgery sternal wounds: a retrospective study

    PubMed Central

    Pitsiou, Georgia; Kioumis, Ioannis; Zarogoulidis, Konstantinos; Lazaridis, George; Papaiwannou, Antonis; Tsirgogianni, Katerina; Karavergou, Anastasia; Lampaki, Sofia; Rapti, Aggeliki; Trakada, Georgia; Zissimopoulos, Athanasios; Karaiskos, Theodoros; Madesis, Athanasios; Drosos, Georgios

    2015-01-01

    Background Cardiothoracic surgery sternal infections are difficult to treat situations. Until now there are no clear guidelines which or if an antibiotic could be used as prophylactic treatment. Patients and methods We collected retrospectively data from 535 patients from our hospital which underwent cardiothoracic surgery and recorded several biological parameters and technical aspects of the surgery. Results It was observed that patients to whom vancomycin was administered had less post surgery infection than those to whom begalin was administered. Male who were treated with vancomycin it was observed that they had 1.67 chances to be treated properly than female. Patients which were hospitalized for more than 7 days before surgery had 62.6% higher chances for post surgery infection. Conclusions It was observed that vancomycin can be used as a prophylactic treatment for cardiothoracic surgeries acting efficiently against sternal wounds. PMID:25861611

  3. Evolution and functional significance of derived sternal ossification patterns in ornithothoracine birds.

    PubMed

    O'Connor, J K; Zheng, X-T; Sullivan, C; Chuong, C-M; Wang, X-L; Li, A; Wang, Y; Zhang, X-M; Zhou, Z-H

    2015-08-01

    The midline pattern of sternal ossification characteristic of the Cretaceous enantiornithine birds is unique among the Ornithodira, the group containing birds, nonavian dinosaurs and pterosaurs. This has been suggested to indicate that Enantiornithes is not the sister group of Ornithuromorpha, the clade that includes living birds and their close relatives, which would imply rampant convergence in many nonsternal features between enantiornithines and ornithuromorphs. However, detailed comparisons reveal greater similarity between neornithine (i.e. crown group bird) and enantiornithine modes of sternal ossification than previously recognized. Furthermore, a new subadult enantiornithine specimen demonstrates that sternal ossification followed a more typically ornithodiran pattern in basal members of the clade. This new specimen, referable to the Pengornithidae, indicates that the unique ossification pattern observed in other juvenile enantiornithines is derived within Enantiornithes. A similar but clearly distinct pattern appears to have evolved in parallel in the ornithuromorph lineage. The atypical mode of sternal ossification in some derived enantiornithines should be regarded as an autapomorphic condition rather than an indication that enantiornithines are not close relatives of ornithuromorphs. Based on what is known about molecular mechanisms for morphogenesis and the possible selective advantages, the parallel shifts to midline ossification that took place in derived enantiornithines and living neognathous birds appear to have been related to the development of a large ventral keel, which is only present in ornithuromorphs and enantiornithines. Midline ossification can serve to medially reinforce the sternum at a relatively early ontogenetic stage, which would have been especially beneficial during the protracted development of the superprecocial Cretaceous enantiornithines.

  4. Corrosion of stainless steel sternal wire after long-term implantation.

    PubMed

    Tomizawa, Yasuko; Hanawa, Takao; Kuroda, Daisuke; Nishida, Hiroshi; Endo, Masahiro

    2006-01-01

    A variety of metallic components have been used in medical devices where lifelong durability and physical strength are demanded. To investigate the in vivo changes of implanted metallic medical devices in humans, stainless steel sternal wires removed from patients were evaluated. Stainless steel (316L) sternal wires removed from four patients after 10, 13, 22, and 30 years of implantation were evaluated using scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Macroscopically, the removed specimens maintained their metallic luster and color. Under SEM, small holes were observed sporadically at 10 years and they tended to connect in the drawing direction. The longer the implanted duration, the more numerous and deeper were the crevices observed. By EDS, sulfur, phosphorus, and calcium were identified in all areas at 10 years, in addition to the component elements of stainless steel, comprising iron, chromium, nickel, and manganese. Corrosion products observed at 30 years were identified as calcium phosphate. In conclusion, stainless steel sternal wires develop corroded pores that grow larger and deeper with time after implantation; however, the pores remain shallow even after decades of implantation and they may not be a cause of mechanical failure. An amount of metal ions equivalent to the corroded volume must have been released into the human body, but the effect of these metal ions on the body is not apparent.

  5. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus

    PubMed Central

    Koutsostathis, Stefanos D.; Lepetsos, Panagiotis; Polyzois, Vasilios D.; Pneumaticos, Spyros G.; Macheras, George A.

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  6. Recurrent case of ibuprofen-induced aseptic meningitis in mixed connective tissue disease.

    PubMed

    Karmacharya, Paras; Mainali, Naba Raj; Aryal, Madan Raj; Lloyd, Benjamin

    2013-04-30

    Although relatively uncommon, the incidence of non-steroidal anti-inflammatory drug-induced aseptic meningitis appears to be increasing among patients with connective tissue disease and also among the healthy population. Ibuprofen is the most common culprit identified. We report a case of a 28-year-old woman with mixed connective tissue disease and recent intake of ibuprofen, presenting with a recurrent episode of ibuprofen-induced aseptic meningitis.

  7. Sternal "retraction": a novel application of a mandibular distractor in treating ectopia cordis with complete cleft sternum.

    PubMed

    Gart, Michael S; Vicari, Frank A

    2015-05-01

    Complete thoracic ectopia cordis is associated with a uniformly dismal prognosis. The primary challenges of this disorder are (1) returning the heart to the thoracic cavity, (2) stabilizing the chest wall, and (3) repairing the sternal defect. Previously published techniques for achieving these goals have demonstrated very limited success and/or significant morbidity.We present a novel application of a mandibular distraction device as part of staged repair of this historically challenging problem. This method uses immediate stabilization and gradual "retraction" of the sternal remnants, thereby allowing physiologic compensation and avoiding the cardiorespiratory embarrassment associated with returning the heart to the thoracic cavity. Moreover, this technique allows stabilization of the associated sternal cleft and chest wall without the commonly associated morbidity of the currently available techniques.

  8. Jugulo-sternal-gland tumors in male tree shrews (Tupaia belangeri).

    PubMed

    Brack, M

    1991-12-01

    Adenocarcinomas of the jugulo-sternal glands were observed in seven adult male tree shrews (Tupaia belangeri) at biopsy or necrospy. Five of these tumors were classified as carcinomas of the sebaceous gland compartment; one was diagnosed as a papilliform adenoma of apocrine (monoptychic) sweat glands; and one was of a mixed sebaceous gland/apocrine sweat gland structure. Four sebaceous gland carcinomas had histologic evidence of vascular invasion; one had metastasized to the regional lymph nodes and lungs and had also invaded the thoracic muscles.

  9. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery

    PubMed Central

    Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-01-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions. PMID:26336388

  10. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery.

    PubMed

    Kozioł, Małgorzata; Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-03-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions.

  11. Does a gentamicin-impregnated collagen sponge reduce sternal wound infections in high-risk cardiac surgery patients?

    PubMed Central

    Birgand, Gabriel; Radu, Costin; Alkhoder, Soleiman; Al Attar, Nawwar; Raffoul, Richard; Dilly, Marie-Pierre; Nataf, Patrick; Lucet, Jean-Christophe

    2013-01-01

    OBJECTIVES Sternal wound infections occurring after cardiac surgery have a critical impact on morbidity, mortality and hospital costs. This study evaluated the efficacy of a gentamicin–collagen sponge in decreasing deep sternal-wound infections in high-risk cardiac surgery patients. METHODS We conducted a quasi-experimental single-centre prospective cohort study in diabetic and/or overweight patients undergoing coronary-artery bypass surgery with bilateral internal mammary artery grafts. The end-point was the rate of reoperation for deep sternal wound infection. The period from January 2006 to October 2008, before the introduction of the gentamicin sponge, was compared with the period from November 2008 to December 2010. RESULTS Of 552 patients (median body mass index, 31.5; 37.7% with diabetes requiring insulin), 68 (12.3%) had deep sternal wound infections. Reoperation for deep sternal wound infections occurred in 40/289 (13.8%) preintervention patients and 22/175 (12.6%) patients managed with the sponge. Independent risk factors were female sex and longer time on mechanical ventilation, but not use of the sponge (adjusted odds ratio, 0.95; 95% confidence interval, 0.52–1.73; P = 0.88). The group managed with the sponge had a higher proportion of gentamicin-resistant micro-organisms (21/27, 77.8%) compared with the other patients (23/56, 41.1%; P < 0.01). The median time to reoperation for wound infection was higher with the sponge (21 vs 17 days, P < 0.01). CONCLUSIONS A gentamicin–collagen sponge was not effective in preventing deep sternal wound infections in high-risk patients. Our results suggest that a substantial proportion of wound contaminations occur after bypass surgery with bilateral internal mammary artery grafts. PMID:23115102

  12. Sternal Gland Scent-Marking Signals Sex, Age, Rank, and Group Identity in Captive Mandrills.

    PubMed

    Vaglio, Stefano; Minicozzi, Pamela; Romoli, Riccardo; Boscaro, Francesca; Pieraccini, Giuseppe; Moneti, Gloriano; Moggi-Cecchi, Jacopo

    2016-02-01

    Mandrills are one of the few Old World primates to show scent-marking. We combined ethological and chemical approaches to improve our understanding of this behavior in 3 zoo-managed groups. We observed the olfactory behavior performed by adults and adolescents (N = 39) for 775h. We investigated the volatile components of sternal scent-marks using gas chromatography-mass spectrometry and compared volatile profiles with traits of the signaler. Males marked more than females and within each sex the frequency of scent-marking was related to age and dominance status, but alpha males scent-marked most frequently and particularly in specific areas at the enclosure boundaries. We identified a total of 77 volatile components of sternal gland secretion, including compounds functioning as male sex pheromones in other mammals, in scent-marks spontaneously released on filter paper by 27 male and 18 female mandrills. We confirmed our previous findings that chemical profiles contain information including sex, male age and rank, and we also found that odor may encode information about group membership in mandrills. Our results support the hypotheses that scent-marking signals the status of the dominant male as well as playing territorial functions but also suggest that it is part of sociosexual communication.

  13. Hyperbaric oxygen therapy as additional treatment in deep sternal wound infections – a single center's experience

    PubMed Central

    Bryndza, Magdalena; Chrapusta, Anna; Kobielska, Ewa; Kapelak, Bogusław; Grudzień, Grzegorz

    2016-01-01

    Introduction Deep sternal wound infection (DSWI) is one of the most serious complications after cardiac surgery procedures, observed in 5% of patients. Current standard medical therapy for DSWI includes antibiotics, surgical debridement, resuturing or negative pressure wound therapy (NPWT). Unfortunately, in some cases these methods are insufficient, and additional therapeutic options are needed. Aim To assess the effects and usefulness of additional hyperbaric oxygen therapy (HBO2) in patients with DSWI after cardiac surgery procedures. Material and methods A retrospective analysis of 10 patients after cardiac surgery who developed DSWI in the period 2010–2012 was performed. After 3 months of ineffective conventional therapy including targeted antibiotic, surgical sternal debridement and NPWT, patients were qualified for additional HBO2 therapy. A total of 20 sessions of HBO2 therapy were performed, each 92 minutes long. Results After 4 weeks of HBO2 treatment, 7 patients presented complete wound healing with fibrous scar formation. One patient was qualified for the another cycle of HBO2 therapy with 20 additional sessions, and complete wound healing was observed. In 2 cases, after 5 and 19 sessions, HBO2 was interrupted because of improper qualifications. Conclusions The HBO2 as an additional therapy in DSWI was successful in 80% of cases, and no complications were observed. However, due to the small number of published studies with a small number of patients, randomized, clinical trials are needed to assess the clinical results of HBO2 in DSWI after cardiac surgery procedures. PMID:27785131

  14. [Segmental sternal dislocation in children. Apropos of a surgically treated case].

    PubMed

    Norotte, G; Peres, E; Vanderweyen, A; Razafindralasitra, P

    1997-01-01

    The authors report one operated case of traumatic sternal segmental dislocation in a child, and propose a mechanism for this uncommon lesion. A fourteen year old boy was admitted in emergency for anterior chest pain, occurring during an exercise in parallel bars without any fall. X ray showed traumatic dislocation of the upper sternal segment. After 12 hours, because of bad clinical tolerance (pain, dyspnea with sweats and disphagia) reduction and plate stabilization (Senegas plate) was performed with immediate pain relief. The boy returned to school after 10 days. Plate was removed two months later after healing, with good clinical and radiological results. According to rare published cases, conservative treatment can be proposed in very young children because of dislocation remodeling. By others, in case of bad tolerance, surgical treatment is suggested despite the inconvenient of device's removal. The originality of this case is the indirect lesion mechanism. Hypothesis is given by authors. Treatment by plate is easy and gives immediate pain relief with good clinical and radiological results in teen-agers.

  15. Is skin closure with cyanoacrylate glue effective for the prevention of sternal wound infections?

    PubMed

    Chambers, Anthony; Scarci, Marco

    2010-05-01

    A best evidence topic in cardiac surgery was written according to a structured protocol. The question addressed whether cyanoacrylate glue was effective at preventing wound infection following sternotomy incision. Altogether more than 108 papers were found using the reported search, of which seven represented the best evidence to answer the clinical question. The authors, journal, date and country of publication, patient group studied, study type, relevant outcomes and results of these papers are tabulated. We conclude that applying cyanoacrylate glue to a sternal wound has superior outcomes in terms of infection rates, both if applied preoperatively (decreasing from 10.8% to 2.7% or 7.8% to 1.1%, according to two studies) and postoperatively (4.9%-2.1%). This trend is true of both deep surgical site infections (0.6%-0%) and superficial site infections (4.3%-2.1%). Furthermore, in patients who had developed mediastinitis following cardiac surgery rates of recurrent sternal detachment and osteomyelitis were significantly reduced in cases where sealant was applied compared to controls (35.3% vs. 0%). In all studies examining hospital stay, duration was reduced in cases where cyanoacrylate glue was used, both in patients treated for recurrent mediastinitis (24.06 vs. 14.16 days) and those with uncomplicated recovery following cardiac surgery (13 vs. 9 days). In addition, two studies examining the use of cyanoacrylate glue to secure the sternum in complicated cases of recurrent detachment report success rates of 86% and 100%.

  16. Comparative Analysis of Direct Hospital Care Costs between Aseptic and Two-Stage Septic Knee Revision

    PubMed Central

    Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen

    2017-01-01

    Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they

  17. Flexible walled container having membrane fitment for use with aseptic filling apparatus

    SciTech Connect

    Davis, J.C.; Reiss, R.J.; Rica, A.F.

    1984-05-01

    There is disclosed an aseptic flexible walled container having a rigid fitment member cooperative with an aseptic filling apparatus and including a neck, outer flanges surrounding the neck, a frangible membrane and an outer end rim receptive of an hermetically sealed lid. The neck is formed with an internal chamferred seating shoulder for fluid-tight engagement with a fill tube. One outer flange cooperates with clamping jaws of the aseptic filling apparatus for detachably sealing the fitment to a sterilizing chamber and placing it in position for insertion of the filling tube which ruptures the membrane and permits the aseptic introduction of product to the container's interior. The other outer flange is secured to an opening in a wall of the flexible container. The joined fitment and container are presterilized prior to filling. Selected materials for the multi-ply container walls and the fitment permit the container to withstand gamma ray and other sterilization treatment, heat and pressure while maintaining required strength. After the container is aseptically filled, such as with flowable food product, the fill tube is withdrawn and a lid is hermetically sealed onto the rim of the fitment. A heat shield adjacent a container wall surrounds the fitment to protect the container from excessive heat generated by the associated filling apparatus during filling.

  18. Cerebrospinal fluid lactate dehydrogenase isoenzymes in children with bacterial and aseptic meningitis.

    PubMed

    Nussinovitch, Moshe; Finkelstein, Yaron; Elishkevitz, Keren Politi; Volovitz, Benjamin; Harel, Daniella; Klinger, Gil; Razon, Yaron; Nussinovitch, Udi; Nussinovitch, Naomi

    2009-10-01

    Differentiation of bacterial from aseptic meningitis may be difficult. Our aim was to determine the pattern of distribution of lactate dehydrogenase (LDH) isoenzymes in the cerebrospinal fluid (CSF) of patients with bacterial and aseptic meningitis. One hundred and fifty-seven patients with suspected meningitis were enrolled in the study. They were divided into 3 groups according to the culture- or bacterial antigen assay-proven diagnosis and CSF findings: bacterial meningitis (n = 31), aseptic meningitis (n = 65), and non-meningitis (n = 61). Total LDH level and percentages of LDH isoenzymes in the CSF were measured in each patient. Each group showed a distinct LDH isoenzyme distribution pattern, with a statistically significant difference among the groups in the percentages of the various isoenzymes. Compared with the non-meningitis group, total LDH activity in the CSF was high in the aseptic meningitis group (49.82+/-35.59 U/L, P < 0.001) and exaggerated in the bacterial meningitis group (944.53+/-112.3 U/L, P < 0.001). Low LDH-2 levels were unique to bacterial meningitis (P < 0.01), whereas high LDH-3 levels were characteristic of aseptic meningitis (P < 0.05). Both groups had low levels of LDH-1 and high levels of LDH-4 and LDH-5. In conclusion, the LDH isoenzyme pattern may be of clinical diagnostic value in meningitis, particularly when culture results are pending.

  19. A novel tantalum-containing bioglass. Part II. Development of a bioadhesive for sternal fixation and repair.

    PubMed

    Alhalawani, Adel Mf; Mehrvar, Cina; Stone, Wendy; Waldman, Stephen D; Towler, Mark R

    2017-02-01

    With over a million median sternotomy surgeries performed worldwide every year, sternal wound complications have posed a serious risk to the affected patients. A rigid therapeutic sternal fixation device has therefore become a necessity. In this work, the incorporation of up to 0.5mol% of tantalum pentoxide (Ta2O5), in exchange for zinc oxide (ZnO), into the SiO2-ZnO-CaO-SrO-P2O5 glass system is presented. The effect of Ta incorporation on the physical, chemical and biological properties of the glass polyalkenoate cements (GPCs) prepared from them have been presented in this manuscript. The data obtained have confirmed that Ta2O5 incorporation into the reference glass system results in increased working times, radiopacity, ion solubility, and long-term mechanical stability. The formulated glass systems have also shown clear antibacterial and antifungal activity against both Gram-negative (Escherichia coli) and Gram-positive prokaryotes (Staphylococcus aureus and Streptococcus epidermidis), as well as eukaryotes (Fusarium solani). Cytotoxicity testing showed that Ta incorporation results in no toxicity effect and may simulate osseo-integration when tested in animal models. These new metallic-containing biomaterial adhesives have been developed for sternal fixation and repair. As a permanent implant, the formulated adhesives can be used in conjunction with sternal cable ties to offer optimal fixation for patients and reduce post-operative complications such as bacterial infection and pain from micro-motion.

  20. [The indicators of immunity in patients with aseptic instability of knee joint].

    PubMed

    Chepeleva, M V; Chegurov, O K; Kuznetsova, E I; Shved, N S

    2014-08-01

    The examination was applied to sampling of 17 patients with stable implants after 18-36 months after endoprosthesis replacement of knee joint and to sampling of 17 patients with developed within this time-frame aseptic instability of endoprosthesis within the same time-frame. The typing of lymphocytes of peripheral blood was implemented using laser flow cytometry. The detection of immunoglobulins, cytokines, circulating immune complexes was made applying the technique of enzymoimmunoassay. In case of development of aseptic instability the signs testifying moderate activation of immune system and starting dysfunction of monocyte macrophage component of immune system. At that, IL-6, TNFα, CD14+HLA-DR provided the most complete information on the side of diagnostic of developing aseptic instability of joint.

  1. Aseptic meningitis outbreak associated with echovirus 9 among recreational vehicle campers--Connecticut, 2003.

    PubMed

    2004-08-13

    Aseptic meningitis is an inflammation of the tissues covering the brain and spinal cord and caused by a virus, most frequently an enterovirus. In August 2003, the Connecticut Department of Public Health (CDPH) received a report of three viral meningitis cases among recreational vehicle (RV) campers staying at a campground in northeastern Connecticut. CDPH, assisted by CDC, conducted an investigation, which 1) identified a total of 12 cases of aseptic meningitis and 24 cases of enterovirus-like illness among 201 campers interviewed, 2) demonstrated how transmission of enterovirus from persons with mild illness contributed to the aseptic meningitis outbreak, and 3) determined that crowded conditions inside RVs and in the campground swimming pool likely facilitated spread of enterovirus. Pool operators should check chlorine and pH levels frequently, particularly during peak pool occupancy; adults should take precautions against passing enterovirus to children, who are at greater risk for severe illness.

  2. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis.

    PubMed

    Godec, Matjaz; Kocijan, Aleksandra; Dolinar, Drago; Mandrino, Djordje; Jenko, Monika; Antolic, Vane

    2010-08-01

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  3. Femoral cement within cement technique in carefully selected aseptic revision arthroplasties.

    PubMed

    Marcos, Lucas; Buttaro, Martin; Comba, Fernando; Piccaluga, Francisco

    2009-06-01

    The aim of this study was to evaluate the clinical and radiological results in a group of patients who underwent aseptic revision hip arthroplasty using the cement within cement (CWC) technique. Between 1999 and 2005, 37 aseptic revision hip operations were performed. There were 30 women and five men, with an average age of 68 years. The reasons for revision were femoral stem fracture, cup failure, acetabular protrusion after hemi-arthroplasty and recurrent dislocation. At an average follow-up of 46 months, none of the patients required further femoral revision. The average post-operative Merle D'Aubigne score was 16.6 points (p<0.05). No evidence of radiological stem failure was observed and no femoral component was considered to be at risk for loosening. In this series of patients, the CWC technique provided consistent with high functional outcomes. This valid and effective alternative should be considered in carefully selected aseptic cases.

  4. [Cardiac tamponade following sternal puncture. Usefulness of ultrasound focussed assessment with sonography for trauma].

    PubMed

    Magaldi, M; Hervías, A; Perelló, L; Fontanals, J

    2014-03-01

    One of the aims of the medical profession is to be able to detect complications in patients during diagnostic tests and treatments. The early diagnosis of these complications can prevent a fatal outcome. The diagnosis is often based on clinical symptoms and supported by complementary tests. Diagnostic tests have been developed in the last few years that are rapid and easy to use, as well as being cost effective and minimally invasive. Focussed assessment with sonography for trauma ultrasound (echo-FAST) was introduced in the 1990s in the field of resuscitation as a test for the rapid detection of intra-abdominal and pericardial fluid in multiple injury patients, but its uses in other cases not involving trauma still raise doubts and controversy. A case is presented of a patient subjected to a sternal puncture for a bone marrow aspirate, who had a complication of a secondary cardiac tamponade, which was diagnosed early using echo-FAST.

  5. Nuss procedure in adult pectus excavatum: a simple artifice to reduce sternal tension.

    PubMed

    Ravenni, Giacomo; Actis Dato, Guglielmo Mario; Zingarelli, Edoardo; Flocco, Roberto; Casabona, Riccardo

    2013-07-01

    Nowadays the Nuss operation represents the standard surgical choice for pectus excavatum repair in children and teenagers. Some concerns have been raised regarding its applicability in adults, as compared with younger patients, in view of the higher rate of complications after surgery. We describe an easy trick that has been performed on a 36-year old man with a moderate pectus excavatum after an unsatisfactory Nuss procedure. It consisted of a T-shaped partial anterior sternotomy, performed after positioning of the stainless steel bar, in order to promote a hinge mechanism of the sternum to reduce the tension over the reinforcement. This procedure was successful with well-controlled postoperative pain and great patient satisfaction. No complications were recorded at 1-year follow-up. In our opinion, this simple trick could represent a valid surgical option for pectus excavatum repair in late adolescents and adults to obviate the occurrence of major sternal tension.

  6. The history of the management of sternal osteomyelitis and mediastinitis - from Hippocrates until today.

    PubMed

    Ennker, Ina Carolin; Ennker, Jürgen C

    2014-01-01

    Even during the time of Hippocrates, Galen and their colleagues recognized mediastinal affections. However, they were not considered with the surgical treatment. First progress in the treatment options of this severe disease, still denoted as 'terra incognita', over to today's gold standard are pictured. The mediastinitis-registry which was founded by the German Society for Thoracic and Cardiovascular Surgery (DGTHG) in 2011 and the recent establishment of the study group to adopt a guideline 'diagnosis and therapy of postoperative mediastinitis/sternal osteomyelitis following cardiac surgery' are attempts to a standardization of the treatment. Substantial advancement in the treatment of postoperative mediastinitis could be achieved in the past. The mortality dropped as low as less than 10%. With these implementations more benefit for the patients' outcome can be expected.

  7. Estimating age at death using the sternal end of the fourth ribs from Mexican males.

    PubMed

    Cerezo-Román, Jessica Inés; Hernández Espinoza, Patricia Olga

    2014-03-01

    The indicators proposed by İşcan et al. (1984) are said to reflect age changes that occur in the sternal end of the fourth rib. These indicators have been used to estimate age-at-death in adult skeletal samples. However, Isçan et al. developed their methods using a forensic sample from Florida (U.S.A.). In order to test the reproducibility of those methods we evaluate its accuracy for the fourth ribs by applying it to a sample of known age and sex but of different biological affinity: modern males from Mexico City. We found that the method developed by İşcan et al. underestimates age-at-death in the Mexican sample.

  8. Negative-pressure wound therapy and laparoscopic omentoplasty for deep sternal wound infections after median sternotomy.

    PubMed

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery.We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps.The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4-12 mo). Late local follow-up results, both functional and aesthetic, were good.We conclude that negative-pressure wound therapy-in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps-is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results.

  9. Estimation of sex from sternal measurements in a Western Australian population.

    PubMed

    Franklin, Daniel; Flavel, Ambika; Kuliukas, Algis; Cardini, Andrea; Marks, Murray K; Oxnard, Charles; O'Higgins, Paul

    2012-04-10

    In Australia, particularly Western Australia, there is a relative paucity of contemporary population-specific morphometric standards for the estimation of sex from unknown skeletal remains. This is largely a historical artefact from lacking, or poorly documented, repositories of human skeletons available for study. However, medical scans, e.g. MSCT (multislice spiral computed tomography) are an ingenious and practical alternative source for contemporary data. To that end, this study is a comprehensive analysis of sternal sexual dimorphism in a sample of modern Western Australian (WA) individuals with a main purpose to develop a series of statistically robust standards for the estimation of sex. The sample comprises thoracic MSCT scans, with a mean of 0.9 millimeter (mm) slice thickness, on 187 non-pathological sterna. Following 3D volume rendering, 10 anatomical landmarks were acquired using OsiriX(®) (version 3.9) and a total of 8 inter landmark linear measurements were calculated using Morph Db (an in-house developed database application). Measurements were analyzed using basic descriptive statistics and discriminant function analyses, with statistical analyses performed using SPSS 19.0. All measurements are sexually dimorphic and sex differences explain 9.8-47.4% of sample variance. The combined length of the manubrium and body, sternal body length, manubrium width, and corpus sterni width at first sternebra contribute significantly to sex discrimination and yield the smallest sex-biases. Cross-validated classification accuracies, i.e., univariate, stepwise and direct function, are 72.2-84.5%, with a sex bias of less than 5%. We conclude that the sternum is a reliable element for sex estimation among Western Australians.

  10. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... HUMAN SERVICES Food and Drug Administration Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration,...

  11. Hepatitis C virus transmission in hemodialysis units: importance of infection control practices and aseptic technique.

    PubMed

    Thompson, Nicola D; Novak, Ryan T; Datta, Deblina; Cotter, Susanne; Arduino, Matthew J; Patel, Priti R; Williams, Ian T; Bialek, Stephanie R

    2009-09-01

    We investigated 4 hepatitis C virus (HCV) infection outbreaks at hemodialysis units to identify practices associated with transmission. Apparent failures to follow recommended infection control precautions resulted in patient-to-patient HCV transmission, through cross-contamination of the environment or intravenous medication vials. Fastidious attention to aseptic technique and infection control precautions are essential to prevent HCV transmission.

  12. Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.

    PubMed

    Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W

    1996-01-01

    A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis.

  13. A low cost multi-level sampling device for synchronous aseptic collection of environmental water samples.

    PubMed

    McCormick, Michael L; Banishki, Nikola; Powell, Sarah; Rumack, Amy; Garrett, Jinnie M

    2014-10-01

    We describe a simple device for the aseptic collection of environmental water samples at high spatial resolution to depths of 50m. To demonstrate the utility of this technique we present geochemical and archaeal community data from samples collected throughout the water column of a stratified lake.

  14. Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)

    NASA Astrophysics Data System (ADS)

    Ghiron, Kenneth; Litchfield, Bruce

    1997-04-01

    Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.

  15. Expression of tenascin-C in aseptic loosening of total hip replacement

    PubMed Central

    Konttinen, Y.; Li, T.; Michelsson, O.; Xu, J.; Sorsa, T.; Santavirta, S.; Imai, S.; Virtanen, I.

    1998-01-01

    OBJECTIVE—To assess if the bonding interlayer between the implant and bone in aseptic loosening of total hip replacement (THR) is qualitatively deteriorated by excessive accumulation of anti-adhesive glycoprotein, tenascin-C.
METHODS—Alkaline phosphatase-anti-alkaline phosphatase (APAAP) method was used for immunohistochemical staining of tenascin-C in interface tissue and control synovial tissue.
RESULTS—Tenascin-C was found to be a major component of the extracellular matrix at a hitherto unrecognised site, namely the synovial membrane-like interface tissue between implant and bone in aseptic loosening of THR. The overall tenascin-C staining (median score 4.0) was greatly increased in aseptic loosening compared with synovial membrane (median score 2.0; p<0.001) and fibrous capsule (median score 2.0; p<0.001) from primary THR operations. Topological analysis disclosed that tenascin-C was also found at the critical implant-interface and interface-bone surfaces.
CONCLUSION—Local tenascin-C expression is increased as a result of a chronic foreign body type reaction associated with excessive cytokine production and tissue injury mediated by microtrauma and neutral endoproteinases. This qualitative and topological deterioration of the bonding interlayer by an increase of anti-adhesive tenascin-C expression may inadvertantly contribute to loosening.

 Keywords: tenascin; aseptic loosening; total hip replacement PMID:9893574

  16. Prevention of sternal dehiscence with the Sternum External Fixation (Stern-E-Fix) corset – a randomized trial in 750 patients

    PubMed Central

    2012-01-01

    Background The main objective of this study will be to determine the effects of a new advanced sternum external fixation (Stern-E-Fix) corset on prevention of sternal instability and mediastinitis in high-risk patients. Methods This prospective, randomized study (January 2009 – June 2011) comprised 750 male patients undergoing standard median sternotomy for cardiac procedures (78% CABG). Patients were divided in two randomized groups (A, n = 380: received a Stern-E-Fix corset postoperatively for 6 weeks and B, n = 370: control group received a standard elastic thorax bandage). In both groups, risk factors for sternal dehiscence and preoperative preparations were similar. Results Wound infections occurred in n = 13 (3.42%) pts. in group A vs. n = 35 (9.46%) in group B. In group A, only 1 patient presented with sternal dehiscence vs. 22 pts. in group B. In all 22 patients, sternal rewiring followed by antibiotic therapy was needed. Mediastinitis related mortality was none in A versus two in B. Treatment failure in group B was more than five times higher than in A (p = 0.01); the mean length of stay in hospital was 12.5 ± 7.4 days (A) versus 18 ± 15.1 days (B) (p=0.002). Re-operation for sternal infection was 4 times higher in group B. Mean ventilation time was relatively longer in B (2.5 vs. 1.28 days) (p = 0.01). The mean follow-up period was 8 weeks (range 6 – 12 weeks). Conclusions We demonstrated that using an external supportive sternal corset (Stern-E-Fix) yields a significantly better and effective prevention against development of sternal dehiscence and secondary sternal infection in high-risk poststernotomy patients. PMID:22958313

  17. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products.

  18. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses.

    PubMed

    Yang, Fei; Wu, Wen; Cao, Lei; Huang, Yan; Zhu, Zhenan; Tang, Tingting; Dai, Kerong

    2011-12-01

    Aseptic loosening is a major cause of failure of total hip arthroplasty (THA). Macrophage apoptosis in interface membrane has been proved to play an important role in the pathogenesis of aseptic loosening. The purpose of current study was to identify the apoptotic mechanism of macrophages in the interface membrane of aseptic loosening. We collected periprosthetic interface membrane from 23 patients undergoing the revision operations for aseptic loosening of hip joint prostheses. To serve as the control group, samples of capsule were collected from 18 patients undergoing the primary hip arthroplasties for osteoarthritis (OA). The ultrastructure of interface membrane was examined by transmission electron microscopy (TEM), and in situ apoptotic macrophage identification was performed by TUNEL staining. Furthermore, using immunohistochemical methods we investigated the expression of some apoptosis-related markers such as inducible nitric oxide synthase (iNOS), peroxynitrite (ONOO(-)), cleaved caspase-3/4/8/9, cytochrome c, glucose regulated protein 78 (GRP78), and growth arrest and DNA damage-inducible gene 153 (GADD153) in macrophages. These markers were regarded as apoptotic inducers or specific indicators of different apoptotic pathways such as death receptor pathway, mitochondrial pathway and endoplasmic reticulum (ER) stress pathway. TEM showed that a great deal of wear debris was phagocytosed by macrophages, which displayed morphological changes characteristic of apoptosis. The results of TUNEL staining demonstrated that there were more apoptotic macrophages in interface membrane. The expression levels of iNOS, ONOO(-), cleaved caspase-3/4/8/9, cytochrome c, GRP78 and GADD153 in macrophages in interface membrane were significantly higher than those in the control samples (p < 0.05). Our results suggest that death receptor pathway, mitochondria/cytochrosome c caspase-dependent pathway and ER stress pathway are involved in the process of macrophage apoptosis. A

  19. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  20. Sternal resection for metastasis from thyroid carcinoma and reconstruction with the sandwiched Marlex and stainless steel mesh.

    PubMed

    Haraguchi, Shuji; Yamashita, Yasuo; Yamashita, Koji; Hioki, Masafumi; Matsumoto, Koshi; Shimizu, Kazuo

    2004-04-01

    A case of 69-year-old woman with a solitary sternal bone metastasis from thyroid carcinoma undergoing surgical therapy was reported here. On admission, most part of the body of the sternum was destroyed by tumor. Subtotal sternectomy was performed and a part of the major pectoral muscles adherent to the sternal tumor was also resected. The chest wall defect was reconstructed with a sandwiched Marlex and stainless steel mesh. Pathological examination of the resected specimen revealed metastatic papillary carcinoma of the thyroid. Her postoperative course was uneventful. The reconstruction with Marlex and stainless steel mesh seemed to be an appropriate procedure to prevent paradoxical movement of the thorax and protect the intrathoracic organs. Stainless steel mesh compensated for limited resiliency of Marlex mesh and remained rigid in all directions.

  1. Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery

    PubMed Central

    Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo

    2016-01-01

    Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Several preventive methods have been introduced, and recently, gentamicin-impregnated collagen sponges (GICSs) have shown a promising effect in reducing the incidence of this type of complications. Gentamicin is an aminoglycoside antibiotic that has been widely used to treat infections caused by multiresistant bacteria; despite its effectiveness, its systemic use carries a risk of toxicity. GICSs appear to overcome this side effect, topically delivering high antibiotic concentrations to the wound and thus reducing the toxic-related events. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent. We have reviewed the current literature focusing on high-risk patients. PMID:27279734

  2. [Reliability of the individual age assessment at the time of death based on sternal rib end morphology in Balkan population].

    PubMed

    Donić, Danijela; Durić, Marija; Babić, Dragan; Popović, Dorde

    2005-06-01

    This paper analyzes the reliability of the Iscan's sternal rib-ends phase method for the assessment of individual age at the time of death in the Balkan population. The method is based on the morphological age changes of the sternal rib ends. The tested samples consisted of 65 ribs from autopsy cases in the Institute for Forensic Medicine, University of Belgrade, during 1999-2002 (23 females, and 42 males of various ages, ranged from 17-91 years), according to the forensic documents. Significant differences between the real chronological age of the individuals and the values established by the Iscan's method was found, especially in the older categories (phases 6 and 7), in both males and females. The results of the discriminative analysis showed the values of the highest diagnostic relevance for the assessment of age in our population: the change of the depth of the articular fossa, the thickness of its walls, and the quality of the bones.

  3. Sternal Precautions: Is It Time for Change? Precautions versus Restrictions – A Review of Literature and Recommendations for Revision

    PubMed Central

    LaPier, Tanya Kinney; Shaw, Donald K.

    2011-01-01

    The processes that occur with normal sternal healing and potential complications related to median sternotomy are of particular interest to physical therapists. The premise of patients following sternal precautions (SP) or specific activity restrictions is the belief that avoiding certain movements will reduce risk of sternal complications. However, current research has identified that many patients remain functionally impaired long after cardiothoracic surgery. It is possible that some SP may contribute to such functional impairments. Currently, SP have several limitations including that they: (1) have no universally accepted definition, (2) are often based on anecdotal/expert opinion or at best supported by indirect evidence, (3) are mostly applied uniformly for all patients without regard to individual differences, and (4) may be overly restrictive and therefore impede ideal recovery. The purpose of this article is to present an overview of current research and commentary on median sternotomy procedures and activity restrictions. We propose that the optimal degree and duration of SP should be based on an individual patient's characteristics (eg, risk factors, comorbidities, previous activity level) that would enable physical activity to be targeted to particular limitations rather than restricting specific functional tasks and physical activity. Such patient-specific SP focusing on function may be more likely to facilitate recovery after median sternotomy and less likely to impede it. PMID:21448343

  4. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department.

    PubMed

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or

  5. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  6. Development and Validation of a Stratification Tool for Predicting Risk of Deep Sternal Wound Infection after Coronary Artery Bypass Grafting at a Brazilian Hospital

    PubMed Central

    Sá, Michel Pompeu Barros Oliveira; Ferraz, Paulo Ernando; Soares, Artur Freire; Miranda, Rodrigo Gusmão Albuquerque; Araújo, Mayara Lopes; Silva, Frederico Vasconcelos; Lima, Ricardo de Carvalho

    2017-01-01

    Objective Deep sternal wound infection following coronary artery bypass grafting is a serious complication associated with significant morbidity and mortality. Despite the substantial impact of deep sternal wound infection, there is a lack of specific risk stratification tools to predict this complication after coronary artery bypass grafting. This study was undertaken to develop a specific prognostic scoring system for the development of deep sternal wound infection that could risk-stratify patients undergoing coronary artery bypass grafting and be applied right after the surgical procedure. Methods Between March 2007 and August 2016, continuous, prospective surveillance data on deep sternal wound infection and a set of 27 variables of 1500 patients were collected. Using binary logistic regression analysis, we identified independent predictors of deep sternal wound infection. Initially we developed a predictive model in a subset of 500 patients. Dataset was expanded to other 1000 consecutive cases and a final model and risk score were derived. Calibration of the scores was performed using the Hosmer-Lemeshow test. Results The model had area under Receiver Operating Characteristic (ROC) curve of 0.729 (0.821 for preliminary dataset). Baseline risk score incorporated independent predictors of deep sternal wound infection: obesity (P=0.046; OR 2.58; 95% CI 1.11-6.68), diabetes (P=0.046; OR 2.61; 95% CI 1.12-6.63), smoking (P=0.008; OR 2.10; 95% CI 1.12-4.67), pedicled internal thoracic artery (P=0.012; OR 5.11; 95% CI 1.42-18.40), and on-pump coronary artery bypass grafting (P=0.042; OR 2.20; 95% CI 1.13-5.81). A risk stratification system was, then, developed. Conclusion This tool effectively predicts deep sternal wound infection risk at our center and may help with risk stratification in relation to public reporting and targeted prevention strategies in patients undergoing coronary artery bypass grafting.

  7. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2015-12-01

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST.

  8. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2014-10-29

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST.

  9. The thin blue line: a review and discussion of aseptic technique and postprocedural infections in rodents.

    PubMed

    Cooper, D M; McIver, R; Bianco, R

    2000-11-01

    A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.

  10. [Aseptic bone necroses as a late complication following successful treatment of leukemias and severe aplastic anemia].

    PubMed

    Slavc, I; Urban, C; Schwingshandl, J; Ritter, G; Trauner, R

    1987-01-01

    Aseptic bone necrosis is a well known complication after corticosteroid treatment in adults and several hundred cases have been reported. Alterations in fat metabolism with vascular occlusion due to fat embolization, as well as microtraumata and osteoporosis are discussed as etiologic factors. In contrast, aseptic bone necrosis in relation to corticosteroid treatment is rare in children and adolescents. We therefore report 3 patients, aged from 10 to 18 years, suffering from severe aplastic anemia, meningeal relapse after acute lymphocytic leukemia and acute myelocytic leukemia respectively, who developed aseptic bone necrosis 6, 11, and 20 months following the onset of corticoid therapy. The patients survive from 28+ to 50+ months after diagnosis of their initial hematologic disease, as it can be expected today for increasing numbers of patients. We therefore believe, that aseptic bone necrosis may represent a serious therapy related complication and suggest that, diagnostic examination in patients with suspicious complaints of the hip, shoulder or knee should also exclude the possibility of a bone necrosis after leucemic relapse has been ruled out. Since radiological changes only develop several weeks to months after the onset of the clinical symptoms and because of the disabling consequences for patients, misdiagnosed at the beginning, a 99 technetium bone scan should be done as early as possible. Corticosteroids, despite their serious side effects are still being considered as a important part of hematologic therapy and are not being omitted in the near future, so that the earliest possible diagnosis of bone necrosis will remain of great importance.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel

    DTIC Science & Technology

    1977-06-01

    divers cannot be related to any specific index of diving activity, and may not be causally related to DCS. radiography dysbaric osteonecrosis ...other names, among them dysbaric osteonecrosis , caisson disease of bone, baro- traumatic arthropathy, and so forth.) For many years, the assumption was...underwater en- gineering group technical note 12. Davidson, J. K. 1976. Dysbaric osteonecrosis . Page 147, in J. K. Davidson, Ed. Aseptic necrosis of

  12. Behçet's disease complicated by multiple aseptic abscesses of the liver and spleen.

    PubMed

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-05-28

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn's disease, and in other diseases. However, aseptic abscesses associated with Behçet's disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet's disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient's response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet's disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet's disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet's disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet's disease.

  13. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  14. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  15. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  16. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  17. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    PubMed Central

    Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    Objective: To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. Methods: In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. Results: Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barrier disturbance (p = 0.001). The Qalb as a marker for the leakiness of the BCSFB and, more indirectly, of the blood-brain barrier (BBB) was positively correlated with the incidence of leptomeningeal contrast enhancement seen on postcontrast fluid-attenuated inversion recovery (FLAIR) MRI (p = 0.003). Patients with a more pronounced brain barrier dysfunction recovered more slowly and stayed longer in the hospital. Conclusions: The severity of meningeal BBB disturbance can be estimated on postcontrast FLAIR MRI, which may be of diagnostic value in patients with aseptic meningitis. PMID:26516629

  18. The neurochemical markers in cerebrospinal fluid to differentiate between aseptic and tuberculous meningitis.

    PubMed

    Qureshi, G A; Baig, S M; Bednar, I; Halawa, A; Parvez, S H

    1998-02-01

    In this study, the use of neurochemical markers in patients with aseptic and tuberculous meningitis has been investigated. The cerebrospinal fluid levels of amino acids, nitrite (a metabolite of nitric oxide), vitamin B12 and homocysteine were quantitated in both groups of patients. Among the amino acids, aspartic acid and glutamic acid both excitatory amino acid, GABA, glycine and tryptophan were all significantly increased in both patient groups whereas decreased level of taurine and increased level of phenylalanine were only found in patients with tuberculous meningitis. The levels of nitrite and its precursor arginine were significantly higher in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. A significantly increased homocysteine level and a decreased level of vitamin B12 were found only in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. This indicates that patients with tuberculous meningitis are particularly prone to vitamin B12 deficiency resulting into increased level of HC, and involvement of free radical showing the importance of these biological markers for promoting the possibility for the design of therapeutic approach.

  19. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  20. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-02

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  1. Another cause of chest pain: Staphylococcus aureus sternal osteomyelitis in an otherwise healthy adult

    PubMed Central

    Vacek, Thomas P; Rehman, Shahnaz; Yu, Shipeng; Moza, Ankush; Assaly, Ragheb

    2014-01-01

    Chest pain requires a detailed differential diagnosis with good history-taking skills to differentiate between cardiogenic and noncardiogenic causes. Moreover, when other symptoms such as fever and elevated white blood cell count are involved, it may be necessary to consider causes that include infectious sources. A 53-year-old female with no significant past medical history returned to the hospital with recurrent complaints of chest pain that was constant, substernal, reproducible, and exacerbated with inspiration and expiration. The chest pain was thought to be noncardiogenic, as electrocardiography did not demonstrate changes, and cardiac enzymes were found to be negative for signs of ischemia. The patient’s blood cultures were analyzed from a previous admission and were shown to be positive for Staphylococcus aureus. The patient was started empirically on vancomycin, which was later switched to ceftriaxone as the bacteria were more sensitive to this antibiotic. A transthoracic echocardiogram did not demonstrate any vegetation or signs of endocarditis. There was a small right pleural effusion discovered on X-ray. Therefore, computed tomography as well as magnetic resonance imaging of the chest were performed, and showed osteomyelitis of the chest. The patient was continued on intravenous ceftriaxone for a total of 6 weeks. Tests for HIV, hepatitis A, B, and C were all found to be negative. The patient had no history of childhood illness, recurrent infections, or previous trauma to the chest, and had had no recent respiratory infections, pneumonia, or any underlying lung condition. Hence, her condition was thought to be a case of primary sternal osteomyelitis without known cause. PMID:25246811

  2. Computed tomographic assessment of sternal lymph node dimensions and attenuation in healthy dogs.

    PubMed

    Milovancev, Milan; Nemanic, Sarah; Bobe, Gerd

    2017-03-01

    OBJECTIVE To assess dimensions and attenuation of sternal lymph nodes (SLNs) observed by means of CT in healthy dogs. ANIMALS 12 healthy adult research dogs. PROCEDURES Precontrast and postcontrast enhanced CT of the thorax was performed on each dog. Objective and subjective contrast-enhanced CT measurements were obtained. RESULTS By use of CT, 2 SLNs were identified in 10 of the 12 dogs and 1 SLN was identified in 2. Median SLN length, height, and width were 8.5 mm (range, 4 to 22 mm), 6.0 mm (range, 3 to 10 mm), and 5.0 mm (range, 3 to 10 mm), respectively. Median SLN length-to-T4 ratio, height-to-T4 ratio, and width-to-T4 ratio were 0.64 (range, 0.24 to 1.22), 0.37 (range, 0.25 to 0.53), and 0.29 (range, 0.19 to 0.67), respectively. Median SLN volume was 123 mm(3) (range, 38 to 484 mm(3)). Median height-to-length ratio, width-to-length ratio, and height-to-width ratio were 0.57 (range, 0.27 to 1.75), 0.51 (range, 0.31 to 1.25), and 1.27 (range, 0.50 to 2.50), respectively. All SLNs had homogenous contrast enhancement with median precontrast and postcontrast attenuation values of 18.3 Hounsfield units (HU; range, 4.4 to 36.9 HU) and 41.3 HU (range, 24.0 to 77.4 HU), respectively. All SLNs had a visible hilus, which was fat attenuating in 8 dogs and hypoattenuating in 4 dogs. CONCLUSIONS AND CLINICAL RELEVANCE CT imaging characteristics described in this study may provide a reference for dimensions and appearance of SLNs of healthy dogs and serve as a basis for comparison with results for diseased dogs.

  3. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  4. Sternal Cleft and Pectus Excavatum: A Combined Approach for the Correction of a Complex Anterior Chest Wall Malformation in a Teenager.

    PubMed

    Tocchioni, Francesca; Ghionzoli, Marco; Lo Piccolo, Roberto; Deaconu, Diana E; Facchini, Flavio; Milanez De Campos, Jose R; Messineo, Antonio

    2015-06-01

    Congenital sternal cleft is a rare chest wall malformation. Because of the flexibility of the chest in infants, surgical repair should be performed by primary closure in the neonatal period. In adolescents and adults, different techniques have been suggested to overcome the lack of sternal bone tissue. We describe a very rare case of an 18-year-old woman with a complete bifid sternum associated with pectus excavatum for whom a satisfactory cosmetic and functional result was obtained by adequate surgical planning, which entailed a combination of two standardized surgical techniques.

  5. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

  6. Growth and toxin production by Clostridium botulinum in steamed rice aseptically packed under modified atmosphere.

    PubMed

    Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo

    2005-05-01

    Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.

  7. Aseptic necrosis of the femoral head after pregnancy: a case report

    PubMed Central

    Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa

    2016-01-01

    A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy. PMID:27795792

  8. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties.

  9. Somatic embryogenesis ofCyclamen persicum Mill. 'Anneke' from aseptic seedlings.

    PubMed

    Takamura, T; Miyajima, I; Matsuo, E

    1995-01-01

    InCyclamen persicum 'Anneke', explants from the various vegetative organs of aseptic seedling formed embryoids. The optimal responses were recorded in Murashige and Skoog (MS) medium enriched with 5.0µM 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5µM kinetin and 3-6% sucrose. Embryogenesis was enhanced at higher temperature of 25-30°C. On the other hand, light inhibited embryogenesis. Histological and morphological studies confirmed that the embryoids were indeed somatic embryos.

  10. The fine structural organization of sternal glands of pseudergates and workers in termites (Isoptera): a comparative survey.

    PubMed

    Quennedey, André; Sillam-Dussès, David; Robert, Alain; Bordereau, Christian

    2008-05-01

    Thirty-nine species belonging to different families of termites are studied to give a comprehensive view of the evolution of the sternal glands. Several modifications occurring at cuticular and cytological levels are described in neuter castes. The outer epicuticle is always pierced by epicuticular pores. In advanced termites the epicuticular filaments greatly increase in number and length creating a thick layer. The pore canals gradually enlarge while the cuticle changes into a lattice structure lining an extracellular space in which the secretion is stored. Two classes of cells are present in basal termites (Mastotermitidae, Hodotermitidae, Termopsidae and Kalotermitidae) but their glandular structures greatly differ between families. A more complex organization with three classes of cells is found in the Serritermitidae and Rhinotermitidae. A regressive evolution occurs in the Termitidae where only two classes of cells are present. A dual nervous control (campaniform sensilla and neurosecretory fibers) is found in lower termites, except for the Hodotermitidae which have mechanosensory bristles. In the other families, neurosecretory fibers are lacking. A comparison with phylogenetic data is given. A more versatile role of sternal glands in neuter castes is hypothesized.

  11. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis.

    PubMed

    Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L

    2016-04-01

    Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15

  12. Outbreak of aseptic meningitis by echo 4: prevalence of clinical cases among adults.

    PubMed

    Portolani, M; Pecorari, M; Pietrosemoli, P; Bartoletti, A; Sabbatini, A M; Meacci, M; Gennari, W; Bazzani, E; Beretti, F; Guaraldi, G

    2001-01-01

    Twenty five cases of meningitis occurred in urban areas surrounding a city (Modena) in Northern Italy, in the period May-July 1999. When the patients were admitted to the Infectious Diseases Division of the University of Modena and Reggio Emilia Hospital and studied by virological and serological methods, the meningitis proved to have an enteroviral origin and enterovirus ECHO 4 type was responsible for all cases of illness. An epidemiological characteristic of the enteroviral meninigitis outbreak was the adult age in 23 out of the 25 patients (mean age 24.50 +/- 7.84 years). The monthly distribution of the aseptic meningitis cases was the following: five cases occurred in May, 13 in June and seven in July. The origin of the spread of the virus infection and the reason for its sudden end remained unknown. The unusual drop in temperature which occurred in the geographic area involved in the aseptic meningitis outbreak at the beginning of August could have interfered with the slowdown in virus circulation.

  13. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  14. SIRT1 protects osteoblasts against particle-induced inflammatory responses and apoptosis in aseptic prosthesis loosening.

    PubMed

    Deng, Zhantao; Wang, Zhenheng; Jin, Jiewen; Wang, Yong; Bao, Nirong; Gao, Qian; Zhao, Jianning

    2017-02-01

    We hypothesized that SIRT1 downregulation in osteoblasts induced by wear particles was one of the reasons for particle-induced osteolysis (PIO) in total joint arthroplasty failure. In the present study, the expression of SIRT1 was examined in osteoblasts treated with TiAl6V4 particles (TiPs) and CoCrMo particles (CoPs) from materials used in prosthetics and specimens from PIO animal models. To address whether SIRT1 downregulation triggers inflammatory responses and apoptosis in osteoblasts, the effect of a SIRT1 activator, resveratrol on the expression of inflammatory cytokines and apoptosis in particle-treated osteoblasts was tested. The results demonstrated that SIRT1 expression was significantly downregulated in particle-treated osteoblasts and PIO animal models. Both pharmacological activation and overexpression of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines and osteoblast apoptosis through NF-κB and p53 signaling, respectively. Furthermore, in PIO animal models, resveratrol significantly reduced the severity of osteolysis. Collectively, the results of the present study indicated that SIRT1 plays a vital role in the pathogenesis of aseptic loosening, and further treatment targeted at SIRT1 possibly lead to novel approaches for prevention of aseptic prosthesis loosening.

  15. Aseptic Culture Systems of Radopholus similis for In Vitro Assays on Musa spp. and Arabidopsis thaliana.

    PubMed

    Elsen, A; Lens, K; Nguyet, D T; Broos, S; Stoffelen, R; De Waele, D

    2001-06-01

    Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana.

  16. Use of gentamicin sulfate-impregnated sponges as adjuvant therapy for the treatment of chronic foreign body associated sternal osteomyelitis in a dog

    PubMed Central

    Wainberg, Shannon H.; Brisson, Brigitte A.; Hayes, Galina M.; Mackenzie, Shawn

    2015-01-01

    A 2-year-old Labrador retriever dog was referred for evaluation of parasternal chronic draining sinus tracts associated with sternal osteomyelitis secondary to the presence of a residual wooden foreign body. The use of gentamicin-impregnated collagen sponges as adjunctive therapy to osteomyelitis treatment is reported herein. PMID:26538672

  17. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  18. Are chest compressions safe for the patient reconstructed with sternal plates? Evaluating the safety of cardiopulmonary resuscitation using a human cadaveric model

    PubMed Central

    2010-01-01

    Background Plate and screw fixation is a recent addition to the sternal wound treatment armamentarium. Patients undergoing cardiac and major vascular surgery have a higher risk of postoperative arrest than other elective patients. Those who undergo sternotomy for either cardiac or major vascular procedures are at a higher risk of postoperative arrest. Sternal plate design allows quick access to the mediastinum facilitating open cardiac massage, but chest compressions are the mainstay of re-establishing cardiac output in the event of arrest. The response of sternal plates and the chest wall to compressions when plated has not been studied. The safety of performing this maneuver is unknown. This study intends to demonstrate compressions are safe after sternal plating. Methods We investigated the effect of chest compressions on the plated sternum using a human cadaveric model. Cadavers were plated, an arrest was simulated, and an experienced physician performed a simulated resuscitation. Intrathoracic pressure was monitored throughout to ensure the plates encountered an appropriate degree of force. The hardware and viscera were evaluated for failure and trauma respectively. Results No hardware failure or obvious visceral trauma was observed. Rib fractures beyond the boundaries of the plates were noted but the incidence was comparable to control and to the fracture incidence after resuscitation previously cited in the literature. Conclusions From this work we believe chest compressions are safe for the patient with sternal plates when proper plating technique is used. We advocate the use of this life-saving maneuver as part of an ACLS resuscitation in the event of an arrest for rapidly re-establishing circulation. PMID:20718981

  19. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from diplodocidae and their morphological, functional and evolutionary implications.

    PubMed

    Tschopp, Emanuel; Mateus, Octávio

    2013-03-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  20. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from Diplodocidae and their morphological, functional and evolutionary implications

    PubMed Central

    Tschopp, Emanuel; Mateus, Octávio

    2013-01-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles – which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  1. Mechanical properties of human bone-implant interface tissue in aseptically loose hip implants.

    PubMed

    Kraaij, Gert; Zadpoor, Amir A; Tuijthof, Gabrielle J M; Dankelman, Jenny; Nelissen, Rob G H H; Valstar, Edward R

    2014-10-01

    The main cause of failure in total hip replacement is aseptic loosening which is associated with the formation of a periprosthetic fibrous (interface) tissue. Despite important applications for finite element modeling of loose implants, the mechanical properties of the bone-implant interface tissue have never been measured in humans. In this study, we performed unconfined compression tests to characterize the mechanical properties of the interface tissue and to determine the parameters of various hyperelastic material models which were fitted to the measurements. Human interface tissues were retrieved during 21 elective revision surgeries from aseptically loosened cemented (N=10) and uncemented hip implants (N=11). Specimens were tested at a fixed deformation rate of 0.1mm/min up to a maximum force of 10N. Elastic moduli for low and high strain regions of the stress-strain curves were determined. Interface tissue from aseptically loose cemented prostheses shows higher elastic moduli (mean=1.85MPa, 95% C.I.=1.76-1.95MPa) in the high strain region as compared to that of the interface tissue from the cementless group (mean=1.65MPa, 95% C.I.=1.43-1.88MPa). The 5-terms Mooney-Rivlin model ( [Formula: see text] ) described the stress-strain behavior the best. Large variations in the mechanical behavior were observed both between specimens from the same patient as between those of different patients. The material model parameters were therefore estimated for the mean data as well as for the curves with the highest and lowest strain at the maximum load. The model parameters found for the mean data were C1=-0.0074MPa, C2=0.0019MPa, C3=0MPa, C4=-0.0032MPa and C5=0MPa in the cemented group and C1=-0.0137MPa, C2=0.0069MPa, C3=0.0026MPa, C4=-0.0094MPa and C5=0MPa in the cementless group. The results of this study can be used in finite element computer.

  2. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage.

  3. First epidemic of aseptic meningitis due to echovirus type 13 among Spanish children.

    PubMed Central

    Trallero, G.; Casas, I.; Avellón, A.; Pérez, C.; Tenorio, A.; De La Loma, A.

    2003-01-01

    Echoviruses are the commonest cause of aseptic meningitis (AM). Echovirus type 13 (EV-13) was the second enterovirus serotype associated with different local outbreaks of AM in Spain between February and October 2000. It was the first time that an epidemic AM caused by this virus was recognized in Spain. The index case appeared in the Canary Islands (Canarias). The EV-13 virus was isolated from 135 patients, predominantly from cerebrospinal fluid (CSF). All isolates were from children under 13 years. The age specific peak incidence was in infants under 1 year. Most patients had fever, headache and other meningeal signs. This enterovirus serotype, not previously detected in Spain, caused severe illness with a high attack rate. PMID:12729193

  4. Aseptic meningitis in a patient taking etanercept for rheumatoid arthritis: a case report

    PubMed Central

    Booker, Matthew J; Flint, Julia; Saravana, Shanmugam

    2008-01-01

    Background We report a case of a 53 year old lady recently commenced on etanercept, an anti-TNF (tumour necrosis factor) therapy for rheumatoid arthritis presenting with confusion, pyrexia and an erythematous rash. Case presentation A lumbar puncture was highly suggestive of bacterial meningitis, but CSF cultures produced no growth, and polymerase chain reactions (PCR) for all previously reported bacterial, fungal and viral causes of meningitis were negative. Conclusion This case report describes aseptic meningitis as a previously unreported complication of etanercept therapy, and serves as a reminder of the rare but potentially life-threatening risk of serious infections in patients taking anti-TNF therapy for a variety of conditions. PMID:19046446

  5. [Acute disseminated encephalomyelitis in children as the result of aseptic meningitis - a report of two cases].

    PubMed

    Gołąbek, Violetta; Woźniakowska-Gęsicka, Teresa; Sokołowska, Dorota

    2011-01-01

    Acute disseminated encephalomyelitis (ADEM) is an inflammation of the spinal cord and brain. Diagnosis of ADEM, due to its rare occurrence and lack of definite laboratory indices, is difficult and is never totally certain. The clinical criterion required for the diagnosis is presence of acute symptoms from the brain and/or spine with fever, occurring after viral or bacterial infection, vaccination or serum administration. Differentiation between ADEM and acute multiple sclerosis in children is difficult, and diagnosis of ADEM may only be confirmed after years of observation, especially as multiple sclerosis is more common than ADEM. The most useful tool in differentiation between the two diseases is MRI. The aim of the study was to present two cases of ADEM with unknown aetiology after aseptic meningitis in children.

  6. [Vacuum-assisted Closure (VAC) Treatment for Sternal Infection in a Patient after Cardiovascular Surgery; Report of a Case].

    PubMed

    Shima, Shotaro; Okamura, Kennichi; Morizumi, Sei; Kanamori, Taro; Ichihara, Tetsuya; Kawata, Mitsuhiro; Suematsu, Yoshihiro

    2015-03-01

    One year ago, a 42-year-old woman underwent aortic root replacement because of a pseudoaneurysm that developed at the site of an anastomosis after ascending aortic replacement for acute aortic dissection. Six months later, she complained of fever and cough. A computed tomography revealed recurrence of the peudoaneurysm at the proximal anastomosis of the aortic root replacement. After emergency re-do aortic root replacement, she was admitted to intensive care unit (ICU) without sternal closure because of mediastinitis. The mediastinitis was managed by debridement and lavage drainage, followed by vacuum-assisted closure (VAC) treatment. The VAC treatment facilitated wound healing and active rehabilitation using a portable device. Finally, the wound was closed completely using a skin graft. VAC treatment is considered very useful in a case of post-sternotomy madiastinitis.

  7. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  8. Techniques and clinical effect of aseptic procedures on patients with acute leukemia in laminar airflow rooms.

    PubMed

    Takeo, H; Sakurai, T; Amaki, I

    1983-01-01

    The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.

  9. Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer

    NASA Astrophysics Data System (ADS)

    Lalime, Erin N.; Berlin, David

    2016-09-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  10. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin N.; Berlin, David

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  11. Aseptically Processed Placental Membrane Improves Healing of Diabetic Foot Ulcerations: Prospective, Randomized Clinical Trial

    PubMed Central

    DiDomenico, Lawrence A.; Orgill, Dennis P.; Galiano, Robert D.; Serena, Thomas E.; Carter, Marissa J.; Kaufman, Jarrod P.; Young, Nathan J.

    2016-01-01

    Background: Allogeneic grafts derived from amnion/chorion are known to be efficacious in healing chronic diabetic foot ulcerations (DFUs). The goal of this study was to compare aseptically processed dehydrated human amnion and chorion allograft (dHACA) versus standard of care (SOC) in facilitating wound closure in nonhealing DFUs. Methods: Patients with DFUs treated with SOC (off-loading, appropriate debridement, and moist wound care) after a 2-week screening period were randomized to either SOC or wound-size-specific dHACA (AmnioBand, Musculoskeletal Transplant Foundation, Edison, N.J.) applied weekly for up to 12 weeks plus SOC. Primary endpoint was the percentage of wounds healed at 6 weeks between groups. Results: At 6 weeks, 70% (14/20) of the dHACA-treated DFUs healed compared with 15% (3/20) treated with SOC alone. Furthermore, at 12 weeks, 85% (17/20) of the DFUs in the dHACA group healed compared with 25% (5/20) in the SOC group, with a corresponding mean time to heal of 36 and 70 days, respectively. At 12 weeks, the mean number of grafts used per healed wound for the dHACA group was 3.8 (median 3.0), and mean cost of the tissue to heal a DFU was $1400. The mean wastage at 12 weeks was 40%. One adverse event and 1 serious adverse event occurred in the dHACA group; neither was graft related. Three adverse events and 1 serious adverse event occurred in the SOC group. Conclusion: Aseptically processed dHACA heals diabetic foot wounds significantly faster than SOC at 6 and 12 weeks with minimal graft wastage. PMID:27826487

  12. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  13. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process.

  14. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  15. Report of Two Cases of Aseptic Meningitis with Persistence of Pneumococcal Cell Wall Components in Cerebrospinal Fluid after Pneumococcal Meningitis▿

    PubMed Central

    Angoulvant, François; Lachenaud, Julie; Mariani-Kurkdjian, Patricia; Aubertin, Guillaume; Houdouin, Véronique; Lorrot, Mathie; de Los Angeles, Laure; Bingen, Edouard; Bourrillon, Antoine; Faye, Albert

    2006-01-01

    We describe two cases of aseptic meningitis occurring some time after pneumococcal meningitis. Both cases may have resulted from an inflammatory response to persistent pneumococcal cell membrane components, as the cerebrospinal fluid samples were positive by the Binax NOW Streptococcus pneumoniae antigen test. Potential mechanisms and diagnostic impact are discussed. PMID:17005744

  16. Complete Genome Sequence Analysis of Echovirus 18 Associated with Aseptic Meningitis in Hebei Province, China, in 2015

    PubMed Central

    Sun, Su-zhen; Guo, Jia-yun; Li, Jing-jie

    2016-01-01

    Echovirus 18 is a member of the genus Enterovirus, family Picornaviridae, which can cause meningitis in children. Here, we report the echovirus 18 complete genome sequence, which was isolated from the cerebrospinal fluid of a child with aseptic meningitis in Hebei Province, China. PMID:27789638

  17. A case of cerebral salt-wasting syndrome associated with aseptic meningitis in an 8-year-old boy.

    PubMed

    Inatomi, Jun; Yokoyama, Yoshiki; Sekine, Takashi; Igarashi, Takashi

    2008-04-01

    Cerebral salt-wasting syndrome is a disorder in which excessive natriuresis and subsequent hyponatremic dehydration occur in patients with intracranial diseases. Cerebral salt-wasting syndrome often develops in patients with severe neurosurgical disorders, such as hydrocephalus, cerebral infarction, and tuberculous meningitis. Here, we report on the case of an 8-year-old boy with cerebral salt-wasting syndrome associated with aseptic meningitis. He showed mild developmental retardation and had a history of convulsion. Four days after his admission, cerebral salt-wasting syndrome abruptly started: natriuresis and hyponatremia gradually improved over 10 days. To the best of our knowledge, this is the first report on cerebral salt-wasting syndrome associated with clinically benign aseptic meningitis.

  18. Vitrification of human laser treated blastocysts within cut standard straws (CSS): novel aseptic packaging and reduced concentrations of cryoprotectants.

    PubMed

    Isachenko, Vladimir; Katkov, Igor I; Yakovenko, Sergey; Lulat, Ayub G-M I; Ulug, Murat; Arvas, Ayse; Isachenko, Evgenia

    2007-06-01

    Vitrification of laser treated human blastocysts using reduced concentrations of permeable cryoprotectants was carried out by submerging cut standard straws (CSS) into liquid nitrogen. The CSS were made by cutting a standard 0.25 ml straw at an angle of approximately 45 degrees . After laser assisted hatching, 6 day blastocysts (n=250) were loaded into droplets of approximately 0.75 microl in the CSS and were either plunged directly into liquid nitrogen or first encased in a standard 0.5 ml straw (aseptic technique) before being vitrified. Permeable cryoprotectants (ethylene glycol+Me(2)SO) at concentrations of 15% and 20% v:v were tested for their effect on post warming re-expansion and post transfer pregnancy rates. Our results indicate that the use of reduced concentrations of cryoprotectants and aseptic packaging of blastocysts did not have any statistically significant impact on the study outcomes.

  19. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature

    PubMed Central

    Scaffidi, Michael A.; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon. PMID:28265555

  20. Aseptic colon resection by an invagination technique. Experimental study on dogs.

    PubMed

    Jørgensen, L S; Raundahl, U; Knudsen, L L; Aksglaede, K; Søgaard, P

    1991-07-01

    A new aseptic colon resection by an invagination technique is presented. The bowel to be resected is invaginated down into the healthy intestine, and the anastomosis is sutured in one layer of continuous suture before transection by a diathermy wire, placed in the intestinal lumen via the anus. Sections of bowel that cannot be invaginated, e.g., because of a tumor, are first removed by transection between pairs of cable ties, which close the lumen. Twenty dogs were operated on without receiving prophylactic antibiotics. In 10, the intestine was transected between cable ties. An imprint, taken from the anastomosis and subcutis, was cultured. The bacterial count at the anastomosis exceeded 100 in only three cases; in the subcutis, this was the case in one dog. One wound infection developed. Serial barium enemas at 1, 2, 3, and 4 weeks revealed no anastomotic leakage. One early death because of a total anastomotic dehiscence was encountered, and two dogs were killed because of wound dehiscence and anastomotic stricture, respectively. It is concluded that, in dogs, the method is easily and safely performed, but further experimental studies are needed.

  1. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature.

    PubMed

    Bollegala, Natasha; Khan, Rishad; Scaffidi, Michael A; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol; Grover, Samir C

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon.

  2. [Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 13 cases with mumps meningitis].

    PubMed

    Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru

    2015-01-01

    We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.

  3. Molecular phylogeny and surface morphology of marine aseptate gregarines (Apicomplexa): Selenidium spp. and Lecudina spp.

    PubMed

    Leander, B S; Harper, J T; Keeling, P J

    2003-12-01

    Many aseptate gregarines from marine invertebrate hosts are thought to have retained several plesiomorphic characteristics and are instrumental in understanding the early evolution of intracellular parasitism in apicomplexans and the phylogenetic position of cryptosporidians. We sequenced the small-subunit (SSU) ribosomal RNA genes from 2 archigregarines, Selenidium terebellae and Selenidium vivax, and 2 morphotypes of the marine eugregarine Lecudina polymorpha. We also used scanning electron microscopy to investigate the surface morphology of trophozoites from Lecudina tuzetae, Monocystis agilis, the 2 species of Selenidium, and the 2 morphotypes of L. polymorpha. The SSU ribosomal DNA sequences from S. vivax and L. polymorpha had long branch lengths characteristic of other gregarine sequences. However, the sequence from S. terebellae was not exceptionally divergent and consistently emerged as 1 of the earliest 'true' gregarines in phylogenetic analyses. Statistical support for the sister relationship between Cryptosporidium spp. and gregarines was significantly bolstered in analyses including the sequence from S. terebellae but excluding the longest branches in the alignment. Eugregarines formed a monophyletic group with the neogregarine Ophryocystis, suggesting that trophozoites with elaborate cortex folds and gliding motility evolved only once. The trophozoites from the 2 species of Selenidium shared novel transverse striations but differed from one another in overall cell morphologies and writhing behavior.

  4. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  5. Growth and colour development of some surface ripening bacteria with Debaryomyces hansenii on aseptic cheese curd.

    PubMed

    Mounier, Jérôme; Irlinger, Françoise; Leclercq-Perlat, Marie-Noëlle; Sarthou, Anne-Sophie; Spinnler, Henry-Eric; Fitzgerald, Gerald F; Cogan, Timothy M

    2006-11-01

    The growth of five bacteria isolated from red-smear cheeses, Brevibacterium aurantiacum, Corynebacterium casei, Corynebacterium variabile, Microbacterium gubbeenense and Staphylococcus saprophyticus in mixed cultures with Debaryomyces hansenii on aseptic model cheese curd at 10 and 14 degrees C was investigated. At both temperatures, C. casei and Micro. gubbeenense had a longer lag phase than C. variabile, Brevi. aurantiacum and Staph. saprophyticus. In all cultures, lactose was utilised first and was consumed more rapidly at 14 degrees C than at 10 degrees C, i.e., 6 d at 14 degrees C and 10 d at 10 degrees C. This utilisation coincided with the exponential growth of Deb. hansenii on the cheese surface. Lactate was also used as a carbon source and was totally consumed after 21 d at 14 degrees C and approximately 90% was consumed after 21 d at 10 degrees C regardless of the ripening culture. Small differences (<0.5 pH unit) in the surface-pH during ripening were noticeable between ripening cultures. Differences in the colour development of the mixed cultures with the yeast control were only noticeable after 15 d for Brevi. aurantiacum and after 21 d for the other bacteria. Regardless of the organisms tested, colour development and colour intensity were also greater at 14 degrees C than at 10 degrees C. This study has provided useful information on the growth and contribution to colour development of these bacteria on cheese.

  6. Adhesion molecules in gonarthrosis and knee prosthesis aseptic loosening follow-up: possible therapeutic implications.

    PubMed

    Dambra, P; Loria, M P; Moretti, B; D'Oronzio, L; Patella, V; Pannofino, A; Cavallo, E; Pesce, V; Dell'Osso, A; Simone, C

    2003-05-01

    The involvement of the synovium is common in phlogistic processes of various joint diseases. Apart from synoviocytes and the other cells in the synovial tissue, circulating cells recruited from peripheral blood also participate in the phlogistic process. The increased expression of adhesion molecules on both circulating and endothelial cell surface may further this recruitment. We studied 15 patients affected by serious gonarthrosis requiring a prosthetic implant (GPI) and 7 with knee prosthesis aseptic loosening (KPL) to evaluate adhesion molecule expression and phlogistic infiltration in the synovium using immunohistochemistry and microscopic analysis. As control we studied 10 subjects affected by degenerative meniscopathies undergoing a selective arthroscopic surgical meniscectomy. Analysis with Kruskal-Wallis test showed no statistical significant differences in the expression of CD54, CD11a, CD11b and CD18 in three groups examined. The model of variance analysis (Friedman test), showed that CD54 expression is greater in patients with GPI and KPL in comparison with the other molecules. Adhesion molecules and their functions are important in arthropathies not only because their evaluation can allow us to identify the degree of inflammation and to predict its evolution, but also because pharmacological control of their expression could have important therapeutic implications.

  7. Iron Supplementation Effects on Redox Status following Aseptic Skeletal Muscle Trauma in Adults and Children

    PubMed Central

    Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis

    2017-01-01

    Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults (n = 14) and children (n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation (p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Clinicaltrials.gov Identifier: NCT02374619. PMID:28203319

  8. Concomitant Sternal Fracture in Flail Chest: An Analysis of 21,741 Polytrauma Patients from the TraumaRegister DGU®.

    PubMed

    Schulz-Drost, Stefan; Krinner, Sebastian; Langenbach, Andreas; Oppel, Pascal; Lefering, Rolf; Taylor, Dominic; Hennig, Friedrich F; Mauerer, Andreas

    2017-02-10

    Background Isolated sternal fractures (SFs) rarely show complications, but their influence in a thorax trauma of the seriously injured still remains unclear. Methods A retrospective analysis of the TraumaRegister DGU(®) was performed involving the years 2009 to 2013 (Injury Severity Score [ISS] ≥ 16, primary admission to a trauma center). Cohort formation: Unilateral and bilateral flail chest (FC) injuries with and without a concomitant SF, respectively. Results In total, 21,741 patients (25% female) met the inclusion criteria, with 3,492 (16.1%) showing SF. Unilateral FC patients were on average 53.6 ± 18.4 years old, and bilateral FC patients were on average 55.2 ± 17.7 years old. The ISS in unilateral FC and bilateral FC amounted to 31.2 ± 13.0 and 43.4 ± 13.1 points, respectively. FC with an SF occurred more frequently as an injury to car occupants and less frequently as an injury to motorcyclists or in injuries due to falls. Conclusion Patients with an SF additional to an FC had longer hospital and intensive care unit stays and were longer artificially respirated than those patients without an SF. SF indicates possible cardiac and thoracic spine injuries.

  9. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae).

    PubMed

    Vujisić, Ljubodrag V; Vučković, Ivan M; Makarov, Slobodan E; Ilić, Bojan S; Antić, Dragan Z; Jadranin, Milka B; Todorović, Nina M; Mrkić, Ivan V; Vajs, Vlatka E; Lučić, Luka R; Curčić, Božidar P M; Mitić, Bojan M

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  10. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae)

    NASA Astrophysics Data System (ADS)

    Vujisić, Ljubodrag V.; Vučković, Ivan M.; Makarov, Slobodan E.; Ilić, Bojan S.; Antić, Dragan Ž.; Jadranin, Milka B.; Todorović, Nina M.; Mrkić, Ivan V.; Vajs, Vlatka E.; Lučić, Luka R.; Ćurčić, Božidar P. M.; Mitić, Bojan M.

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6 O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  11. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD.

  12. Evaluation of disinfecting procedures for aseptic transfer in hospital pharmacy departments.

    PubMed

    Mehmi, Manita; Marshall, Lindsay J; Lambert, Peter A; Smith, Julian C

    2009-01-01

    Current practice in National Health Service (NHS) hospitals employs 70% Industrial Methylated Spirit spray for surface disinfection of components required in Grade A pharmaceutical environments. This study seeks to investigate other agents and procedures that may provide more effective sanitisation. Several methods are available to test the efficacy of disinfectants against vegetative organisms. However, no methods currently available test the efficacy of disinfectants against spores on the hard surfaces encountered in the pharmacy aseptic processing environment. Therefore, a method has been developed to test the efficacy of disinfectants against spores, modified from British Standard 13697 and Association of Analytical Chemists standards. The testing procedure was used to evaluate alternative biocides and disinfection methods for transferring components into hospital pharmacy cleanrooms, and to determine which combinations of biocide and application method have the greatest efficacy against spores of Bacillus subtilis subspecies subtilis 168, Bacillus subtilis American Type Culture Collection (ATCC) 6633, and Bacillus pumilis ATCC 27142. Stainless steel carrier test plates were used to represent the hard surfaces in hospital pharmacy cleanrooms. Plates were inoculated with 10(7)-10(8) colony-forming units per milliliter (CFU/mL) and treated with the various biocide formulations, using different disinfection methods. Sporicidal activity was calculated as log reduction in CFU. Of the biocides tested, 6% hydrogen peroxide and a quaternary ammonium compound/chlorine dioxide combination were most effective compared to a Quat/biguanide, amphoteric surfactant, 70% v/v ethanol in deionised water and isopropyl alcohol in water for injection. Of the different application methods tested, spraying followed by wiping was the most effective, followed closely by wiping alone. Spraying alone was least effective.

  13. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  14. Resection of sternal metastasis from endometrial carcinoma followed by reconstruction with sandwiched marlex and stainless steel mesh: report of a case.

    PubMed

    Haraguchi, Shuji; Hioki, Masafumi; Hisayoshi, Takao; Yamashita, Koji; Koizumi, Kiyoshi; Shimizu, Kazuo

    2006-01-01

    We report the successful resection of sternal metastasis from endometrial carcinoma, followed by reconstruction of the chest defect, in an 87-year-old woman. We performed subtotal sternectomy and concurrent resection of the ribs and overlying soft tissue. The skeletal defect was then reconstructed with sandwiched Marlex and stainless steel mesh, and soft tissue coverage was accomplished by using a pectoralis major advancement flap. The patient had an uneventful postoperative course with no sign of recurrence during 5 years of follow-up. Thus, reconstruction with Marlex and stainless steel mesh could be an effective technique for preventing paradoxical movement of the thorax and protecting the intrathoracic organs.

  15. Absolute identification of muramic acid, at trace levels, in human septic synovial fluids in vivo and absence in aseptic fluids.

    PubMed

    Fox, A; Fox, K; Christensson, B; Harrelson, D; Krahmer, M

    1996-09-01

    This is the first report of a study employing the state-of-the-art technique of gas chromatography-tandem mass spectrometry for absolute identification of muramic acid (a marker for peptidoglycan) at trace levels in a human or animal body fluid or tissue. Daughter mass spectra of synovial fluid muramic acid peaks (> or = 30 ng/ml) were identical to those of pure muramic acid. Absolute chemical identification at this level represents a 1,000-fold increase in sensitivity over previous gas chromatography-mass spectrometry identifications. Muramic acid was positively identified in synovial fluids during infection and was eliminated over time but was absent from aseptic fluids.

  16. Recurrent aseptic meningitis as a rare but important presentation of congenital petrous apex cholesteatoma: the value of appropriate imaging

    PubMed Central

    MacKeith, Samuel A; Soledad-Juarez, Maria; Tiberti, Liliana; Orfila, Daniel

    2014-01-01

    We describe the presentation, investigation and challenging management of a young adult with recurrent aseptic meningitis. The presence of cholesterol and triglycerides in the cerebrospinal fluid sample was recognised as a potential sign of an underlying dermoid or epidermoid cyst. We demonstrate how appropriate imaging of the skull base with diffusion-weighted imaging (DWI) MRI can help differentiate between lesions of the petrous apex, facilitating the diagnosis of a petrous apex congenital cholesteatoma/epidermoid cyst. Awareness of this unusual mode of presentation of a rare disease, as well as knowledge of key diagnostic investigations, may allow for earlier identification, treatment and reduced morbidity/mortality. PMID:24614768

  17. Vitrified sperm banks: the new aseptic technique for human spermatozoa allows cryopreservation at -86 °C.

    PubMed

    Sánchez, R; Risopatrón, J; Schulz, M; Villegas, J V; Isachenko, V; Isachenko, E

    2012-12-01

    The vitrification technique is simple, quick, cost-effective and has showed a significantly stronger cryoprotective effect in contrast to conventional freezing. The method is based on the rapid cooling of the cell by direct immersion in liquid nitrogen (LN (2) ), thereby avoiding the formation of ice crystals, due to the lower risk of water thawing, which impairs cell function. The aim of this study was to evaluate the effect of storage at -86 °C compared to the conventional -196 °C (under LN (2) ) on essential parameters of the functioning of aseptically vitrified human sperm. Sperm motility, integrity of mitochondrial membrane potential and the rate of DNA fragmentation were determined. The comparison of -86 °C and -196 °C demonstrated no statistical difference in sperm progressive motility (73% vs. 77%), integrity of mitochondrial membrane potential (71% vs. 74%) or DNA fragmentation (3.1% vs. 2.9%). In conclusion, aseptically vitrified sperm can be preserved at -86 °C; eliminating the use of LN (2) simplifies and significantly reduces the costs associated with storage in sperm banks by decreasing the time and space needed for storage, the effort in finding stored samples, and by improving safety for the operator. However, for prolonged storage further studies are needed.

  18. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  19. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  20. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  1. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared.

  2. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  3. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  4. Interferon-gamma and cortisol levels in cerebrospinal fluid and its relationship to the etiology of aseptic meningoencephalitis.

    PubMed

    Holub, M; Beran, O; Lacinová, Z; Cinek, O; Chalupa, P

    2006-01-01

    The aim of the study was to analyze the concentrations of Th1/Th2 cytokines and cortisol in the cerebrospinal fluid (CSF) from patients with aseptic meningoencephalitis (AM). The study enrolled 37 patients with AM and 11 control subjects. CSF concentrations of IL-2, IL-4, IL-5, IL-10, IFN-gamma, and TNF-alpha were analyzed using cytokine bead array and flow cytometry; CSF cortisol concentrations were measured by a RIA method. Cortisol was detected in 37 CSF samples (100%) from patients with AM, and it was significantly elevated in comparison to control subjects. IFN-gamma was detected in 32 CSF samples (86.5%) and IL-10 was detectable in 9 CSF samples (24.3%). The CSF cortisol levels correlated negatively with the duration of AM. The intrathecal concentration of IFN-gamma correlated positively with CSF numbers of leukocytes and lymphocytes, and negatively with the duration of AM. The etiology of AM influenced the CSF cortisol concentration, which was significantly higher in patients with tick-borne encephalitis when compared to persons with AM of unknown origin and control subjects. The results indicate that the prevailing intrathecal immune reaction during AM is shifted to a Th1-like response, whereas anti-inflammatory response in the brain is executed by the effect of cortisol.

  5. Case report of early aseptic loosening of total hip arthroplasty in monostotic paget disease, a diagnostic challenge.

    PubMed

    Crego-Vita, Diana; Aedo-Martín, Daniel; Sánchez-Pérez, Coral

    2016-01-01

    Paget's disease of bone is a localised chronic osteopathy which produces bone deformities, bone hypervascularity, structural weakness and altered joint biomechanics. Although radiological diagnosis of Paget's disease of bone is usually straightforward, monostotic cases may potentially raise specific problems which require invasive and expensive procedures such as bone biopsies. The pelvis and upper femur are frequently affected, resulting in disabling hip disease that may require total hip arthroplasty. We report a case of Paget disease of bone in an 84-year-old woman, which was initially identified as avascular necrosis of the hip, reason for which she underwent total hip arthroplasty. During follow up, the patient complained about hip pain and in a few months she was not able to walk because of an early loosening with bone destruction. Radiological and laboratory exams were carried out with normal results except for alkaline phosphatase (AP). After treatment with biphosphonates hip pain relieved but hip reconstruction was not possible. In this paper we present an early aseptic loosening of hip arthroplasty due to monostotic Paget's disease of bone, a rare ethiology of loosening which poses particular diagnostic difficulties prompting an excessive use of excisional biopsies.

  6. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  7. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  8. Broad-range 16S rRNA PCR with cerebrospinal fluid may be unreliable for management of postoperative aseptic meningitis.

    PubMed

    Zarrouk, Virginie; Leflon-Guibout, Véronique; Robineaux, Sébastien; Kalamarides, Michel; Nicolas-Chanoine, Marie-Hélène; Sterkers, Olivier; Fantin, Bruno

    2010-09-01

    We previously demonstrated that discontinuing presumptive antibiotic treatment in cases of negative conventional cultures is safe and effective for patients with postoperative aseptic meningitis (PAM). Here, we prospectively investigated 32 patients with postoperative meningitis. All 26 patients with PAM diagnosed on the basis of conventional cultures demonstrated negative 16S rRNA PCR results. Our results suggest that the PCR technique does not change PAM management.

  9. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    PubMed Central

    Orion, Camille; Sfecci, Alicia; Tisseau, Laurent; Darrieux, Laure; Safa, Gilles

    2016-01-01

    Idiopathic facial aseptic granuloma (IFAG) is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea. PMID:27920676

  10. Feasibility of aseptic processing of a low-acid multiphase food product (salsa con queso) using a continuous flow microwave system.

    PubMed

    Kumar, P; Coronel, P; Simunovic, J; Sandeep, K P

    2007-04-01

    Aseptic processing of a low-acid multiphase food product using a continuous flow microwave heating system can combine the advantages of an aseptic process along with those of microwave heating. Dielectric properties of 2 different brands of 1 such product (salsa con queso) were measured under continuous flow conditions at a temperature range of 20 to 130 degrees C. At 915 MHz, the dielectric constant ranged from 58.7 at 20 degrees C to 41.3 at 130 degrees C with dielectric loss factor ranging from 41.0 at 20 degrees C to 145.5 at 130 degrees C. The loss tangent at 915 MHz ranged from 0.61 at 20 degrees C to 3.52 at 130 degrees C. The temperature profiles at the outlet during processing of salsa con queso in a 5-kW microwave unit showed a narrow temperature distribution between the center and the wall of the tube. The study showed the feasibility of aseptic processing of salsa con queso using a continuous flow microwave system.

  11. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    PubMed

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening.

  12. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression.

  13. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum.

    PubMed

    Zheng, Xiaoting; O'Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-09-23

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements.

  14. Une observation d'un goitre sur dysgénésie thyroïdienne pré-sternale

    PubMed Central

    Fanantenana, Herinirina Nicolas; Hasina, Rajaonarison Ny Ony Narindra Lova; Hery, Rafanomezantsoa; Claude, Rakotoarisoa Andriamihaja Jean; Ahmad, Ahmad

    2015-01-01

    L'hétérotopie thyroïdienne est une localisation anormale de tissus thyroïdiens normaux coexistant avec un organe normal et de localisation normale. Elle se distingue de l'ectopie thyroïdienne et d'une métastase du cancer de la thyroïde. Nous rapportons un cas d'hétérotopie thyroïdienne pré-sternale chez une femme de 65 ans afin de discuter le mécanisme de la migration de la thyroïde, le problème diagnostique et thérapeutique posé par cette topographie exceptionnelle. L'origine thyroïdienne de la masse est confirmée par l'histologie. Dans les lieux isolés, la chirurgie d'exérèse reste le seul moyen pour avoir le diagnostic et pour traiter les patients. PMID:26327954

  15. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum

    PubMed Central

    Zheng, Xiaoting; O’Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-01-01

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements. PMID:25201982

  16. Syphilitic aseptic meningitis

    MedlinePlus

    ... or syphilitic meningitis, is a complication of untreated syphilis . It involves inflammation of the tissues covering the ... This condition is a life-threatening complication of syphilis infection. Syphilis is a sexually transmitted infection. Syphilitic ...

  17. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  18. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved.

  19. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  20. Surgical approaches for stage I and II thymoma-associated myasthenia gravis: feasibility of complete video-assisted thoracoscopic surgery (VATS) thymectomy in comparison with trans-sternal resection

    PubMed Central

    He, Zhicheng; Zhu, Quan; Wen, Wei; Chen, Liang; Xu, Hai; Li, Hai

    2013-01-01

    Complete resection could be achieved in virtually all myasthenic patients with Masaoka stage I and II thymoma using the trans-sternal technique. Whether this is appropriate for minimally invasive approach is not yet clear. We evaluated the feasibility of complete video-assisted thoracoscopic surgery (VATS) thymectomy for the treatment of Masaoka stage I and II thymoma-associated myasthenia gravis, compared to conventional trans-sternal thymectomy. We summarized 33 patients with Masaoka stage I and II thymoma-associated myasthenia gravis between April 2006 and September 2011. Of these, 15 patients underwent right-sided complete VATS (the VATS group) by using adjuvant pneuomomediastinum, comparing with 18 patients using the trans-sternal approach (the T3b group). No intraoperative death was found and no VATS case required conversion to median sternotomy. Significant differences between the two groups regarding duration of surgery and volume of intraoperative blood loss (P = 0.001 and P < 0.001, respectively) were observed. Postoperative morbidities were 26.7% and 33.3% for the VATS and T3b groups, respectively. All 33 patients were followed up for 12 to 61 months in the study. The cumulative probabilities of reaching complete stable remission and effective rate were 26.7% (4/15) and 93.3% (14/15) in the VATS group, which had a significantly higher complete stable remission and effective rate than those in the T3b group (P = 0.026 and P = 0.000, respectively). We conclude that VATS thymectomy utilizing adjuvant pneuomomediastinum for the treatment of stage I and II thymoma-associated myasthenia gravis is technically feasible but deserves further investigation in a large series with long-term follow-up. PMID:23554796

  1. [Use of ProSeal laryngeal mask airway in a patient with spontaneous ventilation for anesthetic management in off-pump coronary artery bypass grafting by lower-end sternal splitting approach].

    PubMed

    Matsumoto, Kappei

    2006-10-01

    Use of the laryngeal mask airway in off-pump coronary artery bypass grafting is controversial, largely because of a concern about increased risk for derangement in pulmonary mechanics. The author used the ProSeal LMA in a patient with spontaneous respiration for anesthetic management of off-pump coronary artery bypass grafting by the lower-end sternal splitting approach. There were no critical hypercapnea, hypoxia, ventilatory problems and pulmonary hypertension. This method provided suitable conditions for maintenance and emergence of anesthesia, providing shorter stay of less than 22 hours in ICU.

  2. Proximal femoral reconstruction after aseptic loosening following proximal femoral replacement for Ewing sarcoma: a case report with one-year follow-up.

    PubMed

    Schoof, Benjamin; Jakobs, Oliver; Gehrke, Thorsten; Gebauer, Matthias

    2014-01-01

    We report the case of a 30-year-old patient initially treated for a proximal femoral Ewing's sarcoma when 12 years old. Index treatment comprised tumour resection and total hip arthroplasty. Two years later revision for aseptic loosening was performed. Subsequently, six further surgical revisons were performed for varying causes. At the age of 23 years the proximal femur was resected and a proximal femoral endoprosthesis implanted.Eighteen years after initial diagnosis the patient presented with recurrent aseptc loosening. Both the proximal femur and acetabulum were reconstructed. For acetabular reconstruction a structural allograft and a tantalum cup were utilised. Reconstruction of the femur utilsed extensive wire mesh and circlage wiring with impaction bone allograft into which a femoral stem was implanted.At one-year follow-up the patient was pain free, had no evidence of infection with satisfactory radiographs and no evidence of implant loosening. This is the first case reporting an extended proximal femoral reconstruction with a wire mesh in combination with impaction bone grafting in an aseptic loosened proximal femoral replacement following Ewing's Sarcoma.

  3. Risk analysis of aseptic meningitis after measles-mumps-rubella vaccination in Korean children by using a case-crossover design.

    PubMed

    Ki, Moran; Park, Taesung; Yi, Sung Gon; Oh, Jin Kyoung; Choi, BoYoul

    2003-01-15

    Epidemiologic study of a vaccine's adverse events is not easy; so many countries have no reliable data. Vaccines containing the Urabe or Hoshino strain have been withdrawn from use in several countries. However, the data are not strong enough to form the basis of a recommendation not to use specific strains. The authors used a case-crossover design to estimate the relative risk of aseptic meningitis in children after receiving the measles-mumps-rubella vaccine in Korea. Study subjects were hospitalized children aged 8-36 months who had aseptic meningitis in 1998. Cases were confirmed by hospital chart reviews using previously defined criteria. Through a telephone survey, the authors obtained vaccination date and place information from parents' vaccination records. Study results showed that no significant risk was associated with the Jeryl Lynn or Rubini strain of the vaccine (relative risk = 0.6, 95% confidence interval (CI): 0.18, 1.97). For the Urabe or Hoshino strain, the relative risk was 5.5 (95% CI: 2.6, 11.8); the risk increased in the third week after vaccination (relative risk = 15.6, 95% CI: 5.9, 41.2) and was elevated until the sixth week. The case-crossover design was useful in confirming the risk of acute adverse events after receiving vaccines.

  4. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs

    PubMed Central

    Wolff, Carsten; Scholtz, Gerhard

    2006-01-01

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans – the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip – the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI – a lipophilic fluorescent dye – to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the

  5. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs.

    PubMed

    Wolff, Carsten; Scholtz, Gerhard

    2006-12-04

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans--the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip--the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI--a lipophilic fluorescent dye--to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the mandibular

  6. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine

    PubMed Central

    Dumaidi, Kamal; Al-Jawabreh, Amer

    2017-01-01

    Background Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. Aim To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. Methods During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. Results HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. Conclusion HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period. PMID:28225788

  7. Nucleotide sequencing of a part of the 5'-noncoding region of echovirus type 9 and rapid virus detection during the acute phase of aseptic meningitis.

    PubMed

    Kim, G R; Lee, J S; Jung, Y T; Chung, Y J; Rhyu, M G

    1997-01-01

    A part of the 5'-noncoding region of echovirus type 9 isolates was sequenced, and an attempt was made for rapid virus detection in clinical samples obtained from 22 subjects hospitalized with aseptic meningitis. The sequence identity of 440-bp products amplified from the region by RT-PCR was 87.7% between the standard echovirus type 9(Hill strain) and the isolates. Specific IgM antibodies to Hill strain were positive in 45.5% by immunofluorescent antibody staining of virus-infected cells. A high detection rate of PCR products was observed in cerebrospinal fluids (CSFs; 54.5%) at admission, and in peripheral mononuclear cells (PMCs; 72.7%) at the end of hospitalization. Viral genomes were detectable for 2 days in serum samples, and for 6 days in PMC samples after onset of disease. When specific IgM antibody titers were less than 1:40, the amplification rate of viral genome from serum samples was 50.0%. These results indicate that the combination of specific IgM determination and viral genome amplification from CSFs will be a rapid and reliable method for early diagnosis.

  8. A retrospective epidemiological study of clinical signs and familial predisposition associated with aseptic meningitis in the Norwegian population of Nova Scotia duck tolling retrievers born 1994–2003

    PubMed Central

    Anfinsen, Kristin P.; Berendt, Mette; Liste, Flora J.H.; Haagensen, Therese R.; Indrebo, Astrid; Lingaas, Frode; Stigen, Oyvind; Alban, Lis

    2008-01-01

    Aseptic meningitis (AM) is a disease that causes grave clinical signs such as intensive neck pain, fever, and lethargy. The severity of this disease is reflected in the fact that affected animals require long-term, and in chronic cases, lifelong therapy with corticosteroids. A number of dogs must be euthanized because of therapeutic failure. In recent years, the Norwegian population of Nova Scotia duck tolling retrievers has experienced an increase in individuals with AM. The aim of the present study was to investigate the prevalence of AM and to pursue the suspicion of hereditary factors influencing an accumulation of AM cases in the breed. Using the Norwegian Kennel Club registery, a random sample (362 dogs) stratified by year of birth was drawn from the total population born from 1994 to 2003 (1525 individuals). The owners were contacted and questioned about clinical signs of AM in their dogs. Subsequently, the practising veterinarians and the breeders of positive responders were contacted in order to confirm a clinical diagnosis of AM and to identify possible affected family members. Pedigrees of AM positive individuals and affected relatives were investigated. The study estimated a prevalence of AM of 2.5%. For all affected dogs, it was possible to trace the pedigree of both parents of affected dogs back to a specific founder dog. The genealogical investigation strongly indicates that genetic factors are involved in the etiology of the disease. PMID:18783024

  9. Monocystis julkae sp.nov., (Protista: Apicomplexa: Monocystidae) a new aseptate gregarine species of the genus Monocystis Stein, 1848 obtain from an Indian Earthworm, Eutyphoeus kherai, Julka, 1978.

    PubMed

    Bhowmik, Biplab; Bandyopadhyay, P K

    2017-03-01

    During the course of a biodiversity survey of the endoparasitic aseptate gregarines in the Malda district of West Bengal, India, seminal vesicles of the earthworm, Eutyphoeus kherai, Julka 1978 were found to be infested with a new species, Monocystis julkae sp.nov., of the genus, Monocystis Stein (Arch Anat Phys Med 181-223, 1848). The trophozoite is elongated but slightly constricted posteriorly. A tail like protrusion appears in the posterior end. Anterior end is rather wider than the posterior one. The whole body size of the trophozoite measures 102.2-184.0 (126.7 ± 19.9) µm × 40.9-81.8 (58.2 ± 10.0) µm. Size of the nucleus ranges from 10.2 to 16.3 (11.9 ± 1.9) µm × 8.1-12.2 (8.8 ± 1.2) µm. The gametocysts are ovoidal containing two unequal gametocytes. Diameter of it measures 61.3-98.1 (75.8 ± 8.6) µm. Oocysts are navicular and measures 6.9-10.0 (8.7 ± 0.9) µm × 3.0-4.6 (4.3 ± 0.4) µm.

  10. Ibandronate and cementless total hip arthroplasty: densitometric measurement of periprosthetic bone mass and new therapeutic approach to the prevention of aseptic loosening

    PubMed Central

    Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe

    2012-01-01

    Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337

  11. Treatment of Aseptic Necrosis of the Lunate Bone (Kienböck Disease) Using a Nickel–Titanium Memory Alloy Arthrodesis Concentrator

    PubMed Central

    Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang

    2015-01-01

    Abstract Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel–titanium (Ni–Ti) memory alloy arthrodesis concentrator in the treatment of this disease. A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni–Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale. Patients were followed up for a mean of 12 months (range, 6–24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred. STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni–Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results. PMID:26496298

  12. Treatment of Aseptic Necrosis of the Lunate Bone (Kienböck Disease) Using a Nickel-Titanium Memory Alloy Arthrodesis Concentrator: A Series of 24 Cases.

    PubMed

    Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang

    2015-10-01

    Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel-titanium (Ni-Ti) memory alloy arthrodesis concentrator in the treatment of this disease.A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni-Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale.Patients were followed up for a mean of 12 months (range, 6-24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred.STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni-Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results.

  13. Incidence and clinical features of herpes simplex viruses (1 and 2) and varicella-zoster virus infections in an adult Korean population with aseptic meningitis or encephalitis.

    PubMed

    Choi, Rihwa; Kim, Gyeong-Moon; Jo, Ik Joon; Sim, Min Seob; Song, Keun Jeong; Kim, Byoung Joon; Na, Duk L; Huh, Hee Jae; Kim, Jong-Won; Ki, Chang-Seok; Lee, Nam Yong

    2014-06-01

    Since there are limited data on the incidence and clinical findings of central nervous system (CNS) infection by three α-herpesviruses including human herpes simplex virus 1 (HSV-1), HSV-2 and varicella-zoster virus (VZV) in Korea, a retrospective analysis of clinical data and polymerase chain reaction (PCR) results was performed in patients who presented with suspicion of acute viral meningitis and/or encephalitis at the emergency department of a tertiary referral hospital in Seoul, Korea. During the 3-year study period, a total of 224 cerebrospinal fluid (CSF) samples from 224 patients were examined. Among the 224 patients, 135 (60.3%) patients were identified as having aseptic meningitis (n = 70, 51.9%), encephalitis (n = 41, 30.4%) or meningoencephalitis (n = 24, 17.8%) at discharge. Twenty-four (17.8%) patients were identified as having VZV meningitis (n = 16, 11.9%), VZV meningoencephalitis (n = 2, 1.5%), HSV-2 meningitis (n = 4, 3.0%), or HSV-1 encephalitis (n = 2, 1.5%). Of the 24 patients infected with the three herpesviruses, immunocompromised patients accounted for 33.3% (n = 8). Skin rashes were observed in half (n = 9) of the patients with VZV, and none with HSV-1 or HSV-2. One patient with VZV meningitis and four patients with brain parenchymal involvement had neurologic sequelae. In conclusion, three herpesviruses are important causative agents of CNS infectious disease with significant morbidity in adults, regardless of the immunologic status. Therefore, CSF should be examined for HSV-1, HSV-2, and VZV using sensitive diagnostic methods in all cases of adult patients with clinical manifestations of CNS disease in order to identify the correct etiology and to determine appropriate therapy.

  14. Treatment of Pseudoarthrosis After Minimally Invasive Hallux Valgus Correction

    PubMed Central

    Cianforlini, Marco; Rosini, Cristina; Marinelli, Mario; de Palma, Luigi

    2014-01-01

    Objective: Treatment of mild and moderate hallux valgus deformities. Discussion: Minimally invasive technique enables surgeons to treat mild and moderate hallux valgus deformities with excellent and good results in the majority of patients. Nonunion of first metatarsal, moreover, has only rarely been reported. Summary: We describe the essential steps of a surgical technique for the treatment of nonunions after miniinvasive subcapital first metatarsal osteotomy reconstructed using a tricortical iliac crest bone graft. PMID:25013553

  15. Occurrence of molds on laminated paperboard for aseptic packaging, selection of the most hydrogen peroxide- and heat-resistant isolates and determination of their thermal death kinetics in sterile distilled water.

    PubMed

    Delgado, Denise Aparecida; de Souza Sant'ana, Anderson; de Massaguer, Pilar Rodriguez

    2012-07-01

    This study aimed at enumerating molds (heat-labile and heat-resistant) on the surface of paperboard material to be filled with tomato pulps through an aseptic system and at determining the most heat- and hydrogen peroxide-resistant strains. A total of 118 samples of laminated paperboard before filling were collected, being 68 before and 50 after the hydrogen peroxide bath. Seven molds, including heat-resistant strains (Penicillium variotii and Talaromyces flavus) with counts ranging between 0.71 and 1.02 CFU/cm(2) were isolated. P. variotii was more resistant to hydrogen peroxide than T. flavus and was inactivated after heating at 85 °C/15 min. When exposed to 35 % hydrogen peroxide at 25 °C, T. flavus (F5E2) and N. fischeri (control) were less resistant than P. variotti (F1A1). P. citrinum (F7E2) was shown to be as resistant as P. variotti. The D values (the time to cause one logarithmic cycle reduction in a microbial population at a determined temperature) for spores of P. variotii (F1A1) and N. fischeri (control) with 4 months of age at 85 and 90 °C were 3.9 and 4.5 min, respectively. Although the contamination of packages was low, the presence of heat- and chemical-resistant molds may be of concern for package sterility and product stability during shelf-life. To our knowledge, this is the first report that focuses on the isolation of molds, including heat-resistant ones, contaminating paperboard packaging material and on estimating their resistance to the chemical and physical processes used for packaging sterilization.

  16. Evaluation of the BioVigilant IMD-A, a novel optical spectroscopy technology for the continuous and real-time environmental monitoring of viable and nonviable particles. Part II. Case studies in environmental monitoring during aseptic filling, intervention assessments, and glove integrity testing in manufacturing isolators.

    PubMed

    Miller, Michael J; Walsh, Michael R; Shrake, Jerry L; Dukes, Randall E; Hill, Daniel B

    2009-01-01

    This paper describes the use of the BioVigilant IMD-A, a real-time and continuous monitoring technology based on optical spectroscopy, to simultaneously and instantaneously detect, size, and enumerate both viable and nonviable particles in a variety of filling and transfer isolator environments during an aseptic fill, transfer of sterilized components, and filling interventions. Continuous monitoring of three separate isolators for more than 16 h and representing more than 28 m3 of air per isolator (under static conditions) yielded a mean viable particle count of zero (0) per cubic meter. Although the mean count per cubic meter was zero, the detection of very low levels of single viable particles was randomly observed in each of these sampling runs. No viable particles were detected during the manual transfer of sterilized components from transfer isolators into a filling isolator, and similar results were observed during an aseptic fill, a filling needle change-out procedure, and during disassembly, movement, and reassembly of a vibrating stopper bowl. During the continuous monitoring of a sample transfer port and a simulated mousehole, no viable particles were detected; however, when the sampling probe was inserted beyond the isolator-room interface, the IMD-A instantaneously detected and enumerated both viable and nonviable particles originating from the surrounding room. Data from glove pinhole studies showed no viable particles being observed, although significant viable particles were immediately detected when the gloves were removed and a bare hand was allowed to introduce microorganisms into the isolator. The IMD-A technology offers the industry an unprecedented advantage over growth-based bioaerosol samplers for monitoring the state of microbiological control in pharmaceutical manufacturing environments, and represents significant progress toward the acceptance of microbiology process analytical technology solutions for the industry.

  17. The sternalis muscle in the Bulgarian population: classification of sternales

    PubMed Central

    JELEV, L.; GEORGIEV, G.; SURCHEV, L.

    2001-01-01

    The sternalis muscle (musculus sternalis) is the name usually given to this common anatomical variant, but the terms ‘episternalis’, ‘presternalis’, ‘sternalis brutorum’, ‘rectus thoracis’, ‘rectus sterni’, ‘superficial rectus abdominis’ and ‘japonicus’ have also been used in the literature (for reviews see Le Double, 1879; Calori, 1888; Pichler, 1911; Blees, 1968). According to Turner (1867), Cabrolius was the first, in 1604, to describe sternalis. Nevertheless this muscle is often unknown even in clinical practice (Bailey & Tzarnas, 1999; Vandeweyer, 1999). Thus far, investigations on the incidence of sternalis have been made both in large populations such as the American (Barlow, 1935) and small populations, for example in Taiwan (Shen et al. 1992; Jeng & Su, 1998). In Europe, all studies on the frequency of this muscle have been made amongst subpopulations in Western (e.g. Cunningham, 1888; Le Double, 1890, 1897) and Northern Europe (Gruber, 1860) although the reported frequencies have been quite different. There is a lack of information about sternalis in Eastern European populations. We therefore present data from a study on the incidence of sternalis muscle in Bulgaria. PMID:11554516

  18. [Graner's intercarpal arthrodesis as therapy of aseptic lunate bone necrosis].

    PubMed

    Ehall, R; Neubauer, W; Stampfel, O; Peicha, G

    1990-07-01

    From 1978 till 1989 at the Department of Orthopaedics (University of Graz, Faculty of Medicine, Division of Surgery) 25 patients were operated for the reason of an avascular necrosis of the lunate bone when the bone structures were already destroyed. The form of therapy was the intercarpal-arthrodesis, developed by Orlando Graner 1966, in a slightly modified way. On the one hand through creating an intercarpal block it is possible to create more or less plain sides of the radiocarpal joint and on the other hand one can stop the carpal collapse what explains long-term-results rather acceptable. The most important disadvantage of this form of therapy is the often found loss of range of movement in the operated radiocarpal joint.

  19. Acute pelvic pain in females in septic and aseptic contexts.

    PubMed

    Pages-Bouic, E; Millet, I; Curros-Doyon, F; Faget, C; Fontaine, M; Taourel, P

    2015-10-01

    Acute pelvic pain in women is a common reason for emergency department admission. There is a broad range of possible aetiological diagnoses, with gynaecological and gastrointestinal causes being the most frequently encountered. Gynaecological causes include upper genital tract infection and three types of surgical emergency, namely ectopic pregnancy, adnexal torsion, and haemorrhagic ovarian cyst rupture. The main gastrointestinal cause is acute appendicitis, which is the primary differential diagnosis for acute pelvic pain of gynaecological origin. The process of diagnosis will be guided by the clinical examination, laboratory study results, and ultrasonography findings, with suprapubic transvaginal pelvic ultrasonography as the first-line examination in this young population, and potentially cross-sectional imaging findings (computed tomography and MR imaging) if diagnosis remains uncertain.

  20. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  1. Revision of the aseptic and septic total ankle replacement.

    PubMed

    Espinosa, Norman; Wirth, Stephan Hermann

    2013-04-01

    Total ankle replacement has become a popular treatment of symptomatic end-stage ankle osteoarthritis. Contemporary total ankle replacement systems provide more anatomic and biomechanically sound function. However, longevity is still limited and long-term results of modern total ankle replacement designs are not available. In the case of failure, conversion into arthrodesis has remained the treatment of choice but at the cost of hindfoot function and potential degeneration of the adjacent joints. Thus, revision total ankle replacement by exchange of the prosthetic components represents an attractive solution. This article focuses on revision total ankle replacement and conversion to ankle arthrodesis.

  2. The use of Papineau technique for the treatment of diabetic and non-diabetic lower extremity pseudoarthrosis and chronic osteomyelitis.

    PubMed

    Polyzois, Vasilios D; Galanakos, Spyridon P; Tsiampa, Vassiliki A; Papakostas, Ioannis D; Kouris, Nikiforos K; Avram, Adrian M; Papalois, Apostolos E; Ignatiadis, Ioannis A

    2011-01-01

    The treatment of 31 consecutive adult patients, ages 25-67 years with chronic draining osteomyelitis (12 cases) or infected pseudarthrosis (19 cases) by the Papineau technique was retrospectively reviewed. The initial injury was an open fracture in 24 patients and a closed fracture in 7 patients. In all cases an Ilizarov circular external fixation device was used for the stabilization of the fracture or for bone lengthening. Mean follow-up for the group was 20 months (range, 10 months to 5 years) and there was successful limb salvage in all cases with eradication of infection and bone consolidation was achieved. The Ilizarov circular external fixation was removed at a mean of 18 weeks (range, 14-24 weeks). The mean time to bone union was 5 months (range, 4-10 months). All patients returned to their pre-treatment activity levels or better.

  3. The use of Papineau technique for the treatment of diabetic and non-diabetic lower extremity pseudoarthrosis and chronic osteomyelitis

    PubMed Central

    Polyzois, Vasilios D.; Galanakos, Spyridon P.; Tsiampa, Vassiliki A.; Papakostas, Ioannis D.; Kouris, Nikiforos K.; Avram, Adrian M.; Papalois, Apostolos E.; Ignatiadis, Ioannis A.

    2011-01-01

    The treatment of 31 consecutive adult patients, ages 25–67 years with chronic draining osteomyelitis (12 cases) or infected pseudarthrosis (19 cases) by the Papineau technique was retrospectively reviewed. The initial injury was an open fracture in 24 patients and a closed fracture in 7 patients. In all cases an Ilizarov circular external fixation device was used for the stabilization of the fracture or for bone lengthening. Mean follow-up for the group was 20 months (range, 10 months to 5 years) and there was successful limb salvage in all cases with eradication of infection and bone consolidation was achieved. The Ilizarov circular external fixation was removed at a mean of 18 weeks (range, 14–24 weeks). The mean time to bone union was 5 months (range, 4–10 months). All patients returned to their pre-treatment activity levels or better. PMID:22396823

  4. Respiratory Function in Voluntary Participating Patagonia Sea Lions (Otaria flavescens) in Sternal Recumbency

    PubMed Central

    Fahlman, Andreas; Madigan, Johnny

    2016-01-01

    We measured esophageal pressures (n = 4), respiratory flow rates (n = 5), and expired O2 and CO2 (n = 4) in five adult Patagonia sea lions (Otaria flavescens, body mass range 94.3–286.0 kg) during voluntary breaths while laying down out of water. The data were used to estimate the dynamic specific lung compliance (sCL), the O2 consumption rate (V˙O2) and CO2 production rates (V˙CO2) during rest. Our results indicate that the resting tidal volume in Patagonia sea lions is approximately 47–73% of the estimated total lung capacity. The esophageal pressures indicated that expiration is passive during voluntary breaths. The average sCL of sea lions was 0.41 ± 0.11 cmH2O−1, which is similar to those measured in anesthetized sea lions and awake cetaceans, and significantly higher as compared to humans (0.08 cmH2O−1). The average estimated V˙O2 and V˙CO2 using breath-by-breath respirometry were 1.023 ± 0.327 L O2 min−1 (range: 0.695–1.514 L O2 min−1) and 0.777 ± 0.318 L CO2 min−1, (range: 0.510–1.235 L CO2 min−1), respectively, which is similar to previously published metabolic measurements from California and Steller sea lions using conventional flow-through respirometry. Our data provide end-tidal gas composition and offer novel data for respiratory physiology in pinnipeds, which may be important for clinical medicine and conservation efforts. PMID:27899896

  5. Respiratory Function in Voluntary Participating Patagonia Sea Lions (Otaria flavescens) in Sternal Recumbency.

    PubMed

    Fahlman, Andreas; Madigan, Johnny

    2016-01-01

    We measured esophageal pressures (n = 4), respiratory flow rates (n = 5), and expired O2 and CO2 (n = 4) in five adult Patagonia sea lions (Otaria flavescens, body mass range 94.3-286.0 kg) during voluntary breaths while laying down out of water. The data were used to estimate the dynamic specific lung compliance (sCL), the O2 consumption rate ([Formula: see text]O2) and CO2 production rates ([Formula: see text]CO2) during rest. Our results indicate that the resting tidal volume in Patagonia sea lions is approximately 47-73% of the estimated total lung capacity. The esophageal pressures indicated that expiration is passive during voluntary breaths. The average sCL of sea lions was 0.41 ± 0.11 cmH2O(-1), which is similar to those measured in anesthetized sea lions and awake cetaceans, and significantly higher as compared to humans (0.08 cmH2O(-1)). The average estimated [Formula: see text]O2 and [Formula: see text]CO2 using breath-by-breath respirometry were 1.023 ± 0.327 L O2 min(-1) (range: 0.695-1.514 L O2 min(-1)) and 0.777 ± 0.318 L CO2 min(-1), (range: 0.510-1.235 L CO2 min(-1)), respectively, which is similar to previously published metabolic measurements from California and Steller sea lions using conventional flow-through respirometry. Our data provide end-tidal gas composition and offer novel data for respiratory physiology in pinnipeds, which may be important for clinical medicine and conservation efforts.

  6. Sternal wound infection caused by Gordonia bronchialis: identification by MALDI-TOF MS

    PubMed Central

    Rodriguez-Lozano, Jesús; Pérez-Llantada, Enrique; Agüero, Jesús; Rodríguez-Fernández, Ana; Ruiz de Alegria, Carlos; Martinez-Martinez, Luis

    2016-01-01

    Introduction: Gordonia spp. infections are uncommon. However, a few clinical cases have been reported in the literature, particularly those involving immunocompromised hosts. Advanced microbiology diagnosis techniques, such as matrix-assisted laser desorption ionization-time of flight MS (MALDI-TOF MS), have been recently introduced in clinical microbiology laboratories in order to improve microbial identification, resulting in better patient management. Case presentation: Here, we present a new clinical case of persistent wound infection caused by Gordonia bronchialis in a 64-year-old woman after a mitral valve replacement, using two MALDI-TOF-based systems for identifying this micro-organism. Conclusion: Both MALDI-TOF systems were able to identify Gordonia spp.; thus, providing a useful tool that overcomes the current limitations of phenotypic identification associated with this micro-organism. Although the technique validation deserves additional verification, our study provides guidance about MALDI-TOF as a fast and easy method for Gordonia spp. identification. PMID:28348789

  7. Simultaneous repair of pectus excavatum and congenital heart disease without cardiopulmonary bypass or sternal osteotomy.

    PubMed

    Sun, Yong; Zhu, Peng; Zheng, Shao-Yi

    2014-10-16

    A 8-year-old girl with severe pectus excavatum and an atrial septal defect had simultaneous repair of the both defects, using thransthoracic occlusion for atrial septal defect and improved Nuss technique for the pectus excavatum. Neither cardiopulmonary bypass nor sternotomy was required in this procedure. Details of the procedure and outcome are described.

  8. Solitary sternal metastasis from hepatocellular carcinoma detected by F-18 FDG PET/CT.

    PubMed

    Kamaleshwaran, Koramadai Karuppusamy; Kashyap, Raghava; Bhattacharya, Anish; Mittal, Bhagwant Rai

    2013-01-01

    Fluorine-18 fluoro-deoxy-glucose positron emission tomography (F-18 FDG PET) is not sensitive modality for the diagnosis of primary hepatocellular carcinoma (HCC). However, FDG-PET imaging may be useful in the identification of extrahepatic metastases. We report an interesting image of HCC with solitary metastasis to sternum detected by F-18 FDG PET/CT.

  9. Environmental regulation of type X collagen production by cultures of limb mesenchyme, mesectoderm, and sternal chondrocytes.

    PubMed

    Solursh, M; Jensen, K L; Reiter, R S; Schmid, T M; Linsenmayer, T F

    1986-09-01

    We have examined whether the production of hypertrophic cartilage matrix reflecting a late stage in the development of chondrocytes which participate in endochondral bone formation, is the result of cell lineage, environmental influence, or both. We have compared the ability of cultured limb mesenchyme and mesectoderm to synthesize type X collagen, a marker highly selective for hypertrophic cartilage. High density cultures of limb mesenchyme from stage 23 and 24 chick embryos contain many cells that react positively for type II collagen by immunohistochemistry, but only a few of these initiate type X collagen synthesis. When limb mesenchyme cells are cultured in or on hydrated collagen gels or in agarose (conditions previously shown to promote chondrogenesis in low density cultures), almost all initiate synthesis of both collagen types. Similarly, collagen gel cultures of limb mesenchyme from stage 17 embryos synthesize type II collagen and with some additional delay type X collagen. However, cytochalasin D treatment of subconfluent cultures on plastic substrates, another treatment known to promote chondrogenesis, induces the production of type II collagen, but not type X collagen. These results demonstrate that the appearance of type X collagen in limb cartilage is environmentally regulated. Mesectodermal cells from the maxillary process of stages 24 and 28 chick embryos were cultured in or on hydrated collagen gels. Such cells initiate synthesis of type II collagen, and eventually type X collagen. Some cells contain only type II collagen and some contain both types II and X collagen. On the other hand, cultures of mandibular processes from stage 29 embryos contain chondrocytes with both collagen types and a larger overall number of chondrogenic foci than the maxillary process cultures. Since the maxillary process does not produce cartilage in situ and the mandibular process forms Meckel's cartilage which does not hypertrophy in situ, environmental influences, probably inhibitory in nature, must regulate chondrogenesis in mesectodermal derivatives. (ABSTRACT TRUNCATED AT 250 WORDS)

  10. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... the Agency's current good manufacturing practice regulations for PET drugs. DATES: Submit either... good manufacturing practices for PET drugs (21 CFR part 212) regarding media fills. A draft guidance of... HUMAN SERVICES Food and Drug Administration Guidance on Media Fills for Validation of...

  11. Loading and unloading of freeze-dryers: airborne contamination risks for aseptically manufactured sterile drug products.

    PubMed

    Ljungqvist, Bengt; Reinmüller, Berit

    2007-01-01

    In pharmaceutical manufacturing, freeze-drying processes can be adversely affected by temperature differences relative to the surrounding air. Loading and unloading of freeze-dryers are performed either without or with temperature differences between the cleanroom and the chamber of the freeze-dryer. This operation can cause a flow of room air through the opening, creating a contamination risk, especially when manual handling of material is performed in this area. To minimize this risk, a high-efficiency particulate air (HEPA) filter unit should be installed above the opening to provide clean air and protect the opening. Here the theoretical relationships are discussed and design criteria are presented.

  12. Chronic granulomatous disease presenting as aseptic ascites in a 2-year-old child.

    PubMed

    Moreau, J F; Ozolek, John A; Lin, P Ling; Green, Todd D; Cassidy, Elaine A; Venkat, Veena L; Buchert, Andrew R

    2013-01-01

    Chronic granulomatous disease (CGD) is a rare inherited immunodeficiency syndrome that results from abnormal nicotinamide adenine dinucleotide phosphate (NADPH) oxidase function. This defect leads to recurrent catalase-positive bacterial and fungal infections as well as associated granuloma formation. We review the case of a 2-year-old boy who presented with ascites and fever of an unknown origin as manifestations of CGD. Cultures were negative for infection throughout his course, and CGD was suspected after identification of granulomas on peritoneal biopsy. Genetic testing revealed a novel mutation in the CYBB gene underlying his condition. This paper highlights the importance of considering CGD in the differential diagnosis of fever of unknown origin and ascites in children.

  13. Feasibility of Applying Ohmic Heating and Split-Phase Aseptic Processing for Ration Entree Preservation

    DTIC Science & Technology

    1994-08-01

    considered an important benefit of the OH process, a 9-point sensory texture scale and an integrity of pieces scale were developed to assess the major...quality. The most notable quality benefits appear to be retention of sensory texture and physical integrity of food pieces. It is expected that...ohmic processing technology will be adaptable to nutrient retention, particularly of heat labile vitamins. This may also be a benefit since vitamin

  14. Outbreak of aseptic meningitis in Djibouti in the aftermath of El Niño.

    PubMed

    Koeck, Jean Louis; Modica, Claude; Chomel, Jean Jacques; Nizou, Jacques Yves; Lina, Bruno; Nicand, Elisabeth

    2003-01-01

    At the end of 1990s, an outbreak of enteroviral meningitis in Djibouti was associated with the cocirculation of multiple serotypes. This uncommon distribution was related to the dissemination of enterically transmitted agents in the aftermath of El Nino events disturbing the Horn of Africa. Both Djiboutians and expatriate residents were infected.

  15. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment

    PubMed Central

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Summary Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn’t seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only. PMID:27134631

  16. Aseptics and aesthetics of chlorine bleach: can its use in laundering be safely abandoned?

    PubMed

    Belkin, N L

    1998-04-01

    The disinfecting and cleansing properties of chlorine bleach in high-temperature laundering formulations first was demonstrated in 1938, and subsequently was found to be equally effective in lower-temperature formulations that included modifications in the laundering cycle. Until another well-documented bleaching additive becomes commercially available, chlorine bleach should continue to be an integral part of the laundering formulations for all textiles used in health care facilities.

  17. Acute aseptic meningitis and diffuse myelitis as the presenting features of neurological Behcet disease.

    PubMed

    Mullins, G M; Elamin, M; Saidha, S; Ali, E; Jennings, L; Counihan, T J; Hennessy, M

    2009-12-01

    We report an explosive presentation of neurological Behcet disease, in an Irish male patient. We present the clinical and radiological findings in our patient and discuss a novel and effective therapeutic approach. We review other treatment modalities of patients with neurological involvement.

  18. Indirect measurement of water content in an aseptic solid substrate cultivation pilot-scale bioreactor.

    PubMed

    Peña Y Lillo, M; Pérez-Correa, R; Agosin, E; Latrille, E

    2001-01-01

    A lack of models and sensors for describing and monitoring large-scale solid substrate cultivation (SSC) bioreactors has hampered industrial development and application of this type of process. This study presents an indirect dynamic measurement model for a 200-kg-capacity fixed-bed SSC bioreactor under periodic agitation. Growth of the filamentous fungus Gibberella fujikuroi on wheat bran was used as a case study. Real data were preprocessed using previously reported methodology. The model uses CO2 production rate and inlet air conditions to estimate average bed water content and average bed temperature. The model adequately reproduces the evolution of the average bed water content and can therefore be used as an on-line estimator in pilot-scale SSC bioreactors. To obtain a reasonable fit of the bed temperature, however, inlet air humidity measurements will have to be adjusted with a data reconciliation algorithm. Good estimation of temperature is important for the future design of improved water content estimation using state observers. The model also provides insight into understanding the complex behavior of the dynamic system, which could prove useful when establishing advanced model-based operational and control strategies.

  19. Decision-making support system based on LCA for aseptic packaging recycling.

    PubMed

    Varžinskas, Visvaldas; Staniškis, Jurgis K; Knašyte, Milda

    2012-09-01

    In Europe post-consumer beverage carton packages are treated in three ways: dumped in a landfill, incinerated for energy recovery, and recycled. In recent years new technologies for beverage carton recycling have been developed and tested. At the same time in Europe the collection of second-hand raw materials is becoming more efficient. In order to facilitate and justify the decision-making process, different possibilities of poly-aluminium handling were analysed. For this reason, the objective of this study was to compare carbon footprints in the whole life cycle of selected technologies and to provide decision-making with data for beverage carton recycling. The paper is based on some of the results of the project 'Sustainable Production through Innovations in small- and medium-sized enterprises (SPIN)'. The SPIN project is providing small- and medium-sized enterprises with a whole set of instruments that put entrepreneurs in a position to innovate their production processes and products leading to improved business and public benefits.

  20. Microbiological Profiles of Deep Terrestrial Sedimentary Rocks Revealed by an Aseptic Drilling Procedure

    NASA Astrophysics Data System (ADS)

    Suzuki, Y.; Suko, T.; Fukuda, A.; Kouduka, M.; Nanba, K.; Sakata, S.; Ito, K.

    2009-12-01

    Unlike the near-surface environments, it is difficult to determine the community structure and biogeochemical functions of microorganisms in the deep subsurface mainly due to accessibility without contamination and disturbance. In an inland fore-arc basin in central Japan, we applied a new drilling procedure using deoxygenated and/or filter-sterilized drilling fluid(s). Although DNA-stained and cultivable cell numbers and the contents of phospholipid fatty acids (PLFA) all indicated the presence of metabolically active microbial populations in sedimentary rocks at a depth range from 200 to 350 m, it was not successful to extract DNA from the drilled core samples. During drilling, drilling fluid used for drilling and coring in the borehole was collected from the borehole bottom and subjected to DNA extraction. Quantitative fluorogenic PCR revealed that bacterial DNA were detected in drilling fluid samples when drilling was performed for siltstone and silty sandstone layers with the limited flow of drilling fluid. Bacterial 16S rRNA gene sequences retrieved from the drilling fluid samples below a depth of 324 m were mostly related to Pseudomonas putida or Flavobacterium succinicans, while those related to other Pseudomonas spp. were predominant at depths of 298 and 299m. PLFA profiles of core samples from a depth range between 250 and 351 m showed the abundance of 16:0, 16:1ω7 and 18:1ω9 fatty acids, which are known as major cellular lipid components of Pseudomonas and Flavobacterium spp. From these results, it was suggested that the members of the genera Pseudomonas and F. succinicans might represent dominant microbial populations that inhabit the deep terrestrial sedimentary rocks in Central Japan. This study was supported by grants from the Nuclear and Industrial Safety Agency (NISA) and Japan Nuclear Energy Safety Organization (JNES).

  1. Selective culturing and genus-specific PCR detection for identification of Aeromonas in tissue samples to assist the medico-legal diagnosis of death by drowning.

    PubMed

    Huys, Geert; Coopman, Vera; Van Varenbergh, Dirk; Cordonnier, Jan

    2012-09-10

    The detection of autochthonous aquatic bacteria in tissue samples from drowning cases is increasingly considered as an alternative approach to assist the medico-legal diagnosis of death by drowning. Bacteria belonging to the genus Aeromonas may be suitable candidates for this application as they are ubiquitous in natural aquatic environments but are generally not part of the human microbiota. The research aims of this study were (i) to develop a sensitive, specific and rapid screening and confirmation method for Aeromonas species in tissue samples and (ii) to evaluate aseptic sternal puncture as a post-mortem sample technique and bone marrow as an alternative matrix to provide evidence of death by drowning. The presence of Aeromonas in tissue samples was verified by cultivation using the selective media Ampicillin Dextrin Agar (ADA) and Ryan's Aeromonas Medium. The use of ADA medium was found most optimal for the sensitive, inexpensive and quick detection of aeromonads in human tissue samples. Positive culture plates were confirmed by harvesting all colonies for DNA extraction and subsequent PCR amplification using Aeromonas genus-specific primers. Aeromonads were detected in lung swab, blood and bone marrow of drowned bodies (n=3), but were negative in these three matrices for all negative controls (n=90) tested. Bone marrow proved to be a suitable alternative matrix and can be sampled post-mortem by an aseptic sternal puncture. In conclusion, this study confirms previous indications that aeromonads in cultures from blood of water bodies can be considered a potential marker for drowning. Given the fact that the number of immersed bodies (drowned and non-drowned) included in this study is statistically not significant, however, more tissue samples need to be investigated to confirm the validity of these methods to aid the diagnosis of death by wet drowning.

  2. Optimizing Prevention of Healthcare-Acquired Infections After Cardiac Surgery (HAI)_2

    ClinicalTrials.gov

    2016-10-24

    Cardiovascular Disease; Healthcare Associated Infectious Disease; Sternal Superficial Wound Infection; Deep Sternal Infection; Mediastinitis; Thoracotomy; Conduit Harvest or Cannulation Site; Sepsis; Pneumonia

  3. Aseptic hydroponics to assess rhamnolipid-Cd and rhamnolipid-Zn bioavailability for sunflower (Helianthus annuus): a phytoextraction mechanism study.

    PubMed

    Wen, Jia; McLaughlin, Mike J; Stacey, Samuel P; Kirby, Jason K

    2016-11-01

    The availability of cadmium (Cd) and zinc (Zn) to sunflower (Helianthus annuus) was investigated in rhamnolipid- and ethylenediaminetetraacetic acid (EDTA)-buffered solutions in order to evaluate the influence of aqueous speciation of the metals on their uptake by the plant, in relation to predictions of uptake by the free ion activity model (FIAM). Free metal ion activity was estimated using the chemical equilibrium program MINTEQ or measured by Donnan dialysis. The uptake of Cd followed the FIAM for the EDTA-buffered solution at EDTA concentrations below 0.4 μM; for the rhamnolipid-buffered solution, the uptake of both metals in roots was not markedly affected by increasing rhamnolipid concentrations in solution. This suggests rhamnolipid enhanced metal accumulation in plant roots (per unit free metal in solution) possibly through formation and uptake of lipophilic complexes. The addition of normal Ca concentrations (low millimetre range) to the rhamnolipid uptake solutions reduced Cd accumulation in shoots by inhibiting Cd translocation, whereas it significantly increased Zn accumulation in shoots. This study confirms that although rhamnolipid could enhance accumulation of Cd in plants roots at low Ca supply, it is not suitable for Cd phytoextraction in contaminated soil environments where Ca concentrations in soil solution are orders of magnitude greater than those of Cd.

  4. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions

    PubMed Central

    2014-01-01

    Background Hydroponics is a plant growth system that provides a more precise control of growth media composition. Several hydroponic systems have been reported for Arabidopsis and other model plants. The ease of system set up, cost of the growth system and flexibility to characterize and harvest plant material are features continually improved in new hydroponic system reported. Results We developed a hydroponic culture system for Arabidopsis and other model plants. This low cost, proficient, and novel system is based on recyclable and sterilizable plastic containers, which are readily available from local suppliers. Our system allows a large-scale manipulation of seedlings. It adapts to different growing treatments and has an extended growth window until adult plants are established. The novel seed-holder also facilitates the transfer and harvest of seedlings. Here we report the use of our hydroponic system to analyze transcriptomic responses of Arabidopsis to nutriment availability and plant/pathogen interactions. Conclusions The efficiency and functionality of our proposed hydroponic system is demonstrated in nutrient deficiency and pathogenesis experiments. Hydroponically grown Arabidopsis seedlings under long-time inorganic phosphate (Pi) deficiency showed typical changes in root architecture and high expression of marker genes involved in signaling and Pi recycling. Genome-wide transcriptional analysis of gene expression of Arabidopsis roots depleted of Pi by short time periods indicates that genes related to general stress are up-regulated before those specific to Pi signaling and metabolism. Our hydroponic system also proved useful for conducting pathogenesis essays, revealing early transcriptional activation of pathogenesis-related genes. PMID:24649917

  5. Towards Using NMR to Screen for Spoiled Tomatoes Stored in 1,000 L, Aseptically Sealed, Metal-Lined Totes

    PubMed Central

    Pinter, Michael D.; Harter, Tod; McCarthy, Michael J.; Augustine, Matthew P.

    2014-01-01

    Nuclear magnetic resonance (NMR) spectroscopy is used to track factory relevant tomato paste spoilage. It was found that spoilage in tomato paste test samples leads to longer spin lattice relaxation times T1 using a conventional low magnetic field NMR system. The increase in T1 value for contaminated samples over a five day room temperature exposure period prompted the work to be extended to the study of industry standard, 1,000 L, non-ferrous, metal-lined totes. NMR signals and T1 values were recovered from a large format container with a single-sided NMR sensor. The results of this work suggest that a handheld NMR device can be used to study tomato paste spoilage in factory process environments. PMID:24594611

  6. [Aseptic, simultaneous and bilateral mobilisation due to an acetabular shell fracture in a 43 year-old patient].

    PubMed

    Ceretti, M; Fanelli, M; Pappalardo, S

    2014-01-01

    The acetabular shell mobilization is the main long-term complication in total hip replacement. Metal-back fracture has also to be considered among the possible causes of shell mobilization. A case is presented of bilateral acetabular shell mobilization due to the trabecular covering de-soldering from the metal-back in a 43 year-old patient, 13-14 years after the first surgery.

  7. Benign recurrent lymphocytic meningitis from herpes simplex virus type 2 during a summer outbreak of aseptic meningitis.

    PubMed

    McDaniel, Edward L; Ferguson, Tomas M; Kwon, Herbert P; Thompson, Jennifer C

    2004-06-01

    Meningitis from herpes simplex virus (HSV) may have a clinical presentation similar to other forms of viral meningitis. However, subtle facets of the history and use of the polymerase chain reaction (PCR) can differentiate HSV from other etiologies. During an outbreak of meningitis from enterovirus, a 32-year-old woman presented to the hospital with clinical meningitis, a history of genital HSV infection, and two previous bouts of viral meningitis. Her signs and symptoms as well as lumbar puncture results were similar to patients meeting our case definition for patients with presumed enteroviral meningitis. The cerebral spinal fluid was positive for HSV by PCR, and she was ultimately diagnosed with recurrent meningitis from HSV. We compared her presentation with patients who met our case definition for enteroviral meningitis. A thorough history and use of PCR may assist in differentiating these clinically similar presentations.

  8. [Validation of aseptic technique of parenteral nutrition compounding in a pharmacy service according to USP Chapter 797].

    PubMed

    Romero Jiménez, Rosa Ma; Pernía López, Ma Sagrario; Sánchez Fresneda, Ma Norberta; Sanjurjo Sáez, María

    2013-01-01

    Introducción: En el proceso de elaboración de nutrición parenteral se debe garantizar que el personal de enfermería utiliza una técnica aséptica adecuada. En el capítulo 797 de la United States Pharmacopeia se clasifican los niveles de riesgo de las preparaciones estériles y se definen los requerimientos que se deben cumplir en la elaboración. Objetivo: Describir el desarrollo de un procedimiento de validación de la técnica aséptica utilizada por el personal de enfermería que elabora nutriciones parenterales en el área de elaboración del Servicio de Farmacia según las recomendaciones del capítulo 797 de la United States Pharmacopeia. Métodos: Se revisó el capítulo 797 de la United States Pharmacopeia y se clasificaron las nutriciones parenterales como preparaciones de riesgo medio de contaminación microbiológica. Resultados: Se adaptaron las recomendaciones de la United States Pharmacopeia para mezclas de riesgo medio y se estableció un procedimiento de validación de la técnica aséptica para la elaboración de las nutriciones parenterales. Discusión: El procedimiento de validación de la técnica aséptica permite validar la calidad del manejo aséptico del personal de enfermería. El procedimiento se ha incorporado a la práctica habitual, realizándose de forma mensual por el personal de enfermería del área de nutrición.

  9. Ingestion of BioCell Collagen®, a novel hydrolyzed chicken sternal cartilage extract; enhanced blood microcirculation and reduced facial aging signs

    PubMed Central

    Schwartz, Stephen R; Park, Joosang

    2012-01-01

    Skin aging and its clinical manifestation is associated with altered molecular metabolism in the extracellular matrix of the dermis. In a pilot open-label study, we investigated the effect of a dietary supplement, BioCell Collagen® (BCC), which contains a naturally occurring matrix of hydrolyzed collagen type II and low-molecular-weight hyaluronic acid and chondroitin sulfate, in 26 healthy females who displayed visible signs of natural and photoaging in the face. Daily supplementation with 1 g of BCC for 12 weeks led to a significant reduction of skin dryness/scaling (76%, P = 0.002) and global lines/wrinkles (13.2%, P = 0.028) as measured by visual/tactile score. Additionally, a significant increase in the content of hemoglobin (17.7%, P = 0.018) and collagen (6.3%, P = 0.002) in the skin dermis was observed after 6 weeks of supplementation. At the end of the study, the increase in hemoglobin remained significant (15%, P = 0.008), while the increase in collagen content was maintained, but the difference from baseline was not significant (3.5%, P = 0.134). This study provides preliminary data suggesting that dietary supplementation with BCC elicits several physiological events which can be harnessed to counteract natural photoaging processes to reduce visible aging signs in the human face. A controlled study is necessary to verify these observations. PMID:22956862

  10. Skin microbial flora and effectiveness of aseptic technique for deep muscle biopsies in Weddell seals (Leptonychotes weddellii ) in McMurdo Sound, Antarctica.

    PubMed

    Mellish, J; Tuomi, P; Hindle, A; Jang, S; Horning, M

    2010-04-01

    Deep muscle biopsies were collected from the pectoralis and longissimus dorsi of wild Weddell seals (Leptonychotes weddellii) in McMurdo Sound, Antarctica, during October-December 2007. Sterile swabs were collected from the surface of each skin site before biopsy and from the deep-needle path after biopsy. No growth occurred in two of six pectoralis and three of six longissimus skin sites, or in four of 10 pectoralis deep biopsy and eight of 12 longissimus deep-biopsy sites. Positive skin culture was not predictive of deep-biopsy contamination, nor did contamination at one body location correlate with contamination at the second site. Psychrobacter species were most common in one or more samples from each of the four sample types. Only one of the eight documented bacteria exhibited resistance to commonly used antibiotics.

  11. Contamination control in HVAC systems for aseptic processing area. Part I: Case study of the airflow velocity in a unidirectional airflow workstation with computational fluid dynamics.

    PubMed

    Ogawa, M

    2000-01-01

    A unidirectional airflow workstation for processing a sterile pharmaceutical product is required to be "Grade A," according to EU-GMP and WHO-GMP. These regulations have employed the wording of "laminar airflow" for unidirectional airflow, with an unclear definition given. This seems to have allowed many reports to describe discussion of airflow velocity only. The guidance values as to the velocity are expressed in various words of 90 ft/min, 0.45 m/sec, 0.3 m/sec, +/- 20%, or "homogeneous air speed." It has been also little clarified how variation in airflow velocity gives influences on contamination control of a workstation working with varying key characteristics, such as ceiling height, internal heat load, internal particle generation, etc. The present author has revealed following points from a case study using Computational Fluid Dynamics: the airflow characteristic in Grade A area shows no significant changes with varying the velocity of supplied airflow, and the particles generated from the operator will be exhausted outside Grade A area without contamination.

  12. Epstein-Barr virus (EBV). VII. Established lymphoid cell line (IVPat-88) obtained from synovial fluid of a patient with aseptic arthritis.

    PubMed

    Pătraşcu, I V; Ghenoiu, O; Tache, M; Stoicescu, M; Cajal, N

    1989-01-01

    Attempts have been made to culture mononuclear cells from synovial fluid of 8 patients with arthropathy, and have led to the development of the lymphoid cell line IVPat-88. Cell line has been propagated by serial passages for more than 14 weeks in continuous culture. The cells grew as single, free-floating individuals, or in dense clumps without adherence to glass or plastic surface. All these cells were identified as altered lymphoblasts because of their growth pattern and uniform morphology, and the presence of Epstein-Barr Viral Capsid Antigen (VCA) in 5 to 10% of the cells. The cell concentration varied during the period of culture from about 300,000 to 1,700,000 cells per ml, and mean doubling time during phases of active growth was 42 and 60 hours in MEM and RPMI 1640 tissue culture media, respectively. The methods used and the characteristics of the cell line are described.

  13. Role of inflammation in the initiation and maintenance of atrial fibrillation and the protective effect of atorvastatin in a goat model of aseptic pericarditis

    PubMed Central

    ZHANG, YE; WANG, YU-TANG; SHAN, ZHAO-LIANG; GUO, HONG-YANG; GUAN, YUAN; YUAN, HONG-TAO

    2015-01-01

    The present study was designed to determine the association between atrial fibrillation (AF) and inflammation in a goat sterile pericarditis model and to assess the effect of atorvastatin, a cholesterol-reducing drug, on AF. A total of 15 adult male goats were randomly divided into control, untreated pericarditis and atorvastatin-treated pericarditis groups. Pericarditis was induced via thoracotomy and atorvastatin was administered orally (60 mg/day) to the goats in the latter group for the duration of the study, commencing 1 week prior to surgery. The levels of high-sensitivity C-reactive protein (hs-CRP), interleukin(IL)-6 and tumor necrosis factor-α (TNF-α) were significantly elevated following surgery in the untreated pericarditis and atorvastatin groups compared with the control group (P<0.05). However, lower levels of hs-CRP, IL-6 and TNF-α were observed in the atorvastatin group compared with the untreated pericarditis group (P<0.05). Additionally, the animals in the atorvastatin-treated pericarditis group had a longer effective refractory period (ERP) and a higher rate adaptation of the ERP compared with those in the untreated pericarditis group (P<0.05). There was a significant negative correlation between the levels of ERP and hs-CRP in the untreated pericarditis group. The inducibility of AF in the left atrium and the duration of AF in the untreated pericarditis and atorvastatin-treated groups increased significantly following surgery (P<0.05). The pericarditis group, however, had a longer duration of AF compared with the atorvastatin group (P<0.05). Thus, inflammation may promote AF by shortening atrial ERP and by reducing the rate adaptation of ERP. These results suggested that atorvastatin can attenuate AF by inhibiting inflammation and may assist in preventing the occurrence and recurrence of AF following cardiac surgery. PMID:25524260

  14. How and Why Would You Do a Pressure Holding Test on an Aseptic Installation for which You Want to Check the Integrity? Theory and Practical Example.

    PubMed

    Chancel, Olivier; Grissely, Raoul; Stering, Magnus; Pisarik, Luc

    2010-01-01

    This paper uses the Boyle-Mariotte Law to restate a few general principles and applies them to rationalise pressure holding tests on sterile installations. The authors offer a methodology to achieve this, as well as a few mathematical models to determine test durations and acceptance limits, as functions of the breach sizes to be considered and the measurement instruments used. Apart from the theoretical approach, readers are offered a few examples to illustrate the models.

  15. Tibial Bowing and Pseudarthrosis in Neurofibromatosis Type 1

    DTIC Science & Technology

    2015-01-01

    Oxendine I, Sant DW, Song MH, Stevenson DA, Viskochil DH, Wise CA, Kim HKW, Rios JJ. Neurofibromin Deficiency -Associated Transcriptional Dysregulation...HKW, Rios JJ. Neurofibromin Deficiency -Associated Transcriptional Dysregulation Suggests a Novel Therapy for Tibial Pseudoarthrosis in NF1. J Bone...Manuscript (Paria et al. Neurofibromin Deficiency -Associated Transcriptional Dysregulation Suggests a Novel Therapy for Tibial Pseudoarthrosis in NF1

  16. Nonoperative treatment of slipped capital femoral epiphysis: a scientific study

    PubMed Central

    2011-01-01

    Background Treatment of the Slipped Capital Femoral Epiphysis remains a cause of concern due to the fact that the true knowledge of the etiopathogeny is unknown, as well as one of its major complications: chondrolysis. The conservative treatment remains controversial; it has been overlooked in the studies and subjected to intense criticism. The purpose of this study is to investigate the results of treatment on the hip of patients displaying slipped capital femoral epiphysis, using the plaster cast immobilization method and its link to chondrolysis. Methods The research was performed based on the study of the following variables: symptomatology, and the degree of slipping. A hip spica cast and bilateral short/long leg casts in abduction, internal rotation with anti-rotational bars were used for immobilizing the patient's hip for twelve weeks. Statistical analysis was accomplished by Wilcoxon's marked position test and by the Fisher accuracy test at a 5% level. Results A satisfactory result was obtained in the acute group, 70.5%; 94%; in the chronic group (chronic + acute on chronic). Regarding the degree of the slipping, a satisfactory result was obtained in 90.5% of hips tested with a mild slip; in 76% with moderate slip and 73% in the severe slip. The statistical result revealed that a significant improvement was found for flexion (p = 0.0001), abduction (p = 0.0001), internal rotation (p = 0.0001) and external rotation (p = 0.02). Chondrolysis was present in 11.3% of the hips tested. One case of pseudoarthrosis with aseptic capital necrosis was presented. There was no significant variation between age and chondrolysis (p = 1.00).Significant variation between gender/non-white patients versus chondrolysis (p = 0.031) and (p = 0.037), respectively was verified. No causal association between plaster cast and chondrolysis was observed (p = 0.60). In regard to the symptomatology group and the slip degree versus chondrolysis, the p value was not statistically

  17. Bone marrow aspiration

    MedlinePlus

    Iliac crest tap; Sternal tap; Leukemia - bone marrow aspiration; Aplastic anemia - bone marrow aspiration; Myelodysplastic syndrome - bone marrow aspiration; Thrombocytopenia - bone marrow aspiration; Myelofibrosis - bone marrow aspiration

  18. The Sauvé-Kapandji procedure: indications and tips for surgical success.

    PubMed

    Lluch, Alberto

    2010-11-01

    Arthrodesis is the most reliable and durable surgical procedure for the treatment of a joint disorder, with the main disadvantage of loss of motion of the fused joint. The distal radioulnar joint can be arthrodesed, while forearm pronation and supination are maintained or even improved by creating a pseudoarthrosis of the ulna just proximal to the arthrodesis. This is known as the Sauvé-Kapandji procedure. This procedure is not void of possible complications, such as nonunion or delayed union of the arthrodesis, fibrous or osseous union at the pseudoarthrosis, and painful instability at the proximal ulna stump. All of these can be prevented if a careful surgical technique is used.

  19. The use of a bone peg in the Sauvé-Kapandji operation.

    PubMed

    Blanco, R; Blanco, F

    1994-04-01

    The use of a bone peg for fusion of the distal radio-ulnar joint as part of the Sauvé-Kapandji procedure is described. This has been used effectively in six patients, one of whom developed a painless pseudoarthrosis after a fall.

  20. Compression of the trachea by a mediastinal parathyroid cyst.

    PubMed

    Hauet, E J; Paul, M A; Salu, M K

    1997-09-01

    Parathyroid cysts are a rare cause of space-occupying lesions in the mediastinum. Because symptoms are not specific, the diagnosis is seldom made before operation. Removal was done through a cervical incision without sternal splitting.

  1. Thymectomy: Common Questions Patients Ask about Thymectomies

    MedlinePlus

    ... A few MG Centers add a formal neck dissection to the sternal technique to also ensure the ... of patient services, public information, medical research, professional education, advocacy and patient care. This publication is intended ...

  2. Surgical Correction in Patients with Lumbar Degenerative Kyphosis Who Had Low Bone Mineral Density: An Analysis of 40 Patients with a Minimum Follow-Up of Two Years

    PubMed Central

    Kim, Ki Tack; Lee, Sang Hun; Huh, Dae Seok; Son, Eun Seok

    2015-01-01

    Study Design Retrospective study. Purpose To investigate influence of bone mineral density (BMD) on the surgical correction of lumbar degenerative kyphosis (LDK). Overview of Literature No studies so far have reported the influence of BMD on the surgical correction of LDK. Methods Forty LDK patients with more than 2 years follow-up were studied. Pelvic incidence (PI), pelvic tilt, sacral slope, sagittal vertical axis (SVA), lumbar lordosis (LL), and thoracic kyphosis were measured preoperatively, immediate postoperatively and at final follow-up. Adverse outcomes: proximal adjacent fractures, sagittal decompensation, pseudoarthrosis, and cage subsidence were documented. Results There were 37 females and 3 males. Average age was 65.1±4.5 years and mean follow-up was 34.2±16.7 months. 42.5% were Takemitsu type 3 curves, 27.5% type 2, 20.0% type 4 and 10.0% type 1. 37.5% had osteopenia, 40.0% osteoporosis and 22.5% had severe osteoporosis. SVA improved from 237.0±96.7 mm preoperatively to 45.3±41.8 mm postoperatively (p=0.000). LL improved from 10.5°±14.7° to -40.6°±10.9° postoperatively (p=0.000). At final follow-up SVA deteriorated to 89.8±72.2 mm and LL to 34.7°±15.8° (p=0.000). The association between late sagittal decompensation, pseudoarthrosis, or proximal adjacent fractures and osteoporosis was insignificant. The difference between immediate postoperative LL and PI (PIDiff) had a significant association with sagittal decompensation and pseudoarthrosis. Conclusions Osteoporosis did not influence the degree of correction, late sagittal decompensation, proximal adjacent fractures, and pseudoarthrosis in LDK. PIDiff had a significant association with sagittal decompensation and pseudoarthrosis. PMID:25705337

  3. Effects of Simulated Pathophysiology on the Performance of a Decision Support Medical Monitoring System for Early Detection of Hemodynamic Decompensation in Humans

    DTIC Science & Technology

    2014-10-01

    anesthesia (2% lidocaine ) using aseptic techniques and advanced until an appro- priate CVP waveform was obtained. This catheter was connected to a high...was placed under local anesthesia (2% lidocaine ) using aseptic techniques. Preservative/anticoagulant bags (63 ml anticoag- ulant citrate phosphate...catheter was placed into a brachial artery under local anesthesia (2% lidocaine ) using aseptic techniques and ultrasound guidance. The catheter was

  4. Final Report for the Center for Advanced Processing and Packaging Studies (CAPPS)

    DTIC Science & Technology

    2010-11-30

    assure food safety. The objectives of CAPPS are to enhance safety and quality of aseptic and extended shelf - life products, to characterize emerging ...aseptic and extended shelf - life processes, and to assure the integrity and functionality of aseptic and extended shelf - life packaging. Examples of new...and Nutritional Quality of Fresh-Cut Fruits and Vegetables : Desirable Levels, Instrumental and Sensory Measurement, and the Effects of Processing

  5. 21 CFR 640.102 - Manufacture of Immune Globulin (Human).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...) Microbial contamination. Low temperatures or aseptic techniques shall be used to minimize contamination by microorganisms. Preservatives to inhibit growth of microorganisms shall not be used during processing. (c)...

  6. 21 CFR 640.102 - Manufacture of Immune Globulin (Human).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) Microbial contamination. Low temperatures or aseptic techniques shall be used to minimize contamination by microorganisms. Preservatives to inhibit growth of microorganisms shall not be used during processing. (c)...

  7. 21 CFR 640.102 - Manufacture of Immune Globulin (Human).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) Microbial contamination. Low temperatures or aseptic techniques shall be used to minimize contamination by microorganisms. Preservatives to inhibit growth of microorganisms shall not be used during processing. (c)...

  8. Anatomic study of the collateral blood supply of the sternum.

    PubMed

    de Jesus, R A; Acland, R D

    1995-01-01

    A microdissection study was carried out on ten injected, cleared human sternal specimens. Three types of vessel were identified that have the potential to carry blood to the sternum after mobilization of the internal thoracic artery (ITA): (1) branches of the ITA that supply both the sternum and the pectoralis major ("sternal/perforating branches"), (2) branches of the ITA that supply both the sternum and an adjoining intercostal space ("sternal/intercostal branches"), and (3) posterior intercostal arteries that do not anastomose with an ITA branch but continue past the ITA to reach the sternum. All three types of vessel were found more frequently in the proximal than in the distal half of the sternum. For sternal/perforating and sternal/intercostal vessels to function as collaterals after ITA bypass grafting, their short common trunks of origin must remain intact. The data support the recommendation that the branches of the ITA be ligated as close as possible to the ITA itself to preserve collateral blood flow to the sternum.

  9. 21 CFR 108.35 - Thermal processing of low-acid foods packaged in hermetically sealed containers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... sealed containers shall promptly report to the Food and Drug Administration any instance of spoilage or... processing systems, aseptic processing and packaging systems, or other thermal processing systems, and... approved by the Commissioner for giving instruction in retort operations, aseptic processing and...

  10. 21 CFR 108.35 - Thermal processing of low-acid foods packaged in hermetically sealed containers.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... sealed containers shall promptly report to the Food and Drug Administration any instance of spoilage or... processing systems, aseptic processing and packaging systems, or other thermal processing systems, and... approved by the Commissioner for giving instruction in retort operations, aseptic processing and...

  11. 40 CFR Table 2 to Subpart Kkkk of... - Emission Limits for Existing Affected Sources

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Sheetcoating 0.03 (0.26). 3. Three-piece can assembly a. Inside spray 0.29 (2.43). b. Aseptic side seam stripes.... End coating a. Aseptic end seal compounds 0.06 (0.54). b. Nonaseptic end seal compounds 0.00 (0.00)....

  12. Platelet-rich plasma for long bone healing

    PubMed Central

    Lenza, Mário; Ferraz, Silvia de Barros; Viola, Dan Carai Maia; dos Santos, Oscar Fernando Pavão; Cendoroglo, Miguel; Ferretti, Mario

    2013-01-01

    ABSTRACT Objective: To evaluate effectiveness of the use of platelet-rich plasma as coadjuvant for union of long bones. Methods: The search strategy included the Cochrane Library (via Central) and MEDLINE (via PubMed). There were no limits as to language or publication media. The latest search strategy was conducted in December 2011. It included randomized clinical trials that evaluated the use of platelet-rich plasma as coadjuvant medication to accelerate union of long bones (acute fractures, pseudoarthrosis and bone defects). The outcomes of interest for this review include bone regeneration, adverse events, costs, pain, and quality of life. The authors selected eligible studies, evaluated the methodological quality, and extracted the data. It was not possible to perform quantitative analysis of the grouped studies (meta-analyses). Results: Two randomized prospective clinical trials were included, with a total of 148 participants. One of them compared recombinant human morphogenic bone protein-7 versus platelet-rich plasma for the treatment of pseudoarthrosis; the other evaluated the effects of three coadjuvant treatments for union of valgising tibial osteotomies (platelet-rich plasma, platelet-rich plasma plus bone marrow stromal cells, and no coadjuvant treatment). Both had low statistical power and moderate to high risk of bias. Conclusion: There was no conclusive evidence that sustained the use of platelet-rich plasma as a coadjuvant to aid bone regeneration of fractures, pseudoarthrosis, or bone defects. PMID:23579757

  13. Significance of the sexual openings and supplementary structures on the phylogeny of brachyuran crabs (Crustacea, Decapoda, Brachyura), with new nomina for higher-ranked podotreme taxa.

    PubMed

    Guinot, Danièle; Tavares, Marcos; Castro, Peter

    2013-01-01

    The patterns of complexity of the male and female sexual openings in Brachyura, which have been the source of uncertainties and conflicting opinions, are documented, together with a study of the morphologies of the coxal and sternal gonopores in both sexes, penises, spermathecae, and gonopods. The vulvae, male gonopores and penises are described among selected taxa of Eubrachyura, and their function and evolution examined in the context of a wide variety of mating behaviours. The location of female and male gonopores, the condition of the penis (coxal and sternal openings and modalities of protection), and related configurations of thoracic sternites 7 and 8, which are modified by the intercalation of a wide sternal part (thoracic sternites 7 and 8) during carcinisation, show evidence of deep homology. They represent taxonomic criteria at all ranks of the family-series and may be used to test lineages. Of particular significance are the consequences of the posterior expansion of the thoracic sternum, which influences the condition, shape, and sclerotisation of the penis, and its emergence from coxal (heterotreme) to coxo-sternal, which is actually still coxal (heterotreme), in contrast to a sternal emergence (thoracotreme). The heterotreme-thoracotreme distinction results from two different trajectories of the vas deferens and its ejaculatory duct via the P5 coxa (Heterotremata) or through the thoracic sternum (Thoracotremata). Dissections of males of several families have demonstrated that this major difference not only affects the external surface (perforation of the coxa or the sternum by the ejaculatory duct) but also the internal anatomy. There is no evidence for an ejaculatory duct passing through the articular membrane between the P5 coxa and the thoracic sternum in any Brachyura, even when the sternal male gonopore is very close to the P5 coxa. Trends towards the coxo-sternal condition are exemplified by multistate characters, varying from a shallow

  14. Video assisted resternotomy in high-risk redo operations - the St Mary's experience.

    PubMed

    Athanasiou, Thanos; DeL Stanbridge, Rex; Kumar, Pankaj; Cherian, Ashok

    2002-05-01

    The incidence of re-operative median sternotomy is rising. During resternotomy, catastrophic haemorrhage remains a dreaded complication. We describe our approach and experience with the combined use of Mayfield resternotomy retractor and anterior sternal retraction which allows division of adhesions between the sternum and mediastinal structures under direct vision with endoscopic or conventional instruments prior to resternotomy with a standard Hall reciprocating saw. The mean time to divide the retro-sternal adhesions was 26.4+/-16.7 min. No morbidity related to sternal division was observed. For redo surgery, repeat sternotomy under direct vision may reduce the sternotomy related morbidity (especially the need for cardiopulmonany bypass due to significant haemorrhage) and mortality.

  15. Dyslipidemia and sternum fracture.

    PubMed

    Can, Cagdas; Gulactı, Umut; Sarıhan, Aydin; Topacoglu, Hakan

    2013-06-01

    Tenderness over the sternum is a clue for possible sternal fracture. Sternal fractures usually occur at the body or manubrium. Lateral chest radiography could detect a sternum fracture, but the diagnosis is usually made by chest tomography. Traumatic sternum fracture considered as a marker of seriously life-threatening, high-energy injury. In hyperlipidemia, oxidized lipids accumulate in vascular tissues and trigger atherosclerosis. Such lipids also deposit in bone tissues where they may promote osteoporosis. In the literature, there is no previously reported traumatic sternal fracture due to hyperlipidemia-induced osteoporosis. Here, we report a case of a combined mixed type familial hyperlipidemia-induced osteoporosis in which the patient having seat belt on had an unexpected sternum fracture in a low-energy motor vehicle accident.

  16. Resection of Primary and Secondary Tumors of the Sternum: An Analysis of Prognostic Variables

    PubMed Central

    Ahmad, Usman; Yang, Haoxian; Sima, Camelia; Buitrago, Daniel H.; Ripley, R. Taylor; Suzuki, Kei; Bains, Manjit S.; Rizk, Nabil P.; Rusch, Valerie W.; Huang, James; Adusumilli, Prasad S.; Rocco, Gaetano; Jones, David R.

    2015-01-01

    Background We sought to determine the prognostic variables associated with overall survival (OS) and recurrence-free probability (RFP) in patients with primary and secondary sternal tumors treated with surgical resection. Methods A retrospective analysis of patients who underwent resection of primary or secondary sternal tumors at two cancer institutes between 1995 and 2013 was performed. OS and RFP were estimated using the Kaplan-Meier method, and predictors of OS and RFP were analyzed using the Cox proportional hazards model. Results Seventy-eight patients underwent sternal resection with curative (n=67; 86%) or palliative (n=6; 8%) intent. Seventy-three patients (94%) had malignant tumors, of which 28 (36%) were primary and 45 (57%) were secondary malignant. Thirteen patients (17%) underwent complete and 65 (83%) underwent partial sternal resection. There were no perioperative deaths, and grade III/IV complications were noted in 17 patients (22%). The 5-year OS was 80% for patients with primary malignant tumors, 73% for patients with non-breast secondary malignant tumors, and 58% for patients with breast tumors (p=0.85). In the overall cohort, R0 resection was associated with prolonged 5-year OS (84% vs 20%) on both univariate (p=0.004) and multivariate (adjusted HR, 3.37; p=0.029) analysis. On subgroup analysis, R0 resection was associated with improved OS and RFP only for patients with primary malignant tumors. Conclusions Sternal resection can achieve favorable OS for patients with primary and secondary sternal tumors. R0 resection is associated with improved 5-year OS and RFP in patients with primary malignant tumors. We did not detect a similar effect in patients with breast or non-breast secondary tumors. PMID:26002443

  17. Combined vacuum-assisted closure treatment with laparoscopic mobilization of an omental flap and meshed skin grafts for reconstruction of infected sternotomy wounds: two cases.

    PubMed

    Veir, Zoran; Smud, Sanda; Bogdanić, Branko; Cvjeticanin, Bruno; Bagatin, Dinko; Dujmović, Anto; Duduković, Mladen; Ivrlac, Radojko; Bulić, Kresimir; Mijatović, Davor

    2009-12-01

    In cardiac surgery, poststernotomy wounds are life threatening complications, with mortality up to 50%. We described two patients, who underwent coronary artery bypass grafting and postoperatively developed a deep sternal wound infection. Reconstruction was combined with vacuum-assisted closure treatment, laparoscopic mobilization of an omental flap and split thickens skin grafts. The omental flap is a well-vascularized local flap with a large surface area and has excellent immunologic and angiogenic properties. Both patients recovered completely. In our opinion, vacuum-assisted closure treatment and laparoscopic mobilization of great omentum is suitable option for treating deep sternal wounds.

  18. Cutaneous metastasis from gastrointestinal adenocarcinoma of unknown primary origin*

    PubMed Central

    Junqueira, Ana Lucia Ariano; Corbett, Ana Maria França; de Oliveira Filho, Jayme; Nasser, Kassila da Rosa; Haddad, Natalie Nejem; Tebet, Ana Carolina Franco

    2015-01-01

    Cutaneous metastasis is a rare manifestation of visceral malignancies that indicates primarily advanced disease. Due to its low incidence and similarity to other cutaneous lesions, it is not uncommon to have a delayed diagnosis and a shortened prognosis. We describe the case of a patient who presented with a cutaneous nodule in the sternal region as a first sign of malignancy. PMID:26375228

  19. Postoperative Mediastinitis Due to Finegoldia magna with Negative Blood Cultures▿

    PubMed Central

    Kernéis, Solen; Matta, Matta; Hoï, Annie Buu; Podglajen, Isabelle; Gutmann, Laurent; Novara, Ana; Latremouille, Christian; Mainardi, Jean-Luc

    2009-01-01

    We report a case of Finegoldia magna (formerly known as Peptostreptococcus magnus) mediastinitis following coronary artery bypass in a 50-year-old patient. Even if staphylococci remain the main causative organism of postoperative mediastinitis, the responsibility of anaerobic bacteria must be considered in cases of fever and sternal drainage with negative blood cultures. PMID:19812272

  20. Staged repair of pentalogy of Cantrell with ectopia cordis and ventricular septal defect.

    PubMed

    Sakasai, Yoshie; Thang, Bui Quoc; Kanemoto, Shinya; Takahashi-Igari, Miho; Togashi, Shinji; Kato, Hideyuki; Hiramatsu, Yuji

    2012-05-01

    Pentalogy of Cantrell is a rare congenital anomaly characterized by a combination of severe defects in the middle of the chest and abdomen including intracardiac defects. Survival rate after cardiac surgery is extremely low. We present a successful staged complete repair of an omphalocele, a ventricular septal defect and a sternal defect in a case of pentalogy of Cantrell.

  1. Intraosseous Infusion Rates under High Pressure: A Cadaveric Comparison of Anatomic Sites

    DTIC Science & Technology

    2014-01-01

    myeloproliferative malignancy, fracture of targeted bone, previous orthopedic procedures near insertion site, recent IO placement, prosthetic limb or...not evaluate the sternal IO access site. Complications from IO placement have been documented to include iatrogenic bone fracture , osteomyelitis...compartment syndrome, growth plate disruption, hematoma formation, fat embolization, and tissue necrosis [34-37]. These complications can not only be

  2. Cutaneous metastasis from gastrointestinal adenocarcinoma of unknown primary origin.

    PubMed

    Junqueira, Ana Lucia Ariano; Corbett, Ana Maria França; Oliveira Filho, Jayme de; Nasser, Kassila da Rosa; Haddad, Natalie Nejem; Tebet, Ana Carolina Franco

    2015-01-01

    Cutaneous metastasis is a rare manifestation of visceral malignancies that indicates primarily advanced disease. Due to its low incidence and similarity to other cutaneous lesions, it is not uncommon to have a delayed diagnosis and a shortened prognosis. We describe the case of a patient who presented with a cutaneous nodule in the sternal region as a first sign of malignancy.

  3. Osteomyelitis Caused by Staphylococcus schleiferi and Evidence of Misidentification of This Staphylococcus Species by an Automated Bacterial Identification System

    PubMed Central

    Calvo, Jorge; Hernández, José L.; Fariñas, Maria C.; García-Palomo, Daniel; Agüero, Jesús

    2000-01-01

    We report a case of sternal osteomyelitis due to Staphylococcus schleiferi in a patient who underwent thoracic surgery. This constitutes the first documented case of osteomyelitis caused by this Staphylococcus species. We also relate our experience in the utilization of commercially available MicroScan panels for the identification of this microorganism. PMID:11015429

  4. Median sternotomy.

    PubMed

    Reser, Diana; Caliskan, Etem; Tolboom, Herman; Guidotti, Andrea; Maisano, Francesco

    2015-01-01

    Sternotomy is considered to be the gold standard incision in cardiac surgery, resulting in low failure rates and excellent proven long-term outcomes. It can also be used in thoracic surgery for mediastinal, bilateral pulmonary or lower trachea and main stem bronchus surgery. Sternotomy has to be performed properly to avoid short- and long-term morbidity and mortality. The surgical technique is well established and certain principles are recognized to be crucial to minimize complications. The identification of the correct landmarks, midline tissue preparation, osteotomy with the avoidance of injury to underlying structures like pleura, pericardium, innominate vein, brachiocephalic artery and ectatic ascending aorta, and targeted bleeding control are important steps of the procedure. As important as the performance of a proper sternotomy is a correct sternal closure. An override or shift of the sternal edges has to be avoided by placing the wires at a proper distance from each other without injuring the thoracic pedicle. The two sternal halves have to be tightly re-approximated to facilitate healing of the bone and to avoid instability, which is a risk factor for wound infection. With a proper performance of sternotomy and sternal closure, instability and wound infections are rare and depend on patient-related risk factors.

  5. Practical Tips for the Safe Handling of Micro-organisms in Schools

    ERIC Educational Resources Information Center

    Holt, G.

    1974-01-01

    Outlines safe laboratory procedures for the handling of micro-organisms including aseptic technique, manipulation of cultures, and treatment of contaminated equipment. Identifies the principal hazard as the microbial aerosol, explains its possible effects, and describes the appropriate precautions. (GS)

  6. Osteonecrosis

    MedlinePlus

    Avascular necrosis; Bone infarction; Ischemic bone necrosis; AVN; Aseptic necrosis ... Osteonecrosis occurs when part of the bone does not get blood and dies. After a while, the bone can collapse. If osteonecrosis is not treated, the joint deteriorates, leading ...

  7. Endophyte microbiome diversity in micropropagated Atriplex canescens and Atriplex torreyi var griffithsii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequ...

  8. 40 CFR 63.3481 - Am I subject to this subpart?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... are inside spray on food cans, aseptic side seam stripes on food cans, nonaseptic side seam stripes on food cans, side seam stripes on general line nonfood cans, and side seam stripes on aerosol...

  9. 14 CFR 1232.106 - Management authority and responsibility.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... training and acclimation of animal subjects. (4) Surgery and Surgical Procedures. The veterinarian will monitor all surgical procedures and verify that the principles of the Guide with regard to aseptic...

  10. A Course in... Biochemical Engineering.

    ERIC Educational Resources Information Center

    Ng, Terry K-L.; And Others

    1988-01-01

    Describes a chemical engineering course for senior undergraduates and first year graduate students in biochemical engineering. Discusses five experiments used in the course: aseptic techniques, dissolved oxygen measurement, oxygen uptake by yeast, continuous sterilization, and cultivation of microorganisms. (MVL)

  11. Effect of position and time held in that position on ground-glass opacity in computed tomography images of dogs.

    PubMed

    Lee, Sang-Kwon; Park, Seungjo; Cheon, Byunggyu; Moon, Sohyeon; Hong, Sunghwa; Cho, Hyun; Chang, Dongwoo; Choi, Jihye

    2017-03-01

    OBJECTIVE To evaluate effects of position, time in that position, and positive end-expiratory pressure on ground-glass opacity caused by physiologic atelectasis on lung CT images and to determine effects of recumbency position before CT. ANIMALS 6 healthy Beagles. PROCEDURES In a crossover study, dogs were placed in 4 positions (sternal, dorsal, right lateral, and left lateral recumbency) for 2 holding times (30 and 60 minutes). Dogs were then repositioned in sternal recumbency, and CT was performed at 2 positive end-expiratory pressures (0 and 15 mm Hg). Location, distribution, and degree of ground-glass opacities were evaluated on lung CT images. Volume and mean density of the lungs and ground-glass opacities as well as maximum density of ground-glass opacities were evaluated. RESULTS Ground-glass opacities were mainly observed in parts of the lungs that were dependent during the various positions before CT, except for sternal recumbency. Opacities were reversible and decreased or disappeared after lung inflation. Ground-glass opacities were observed most frequently and had greatest severity when dogs were positioned in left lateral recumbency before CT. Ground-glass opacities were negligible for dogs positioned in sternal recumbency before CT. CONCLUSIONS AND CLINICAL RELEVANCE Location and reversibility of ground-glass opacities may help clinicians distinguish whether they are attributable to atelectasis or a result of pathological changes. Dogs should be positioned in sternal recumbency to minimize the occurrence of ground-glass opacities, particularly when several procedures are performed before CT, which increases the time that a dog will remain in the same position.

  12. Diurnal rhythm and concordance between objective and subjective hot flashes: The Hilo Women’s Health Study

    PubMed Central

    Sievert, Lynnette L.; Reza, Angela; Mills, Phoebe; Morrison, Lynn; Rahberg, Nichole; Goodloe, Amber; Sutherland, Michael; Brown, Daniel E.

    2010-01-01

    Objective To test for a diurnal pattern in hot flashes in a multi-ethnic population living in a hot, humid environment. To examine rates of concordance between objective and subjective measures of hot flashes using ambulatory and laboratory measures. Methods Study participants aged 45–55 were recruited from the general population of Hilo, Hawaii. Women wore a Biolog hot flash monitor, kept a diary for 24-hours, and also participated in 3-hour laboratory measures (n=199). Diurnal patterns were assessed using polynomial regression. For each woman, objectively recorded hot flashes that matched subjective experience were treated as true positive readings. Subjective hot flashes were considered the standard for computing false positive and false negative readings. True positive, false positive, and false negative readings were compared across ethnic groups by chi-square analyses. Results Frequencies of sternal, nuchal and subjective hot flashes peaked at 15:00 ± 1 hour with no difference by ethnicity. Laboratory results supported the pattern seen in ambulatory monitoring. Sternal and nuchal monitoring showed the same frequency of true positive measures, but non-sternal electrodes picked up more false positive readings. Laboratory monitoring showed very low frequencies of false negatives. There were no ethnic differences in the frequency of true positive or false positive measures. Women of European descent were more likely to report hot flashes that were not objectively demonstrated (false negative measures). Conclusions The diurnal pattern and peak in hot flash occurrence in the hot humid environment of Hilo was similar to results from more temperate environments. Lack of variation in sternal vs. non-sternal measures, and in true positive measures across ethnicities suggests no appreciable effect of population variation in sweating patterns. PMID:20220538

  13. Segmentation of the sternum from low-dose chest CT images

    NASA Astrophysics Data System (ADS)

    Liu, Shuang; Xie, Yiting; Reeves, Anthony P.

    2015-03-01

    Segmentation of the sternum in medical images is of clinical significance as it frequently serves as a stable reference to image registration and segmentation of other organs in the chest region. In this paper we present a fully automated algorithm to segment the sternum in low-dose chest CT images (LDCT). The proposed algorithm first locates an axial seed slice and then segments the sternum cross section on the seed slice by matching a rectangle model. Furthermore, it tracks and segments the complete sternum in the cranial and caudal direction respectively through sequential axial slices starting from the seed slice. The cross section on each axial slice is segmented using score functions that are designed to have local maxima at the boundaries of the sternum. Finally, the sternal angle is localized. The algorithm is designed to be specifically robust with respect to cartilage calcifications and to accommodate the high noise levels encountered with LDCT images. Segmentation of 351 cases from public datasets was evaluated visually with only 1 failing to produce a usable segmentation. 87.2% of the 351 images have good segmentation and 12.5% have acceptable segmentation. The sternal body segmentation and the localization of the sternal angle and the vertical extents of the sternum were also evaluated quantitatively for 25 good cases and 25 acceptable cases. The overall weighted mean DC of 0.897 and weighted mean distance error of 2.88 mm demonstrate that the algorithm achieves encouraging performance in both segmenting the sternal body and localizing the sternal angle.

  14. Production of Murine Monoclonal Antibodies using Traditional and Novel Technology

    DTIC Science & Technology

    2010-03-01

    were removed aseptically , and the cells were released by pressing the blunt end of a syringe plunger against a sterile petri dish. Debris was allowed to...surface. 9.5 mL of the cell suspension were then aseptically plate out into 10 individual 100 mm petri plates. The plates were tilted to level the mixture...Characterization. FEMS Microbiology Immunology. 1992, 89, 247-54. Ikematsu, Hideyuki; Goldfarb, Inna S.; Harindranath, Magaradona; Kasaian, Marion T

  15. Subarachnoid fat embolism complicating autologous fat grafting following translabyrinthine excision of acoustic neuroma.

    PubMed

    Reece, A T; O'Reilly, B; Teasdale, E; Todd, N V

    1989-09-01

    A 64-year-old man had complete excision of an acoustic schwannoma via the translabyrinthine route and the mastoid cavity was packed with fat. Post-operatively there were two episodes of aseptic meningitis and CT scanning demonstrated migration of fat into the basal subarachnoid CSF spaces. This unusual complication should be recognized and differentiated from both true infective meningitis and aseptic meningitis from other causes.

  16. The Effect of Sterile Acellular Dermal Matrix Use on Complication Rates in Implant-Based Immediate Breast Reconstructions

    PubMed Central

    Park, Youngsoo; Choi, Kyoung Wook; Chung, Kyu-Jin; Kim, Tae Gon; Kim, Yong-Ha

    2016-01-01

    Background The use of acellular dermal matrix (ADM) in implant-based immediate breast reconstruction has been increasing. The current ADMs available for breast reconstruction are offered as aseptic or sterile. No published studies have compared aseptic and sterile ADM in implant-based immediate breast reconstruction. The authors performed a retrospective study to evaluate the outcomes of aseptic versus sterile ADM in implant-based immediate breast reconstruction. Methods Implant-based immediate breast reconstructions with ADM conducted between April 2013 and January 2016 were included. The patients were divided into 2 groups: the aseptic ADM (AlloDerm) group and the sterile ADM (MegaDerm) group. Archived records were reviewed for demographic data and postoperative complication types and frequencies. The complications included were infection, flap necrosis, capsular contracture, seroma, hematoma, and explantation for any cause. Results Twenty patients were reconstructed with aseptic ADM, and 68 patients with sterile ADM. Rates of infection (15.0% vs. 10.3%), flap necrosis (5.0% vs. 7.4%), capsular contracture (20.0% vs. 14.7%), seroma (10.0% vs. 14.7%), hematoma (0% vs. 1.5%), and explantation (10.0% vs. 8.8%) were not significantly different in the 2 groups. Conclusions Sterile ADM did not provide better results regarding infectious complications than aseptic ADM in implant-based immediate breast reconstruction. PMID:27896182

  17. A new case of MOMO syndrome.

    PubMed

    Wallerstein, Robert; Sugalski, Rachel D

    2010-01-01

    MOMO syndrome, a condition described in three earlier patients, is a constellation of macrosomia, obesity, macrocephaly, and ocular abnormalities as the main findings. We report a 6-year-old child with these findings as well as significant developmental issues, delayed bone age, clavicular pseudoarthrosis, and straight femurs. We believe that this child should be considered as having MOMO syndrome. Careful consideration of his facial features shows some overlap with Kabuki syndrome. Description of this case may help to better elucidate the clinical features of MOMO syndrome.

  18. Biological performance of a polycaprolactone-based scaffold used as fusion cage device in a large animal model of spinal reconstructive surgery.

    PubMed

    Abbah, Sunny A; Lam, Christopher X L; Hutmacher, Dietmar W; Goh, James C H; Wong, Hee-Kit

    2009-10-01

    A bioactive and bioresorbable scaffold fabricated from medical grade poly (epsilon-caprolactone) and incorporating 20% beta-tricalcium phosphate (mPCL-TCP) was recently developed for bone regeneration at load bearing sites. In the present study, we aimed to evaluate bone ingrowth into mPCL-TCP in a large animal model of lumbar interbody fusion. Six pigs underwent a 2-level (L3/4; L5/6) anterior lumbar interbody fusion (ALIF) implanted with mPCL-TCP + 0.6 mg rhBMP-2 as treatment group while four other pigs implanted with autogenous bone graft served as control. Computed tomographic scanning and histology revealed complete defect bridging in all (100%) specimen from the treatment group as early as 3 months. Histological evidence of continuing bone remodeling and maturation was observed at 6 months. In the control group, only partial bridging was observed at 3 months and only 50% of segments in this group showed complete defect bridging at 6 months. Furthermore, 25% of segments in the control group showed evidence of graft fracture, resorption and pseudoarthrosis. In contrast, no evidence of graft fractures, pseudoarthrosis or foreign body reaction was observed in the treatment group. These results reveal that mPCL-TCP scaffolds could act as bone graft substitutes by providing a suitable environment for bone regeneration in a dynamic load bearing setting such as in a porcine model of interbody spine fusion.

  19. Update Review and Clinical Presentation in Congenital Insensitivity to Pain and Anhidrosis

    PubMed Central

    Pérez-López, L. M.; Cabrera-González, M.; Gutiérrez-de la Iglesia, D.; Ricart, S.; Knörr-Giménez, G.

    2015-01-01

    Introduction. Congenital insensitivity to pain and anhidrosis (CIPA) or hereditary sensory and autonomic neuropathy type IV is an extremely rare syndrome. Three clinical findings define the syndrome: insensitivity to pain, impossibility to sweat, and mental retardation. This pathology is caused by a genetic mutation in the NTRK1 gene, which encodes a tyrosine receptor (TrkA) for nerve growth factor (NGF). Methods. The consultation of a child female in our center with CIPA and a tibia fracture in pseudoarthrosis encouraged us to carefully review literature and examine the therapeutic possibilities. A thorough review of literature published in Pubmed was done about CIPA and other connected medical issues mentioned in the paper. Conclusions. The therapeutic approach of CIPA remains unclear. The preventive approach remains the only possible treatment of CIPA. We propose two new important concepts in the therapeutic approach for these patients: (1) early surgical treatment for long bone fractures to prevent pseudoarthrosis and to allow early weight bearing, decreasing the risk of further osteopenia, and (2) bisphosphonates to avoid the progression of osteopenia and to reduce the number of consecutive fractures. PMID:26579324

  20. Transitional lumbosacral segment with unilateral transverse process anomaly (Castellvi type 2A) resulting in extraforaminal impingement of the spinal nerve: a pathoanatomical study of four specimens and report of two clinical cases.

    PubMed

    Weber, Jochen; Ernestus, Ralf-Ingo

    2010-04-01

    The spinal nerve can be pinched between the transverse process of the fifth lumbar vertebra and the sacral ala. The patients are divided into two types: elderly persons with degenerative scoliosis and somewhat younger adults with isthmic spondylolisthesis. For the first time, we describe extraforaminal impingement of the spinal nerve in transitional lumbosacral segment with unilateral transverse process anomaly. Selective nerve root blocks were performed in two clinical cases. One patient underwent nerve root decompression via a posterior approach. One year after operation, this patient reported no radicular or lumbar pain. The pathoanatomical study demonstrated pseudoarthrosis between the transverse process and the ala of the sacrum and showed dysplastic facet joints at the level below the transitional vertebra in all specimens. Furthermore, we present the oldest illustration of this pathological condition, published in a book by Carl Wenzel in 1824. Extraforaminal entrapment of the spinal nerve in transitional lumbosacral segment with unilateral transverse process anomaly can cause radiculopathy, and osteophytes are the cause of the entrapment. Dysplastic facet joints on the level below the transitional vertebra could be one reason for "micromotion" resulting in pseudoarthrosis with osteophytes. Sciatica relief was obtained by means of selective nerve root blocks or posterior decompression via a dorsomedial approach.

  1. Update Review and Clinical Presentation in Congenital Insensitivity to Pain and Anhidrosis.

    PubMed

    Pérez-López, L M; Cabrera-González, M; Gutiérrez-de la Iglesia, D; Ricart, S; Knörr-Giménez, G

    2015-01-01

    Introduction. Congenital insensitivity to pain and anhidrosis (CIPA) or hereditary sensory and autonomic neuropathy type IV is an extremely rare syndrome. Three clinical findings define the syndrome: insensitivity to pain, impossibility to sweat, and mental retardation. This pathology is caused by a genetic mutation in the NTRK1 gene, which encodes a tyrosine receptor (TrkA) for nerve growth factor (NGF). Methods. The consultation of a child female in our center with CIPA and a tibia fracture in pseudoarthrosis encouraged us to carefully review literature and examine the therapeutic possibilities. A thorough review of literature published in Pubmed was done about CIPA and other connected medical issues mentioned in the paper. Conclusions. The therapeutic approach of CIPA remains unclear. The preventive approach remains the only possible treatment of CIPA. We propose two new important concepts in the therapeutic approach for these patients: (1) early surgical treatment for long bone fractures to prevent pseudoarthrosis and to allow early weight bearing, decreasing the risk of further osteopenia, and (2) bisphosphonates to avoid the progression of osteopenia and to reduce the number of consecutive fractures.

  2. The Sauvé-Kapandji Procedure

    PubMed Central

    Lluch, Alberto

    2013-01-01

    Arthrodesis is the most reliable and durable surgical procedure for the treatment of a joint disorder, and its only disadvantage is the loss of motion of the fused joint. The distal radioulnar joint can be arthrodesed, while forearm pronation and supination are maintained or even improved by creating a pseudoarthrosis of the ulna just proximal to the arthrodesis. This is known as the Sauvé-Kapandji (S-K) procedure. The Sauvé-Kapandji differs from the Darrach procedure in that it preserves ulnar support of the wrist, as the distal radioulnar ligaments and ulnocarpal ligaments are maintained. Aesthetic appearance is also superior after the S-K procedure, as the normal prominence of the ulnar head, most noticeable when the forearm is in pronation, is maintained. However, the S-K is not free of possible complications, such as nonunion or delayed union of the arthrodesis, fibrous or osseous union at the pseudoarthrosis, and painful instability at the proximal ulna stump. All of these complications can be prevented if a careful surgical technique is used. PMID:24436787

  3. The sauvé-kapandji procedure.

    PubMed

    Lluch, Alberto

    2013-02-01

    Arthrodesis is the most reliable and durable surgical procedure for the treatment of a joint disorder, and its only disadvantage is the loss of motion of the fused joint. The distal radioulnar joint can be arthrodesed, while forearm pronation and supination are maintained or even improved by creating a pseudoarthrosis of the ulna just proximal to the arthrodesis. This is known as the Sauvé-Kapandji (S-K) procedure. The Sauvé-Kapandji differs from the Darrach procedure in that it preserves ulnar support of the wrist, as the distal radioulnar ligaments and ulnocarpal ligaments are maintained. Aesthetic appearance is also superior after the S-K procedure, as the normal prominence of the ulnar head, most noticeable when the forearm is in pronation, is maintained. However, the S-K is not free of possible complications, such as nonunion or delayed union of the arthrodesis, fibrous or osseous union at the pseudoarthrosis, and painful instability at the proximal ulna stump. All of these complications can be prevented if a careful surgical technique is used.

  4. Is there a role for robotic totally endoscopic coronary artery bypass in patients with a colostomy?

    PubMed

    Gibber, Marc; Lehr, Eric J; Kon, Zachary N; Wehman, P Brody; Griffith, Bartley P; Bonatti, Johannes

    2014-01-01

    Preoperative colostomy presents a significant risk of sternal wound complications, mediastinitis, and ostomy injury in patients requiring coronary artery bypass grafting. Less invasive procedures in coronary surgery have a potential to reduce the risk of sternal wound healing problems. Robotic totally endoscopic coronary artery bypass grafting in patients with a colostomy has not been reported. We describe a case of completely endoscopic coronary surgery using the da Vinci Si system in a patient with a transverse colostomy. Single left internal mammary artery grafting to the left anterior coronary artery was performed successfully on the beating heart. We regard this technique as the least invasive method of surgical coronary revascularization with a potential to reduce the risk of surgical site infection and mediastinitis in patients with a colostomy.

  5. Tuberculous osteomyelitis/arthritis of the first costo-clavicular joint and sternum.

    PubMed

    Patel, Prasan; Gray, Robin R

    2014-12-28

    A young Somali immigrant presents with a two-year history of a large, firm, painful right anterolateral chest wall sternal mass. The patient denied any history of trauma or infection at the site and did not have a fever, erythematous lesion at the site, clubbing, or lymphadenopathy. A lateral chest radiograph demonstrated a low density mass isolated to the subcutaneous soft tissue overlying the sternum, ribs and clavicle. Computed tomography (CT) with contrast demonstrated a cystic lesion in the right anterolateral chest wall deep to the pectoralis muscle. Enhanced CT of the chest demonstrated sclerosis and destruction of the rib and costochondral joint and manubrio-sternal joint narrowing. Ultrasound-guided biopsy and aspiration returned 500 cc of purulent, cloudy yellow, foul-smelling fluid. Acid-fact bacilli stain and the nucleic acid amplification test identified and confirmed Mycobacterium tuberculosis. A diagnosis of tuberculous osteomyelitis/septic arthritis was made and antibiotic coverage for tuberculosis was initiated.

  6. [Ectopia cordis and Cantrell's pentalogy: personal experience and considerations on the surgical treatment].

    PubMed

    Pampaloni, A; Noccioli, B; Pampaloni, F; Vanini, V

    1997-01-01

    Clefts of the sternum have always attracted attention whether for pathological and physiological features or for research of surgical correction. Two cases of sternal cleft, one with partial ectopia cordis, the other with Cantrell's pentalogy, are presented. Embryology, strategies and several surgical techniques are discussed on the grounds of personal experience. The pediatric surgeon can make a choice among a lot of surgical techniques, because the ectopia cordis and Cantrell's pentalogy are very uncommon and the surgical treatment has a difficult codification. The knowledge of several methods of surgical correction is necessary to reduce high mortality of ectopia cordis and Cantrell's pentalogy. Primary repair in the neonatal period is the best type of management for these rare conditions, because simple closure of the sternal defect during the first month of life avoids the more complex reconstruction necessary in older children.

  7. Analysis of CaCO3 deposit formation and degradation during the molt cycle of the terrestrial isopod Porcellio scaber (Crustacea, Isopoda).

    PubMed

    Fabritius, Helge; Ziegler, Andreas

    2003-05-01

    Terrestrial isopods store cuticular calcium in large sternal deposits composed of an amorphous CaCO(3) compound. A large part of the deposits consists of numerous small spherules that increase the exposed surface to facilitate resorption of CaCO(3) during cuticle mineralization. It is not known how these spherules are formed and how they are dissolved. This paper presents for the first time an analysis of ultrastructural changes occurring in the sternal CaCO(3) deposits of a terrestrial isopod during their formation and degradation. Our results indicate that formation of the spherules takes place in a specialized aggregation zone, in which 10- to 30-nm-thick granules form agglomerations that then increase in size to form spherules that reveal a concentric growth pattern. Degradation of the deposits occurs in a manner that exposes a maximum of surface area on all levels of their structural organization.

  8. Bone scan appearances following biopsy of bone and bone marrow

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-10-01

    The influence of sternal marrow aspiration, iliac crest marrow aspiration, and iliac crest bone biopsy on bone scan appearances was examined. Eighteen patients were scanned a mean of 9.9 days after sternal marrow aspiration with a Salah needle. Bone scans obtained in 9 patients a mean of 10 days aftr iliac crest trephine marrow biopsy with a Jamshidi needle showed no abnormality at the biopsy site. In 18 patients with metabolic bone disease who had undergone iliac crest bone biopsy with an 8 mm needle, a scan abnormality due to the biopsy was usually present when the interval between the biopsy and the scan was 5 days to 2 months. Patients who were scanned within 3 days of iliac crest bone biopsy or more than 2 months after biopsy had normal scan appearance at the biopsy site.

  9. PHACES syndrome associated with carcinoid endobronchial tumor.

    PubMed

    Mama, Nadia; H'mida, Dorra; Lahmar, Imen; Yacoubi, Mohamed Tahar; Tlili-Graiess, Kalthoum

    2014-05-01

    PHACES syndrome consists of the constellation of manifestations including posterior fossa anomalies of the brain (most commonly Dandy-Walker malformations), hemangiomas of the face and scalp, arterial abnormalities, cardiac defects, eye anomalies and sternal defects. We present a case with a possible PHACES syndrome including sternal cleft and supraumbilical raphé, precordial skin tag, persistent left superior vena cava and subtle narrowing of the aorta with an endobronchial carcinoid tumor. All these anomalies were discovered on chest multi-detector CT. This is a unique case of PHACES syndrome associated with carcinoid tumor. Review of the literature revealed 3 cases of PHACES syndrome with glial tumor. The authors tried to find the relationship between PHACES syndrome and carcinoid tumors or gliomas, which all derive from the neural crest cells.

  10. The relationship of endophytic fungi to the gametophyte of the fern Schizaea pusilla.

    PubMed

    Swatzell, L J; Powell, M J; Kiss, J Z

    1996-01-01

    Schizaea pusilla is a rare and threatened fern restricted in North America to acidic bogs of Nova Scotia, Newfoundland, and New Jersey. The gametophyte lives in close association with two endophytic fungi. To characterize the nature of this fern's relationship with these fungi, we introduced axenic gametophytes to bog soil for colonization. Following colonization, the endophytic fungi were isolated and reintroduced to axenic gametophytes. The gametophytes introduced to bog soil were colonized by an aseptate fungus that formed vesicles and arbuscules within the gametophyte. However, culture of colonized gametophytes produced two fungal isolates: an aseptate fungus (fungus B) and a septate fungus (fungus A). Upon reintroduction of fungal isolates to axenically grown gametophytes, the aseptate fungus demonstrated a positive growth response to the presence of the gametophytes and colonized the gametophytes without harm to the host. The septate fungus did not exhibit any specific recognition but contacted the gametophytes randomly, leaving a large percentage of the host nonviable. We propose that the relationship of the septate fungus to the gametophyte of S. pusilla is nonmycorrhizal while the relationship of the aseptate fungus to the gametophyte is mycorrhizal. Furthermore, based on lack of nutrient availability in local soils, formation of specialized structures in the gametophyte for harboring fungi, and dependence of the fern on fungal presence for completion of its life cycle, we propose that S. pusilla maintains an obligatory relationship with the aseptate mycorrhizal fungus.

  11. PHACE Syndrome: Persistent Fetal Vascular Anomalies

    PubMed Central

    Prochazka, V.; Hrbac, T.; Chmelova, J.; Skoloudik, D.; Prochazka, M.

    2005-01-01

    Summary PHACE(S) syndrome is an acronym for neurocutaneous disease encompassing the expression of (P) posterior cranial fossa malformations, (H) facial haemangiomas, (A) arterial anomalies, (C) aortic coarctaion and other cardiac defects, (E) eye abnormalities and (S) for sternal malformation or stenotic arterial diseases. We report on a case of PHACE syndrome complete expression with persistent fetal vascular anomalies unusually in a 55-year-old women with large bilateral facial and neck haemangioma and posterior fossa circulation insufficiency. PMID:20584448

  12. Association of arterial blood pressure and CPR quality in a child using three different compression techniques, a case report

    PubMed Central

    2013-01-01

    A 2-year-old boy found in cardiac arrest secondary to drowning received standard CPR for 35 minutes and was transported to a tertiary hospital for rewarming from hypothermia. Chest compressions in hospital were started using two-thumb encircling hands technique. Subsequently two-thumbs direct sternal compression technique and after sternal force/depth sensor placement, chest compression with classic one-hand technique were done. By using CPR recording/feedback defibrillator, quantitative CPR quality data and invasive arterial pressures were available for analyses for 5 hours and 35 minutes. 316 compressions with the two-thumb encircling hands technique provided a mean (SD) systolic arterial pressure (SAP) of 24 (4) mmHg, mean arterial pressure (MAP) 18 (3) and diastolic arterial pressure (DAP) of 15 (3) mmHg. ~6000 compressions with the two thumbs direct compression technique created a mean SAP of 45 (7) mmHg, MAP 35 (4) mmHg and DAP of 30 (3) mmHg. ~20,000 compressions with the sternal accelerometer in place produced SAP 50 (10) mmHg, MAP 32 (5) mmHg and DAP 24 (4) mmHg. Restoration of spontaneous circulation (ROSC) was achieved at the point when the child achieved normothermia by using peritoneal dialysis. Unfortunately, the child died ten hours after ROSC without any signs of neurological recovery. This case demonstrates improved hemodynamic parameters with classic one-handed technique with real-time quantitative quality of CPR feedback compared to either the two-thumbs encircling hands or two-thumbs direct sternal compression techniques. We speculate that the improved arterial pressures were related to improved chest compression depth when a real-time CPR recording/feedback device was deployed. Trial registration ClinicalTrials.gov: NCT00951704. PMID:23819769

  13. [Acute Postoperative Negative Pressure Pulmonary Edema Caused by the Compression of Brachiocephalic Artery].

    PubMed

    Tagawa, Miki; Iwai, Hidetaka; Fukatsu, Ken; Shimada, Mami; Hirabayashi, Yoshihiro

    2016-06-01

    We report a case of negative-pressure pulmonary edema occurring by tracheal obstruction caused by the brachiocephalic artery. The patient had deformed thorax with cerebral palsy, which deformed thorax placing the brachiocephalic artery high over the trachea, resulting in close and tight contact between the artery and trachea. Additional deformity of the thorax associated with myotonic attacks after general anesthesia might shorten the distance between the sternal notch and the vertebral body, resulting in the tracheal obstruction by the artery.

  14. A draping technique for prevention of coronary bypass graft kinking and suture-line oozing.

    PubMed

    Canver, C C

    1996-01-01

    Acute kinking of coronary bypass grafts and postoperative hemorrhage due to oozing from the anastomotic suture lines are uncommon but devastating complications of myocardial revascularization. Routine draping of arterial and venous coronary bypass grafts just prior to sternal closure by use of thrombin-soaked oxidized regenerated cellulose may help to avoid these potentially lethal complications. This practice appears to be devoid of any immediate or long-term sequela to the patient.

  15. Pectoralis major transfer for the management of scapula winging secondary to serratus anterior injury or paralysis.

    PubMed

    Elhassan, Bassem

    2014-02-01

    Pectoralis major transfer (partial or complete) is the most common transfer to the scapula for winging as a result of serratus anterior paralysis or injury. The most commonly described technique is to transfer the pectoralis major prolonged with tendon allograft or autograft to the scapula. We present a technique that entails direct transfer of the sternal head of the pectoralis major with its bony insertion to the lower scapula.

  16. Presternal false aneurysm due to osseous arrosion of the right ventricle.

    PubMed

    Deschka, Heinz; Machner, Matthias; Wimmer-Greinecker, Gerhard

    2013-04-01

    Right ventricular rupture after open heart surgery is a rare but severe postoperative complication. In most cases, right ventricular bleeding is associated with mediastinitis and either directly caused by inflammatory processes or iatrogenically through penetration of dehiscent sternal edges or vacuum-assisted closure therapy. We describe a case of right ventricular rupture due to osseous arrosion in a closed chest in the absence of mediastinitis which led to the creation of a massive presternal false aneurysm.

  17. Repair of ectopia cordis using a resorbable poly-L-lactic-polyglycolic acid plate in a patient with pentalogy of Cantrell.

    PubMed

    Chia, Hui-Ling; Rasheed, Mohamed Zulfikar; Ong, Kim-Kiat; Yeow, Vincent Kok-Leng

    2012-06-01

    We present a case of a 10-month-old male infant with thoracoabdominal ectopia cordis, as part of Cantrell pentad, repaired using a poly-L-lactic-polyglycolic acid plate, a resorbable plating system widely used in craniomaxillofacial reconstruction. This is the first reported case of sternal reconstruction using a poly-L-lactic-polyglycolic acid plate. The repair was successfully carried out without cardiopulmonary compromise and good aesthetic outcome was achieved.

  18. Bifid sternum

    PubMed Central

    Das, Sibes Kumar; Jana, Pulak Kumar; Bairagya, Tapan Das; Ghoshal, Bhaswati

    2012-01-01

    A bifid sternum is a rare congenital anomaly generally diagnosed as asymptomatic at birth. It is sometimes associated with other congenital anomalies. The sternal defects are best corrected surgically during the neonatal period within the first month of life. Sometimes the defect may be diagnosed only in adult life. We here report a case of bifid sternum which was diagnosed incidentally in a 23-year-old male. PMID:22345921

  19. Pentalogy of Cantrell; complete expression in a nine-month-old-boy

    PubMed Central

    Aliyu, Ibrahim; Mohammad, Mohammad Aminu

    2013-01-01

    Pentalogy of Cantrell is a rare congenital malformation whose exact cause is not completely understood; it is characterized by defects in the anterior abdominal and thoracic walls consisting of omphalocoele, diaphragmatic defect, ectopia cordis, intracardiac defects and sternal clefts. The complex has variable clinical expression with complete and incomplete expressions reported. We, therefore, report a case of complete manifestation of the pentad in a 9-month-old boy. PMID:23901184

  20. Hypertrophic osteodystrophy preceding canine juvenile cellulitis in an Australian shepherd puppy

    PubMed Central

    Wentzell, Meaghan L.

    2011-01-01

    A 10-week-old intact female Australian shepherd dog was presented sternally recumbent, mildly pyrexic, and painful on long bone palpation of both forelimbs. Based on radiographs she was diagnosed with hypertrophic osteodystrophy. Analgesia was provided with intravenous, oral, and topical medications. Approximately 2 wk later she was presented for facial swelling, regional dermatitis, and lymphadenopathy. Canine juvenile cellulitis was diagnosed and successfully treated. PMID:21731101

  1. Isolated Pericardial Hydatid Cyst: A Case Report

    PubMed Central

    Cece, Hasan; Yildiz, Sema; Sogut, Ozgur; Hazar, Abdussamet; Sezen, Yusuf

    2011-01-01

    Cardiac echinococcosis is extremely rare, and cysts are found mostly within the myocardium. Most cardiac hydatid cysts are located in the left ventricular wall. Only a few cases of isolated pericardial hydatid cysts have been reported. Echocardiography, computed tomography and magnetic resonance imaging are important diagnostic tools for the diagnosis of echinococcosis. Herein, we report a rare case of isolated pericardial hydatid cyst who presented to our emergency department with complaints of mid-sternal chest pain and shortness of breath.

  2. Positional Right Ventricular Obstruction in Pectus Excavatum.

    PubMed

    Underwood, Katherine; Vorsanger, Matthew; Saric, Muhamed; Skolnick, Adam H

    2017-04-15

    Pectus excavatum is one of the most common congenital chest wall deformities. The degree of sternal depression, which may result in compression of the right heart by the chest wall, is variable. While typically asymptomatic, there are various symptoms that can result from severe pectus excavatum. We report on a patient with severe pectus excavatum leading to dynamic obstruction of the right ventricular outflow tract in the seated position.

  3. Association of Optimism with Emotional and Cardiovascular Reactivity in Coronary Patients, and Healthy Controls

    DTIC Science & Technology

    2007-04-12

    Aging Study, and found a protective dose-response relationship between higher levels of optimism and reduced occurrence of nonfatal MI, angina pectoris ...post surgical sternal wound infection, angina , MI, need for angioplasty, and need for another bypass surgery (N=247, b=-.09 +.04, p<.05; odds ratio...unstable angina , (6) critical valvular pathology, and (7) refusal of informed consent. CAD patients (N = 31) Inclusion criteria: (1

  4. Optimism and Cardiovascular Function in Children with Congenital Heart Disease

    DTIC Science & Technology

    2010-02-17

    optimism and reduced occurrence of nonfatal MI [present risk], angina pectoris (relative risk 0.45, 95% confidence interval = 0.29 - 0.68), and...individuals, including post surgical sternal wound infection, angina , MI, referal for angioplasty, and necessity for repeat bypass surgery (N=247, b=-.09...Demographic Factors (age, gender) Risk Factors (hypertension, IDDM, PVD) Cardiac Disease Severity (ejection fraction, angina , dyspenea

  5. Surgical site infection after cardiac surgery: a simplified surveillance method.

    PubMed

    Lucet, Jean-Christophe

    2006-12-01

    We report the results of a 2-year, 7-center program of surveillance of deep sternal wound infection (DSWI) after cardiac surgery. DSWI was defined as the need for reoperation. Stratification data were abstracted from computerized files. The incidence of DSWI was 2.2% (198 of 8,816 cardiac surgery procedures). The risk factors identified were obesity, age, coronary artery bypass grafting, postoperative mechanical ventilation, and early surgical reexploration. The resource efficiency of this simplified surveillance method is discussed.

  6. Do you know this syndrome?

    PubMed

    Dellatorre, Gerson; Castro, Caio César Silva de

    2012-01-01

    The SAPHO syndrome (synovitis, acne, pustulosis, hyperostosis and osteitis) includes a group of findings characterized by bone lesions usually located on the anterior chest wall, often associated with skin lesions. We report the case of a 47 years old patient, with osteochondritis at costoesternal and manubrium-sternal joints, besides of palmar-plantar pustulosis. The diagnosis is predominantly clinical and there are several treatment options described in the literature.

  7. The Society of Thoracic Surgeons Clinical Practice Guidelines on Arterial Conduits for Coronary Artery Bypass Grafting.

    PubMed

    Aldea, Gabriel S; Bakaeen, Faisal G; Pal, Jay; Fremes, Stephen; Head, Stuart J; Sabik, Joseph; Rosengart, Todd; Kappetein, A Pieter; Thourani, Vinod H; Firestone, Scott; Mitchell, John D

    2016-02-01

    Internal thoracic arteries (ITAs) should be used to bypass the left anterior descending (LAD) artery when bypass of the LAD is indicated (class of recommendation [COR] I, level of evidence [LOE] B). As an adjunct to left internal thoracic artery (LITA), a second arterial graft (right ITA or radial artery [RA]) should be considered in appropriate patients (COR IIa, LOE B). Use of bilateral ITAs (BITAs) should be considered in patients who do not have an excessive risk of sternal complications (COR IIa, LOE B). To reduce the risk of sternal infection with BITA, skeletonized grafts should be considered (COR IIa, LOE B), smoking cessation is recommended (COR I, LOE C), glycemic control should be considered (COR IIa, LOE B), and enhanced sternal stabilization may be considered (COR IIb, LOE C). As an adjunct to LITA to LAD (or in patients with inadequate LITA grafts), use of a RA graft is reasonable when grafting coronary targets with severe stenoses (COR IIa, LOE: B). When RA grafts are used, it is reasonable to use pharmacologic agents to reduce acute intraoperative and perioperative spasm (COR IIa, LOE C). The right gastroepiploic artery may be considered in patients with poor conduit options or as an adjunct to more complete arterial revascularization (COR IIb, LOE B). Use of arterial grafts (specific targets, number, and type) should be a part of the discussion of the heart team in determining the optimal approach for each patient (COR I, LOE C).

  8. A retrospective study: clinical experience using vacuum-assisted closure in the treatment of wounds.

    PubMed Central

    Antony, Suresh; Terrazas, Sandra

    2004-01-01

    We report the results of our wound care experience using the wound vac as an adjunct therapy in the treatment of sternal, spinal, and lower-extremity wounds. This is a retrospective study in which 42 patients were evaluated between 1999 and 2002 for nonhealing sternal, spinal, and lower-extremity wounds. There were 12 patients with sternal wounds with a variety of pathogens who were treated with antimicrobials along with the wound VAC. The VAC was applied for an average of 12 days, and all 12 patients went onto complete closure by the end of four weeks. There were 14 patients in the lower-extremity wound group, again, with a variety of pathogens. The VAC was placed for an average of 29.3 days to achieve closure along with the wound VAC. There were 16 spinal wound patients with a variety of pathogens. All the patients received antimicrobial therapy, with the average duration of the VAC beings 27.6 days and closure taking about eight weeks. The wound VAC, along with appropriate antimicrobial therapy and surgery, appears to help reduce the number of days to healing, along with a reduction in the number hospital days and possibly costs to the health system. Images Figure 1a Figure 1b Figure 2a Figure 2b Figure 3a Figure 3b Figure 4 Figure 5 PMID:15303413

  9. A Consideration of Breast Imagery in Art as Depicted through Western Painting

    PubMed Central

    Park, Ju Yong; Hwang, Se Won

    2015-01-01

    The aim of this study is to consider breast imagery in art as depicted through western painting. Twenty western art paintings were collated. Most of the sample paintings were created from the mid-nineteenth century to the late twentieth century and some are from the Renaissance period. Ten anthropometric items were used to measure 15 distances between two landmarks and 3 angles between three points. The distance from the nipple to the sternal notch and to the midclavicular point was the same and they were 0.46 of the distance from the sternal notch to the umbilicus. The shape of the projection of the breast was almost an isosceles triangle and the altitude of the triangle was at a proportion of 0.45 of the bottom length and 0.16 of the distance from the sternal notch to the umbilicus. The distance between the lateral ends of the breasts was 2.14 times the facial width and the distance between nipples was 1.36 times the facial width. Proportions from works of art are more ideal and attractive than clinically measured proportions. The desirable ratios measured from historical paintings might be useful in planning breast surgeries. PMID:25798397

  10. Outcomes of Nipple-Sparing Mastectomy: Role of Anatomic Measurements.

    PubMed

    Pairawan, Seyed S; Cody, Derek; Kim, Hahns; Hughes, M Katherine; Solomon, Naveenraj; Senthil, Maheswari; Garberoglio, Carlos; Lum, Sharon

    2016-10-01

    Nipple-sparing mastectomy (NSM) offers improved cosmesis for women undergoing mastectomy; however, there is increased risk for complications with this technique. We sought to determine if standard anatomic measurements could be used to predict complications of NSM. We performed a retrospective review of NSM for which anthropometric measurements of sternal notch to nipple distance, base width, and inframammary fold to nipple distance were available, and compared outcomes by anatomic measurements. We identified 102 cases of NSM with measurements available for study performed in 55 patients. Areola necrosis was associated with base width of greater than 15 cm (42.9% vs 10.9%, P = 0.02), infections were more likely with inframammary fold to nipple distance of more than 10 cm (29.2% vs 10.3%, P = 0.02), hematomas were more likely with sternal notch to nipple distance more than 30 cm (22.2% vs 4.3%, P = 0.03), and delayed wound healing was more likely with sternal notch to nipple distance of more than 25 cm (10.3% vs 1.6%, P = 0.03). There were no significant differences in nipple necrosis, skin flap necrosis, wound care requirements, or operative intervention based on anatomic measurement. Standard anatomic measurements are inconsistent predictors of outcome from NSM and should not be used alone to exclude attempts at NSM.

  11. A new kinorhynch genus, Mixtophyes (Kinorhyncha: Homalorhagida), from the Guinea Basin deep-sea, with new data on the family Neocentrophyidae

    NASA Astrophysics Data System (ADS)

    Sánchez, Nuria; Pardos, Fernando; Sørensen, Martin V.

    2014-06-01

    A new homalorhagid genus and species, Mixtophyes abyssalis gen. et sp. nov., is described from the deep-sea of the Guinea Basin in the Atlantic Ocean. The new genus and species was collected during the R/V Meteor Diva2 M63/2 Cruise, and it is characterized by a trunk with segment 1 consisting of a tergal and a single sternal plate, without any subdivisions or differentiations, segment 2-10 of one tergal and two sternal plates and segment 11 of a tergal and a sternal plate. Lateral terminal spines are present in both sexes. As part of the study of the new taxon, the type material of Neocentrophyes intermedius and N. satyai was re-examined, and new information is provided for both species. Based on the information from Mixtophyes abyssalis gen. et sp. nov. and re-examination of the two Neocentrophyes species, emended diagnoses for Neocentrophyes and Neocentrophyidae are proposed, and an updated identification key to homalorhagid genera and species of Neocentrophyidae is provided. Mixtophyes abyssalis gen. et sp. nov. is tentatively assigned to Neocentrophyidae, but evaluation of our current hypotheses about homalorhagid evolution and phylogeny also indicated that the family most probably is paraphyletic and that revision of homalorhagid classification is required when new results from phylogenetic analyses become available.

  12. The influence of load carrying on the energetics and kinematics of terrestrial locomotion in a diving bird.

    PubMed

    Tickle, Peter G; Lean, Samantha C; Rose, Kayleigh A R; Wadugodapitiya, Avanti P; Codd, Jonathan R

    2013-01-01

    The application of artificial loads to mammals and birds has been used to provide insight into the mechanics and energetic cost of terrestrial locomotion. However, only two species of bird have previously been used in loading experiments, the cursorial guinea fowl (Numida meleagris) and the locomotor-generalist barnacle goose (Branta leucopsis). Here, using respirometry and treadmill locomotion, we investigate the energetic cost of carrying trunk loads in a diving bird, the tufted duck (Aythya fuligula). Attachment of back loads equivalent to 10% and 20% of body mass increased the metabolic rate during locomotion (7.94% and 15.92%, respectively) while sternal loads of 5% and 10% had a greater proportional effect than the back loads (metabolic rate increased by 7.19% and 13.99%, respectively). No effect on locomotor kinematics was detected during any load carrying experiments. These results concur with previous reports of load carrying economy in birds, in that there is a less than proportional relationship between increasing load and metabolic rate (found previously in guinea fowl), while application of sternal loads causes an approximate doubling of metabolic rate compared to back loads (reported in an earlier study of barnacle geese). The increase in cost when carrying sternal loads may result from having to move this extra mass dorso-ventrally during respiration. Disparity in load carrying economy between species may arise from anatomical and physiological adaptations to different forms of locomotion, such as the varying uncinate process morphology and hindlimb tendon development in goose, guinea fowl and duck.

  13. Design Considerations of a Compounded Sterile Preparations Course

    PubMed Central

    Petraglia, Christine; Mattison, Melissa J.

    2016-01-01

    Objective. To design a comprehensive learning and assessment environment for the practical application of compounded sterile preparations using a constructivist approach. Design. Compounded Sterile Preparations Laboratory is a required 1-credit course that builds upon the themes of training aseptic technique typically used in health system settings and threads application of concepts from other courses in the curriculum. Students used critical-thinking skills to devise appropriate strategies to compound sterile preparations. Assessment. Aseptic technique skills were assessed with objective, structured, checklist-based rubrics. Most students successfully completed practical assessments using appropriate technique (mean assessment grade=83.2%). Almost all students passed the practical media fill (98%) and gloved fingertip sampling (86%) tests on the first attempt; all passed on the second attempt. Conclusion. Employing a constructivist scaffold approach to teaching proper hygiene and aseptic technique prepared students to pass media fill and gloved fingertip tests and to perform well on practical compounding assessments. PMID:26941438

  14. Revision surgery after total joint arthroplasty: a complication-based analysis using worldwide arthroplasty registers.

    PubMed

    Sadoghi, Patrick; Liebensteiner, Michael; Agreiter, Mark; Leithner, Andreas; Böhler, Nikolaus; Labek, Gerold

    2013-09-01

    The authors performed a complication-based analysis of total knee (TKA), total hip (THA), and total ankle arthroplasty (TAA) using worldwide arthroplasty registers. We extracted data with respect to reason for revision surgery and pooled causes. The most common causes for revisions in THA were aseptic loosening (55.2%), dislocation (11.8 %), septic loosening (7.5%), periprosthetic fractures (6%), and others. The most common causes in TKA were aseptic loosening (29.8%), septic loosening (14.8%), pain (9.5%), wear (8.2%), and others. The most common causes in TAA were aseptic loosening (38%), technical errors (15%), pain (12%), septic loosening (9.8%), and others. Revisions in TKA and THA differ with respect to type of complication. However, in case of TAA, higher rates of technically related complications are reported.

  15. Nuss bar procedure: past, present and future

    PubMed Central

    Obermeyer, Robert J.; Kelly, Robert E.

    2016-01-01

    Repair of pectus excavatum began at the beginning of the 20th century before endotracheal intubation was standard practice. Surgeons therefore developed techniques that corrected the deformity using an open procedure via the anterior chest wall. Initial techniques were unsatisfactory, but by the 1930s the partial rib resection and sternal osteotomy technique had been developed and was used in combination with external traction post-operatively to prevent the sternum from sinking back into the chest. In 1949, Ravitch recommended complete resection of the costal cartilages and complete mobilization of the sternum without external traction, and in 1961 Adkins and Blades introduced the concept of a substernal strut for sternal support. The wide resection resulted in a very rigid anterior chest wall, and in some instances, the development of asphyxiating chondrodystrophy. The primary care physicians therefore became reluctant to refer the patients for repair. In 1987, Nuss developed a minimally invasive technique that required no cartilage or sternal resection and relied only on internal bracing by means of a sub-sternal bar, which is inserted into the chest through two lateral thoracic incisions and guided across the mediastinum with the help of thoracoscopy. After publication of the procedure in 1998, it became widely accepted and a flood of new patients suddenly started to appear, which allowed for rapid improvements and modifications of the technique. New instruments were developed specifically for the procedure, complications were recognized, and the steps taken to prevent them included the development of a stabilizer and the use of pericostal sutures to prevent bar displacement. Various options were developed for sternal elevation prior to mediastinal dissection to prevent injury to the mediastinal structures, allergy testing was implemented, and pain management improved. The increased number of patients coming for repair permitted studies of cardiopulmonary

  16. Neurological infections after neuraxial anesthesia.

    PubMed

    Reynolds, Felicity

    2008-03-01

    Infection is the commonest cause of serious neurologic sequelae of neuraxial anesthesia. The incidence depends on operator skill and patient population. Meningitis, a complication of dural puncture, is usually caused by viridans streptococci. The risk factors are dural puncture during labor, no mask and poor aseptic technique, vaginal infection and bacteremia. Epidural abscess is a complication of epidural catheterization, route of entry the catheter track and the organism usually the staphylococcus. Principal risk factors are prolonged catheterization, poor aseptic technique and traumatic insertion. Prevention includes wearing a mask, using a full sterile technique, avoiding prolonged catheterization and prescribing antibiotics in a high-risk situation.

  17. [PROGNOSTICATION OF LIMITED ACCUMULATIONS LIQUID INFECTION BY SEVERE ACUTE PANCREATITIS].

    PubMed

    Sheiko, V D; Oganezyan, A G

    2015-07-01

    The results of examination and treatment of 53 patients on limited accumulations of liquid (LAL) for severe acute pancreatitis (SAP) were analysed. In 62.5% of patients on acute aseptic LAL celebrated parapancreatyc liquid accumulation were determinened. Most (94.6%) patients infected by LAL revealed heterogeneity of their structure according ultrasonography, in 81.1%--secvestral mass in their cavity. Systemic inflammatory response syndrome (SIRS) observed both aseptic and infected LAL. Prognostically important criteria LAL infection in patients on SAP is the heterogeneity of echostructure in absence of a downward trend. Diagnostic puncture under ultrasound control and microbiological studies are safe methods of diagnosis by infected LAL in SAP.

  18. Emperor's new clothes: Is particle disease really infected particle disease?

    PubMed

    Wasko, Marcin K; Goodman, Stuart B

    2016-09-01

    Aseptic loosening remains the most significant long-term complication of total hip replacement. The current paradigm points to an inflammatory response to wear particles as its main trigger. Recently, there have been increasing numbers of positive bacterial isolates reported among patients with clinically absent infection. This paper reviews existing evidence on possible involvement of bacteria and microbial-associated molecular patterns in the pathology of so-called "aseptic loosening." © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:1497-1504, 2016.

  19. [Role of poliomyelitis viruses in the etiology of serous meningitis in Odessa 1979-1983].

    PubMed

    Zevakov, V F; Semak, S Ia; Titarenko, V I; Andreĭchenko, N V; Gedzul, O V

    1987-01-01

    The etiology of aseptic meningitides has been studied in the patients hospitalized in the Odessa city clinical hospital in 1979-1983. Altogether 268 strains of enteroviruses have been isolated, among them 105 poliomyelitis viruses (38.8%); 26 poliomyelitis virus strains have been isolated from the cerebrospinal fluid. Most frequently, type I poliovirus has been isolated. Poliovirus strains isolated from the cerebrospinal fluid had the genetic markers of virulent strains. The authors believe that isolation of poliomyelitis virus from the cerebrospinal fluid in aseptic meningitis proves its etiological role in the disease.

  20. The contributions of infection control to a century of surgical progress.

    PubMed Central

    Alexander, J W

    1985-01-01

    Although many surgical procedures were well-developed in principle before 1867, their application for the treatment of human disease was limited because of a mortality rate from postoperative infection alone of about 50%. It was the eventual acceptance of Lister's work and the development of the aseptic-antiseptic ritual that allowed operative therapy to be successful and made modern surgery possible. The background leading to the development of aseptic-antiseptic rituals is discussed. Images FIG. 2. FIG. 3. FIG. 4. FIG. 5. PMID:3883923

  1. [Dermatologic aspects of SAPHO-syndrome].

    PubMed

    Károlyi, Z; Harhai, I; Erós, N

    2001-08-19

    SAPHO syndrome (synovitis, acne, pustulosis, hyperostosis, osteitis) as a new disease entity was first described in 1987. The syndrome is characterized by the presence of pustular dermatoses together with aseptic osteoarticular lesions. The bone involvement includes hyperostosis, aseptic osteomyelitis or arthritis of the anterior chest wall, sacroiliac joints or long bones. Skin diseases include acne conglobata or acne fulminans, palmoplantar pustulosis and hidradenitis suppurativa. Authors describe the dermatological relationship of SAPHO syndrome reporting their 7 cases (3 acne fulminans, 4 palmoplantar pustulosis). Authors draw attention to the isotretinoin therapy as a possible provoking factor of the articular symptoms, and they emphasize the diagnostic role of bone scintigraphy.

  2. Total arthroplasty in displaced dysplastic hips with acetabular reconstruction and femoral shortening - technical note.

    PubMed

    Silva, Paulo; de Oliveira, Leandro Alves; Coelho, Danilo Lopes; do Amaral, Rogério Andrade; Rebello, Percival Rosa; de Moraes, Frederico Barra

    2014-01-01

    To describe a new procedure of total hip replacement in patient with severe developmental dysplasia of the left hip, using technique of acetabular reconstruction with autogenous bone grafts and subtrochanteric shortening femoral osteotomy. Total hip replacement done in January of 2003. The Eftekhar's classification was used and included type D, neglected dislocations. Bone graft incorporated in acetabular shelf and femoral osteotomy. Our contribution is the use of an Allis plate to better fix acetabular grafts, avoiding loosening, and cerclage around bone graft in femoral osteotomy site, which diminish pseudoarthrosis risk. This technique shows efficiency, allowing immediately resolution for this case with pain and range of motion of hip improvement. It also allows the acetabular dysplasia reconstruction, equalization of the limb length (without elevated risk of neurovascular lesion) and repairs the normal hip biomechanics due to the correction of the hip's center of rotation.

  3. Total arthroplasty in displaced dysplastic hips with acetabular reconstruction and femoral shortening – technical note☆☆☆

    PubMed Central

    Silva, Paulo; de Oliveira, Leandro Alves; Coelho, Danilo Lopes; do Amaral, Rogério Andrade; Rebello, Percival Rosa; de Moraes, Frederico Barra

    2014-01-01

    To describe a new procedure of total hip replacement in patient with severe developmental dysplasia of the left hip, using technique of acetabular reconstruction with autogenous bone grafts and subtrochanteric shortening femoral osteotomy. Total hip replacement done in January of 2003. The Eftekhar's classification was used and included type D, neglected dislocations. Bone graft incorporated in acetabular shelf and femoral osteotomy. Our contribution is the use of an Allis plate to better fix acetabular grafts, avoiding loosening, and cerclage around bone graft in femoral osteotomy site, which diminish pseudoarthrosis risk. This technique shows efficiency, allowing immediately resolution for this case with pain and range of motion of hip improvement. It also allows the acetabular dysplasia reconstruction, equalization of the limb length (without elevated risk of neurovascular lesion) and repairs the normal hip biomechanics due to the correction of the hip's center of rotation. PMID:26229775

  4. Pediatric Patient with Incidental Os Odontoideum Safely Treated with Posterior Fixation Using Rod-Hook System and Preoperative Planning Using 3D Printer: A Case Report.

    PubMed

    Sakai, Toshinori; Tezuka, Fumitake; Abe, Mitsunobu; Yamashita, Kazuta; Takata, Yoichiro; Higashino, Kosaku; Nagamachi, Akihiro; Sairyo, Koichi

    2017-05-01

    Os odontoideum is often found incidentally. Surgical treatment is recommended for patients with atlantoaxial instability or neurologic deficits. Although various techniques have been used for C1-C2 fusion in adults, the use of these procedures in children is not widely accepted. We present a 12-year-old boy with incidental os odontoideum and obvious C1-C2 instability, in which bony union was achieved safely and successfully by posterior fixation using a rod-hook system and perioperative planning using a three-dimensional printer. At the 2-year follow-up, bone formation around the gap of the dens, which has been generally considered as pseudoarthrosis, was obtained after union of the posterior element of C1-C2.

  5. [Proximal tibial valgus osteotomy semi-invasive technique. A report on 66 cases].

    PubMed

    González Maza, Carlos; Moscoso López, Luis; Magaña García, Ignacio; Mejía Vargas, Gildardo; López Segundo, José Román

    2007-01-01

    The purpose of the present study is to report sixty six high tibial lateral osteotomies (HTO) make on patients with osteoarthrosis of the medial compartment, using modified semi invasive technique. With this technique the incision is 5-6 mm, fibular head is not resect, biceps femoris tendon is not cut, no internal fixation is place; the median follow-up was 6.4 years. The status of the patient at the final follow-up was analyzed using Knee Society Score (KSS), and Visual Analogue Scale (VAS). An average of 85 points was achieved after HTO compared to 55 points preoperative and 83 points after HTO compared to 51 points preoperative, was obtained at the evaluation with KSS. The only complication was superficial infections (4%). Serious complications did not appear. There was not pseudoarthrosis.

  6. Congenital insensitivity to pain and anhidrosis.

    PubMed

    Sasnur, Ashok H; Sasnur, Prakash A; Ghaus-Ul, Raza Shamikh Muneer

    2011-05-01

    Congenital insensitivity to pain and anhidrosis (CIPA) is a rare reported entity characterised by disturbance in the pain and temperature perception due to involvement of the autonomic and sensory nervous system. It is an autosomal recessive trait with several defects of the gene NTRK1 coding for the neurotrophic tyrosine kinase - a nerve growth factor receptor on chromosome 1q21-q22. Traumatic fractures are common and, because of lack of pain, may go unrecognised for prolonged periods, resulting in nonunion or pseudoarthrosis. A Charcot joint may be the end result. Treatment complications are very common in these patients and range from infection to wound breakdown to failure of fixation. We report here a rare case of CIPA in a 9-year-old girl and her younger male sibling with generalised absence of pain, anhidrosis and its orthopaedic implications.

  7. Review of early clinical results and complications associated with oblique lumbar interbody fusion (OLIF).

    PubMed

    Phan, Kevin; Maharaj, Monish; Assem, Yusuf; Mobbs, Ralph J

    2016-09-01

    Lumbar interbody fusion represents an effective surgical intervention for patients with lumbar degenerative diseases, spondylolisthesis, disc herniation, pseudoarthrosis and spinal deformities. Traditionally, conventional open anterior lumbar interbody fusion and posterior/transforaminal lumbar interbody fusion techniques have been employed with excellent results, but each with their own advantages and caveats. Most recently, the antero-oblique trajectory has been introduced, providing yet another corridor to access the lumbar spine. Termed the oblique lumbar interbody fusion, this approach accesses the spine between the anterior vessels and psoas muscles, avoiding both sets of structures to allow efficient clearance of the disc space and application of a large interbody device to afford distraction for foraminal decompression and endplate preparation for rapid and thorough fusion. This review aims to summarize the early clinical results and complications of this new technique and discusses potential future directions of research.

  8. The primary Sauve-Kapandji procedure--for treatment of comminuted distal radius and ulnar fractures.

    PubMed

    Horii, E; Ohmachi, T; Nakamura, R

    2005-02-01

    We have performed primary Sauve-Kapandji procedures on four patients with severe open comminuted fractures of both the distal radius and ulna. The fragmented distal ulna was fixed to the sigmoid notch in order to stabilize the ulnar side of the carpus, and a proximal pseudoarthrosis was maintained for forearm rotation. All the distal radial fractures united without major complications. The mean wrist flexion/extension arc was 76 degrees , the mean pronation/supination arc was 135 degrees, and grip strength was 64% of the contralateral side. All patients returned to their work or daily activities within short time period without any additional surgical treatment, except for removal of implants in three patients. The primary Sauve-Kapandji procedure is effective for the reconstruction of severely combined distal radius and ulnar fractures.

  9. Efficacy of soaking in 70% isopropyl alcohol on aerobic bacterial decontamination of surgical instruments and gloves for serial mouse laparotomies.

    PubMed

    Keen, Jessica N; Austin, MaryKay; Huang, Li-Shan; Messing, Susan; Wyatt, Jeffrey D

    2010-11-01

    Rodent surgeries in biomedical research facilities are often performed in series. This practice presents many challenges to maintaining aseptic technique between animals. Here, we examined using soaking in 70% isopropyl alcohol for aerobic bacterial decontamination of surgical instruments and gloves used in a series of as many as 10 mouse laparotomy surgeries. These surgeries were performed on mice that were euthanized immediately prior to the procedure. Instruments and gloves were cultured before and after each procedure to determine the presence of aerobic bacterial contamination. To assess the efficacy of the decontamination protocol, culture results were grouped by procedure and then paired (before soak and after soak) for analysis using McNemar test at an α level of 0.05. In addition, by using the Fisher exact test, this modified aseptic method was compared with strict aseptic technique, for which autoclaved instruments and sterile surgical gloves were used for each procedure. In this study, we observed that the modified aseptic technique using 70% isopropyl alcohol soaks pre- vented aerobic bacterial contamination of instruments and gloves for as many as 5 mice.

  10. Management of Malignant Pleural Effusion with ASEPT® Pleural Catheter: Quality of Life, Feasibility, and Patient Satisfaction

    PubMed Central

    Dhaliwal, Inderdeep; Mahdavian, Masoud; Asghari, Shabnam; Chun To Wong, Benson; Labelle, Rosalie

    2016-01-01

    Objective. The PleurX® IPC system has been used extensively in the past. Over time, management of MPE with the PleurX system can be costly. The new ASEPT pleural catheter, through advantages in design, may ultimately show cost savings. The primary outcome of this study was to evaluate safety and efficacy of the ASEPT system. Method. This single centre, prospective study enrolled 50 patients with MPE, who were followed for as long as they were alive with a catheter. Quality of Life (QoL) was assessed before, at 2 weeks, and 6 weeks after ASEPT catheter insertion using the EORTC QLQ-C30 and LC13 questionnaires. Ease of catheter use and complications were reported by physician and community nurses. Results. 50 patients with MPE with a mean age of 64.5 ± 1.9, BDI of 2.8 ± 0.9, and ECOG score of 3.0 ± 0.7 were recruited. No immediate or long-term complications were reported during the study period. Compared to precatheter insertion, global health status (−18, p < 0.001), QLQ-C30 dyspnea (−39, p < 0.00001), and LC13 dyspnea (−11, p < 0.0005) significantly improved at 2 and 6 weeks after intervention. Provider surveys indicated favourable ease of use. Conclusion. The new ASEPT catheter offers a safe and effective option for the management of MPE. PMID:28074083

  11. Utility of cerebrospinal fluid cortisol level in acute bacterial meningitis

    PubMed Central

    Mehta, Anish; Mahale, Rohan R.; Sudhir, Uchil; Javali, Mahendra; Srinivasa, Rangasetty

    2015-01-01

    Background: Meningitis remains a serious clinical problem in developing as well as developed countries. Delay in diagnosis and treatment results in significant morbidity and mortality. The role and levels of intrathecal endogenous cortisol is not known. Objective: To study the cerebrospinal fluid (CSF) cortisol levels and to evaluate its role as a diagnostic and therapeutic marker in acute bacterial meningitis. Materials and Methods: Thirty patients with acute bacterial meningitis with no prior treatment were evaluated. Cortisol levels were compared with 20 patients with aseptic (viral) meningitis and 25 control subjects. Results: Mean CSF cortisol level was 13.85, 3.47, and 1.05 in bacterial meningitis, aseptic meningitis, and controls, respectively. Mean CSF cortisol level in bacterial meningitis was significantly higher as compared to controls (P < 0.001). There was significant difference in CSFcortisol levels in bacterial and aseptic meningitis (P < 0.001). Conclusions: Cortisol levels in CSF are highly elevated in patients with acute bacterial meningitis. This suggests that intrathecalcortisol may serve as a valuable, rapid, relatively inexpensive diagnostic marker in discriminatingbetween bacterial and aseptic meningitis. This helps in earlier institution of appropriate treatment and thereby decreasing morbidity and mortality. PMID:26019421

  12. (+)-Strigol, a witchweed seed germination stimulant, from Menispermum dauricum root culture.

    PubMed

    Yasuda, Norifumi; Sugimoto, Yukihiro; Kato, Masako; Inanaga, Shinobu; Yoneyama, Koichi

    2003-04-01

    (+)-Strigol was isolated from Menispermum dauricum root culture filtrate. Its identity was confirmed by HPLC, 1H NMR, UV and MS, and on the basis of its CD spectrum. This is the first report on isolation of strigolactone from aseptic plant culture.

  13. 40 CFR 63.3481 - Am I subject to this subpart?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... example, spray guns or dip tanks. (1) One- and two-piece draw and iron can body coating. The one- and two... are inside spray on food cans, aseptic side seam stripes on food cans, nonaseptic side seam stripes on... repair spray coatings to metal can ends. This subcategory includes three distinct coating type...

  14. 40 CFR 63.3481 - Am I subject to this subpart?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... example, spray guns or dip tanks. (1) One- and two-piece draw and iron can body coating. The one- and two... are inside spray on food cans, aseptic side seam stripes on food cans, nonaseptic side seam stripes on... repair spray coatings to metal can ends. This subcategory includes three distinct coating type...

  15. 40 CFR 63.3481 - Am I subject to this subpart?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... example, spray guns or dip tanks. (1) One- and two-piece draw and iron can body coating. The one- and two... are inside spray on food cans, aseptic side seam stripes on food cans, nonaseptic side seam stripes on... repair spray coatings to metal can ends. This subcategory includes three distinct coating type...

  16. Campylobacter can remain in various organs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Day old broiler chicks were obtained from a commercial hatchery and inoculated either orally or intracloacally with a characterized strain of Campylobacter jejuni. After 1 hr, 1day and 1wk post inoculation, the thymus, spleen, liver/gallbladder, bursa of Fabricius and ceca were aseptically removed ...

  17. Effects of nano-TiO2 on the agronomically-relevant Rhizobium-legume symbiosis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The impact of nano-TiO2 on Rhizobium-legume symbiosis was studied using garden peas and the compatible bacterial partner Rhizobium leguminosarum bv. viciae 3841. Exposure to nano-TiO2 did not affect the germination of peas grown aseptically, nor did it impact the gross root structure. However, nano-...

  18. Progress in cryopreservation of dormant winter buds of selected tree species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cryopreservation of germplasm, using dormant winter buds (DB) as source plant materials is economically favorable over tissue culture options (TC). Processing DB does not require aseptic conditions and involved cryopreservation procedures. Although, the DB cryopreservation method has been known f...

  19. Cryopreservation of Salix sp. dormant winter buds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cryopreservation, using dormant winter buds (DB) as source plant materials is economically advantageous over tissue culture options (TC). Processing DB does not require aseptic conditions and elaborate cryopreservation procedures. However, the DB approach is only feasible for cryopreserving a sel...

  20. Medical Laboratory Technician--Microbiology (AFSC 90470).

    ERIC Educational Resources Information Center

    Thompson, Joselyn H.

    This four-volume student text is designed for use by Air Force personnel enrolled in a self-study extension course for medical laboratory technicians. Covered in the individual volumes are laboratory procedures in clinical bacteriology (the history of bacteriology; aseptic techniques and sterilization procedures; bacterial morphology and…

  1. Microflora in soils of desert regions

    NASA Technical Reports Server (NTRS)

    Cameron, R. E.

    1970-01-01

    Desert soil samples, collected using aseptic techniques, are low in organic matter and cation exchange capacity. Aerobic and microaerophilic bacteria are most abundant, next are algae and molds. Chemical and physical properties are determined by standard procedures, including the Kjeldahl method and the use of Munsell soil color charts.

  2. AEROBIC SOIL MICROCOSMS FOR LONG-TERM BIODEGRADATION OF HYDROCARBON VAPORS

    EPA Science Inventory

    The aims of this research project included the development of laboratory protocols for the preparation of aerobic soil microcosms using aseptic field soil samples, and for the gas chromatographic analysis of hydrocarbon vapor biodegradation based on vapor samples obtained from th...

  3. Feasibility Study of Pharmacological Treatment to Reduce Morbidity and Mortality after Brain Injury

    DTIC Science & Technology

    1988-05-15

    Animals were housed individually in S standard wire- mesh cages, maintained on a 12:12 hour light:dark cycle, and unless otherwise specified, given food...incision closed with 4-0 prolene , with both catheters exiting at the posterior end of the incision. Aseptic techniques were used throughout this

  4. Humeral windows in revision total elbow arthroplasty.

    PubMed

    Peach, Chris A; Salama, Amir; Stanley, David

    2016-04-01

    The use of cortical windows for revision elbow arthroplasty has not previously been widely reported. Their use aids safe revision of a well fixed humeral prosthesis and can be used in the setting of dislocation, periprosthetic fracture or aseptic loosening of the ulnar component. We describe our technique and results of cortical windows in the distal humerus for revision elbow arthroplasty surgery.

  5. Incidence of intramammary infection at parturition for first calf heifers and multiparous cows

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aseptic quarter foremilk samples (10 ml) were obtained within 3 days of calving from 116 heifers (463 quarters) and 101 multiparous cows (404 quarters). Intramammary infections were observed in 183 quarters (40%) of 87 heifers, and in 117 quarters (29%) of 59 multiparous cows. Of the 183 infected q...

  6. Microbiological differences between laying hen strains housed in various production systems.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sister flocks of three strains of laying hens were housed in conventional cage, free range, and cage free production systems. All flocks were located on a single, commercial-style research facility and provided the same dietary and lighting regimens. Once a season, a sample of shell eggs was asept...

  7. 21 CFR 522.2424 - Sodium thiamylal for injection.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... § 522.2424 Sodium thiamylal for injection. (a) Specifications. The drug is a sterile dry powder. It is reconstituted aseptically with sterile distilled water, water for injection, or sodium chloride injection, to a... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Sodium thiamylal for injection. 522.2424...

  8. Methods for external disinfection of blow fly (Diptera: Calliphoridae) eggs prior to use in wound debridement therapy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maggot debridement therapy (MDT) is the use of the larval stage of flies (i.e., Calliphoridae) to remove necrotic tissue and disinfect wounds. Effective MDT requires an aseptic technique to prevent the unintentional introduction of pathogenic bacteria into a wound to be debrided, yet the external s...

  9. 21 CFR 526.464a - Cloxacillin benzathine.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...) of this chapter for use in dairy cows. (1) Amount. Administer aseptically into each quarter... Staphylococcus aureus and Streptococcus agalactiae including penicillin resistant strains in dairy cows during the dry period. (3) Limitations. For use in dry cows only. Not to be used within 30 days of...

  10. Particle Disease: A Current Review of the Biological Mechanisms in Periprosthetic Osteolysis After Hip Arthroplasty

    PubMed Central

    Sukur, Erhan; Akman, Yunus Emre; Ozturkmen, Yusuf; Kucukdurmaz, Fatih

    2016-01-01

    Background: Inflammatory responses to wear debris cause osteolysis that leads to aseptic prosthesis loosening and hip arthroplasty failure. Although osteolysis is usually associated with aseptic loosening, it is rarely seen around stable implants. Aseptic implant loosening is a simple radiologic phenomenon, but a complex immunological process. Particulate debris produced by implants most commonly causes osteolysis, and this is called particle-associated periprosthetic osteolysis (PPO). Objective: The objective of this review is to outline the features of particle-associated periprosthetic osteolysis to allow the physician to recognise this condition and commence early treatment, thereby optimizing patient outcome. Methods: A thorough literature search was performed using available databases, including Pubmed, to cover important research published covering particle-associated PPO. Results: Although osteolysis causes bone resorption, clinical, animal, and in vitro studies of particle bioreactivity suggest that particle-associated PPO represents the culmination of several biological reactions of many cell types, rather than being caused solely by the osteoclasts. The biological activity is highly dependent on the characteristics and quantity of the wear particles. Conclusion: Despite advances in total hip arthroplasty (THA), particle-associated PPO and aseptic loosening continue to be major factors that affect prosthetic joint longevity. Biomarkers could be exploited as easy and objective diagnostic and prognostic targets that would enable testing for osteolysis after THA. Further research is needed to identify new biomarkers in PPO. A comprehensive understanding of the underlying biological mechanisms is crucial for developing new therapeutic interventions to reverse or suppress biological responses to wear particles. PMID:27499822

  11. Amelioration of Radiation-Induced Hematopoietic and Gastrointestinal Damage by Ex-RAD (trademark) in Mice

    DTIC Science & Technology

    2012-06-06

    injections of the drug and vehicle in animals were done aseptically at the nape of the neck with a 23-G needle before irradiation. No infection or local...compared with vehicle control. Fig. 6. Crypts per circumference of jejunum sections from Ex-RAD-treated and vehicle-treated groups 12 h and 3.5 days post

  12. 40 CFR 63.3561 - What definitions apply to this subpart?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... destruction or removal before discharge to the atmosphere. Adhesive means any chemical substance that is... pressurized aerosol product is packaged. Aseptic coating means any coating that must withstand high... subjected to high temperature steam, chemicals, or a combination of both to sterilize food cans prior...

  13. Fun Microbiology: Using a Plant Pathogenic Fungus To Demonstrate Koch's Postulates.

    ERIC Educational Resources Information Center

    Mitchell, James K.; Orsted, Kathy M.; Warnes, Carl E.

    1997-01-01

    Describes an experiment using a plant pathogenic fungus in which students learn to follow aseptic techniques, grow and produce spores of a fungus, use a hemacytometer for enumerating spores, prepare serial dilutions, grow and inoculate plants, isolate a pure culture using agar streak plates, and demonstrate the four steps of Koch's postulates.…

  14. Meningitis in a College Student in Connecticut, 2007

    ERIC Educational Resources Information Center

    Sosa, Lynn E.; Gupta, Shaili; Juthani-Mehta, Manisha; Hadler, James L.

    2009-01-01

    The authors describe a case of aseptic meningitis in a college student that was ultimately attributed to infection with lymphocytic choriomeningitis virus (LCMV). The authors also provide a review of LCMV infection, epidemiology, and public health implications. Providers should be aware of LCMV as a cause of meningitis in college students,…

  15. 9 CFR 147.11 - Laboratory procedure recommended for the bacteriological examination of salmonella.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    .... Careful aseptic technique should be used when collecting all tissue samples. (1) Direct culture (refer to..., and inflamed serosal surfaces) should be sampled for direct culture using either flamed wire loops or... culture. 7 Biochemical identification charts may be obtained from “A Laboratory Manual for the...

  16. Evidence supporting vertical transmission of Salmonella in dairy cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We set out to investigate whether Salmonella enterica could be recovered from various tissues of viable neonatal calves immediately following parturition. Eleven samples were aseptically collected from each of 20 calves and consisted of both left and right subiliac and prescapular lymph nodes (LN),...

  17. 21 CFR 211.113 - Control of microbiological contamination.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... shall include validation of all aseptic and sterilization processes. ... 21 Food and Drugs 4 2012-04-01 2012-04-01 false Control of microbiological contamination. 211.113 Section 211.113 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  18. 21 CFR 211.113 - Control of microbiological contamination.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... shall include validation of all aseptic and sterilization processes. ... 21 Food and Drugs 4 2014-04-01 2014-04-01 false Control of microbiological contamination. 211.113 Section 211.113 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  19. 21 CFR 211.113 - Control of microbiological contamination.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... shall include validation of all aseptic and sterilization processes. ... 21 Food and Drugs 4 2013-04-01 2013-04-01 false Control of microbiological contamination. 211.113 Section 211.113 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  20. Surgical Education: Attitudes toward Animal Use in Teaching Surgery at Louisiana State University.

    ERIC Educational Resources Information Center

    Hedlund, Cheryl S.; Hosgood, Giselle; Naugler, Sasha

    2002-01-01

    Surveyed students and faculty at Louisiana State University about the use of animals for teaching surgery. Found that they favored the practice, finding it helpful for learning aseptic technique and suturing skills but less so for learning tissue handling, dissection, hemostasis, or anesthesia. (EV)

  1. Cloning: plants – micropropagation/tissue culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clonal micropropagation is the multiplication of the buds and shoots that occur in leaf axils on a defined nutrient medium in an aseptic in vitro environment. The resulting shoots are either subdivided for continued multiplication or rooted and acclimatized to the greenhouse or field. Micropropagati...

  2. The prevalence of Salmonella enterica serovars Heidelberg and Kentucky in the scalder water of a commercial poultry processing plant in the southeastern United States.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The purpose of this study was to assess the presence of Salmonella enterica present in the water of scalder and chiller tanks from a commercial chicken processing plant in the southeaster United States. Three liters of scald and chill water were aseptically sampled three times daily for three consec...

  3. [Outpatient care for urological patients].

    PubMed

    Kul'chitskiĭ, V V

    1999-01-01

    The presence of adequately equipped surgical unit in outpatient clinics provides surgical aid to more patients with urological diseases. Preoperative preparation, aseptic and antiseptic measures, local anesthesia were routine. 64 operations for phimosis, condylomatous growth of the foreskin, hydrocele, cyst of the epididymis and spermatic cord, chronic epididymitis, short frenulum of the prepuce were performed in outpatient setting. Recovery lasted as usual.

  4. 21 CFR 113.100 - Processing and production records.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... percent solids. (3) Hydrostatic retorts. The temperature in the steam chamber between the steam-water... process specifies maintenance of particular temperatures in the hydrostatic water legs, the temperatures near the top and the bottom of each hydrostatic water leg. (4) Aseptic processing and packaging...

  5. 40 CFR Table 2 to Subpart Kkkk of... - Emission Limits for Existing Affected Sources

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... Three-piece can assembly a. Inside spray 0.29 (2.43). b. Aseptic side seam stripes on food cans 1.94 (16... seal compounds 0.06 (0.54). b. Nonaseptic end seal compounds 0.00 (0.00). c. Repair spray coatings...

  6. Pressure load on specific body areas of gestating sows lying on rubber mats with different softness.

    PubMed

    Schubbert, A; Hartung, E; Schrader, L

    2014-08-01

    Rubber mats offer a possibility to increase lying comfort for sows with positive effects on sow lying behavior and health. However, until now, no information has been reported about the relationship between the softness of rubber mats and the pressure load on certain body areas of sows. We used a total of 68 (40 multiparous, 28 primiparous) German Landrace × German Landrace sows with a BW within the range of 90 to 330 kg (divided in 3 weight classes) to measure peak force and distribution of pressure during lying in the sternal and half recumbent position. Measures were done in an experimental pen that was equipped with a pressure sensor map system (5400 NTL; Tekscan Inc., Boston, MA). Three rubber mats differing in softness (penetration depth: hard mat, 4.0 mm [HM]; soft mat, 14.6 mm [SM]; very soft mat, 43.0 mm [VSM]) were tested and compared to concrete floor (CF) as a reference. Pressure load was analyzed in the sternal position for the sternum, belly, and ham body regions and also in the half recumbent position for the shoulder. For each lying position we determined the body region with the highest pressure load and analyzed the peak force (PF) and the contact area (CA) using a mixed model ANOVA (MIXED procedure of SAS Enterprise, version 4.3., SAS Inst. Inc., Cary, NC) with floor type, weight class of sows, and their interaction as fixed factors. Overall, the highest values for PF in the sternal position were found on the sternum (median: 1.62 N/cm(2)) and in the half recumbent position on the shoulder (median: 2.72 N/cm(2)). In the sternal position PF on the sternum was lower on VSM compared to CF (P = 0.001). In the half-recumbent position PF on the shoulder was lower on VSM compared to CF (P = 0.013) and compared to HM (P = 0.011). The weight of the sows affected PF on the sternum in the sternal position, with lower values in weight class 1 compared to weight class 2 (P = 0.001) and weight class 3 (P = 0.002). Contact area under the sternum was larger on

  7. Double vs single internal thoracic artery harvesting in diabetic patients: role in perioperative infection rate

    PubMed Central

    Agrifoglio, Marco; Trezzi, Matteo; Barili, Fabio; Dainese, Luca; Cheema, Faisal H; Topkara, Veli K; Ghislandi, Chiara; Parolari, Alessandro; Polvani, Gianluca; Alamanni, Francesco; Biglioli, Paolo

    2008-01-01

    Background The aim of this prospective study is to evaluate the role in the onset of surgical site infections of bilateral internal thoracic arteries harvesting in patients with decompensated preoperative glycemia. Methods 81 consecutive patients with uncontrolled diabetes mellitus underwent elective CABG harvesting single or double internal thoracic arteries. Single left ITA was harvested in 41 patients (Group 1, 50.6%), BITAs were harvested in 40 (Group 2, 49.4%). The major clinical end points analyzed in this study were infection rate, type of infection, duration of infection, infection relapse rate and total hospital length of stay. Results Five patients developed sternal SSI in the perioperative period, 2 in group 1 and 3 in group 2 without significant difference. All sternal SSIs were superficial with no sternal dehiscence. The development of infection from the time of surgery took 18.5 ± 2.1 and 7.3 ± 3.0 days for Groups 1 and 2 respectively. The infections were treated with wound irrigation and debridement, and with VAC therapy as well as with antibiotics. The VAC system was removed after a mean of 12.8 ± 5.1 days, when sterilization was achieved. The overall survival estimate at 1 year was 98.7%. Only BMI was a significant predictor of SSI using multivariate stepwise logistic regression analysis (Odds Ratio: 1.34; 95%Conficdence Interval: 1.02–1.83; p value: 0.04). In the model, the use of BITA was not an independent predictor of SSI. Conclusion CABG with bilateral pedicled ITAs grafting could be performed safely even in diabetics with poor preoperative glycaemic control. PMID:18573201

  8. Hospital-Acquired Infections After Cardiac Surgery and Current Physician Practices: A Retrospective Cohort Study

    PubMed Central

    O’Keefe, Scott; Williams, Kenneth; Legare, Jean-Francois

    2017-01-01

    Background The management of hospital-acquired infections (HAIs) with respect to physician practices remains largely unexplored despite increasing efforts to standardize care. In the present study, we report findings from a 2-month audit of all patients that have undergone cardiac surgery at a large referral center in Atlantic Canada. Methods All patients who underwent cardiac surgical procedures during May and June 2013 at the Queen Elizabeth II Health Sciences Center in Halifax, Nova Scotia were identified. The prevalence of urinary tract infections (UTIs), pneumonia, leg harvest site infections, superficial sternal wound infections, deep sternal wound infections, and sepsis was examined to determine physician approaches in terms of verification rates (microbiology), time of diagnosis and duration of treatment. Continuous variables were compared using Student’s t-test and categorical variables were analyzed using Fischer’s exact test. Results A total of 185 consecutive patients underwent cardiac surgical procedures, of which 39 (21%) developed at least one postoperative infection. The overall prevalence of infection types, from highest to lowest, was UTI (8%), pneumonia (7%), leg harvest site infection (5%), superficial surgical site infection (4%), and sepsis (2%). There were no deep sternal wound infections. The overall in-hospital mortality rate was 3.8% with a median length of stay (LOS) of 8 days. The overall infection verification rate was 50% (ranged from 100% in sepsis to 10% in leg harvest site infections). In all cases, a full course of antibiotics was administered despite negative microbiology cultures or limited evidence of an actual infection. Conclusions HAIs are commonly treated without being verified and treatment is often not discontinued after negative cultures are received. Our findings highlight the fact that antibiotic treatment is not always supported by evidence, and the effect of this could contribute to increased selective pressure

  9. A reappraisal of adult thoracic surface anatomy.

    PubMed

    Mirjalili, S Ali; Hale, Samuel J M; Buckenham, Tim; Wilson, Ben; Stringer, Mark D

    2012-10-01

    Accurate surface anatomy is essential for safe clinical practice. Numerous inconsistencies in clinically important surface markings exist between and within anatomical reference texts. The aim of this study was to investigate key thoracic surface anatomical landmarks in vivo using computed tomographic (CT) imaging. High-resolution thoracic CT scans from 153 supine adults (mean age 63, range 19-89 years; 53% female) taken at end tidal inspiration were analyzed by dual consensus reporting to determine the surface anatomy of the sternal angle, central veins, heart, lungs, and diaphragm. Patients with kyphosis/scoliosis, distorting space-occupying lesions, or visceromegaly were excluded. The position of the cardiac apex, formation of the brachiocephalic veins, and vertebral levels of the sternal angle, xiphisternal joint, and aortic hiatus were consistent with commonly accepted surface markings although there was a wide range of normal variation. In contrast, common surface markings were markedly inaccurate for the following: the position of the tracheal bifurcation, aortic arch, and azygos vein termination (below the plane of the sternal angle at T5-T6 vertebral level in most individuals); the superior vena cava/right atrial junction (most often behind the fourth costal cartilage); the lower border of the lung (adjacent to T12 vertebra posteriorly); and the level at which the inferior vena cava and esophagus traverse the diaphragm (T11 in most). Surface anatomy must be reappraised using modern imaging in vivo if it is to be evidence based and fit for purpose. The effects of gender, age, posture, respiration, build, and ethnicity also deserve greater emphasis.

  10. Poststernotomy mediastinitis: a review of conventional surgical treatments, vacuum-assisted closure therapy and presentation of the Lund University Hospital mediastinitis algorithm.

    PubMed

    Sjögren, Johan; Malmsjö, Malin; Gustafsson, Ronny; Ingemansson, Richard

    2006-12-01

    Poststernotomy mediastinitis, also commonly called deep sternal wound infection, is one of the most feared complications in patients undergoing cardiac surgery. The overall incidence of poststernotomy mediastinitis is relatively low, between 1% and 3%, however, this complication is associated with a significant mortality, usually reported to vary between 10% and 25%. At the present time, there is no general consensus regarding the appropriate surgical approach to mediastinitis following open-heart surgery and a wide range of wound-healing strategies have been established for the treatment of poststernotomy mediastinitis during the era of modern cardiac surgery. Conventional forms of treatment usually involve surgical revision with open dressings or closed irrigation, or reconstruction with vascularized soft tissue flaps such as omentum or pectoral muscle. Unfortunately, procedure-related morbidity is relatively frequent when using conventional treatments and the long-term clinical outcome has been unsatisfying. Vacuum-assisted closure is a novel treatment with an ingenious mechanism. This wound-healing technique is based on the application of local negative pressure to a wound. During the application of negative pressure to a sternal wound several advantageous features from conventional surgical treatment are combined. Recent publications have demonstrated encouraging clinical results, however, observations are still rather limited and the underlying mechanisms are largely unknown. This review provides an overview of the etiology and common risk factors for deep sternal wound infections and presents the historical development of conventional therapies. We also discuss the current experiences with VAC therapy in poststernotomy mediastinitis and summarize the current knowledge on the mechanisms by which VAC therapy promotes wound healing. Finally, we suggest a structured algorithm for using VAC therapy for treatment of poststernotomy mediastinitis in clinical

  11. Immobilization of domestic goats (Capra hircus) using orally administered carfentanil citrate and detomidine hydrochloride.

    PubMed

    Sleeman, J M; Carter, W; Tobin, T; Ramsay, E C

    1997-06-01

    Eight domestic goats (Capra hircus) were anesthetized with a combination of carfentanil citrate and detomidine HCl each at a dosage of 60 micrograms/kg, mixed with an equal volume of 0.5% saponin, an absorption enhancer. The drug combination was delivered by hand directly into the buccal cavity. Physiologic parameters were measured prior to drug administration and at 5-min intervals after the goats reached sternal recumbency. Depth of anesthesia was assessed at the same time intervals following drug administration. Blood was drawn prior to drug administration, at initial contact following sustained sternal recumbency, and at 15-min intervals thereafter. Serum carfentanil and detomidine levels were measured using slightly modified commercial enzyme-linked immunosorbent assay kits and techniques. Mean (+/-SD) induction time (time from drug administration to sternal recumbency) was 22 +/- 4.3 min (n = 8), and inductions were characterized by long excitement phases (9.3 +/- 5.8 min). There was considerable variation in the depth of anesthesia. Three goats appeared to be lightly anesthetized, two goats showed moderate levels of anesthesia, and three goats attained levels of anesthesia adequate for the performance of minor veterinary procedures. Physiologic changes caused by the drug combination were minor and were consistent with changes seen with parenteral administration of these drugs. Serum carfentanil levels were greatest at the time of initial contact for three goats and greatest 15 min later for two other goats. Levels then decreased slightly during the procedures, suggesting carfentanil absorption in these animals was across the oral mucosa. Serum detomidine levels rose gradually throughout anesthesia. Reversals with naltrexone and yohimbine or atipamezole were rapid and smooth.

  12. A novel acropectoral syndrome maps to chromosome 7q36

    PubMed Central

    Dundar, M.; Gordon, T.; Ozyazgan, I.; Oguzkaya, F.; Ozkul, Y.; Cooke, A.; Wilkinson, A; Holloway, S.; Goodman, F.; Tolmie, J.

    2001-01-01

    F syndrome (acropectorovertebral syndrome) is a dominantly inherited skeletal dysplasia affecting the hands, feet, sternum, and lumbosacral spine, which has previously been described in only two families. Here we report a six generation Turkish family with a related but distinct dominantly inherited acropectoral syndrome. All 22 affected subjects have soft tissue syndactyly of all fingers and all toes and 14 also have preaxial polydactyly of the hands and/or feet. In addition, 14 have a prominent upper sternum and/or a blind ending, inverted U shaped sinus in the anterior chest wall. Linkage studies and haplotype analysis carried out in 16 affected and nine unaffected members of this family showed that the underlying locus maps to a 6.4 cM interval on chromosome 7q36, between EN2 and D7S2423, a region to which a locus for preaxial polydactyly and triphalangeal thumb-polysyndactyly has previously been mapped. Our findings expand the range of phenotypes associated with this locus to include total soft tissue syndactyly and sternal deformity, and suggest that F syndrome may be another manifestation of the same genetic entity. In mice, ectopic expression of the gene Sonic hedgehog (Shh) in limb buds and lateral plate mesoderm during development causes preaxial polydactyly and sternal defects respectively, suggesting that misregulation of SHH may underlie the unusual combination of abnormalities in this family. A recently proposed candidate gene for 7q36 linked preaxial polydactyly is LMBR1, encoding a novel transmembrane receptor which may be an upstream regulator of SHH.


Keywords: preaxial polydactyly; sternal deformity; F syndrome; chromosome 7q36 PMID:11333865

  13. Can patients determine the level of their dysphagia?

    PubMed Central

    Ashraf, Hafiz Hamad; Palmer, Joanne; Dalton, Harry Richard; Waters, Carolyn; Luff, Thomas; Strugnell, Madeline; Murray, Iain Alexander

    2017-01-01

    AIM To determine if patients can localise dysphagia level determined endoscopically or radiologically and association of gender, age, level and pathology. METHODS Retrospective review of consecutive patients presenting to dysphagia hotline between March 2004 and March 2015 was carried out. Demographics, clinical history and investigation findings were recorded including patient perception of obstruction level (pharyngeal, mid sternal or low sternal) was documented and the actual level of obstruction found on endoscopic or radiological examination (if any) was noted. All patients with evidence of obstruction including oesophageal carcinoma, peptic stricture, Schatzki ring, oesophageal pouch and cricopharyngeal hypertrophy were included in the study who had given a perceived level of dysphagia. The upper GI endoscopy reports (barium study where upper GI endoscopy was not performed) were reviewed to confirm the distance of obstructing lesion from central incisors. A previously described anatomical classification of oesophagus was used to define the level of obstruction to be upper, middle or lower oesophagus and this was compared with patient perceived level. RESULTS Three thousand six hundred and sixty-eight patients were included, 42.0% of who were female, mean age 70.7 ± 12.8 years old. Of those with obstructing lesions, 726 gave a perceived level of dysphagia: 37.2% had oesophageal cancer, 36.0% peptic stricture, 13.1% pharyngeal pouches, 10.3% Schatzki rings and 3.3% achalasia. Twenty-seven point five percent of patients reported pharyngeal level (upper) dysphagia, 36.9% mid sternal dysphagia and 25.9% lower sternal dysphagia (9.5% reported multiple levels). The level of obstructing lesion seen on diagnostic testing was upper (17.2%), mid (19.4%) or lower (62.9%) or combined (0.3%). When patients localised their level of dysphagia to a single level, the kappa statistic was 0.245 (P < 0.001), indicating fair agreement. 48% of patients reporting a single level of

  14. Adenoid cystic carcinoma of the submandibular gland with rare metastasis to the sternum in a 52-year-old male

    PubMed Central

    Alshammari, Abdullah; Eldeib, Omar Jamal; Eldeib, Ahmed Jamal; Saleh, Waleed

    2016-01-01

    Adenoid cystic carcinoma (ACC) is a rare tumor, described as being one of the most biologically destructive tumors of the head and neck. It is the most common malignancy that affects the minor salivary glands. Lung and bones are the most common regions of ACC distant metastasis. To the best of our knowledge, herein, we report the first ever case of latent isolated sternal metastasis from ACC in a 52-year-old gentleman, who was diagnosed to have ACC of the submandibular gland, excised 10 years ago. PMID:26933463

  15. Pseudoaneurysm of the Right Internal Mammary Artery Post Vacuum-Assisted Closure Therapy: A Rare Complication and Literature Review.

    PubMed

    Datta, Subir; Manoly, Imthiaz; Karangelis, Dimos; Hasan, Ragheb

    2016-02-01

    Vacuum-assisted closure (VAC) therapy in the management of sternal wound infection post cardiac surgery has gained popularity since last decade. It is very cost effective and has survival benefit compared with conventional management. Although there are few complications associated with VAC therapy including right ventricular free wall rupture and infectious erosion to aorta, there are now isolated reports of vein graft pseudoaneurysm associated with it. We describe an extremely rare complication of right internal mammary artery pseudoaneurysm post VAC therapy in a 56-year-old man which was successfully managed surgically. We also did a literature review on the possible complications of VAC therapy post cardiac surgery and its management.

  16. Percutaneous coil embolisation of a false aortic aneurysm following coronary surgery and mediastinitis.

    PubMed

    Barbetakis, Nikolaos; Xenikakis, Theocharis; Efstathiou, Andreas; Fessatidis, Ioannis

    2007-01-01

    A 71-year-old male patient was admitted with methicillin-resistant staphylococcus aureus mediastinitis two months after coronary artery bypass grafting. Treatment with immediate surgical debridement, removal of sternal wires and use of vacuum-assisted closure device was started. Spiral computerised tomography and aortography revealed a false aortic aneurysm at the cannulation site. Active mediastinitis and the patient's objection to further surgery led us to perform percutaneous coil embolisation. No postoperative complication was observed and one year later the patient is in excellent condition.

  17. Yuebeipotamon calciatile, a new genus and new species of freshwater crab from southern China (Crustacea, Decapoda, Brachyura, Potamidae)

    PubMed Central

    Huang, Chao; Shih, Hsi-Te; Mao, Si Ying

    2016-01-01

    Abstract A new genus and species of freshwater crab, Yuebeipotamon calciatile gen. n., sp. n., is described from southern China. While the carapace features are superficially similar to species of Sinopotamon Bott, 1967, Longpotamon Shih, Huang & Ng, 2016, and Tenuilapotamon Dai, Song, Li, Chen, Wang & Hu, 1984, the new genus possesses a distinctive combination of carapace, ambulatory leg, male thoracic sternal, male abdominal, and gonopodal characters that distinguish it from these and other genera. Molecular evidence derived from the mitochondrial 16S rDNA supports the establishment of a new genus. PMID:27667941

  18. Giant Anterior Chest Wall Basal Cell Carcinoma: An Approach to Palliative Reconstruction

    PubMed Central

    Prendergast, Christina; Leis, Amber

    2016-01-01

    Anterior chest wall giant basal cell carcinoma (GBCC) is a rare skin malignancy that requires a multidisciplinary treatment approach. This case report demonstrates the challenges of anterior chest wall GBCC reconstruction for the purpose of palliative therapy in a 72-year-old female. Surgical resection of the lesion included the manubrium and upper four ribs. The defect was closed with bilateral pectoral advancement flaps, FlexHD, and pedicled VRAM. The palliative nature of this case made hybrid reconstruction more appropriate than rigid sternal reconstruction. In advanced metastatic cancers, the ultimate goals should be to avoid risk for infection and provide adequate coverage for the defect. PMID:28083152

  19. Clinical experience with Leptospermum honey use for treatment of hard to heal neonatal wounds: case series.

    PubMed

    Boyar, V; Handa, D; Clemens, K; Shimborske, D

    2014-02-01

    Preterm, critically ill neonates represent a challenge in wound healing. Many factors predispose infants to skin injuries, including decreased epidermal-dermal cohesion, deficient stratum corneum, relatively alkaline pH of skin surface, impaired nutrition and presence of multiple devices on the skin. We present a case series describing the use of medical-grade honey-Leptospermum honey (Medihoney), for successful treatment of slowly healing neonatal wounds, specifically stage 3 pressure ulcer, dehiscent and infected sternal wound, and full-thickness wound from an extravasation injury.

  20. Avian Soft Tissue Surgery.

    PubMed

    Guzman, David Sanchez-Migallon

    2016-01-01

    Basic surgical instrumentation for avian soft tissue surgery includes soft tissue retractors, microsurgical instrumentation, surgical loupes, and head-mounted lights. Hemostasis is fundamental during the surgical procedures. The indications, approach, and complications associated with soft tissue surgeries of the integumentary (digit constriction repair, feather cyst excision, cranial wound repair, sternal wound repair, uropygial gland excision), gastrointestinal (ingluviotomy, crop biopsy, crop burn repair, celiotomy, coelomic hernia and pseudohernia repair, proventriculotomy, ventriculotomy, enterotomy, intestinal resection and anastomosis, cloacoplasty, cloacopexy), respiratory (rhinolith removal, sinusotomy, tracheotomy, tracheal resection and anastomosis, tracheostomy, pneumonectomy) and reproductive (ovocentesis, ovariectomy, salpingohysterectomy, cesarean section, orchidectomy, vasectomy, phallectomy) systems are reviewed.

  1. Pentalogy of Cantrell: case report and review of the literature

    PubMed Central

    Bakhiet, Elghazali A; Elhag, Salma M M; Karrar, Mohamed Z

    2014-01-01

    Pentalogy of Cantrell is a syndrome that consists of five anomalies: a midline, upper abdominal wall abnormality; lower sternal defect; anterior diaphragmatic defect; diaphragmatic pericardial defect, and congenital abnormalities of the heart. The pathogenesis of this condition is not fully known yet, associations are common with this condition and treatment is extremely challenging. Prognosis and outcome depends on the type of the pentalogy of Cantrell and associated cardiac anomalies. It can be diagnosed reliably by antenatal ultrasound during the first trimester. We describe a Sudanese baby of undetermined sex who had the typical features of pentalogy of Cantrell and died shortly after birth. PMID:27493395

  2. Avoidance of a potential tracheoinnominate fistula by innominate artery re-implantation in a four year old girl with tracheostomy dependence and Pfeiffer syndrome.

    PubMed

    Olson, Michael D; Boesch, R Paul; Duncan, Audra A; Cofer, Shelagh A

    2016-02-01

    A 4 year old tracheostomy dependent girl with Pfeiffer syndrome was noted on bronchoscopy to have a pulsatile tracheostomal mass. CT chest angiography was consistent with the innominate artery crossing anterior to the trachea and superior to the sternal notch. The patient underwent reimplantation of the innominate artery via a median sternotomy approach. Tracheoinnominate fistula is a potentially devastating complication of tracheostomy. We report discovery of a near tracheoinnominate fistula in order to highlight the importance of regular interval surveillance endoscopy in tracheostomy dependent children and to discuss a preventative surgical intervention employed in prevention of this potentially devastating complication.

  3. [Light chain deposition disease as a cause of renal failure].

    PubMed

    Wohl, P; Chadimová, M; Englis, M; Táborský, P; Rossmann, P; Matl, I

    1998-11-30

    The objective of the paper is to draw attention to a rare cause of rapidly progressing renal failure which developed in the course of four months as a result of light chain deposition disease. The authors submit two case-histories of the disease assessed by renal biopsy after previous clinical and laboratory suspicion of monoclonal gammapathy. In one patient in the sternal punctate plasmacytoma was diagnosed and in the second case it was not possible to detect any type of monoclonal gammapathy or another possible cause of disease. Renal failure was in both cases irreversible and both patients were enlisted in regular haemodialyzation treatment.

  4. Non-intubated subxiphoid uniportal video-assisted thoracoscopic thymectomy using glasses-free 3D vision

    PubMed Central

    Jiang, Long; Liu, Jun; Shao, Wenlong; Li, Jingpei

    2016-01-01

    Trans-sternal thymectomy has long been accepted as the standard surgical procedure for thymic masses. Recently, minimally invasive methods, such as video-assisted thoracoscopic surgery (VATS) and, even more recently, non-intubated anesthesia, have emerged. These methods provide advantages including reductions in surgical trauma, postoperative associated pain, and in regards to VATS, provide certain cosmetic benefits. Considering these advantages, we herein present a case of subxiphoid uniportal VATS for thymic mass using a glasses-free 3D thoracoscopic display system. PMID:28149591

  5. Parathelphusa pardus, a new species of lowland freshwater crab from swamps in central Sumatra, Indonesia (Crustacea: Brachyura: Gecarcinucidae).

    PubMed

    Ng, Peter K L; Riady, Rikhi; Windarti, Windarti

    2016-02-29

    A new species of gecarcinucid freshwater crab of the genus Parathelphusa H. Milne Edwards, 1853, is described from freshwater swamp habitats in Pekanbaru, Riau Province, in central-eastern Sumatra, Indonesia. Parathelphusa pardus sp. nov., has a very distinctive colour pattern, and in this respect, resembles P. maindroni (Rathbun, 1902) from Sumatra and Peninsular Malaysia; P. batamensis Ng, 1992, from Batam Island, Indonesia; P. reticulata Ng, 1990, from Singapore; and P. oxygona Nobili, 1901, from western Sarawak. It can be distinguished from these species and congeners by a suite of carapace, ambulatory leg, thoracic sternal and most importantly, male first gonopod characters.

  6. Serial immobilization of a Brazilian tapir (Tapirus terrestrus) with oral detomidine and oral carfentanil.

    PubMed

    Pollock, Christal G; Ramsay, Edward C

    2003-12-01

    Detomidine (0.17 +/- 0.03 mg/kg, p.o.) followed in 20 min by carfentanil (7.88 +/- 1.85 microg/kg, p.o.) reliably restrained an adult Brazilian tapir (Tapirus terrestrus) eight times for short medical procedures. Detomidine caused head droop, sawhorse stance, ataxia or head pressing (or both). Sternal or lateral recumbency was reached within 10.75 +/- 7.6 min of carfentanil administration. Recoveries after i.v. and s.c. administration of yohimbine and naltrexone were smooth and rapid, with the tapir standing within 2-5 min.

  7. Ambaeolothrips: a new genus of Neotropical Aeolothripidae (Thysanoptera), with observations on the type-species from mango trees in Mexico.

    PubMed

    Mound, Laurence; Cavalleri, Adriano; O'donnell, Cheryle; Infante, Francisco; Ortiz, Antonio; Goldarazena, Arturo

    2016-06-30

    Ambaeolothrips gen. n. is diagnosed for three Neotropical species: the type species romanruizi Ruiz-De la Cruz et al. comb. n. from Mexico, microstriatus Hood comb. n. from Panama, and pampeanus sp. n. from southern Brazil. Variation is discussed among character states that are used in the generic classification of the family Aeolothripidae, including segmentation of the antennae and maxillary palps, sculpture of the metanotum and presence of sternal discal setae. New field observations on the biology of romanruizi indicate that this species is phytophagous in flowers and on leaves, with no evidence of predation on the larvae of other thrips.

  8. Scintigraphic and CT findings of Tietze's syndrome: Report of a case and review of the literature

    SciTech Connect

    Honda, N.; Machida, K.; Mamiya, T.; Takahashi, T.; Takishima, T.; Hasegawa, N.; Kamano, T.; Hashimoto, M.; Ohno, K.; Itoyama, S.; )

    1989-08-01

    A case of Tietze's syndrome is reported. A 43-year-old woman, who had experienced right anterior chest pain and tender swelling of the right first costosternal junction for seven months, showed increased accumulation of the right first, the right fourth, and the left first costochondral junction on bone imaging. Ga-67 imaging showed increased accumulation at the right first costosternal junction. CT showed sclerosis of the sternal manubrium, partial calcification of costal cartilage, and soft tissue swelling. Biopsy of the right first costal cartilage showed chronic inflammation with fibrosis and ossification. Increased uptake of bone gallium imaging is consistent with Tietze's syndrome.15 references.

  9. Breast implant foreign body reaction mimicking breast cancer recurrence on FDG PET/CT.

    PubMed

    Ulaner, Gary A; D'Andrea, Gabriella; Cody, Hiram S

    2013-06-01

    A woman with bilateral breast cancer treated with bilateral mastectomies, implant reconstructions, chemotherapy, and hormonal therapy underwent FDG PET/CT imaging. Imaging demonstrated sternal, nodal, and lung lesions which were stable or slowly increasing, as well as a parasternal chest wall mass which was enlarging much more rapidly and was excised. Pathology of the chest wall mass demonstrated only benign soft tissue with fat necrosis and foreign body giant cell reaction, without evidence of malignancy or implant rupture. This case demonstrates how a benign FDG-avid foreign body reaction, induced by an intact breast prosthesis, could easily be mistaken for malignancy.

  10. A new genus and new species of Potamidea (Crustacea: Decapoda: Brachyura: Potamoidae), the first stygomorphic cave crab known from China and East Asia.

    PubMed

    Huang, Chao; Shih, Hsi-Te; Ng, Peter K L

    2017-02-15

    A new genus and species of freshwater crab, Diyutamon cereum n. gen., n. sp., is described from a cave in Guizhou, China. This is the first record of a true stygomorphic crab from China and East Asia, possessing pale body coloration, strongly reduced eyes, and long ambulatory legs. While superficially similar to Chinapotamon Dai & Naiyanetr, 1994, and Tiwaripotamon Bott, 1970, the new genus possesses a diagnostic combination of carapace, ambulatory leg, thoracic sternal, and male abdominal characters that easily distinguishes it from other genera. Molecular data derived from the mitochondrial 16S rDNA supports the establishment of the new genus.

  11. Compression of the Right Ventricular Outflow Tract due to Straight Back Syndrome Clarified by Low-dose Dual-source Computed Tomography

    PubMed Central

    Hasegawa, Kohei; Takaya, Tomofumi; Mori, Shumpei; Ito, Tatsuro; Fujiwara, Sei; Nishii, Tatsuya; K Kono, Atsushi; Shimoura, Hiroyuki; Tanaka, Hidekazu; Hirata, Ken-ichi

    2016-01-01

    A 23-year-old asymptomatic woman was referred to our hospital for further examination of a systolic ejection murmur with fixed splitting of the second heart sound auscultated at the third left sternal border. Initial echocardiography could not detect the cause. Subsequently performed low-dose computed tomography, however, ruled out the possibility of any congenital heart diseases, but revealed a markedly shortened anteroposterior diameter of the chest, which led us to a diagnosis of straight back syndrome. A vertically oriented “pancake” appearance of the heart, straight vertebral column, and compression of the right ventricular outflow tract were clearly demonstrated on the reconstructed images. PMID:27853069

  12. An Intelligent Pattern Recognition System Based on Neural Network and Wavelet Decomposition for Interpretation of Heart Sounds

    DTIC Science & Technology

    2007-11-02

    sound Apex 1.13 2 S3 Apex 1.13 3 S4 Apex 0.9 4 Aortic stenosis Right base 0.9 5 Mitral regurgitation Apex 0.79 6 Midsystolic click Apex 1.13 7...Ventricular septal defect Lower left sternal border 0.9 8 Atrial septal defect Left base 0.9 9 Mitral stenosis Apex 1.13 10 Aortic regurgitation Mid...Number ARP (%) Normal heart sound 9 98 1 92 S3 10 99 -- -- S4 9 99 1 99 Aortic stenosis 10 99 -- -- Mitral regurgitation 10 99 -- -- Midsystolic

  13. An Archaeological an Bioarchaeological Perspective. The Tucker (41DT104) and Sinclair (41DT105) Cemeteries of Delta County, Texas

    DTIC Science & Technology

    1988-01-01

    scapula , the majority of the left clavicle minus the sternal articular sxirface, the left radial shaft, a 56 C.f.- -am% e. Fiue 4 ofi HrwrefomTcerCmeey a-e...were no caries or fillings observed. Neither thri canine nor the incisors exhibited the lingual ridging on the medial or distal border termed...the glenoid cavity of the left scapula , a piece of the right humeral shaft, portions of both humeral heads, a fragment of an ulna, a metacarpal and

  14. Treatment of winged scapula by pectoralis major transfer.

    PubMed

    Iceton, J; Harris, W R

    1987-01-01

    We report the transfer of the sternal part of the pectoralis major to the lower pole of the scapula in 15 patients with winged scapula. At follow-up after 1 to 16 years nine had a satisfactory result and were gainfully employed, though in four of these re-operation had been necessary. Two patients had fair results; the transplant functioned, but they had limited voluntary control. Four were failures: two had had paralysis of other shoulder girdle muscles in addition to the serratus anterior. The indications for the operation are discussed.

  15. New species of Dinychus Kramer, 1886 from fragments of the former Gondwanaland (Acari: Uropodina: Dinychidae).

    PubMed

    Kontschán, Jenő; Ripka, Géza

    2016-07-15

    We describe two new species of Dinychus Kramer, 1886 from fragments of the former Gondwanaland supercontinent. Dinychus indica sp. nov. from India belongs to the Dinychus woelkei-group It differs from the previously known Dinychus species on the basis of the sculptural pattern of the sternal and genital shields of female. The female of Dinychus chilensis sp. nov. from Chile has a quadrangular genital shield, which is a unique character state in the genus Dinychus. New keys to the Central and South American Dinychus and to Dinychus woelkei-group are presented.

  16. Management of severe asymmetric pectus excavatum complicating aortic repair in a patient with Marfan's syndrome.

    PubMed

    Yeung, Jonathan C; Marcuzzi, Danny; Peterson, Mark D; Ko, Michael A

    2016-05-01

    We describe the case of a 28-year old man with Marfan's syndrome and severe pectus excavatum who required an aortic root replacement for an ascending aortic aneurysm. There was a near-vertical angulation of the sternum that presented challenges with opening and exposure of the heart during aortic surgery. Furthermore, removal of the sternal retractor after aortic repair resulted in sudden loss of cardiac output. A Ravitch procedure was then performed to successfully close the chest without further cardiovascular compromise. We propose that patients with a severe pectus excavatum and mediastinal displacement seen on preoperative CT scanning should be considered for simultaneous, elective repair.

  17. Early subsidence of shape-closed hip arthroplasty stems is associated with late revision

    PubMed Central

    van der Voort, Paul; Pijls, Bart G; Nieuwenhuijse, Marc J; Jasper, Jorrit; Fiocco, Marta; Plevier, Josepha W M; Middeldorp, Saskia; Valstar, Edward R; Nelissen, Rob G H H

    2015-01-01

    Background and purpose Few studies have addressed the association between early migration of femoral stems and late aseptic revision in total hip arthroplasty. We performed a meta-regression analysis on 2 parallel systematic reviews and meta-analyses to determine the association between early migration and late aseptic revision of femoral stems. Patients and methods Of the 2 reviews, one covered early migration data obtained from radiostereometric analysis (RSA) studies and the other covered long-term aseptic revision rates obtained from survival studies with endpoint revision for aseptic loosening. Stems were stratified according to the design concept: cemented shape-closed, cemented force-closed, and uncemented. A weighted regression model was used to assess the association between early migration and late aseptic revision, and to correct for confounders. Thresholds for acceptable and unacceptable migration were determined in accordance with the national joint registries (≤ 5% revision at 10 years) and the NICE criteria (≤ 10% revision at 10 years). Results 24 studies (731 stems) were included in the RSA review and 56 studies (20,599 stems) were included in the survival analysis review. Combining both reviews for the 3 design concepts showed that for every 0.1-mm increase in 2-year subsidence, as measured with RSA, there was a 4% increase in revision rate for the shape-closed stem designs. This association remained after correction for age, sex, diagnosis, hospital type, continent, and study quality. The threshold for acceptable migration of shape-closed designs was defined at 0.15 mm; stems subsiding less than 0.15 mm in 2 years had revision rates of less than 5% at 10 years, while stems exceeding 0.15 mm subsidence had revision rates of more than 5%. Interpretation There was a clinically relevant association between early subsidence of shape-closed femoral stems and late revision for aseptic loosening. This association can be used to assess the safety of

  18. Cervical range of movement in relation to neck dimension.

    PubMed

    Reynolds, Jeremy; Marsh, D; Koller, Heiko; Zenenr, Juliane; Bannister, G

    2009-06-01

    The authors investigated the effect of neck dimension upon cervical range of motion. Data relating to 100 healthy subjects, aged between 20 and 40 years, were recorded with respect to age, gender and range of motion in three planes. Additionally, two widely used methods of measuring neck motion, chin-sternal distance and uniplanar goniometer, were assessed against a validated measurement tool, the 'CROM goniometer'. Using multiple linear regression analysis it was determined that sagittal flexion (P = 0.002) and lateral rotation (P < 0.0001) were most closely related to neck circumference alone whereas lateral flexion (P < 0.0001) was most closely related to a ratio of circumference and length of neck. Hence, assessing cervical range of motion as outcome variable or as a measure at posttreatment follow-up, neck circumference was shown to be one of the factors influencing total neck motion, particularly sagittal flexion and lateral tilt. Comparison of cervical range of motion assessed with a validated measurement tool, the CROM goniometer, with results of both frequently applied clinician's instruments, the uniplanar goniometer and measurement of chin-sternal distance, showed low reliability with the latter techniques, and motion values measured with these techniques should be interpreted with caution if using them for comparison of cervical range of motion of alike groups. We demonstrated that neck dimension should be incorporated into cervical functional outcome assessment and one should be wary about recorded values for neck motion from non-validated measurement tools.

  19. Comparison of objective and patient-reported hot flash measures in men with prostate cancer.

    PubMed

    Hanisch, Laura J; Palmer, Steven C; Marcus, Steven C; Hantsoo, Liisa; Vaughn, David J; Coyne, James C

    2009-01-01

    Hot flashes are one of the bothersome symptoms frequently experienced after endocrine treatments for breast and prostate cancers. Many studies have evaluated interventions for hot flashes, but results are obscured by methodologic limitations. We compared the performance of three techniques to measure hot flashes over 48 hours among 47 patients with prostate cancer undergoing androgen deprivation therapy to determine the feasibility and accuracy of each measure. Sternal skin conductance, electronic event marking, and twice daily diaries identified 478, 410, and 285 hot flashes, respectively. Diaries produced the lowest hourly hot flash rate (M = 0.17), which was significantly different from the rates of the objective profile (M = 0.28) and event marks (M = 0.23).The sensitivity and positive predictive value of the three measures demonstrated that the diaries underperformed, but these values did not exceed moderate levels for any measure (% = 28-59). Study results suggest the combined use of sternal skin conductance and event marking for the measurement of hot flash frequency in pathophysiologic studies and clinical trials with prostate cancer patients. Conversely, the use of retrospective diaries may be adequate for clinical practice to determine clinically significant changes in salient events.

  20. Acute venous thrombosis as complication and clue to diagnose a SAPHO syndrome case. A case report.

    PubMed

    Rosero, A; Ruano, R; Martin, M; Hidalgo, C; Garcia-Talavera, J

    2013-01-01

    This report concerns a male adult admitted for sternal and left arm pain, who was diagnosed and treated for acute deep venous thrombosis in the left subclavian and axillary veins. X-ray and a hybrid single photon emission tomography and computed tomography (SPECT-CT) scintigraphy scan revealed high intensity uptake in both sternoclavicular joints, which corresponded to hyperostosis, thereby suggesting a SAPHO syndrome. Upon reviewing the patient's medical history, we found dermatological pustulosis disease and an intermittent sternal chest pain untreated since 10 years ago. In the biochemical study we found erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) elevation, hyperglobulinemia, and mild anaemia. Initial treatment included nonsteroidal anti-inflammatory drugs (NSAIDs) with low response, which then changed to methotrexate, sulfasalazine, and prednisone. The patient's pain was controlled almost completely in 10 months. A control bone scan revealed a marked decrease in intensity of bone deposits according to clinical response. To our knowledge, there are only a few cases of SAPHO and thrombosis and none are followed up with a bone SPECT-CT scan.

  1. Morphological variations of the anterior thoracic skeleton and their forensic significance: radiographic findings in a Spanish autopsy sample.

    PubMed

    Macaluso, P James; Lucena, Joaquín

    2014-08-01

    The anterior thoracic skeleton may exhibit a number of morphological variations or anomalies, including accessory ossicles, atypical fusion or nonfusion of bony segments, and accessory foramina. Awareness of these minor skeletal variants is important in forensic medicine given that they may be mistakenly identified as pathological or traumatic lesions. The identification of subtle morphological anomalies may also aid in the process of individualization by serving as points of similarity if their occurrence was recorded antemortem. This study assessed the prevalence of anatomical variants of the sternum and ribs in a modern population from Spain, since the frequency of these skeletal anomalies differs between population groups. The occurrence of sternal clefts and foramina, bifurcated ribs, fusion of the manubriosternal and sternoxiphoidal junctions, and type of xiphoid process end was evaluated on posterior-anterior digital radiographs. None of the morphological variations were associated with sex or age, with the exception of two traits related to the xiphoid process. The xiphoid process was absent more often in younger individuals, particularly specimens below the age of 30 years, whereas, complete fusion of the sternoxiphoidal junction was more often observed in individuals above 50 years of age. However, these morphological variants are highly variable in the study sample and thus they have limited utility in forensic age estimation in the Spanish population. Nonetheless, the presence of various morphological anomalies such as sternal foramina, bifid ribs, and triple-ended xiphoid processes may provide information useful for establishing a personal identification.

  2. Computed tomography, radiology and echocardiography in cats naturally infected with Aelurostrongylus abstrusus.

    PubMed

    Lacava, Giuseppe; Zini, Eric; Marchesotti, Federica; Domenech, Oriol; Romano, Francesca; Manzocchi, Simone; Venco, Luigi; Auriemma, Edoardo

    2017-04-01

    Objectives The aims of the study were to describe the radiographic and computed tomographic features in cats naturally infected with Aelurostrongylus abstrusus, and to identify signs of pulmonary hypertension with echocardiography. Methods Fourteen cats positive on Baermann test for A abstrusus were included in the study. All cats underwent thoracic radiography, CT and echocardiography. Results The most common clinical signs were coughing (10/14) and dyspnoea (5/14). Radiographic findings included a generalised unstructured interstitial pulmonary pattern (8/14), mixed bronchointerstitioalveolar pattern (3/14) and bronchointerstitial pattern with bronchial wall thickening (3/14). Sternal lymphadenopathy was detected on thoracic radiographs in six cats. On CT, features were mixed bronchointerstitioalveolar pattern with ground-glass appearance in six cats, interstitioalveolar with multiple pulmonary nodules in five, interstitial ground-glass infiltrates in three, regional lymph node enlargement in 11 (10 sternal, three cranial mediastinal and three tracheobronchial lymph nodes) and subpleural thickening in four. None of the thoracic radiographs revealed subpleural thickening. In all cases, pulmonary vessels were normal in terms of size, shape and attenuation on both radiography and CT. Pulmonary hypertension and cardiac abnormalities were not observed in any cat during echocardiography. Conclusions and relevance CT provided a more thorough characterisation of pulmonary and mediastinal lesions compared with thoracic radiographs in cats naturally infected with A abstrusus. Although feline aelurostrongylosis has been previously associated with histopathological lesions in lung arteries, in this cohort clinical evidence of pulmonary hypertension was not documented.

  3. Clinical relevance of abnormal scintigraphic findings of adult equine ribs.

    PubMed

    Dahlberg, Jessica A; Ross, Michael W; Martin, Benson B; Davidson, Elizabeth J; Leitch, Midge

    2011-01-01

    Horses with cranial rib abnormalities may exhibit severe acute lameness and may have unusual gait deficits characterized by forelimb abduction during protraction at the walk. Horses with caudal rib abnormalities may resent being saddled and ridden. In a retrospective evaluation of 20 horses with a documented rib lesion, 25 sites of increased radiopharmaceutical uptake were found in one or more ribs. Thirteen (52%) scintigraphic lesions involved the first rib; four were located immediately dorsal to the sternal articulation, eight were near the costochondral junction and one was at the costovertebral junction. Six (24%) scintigraphic rib lesions involved ribs 2-8; one was located immediately dorsal to the sternal articulation, three were at the costovertebral junction and two were near the costochondral junction. Six (24%) scintigraphic rib lesions involved the mid-portion (five) or costovertebral junction (one) of ribs 9-18. The 20 horses were divided into three groups based on the clinical relevance of the scintigraphic findings. Group 1 (n=3) horses had clinical signs attributed to a rib abnormality; Group 2 (n=6) horses had a rib abnormality that was a plausible explanation for clinical signs; Group 3 (n=11) horses had clinical signs that could not be attributed to a rib abnormality. For horses with cranial rib abnormalities, a modified lateral scintigraphic image with the ipsilateral limb pulled caudally and a left (right) 45° caudal-right (left) radiograph facilitated the diagnosis.

  4. A review of 35 cases of asymmetric crying facies.

    PubMed

    Caksen, H; Odabaş, D; Tuncer, O; Kirimi, E; Tombul, T; Ikbal, M; Ataş, B; Ari Yuca, S

    2004-01-01

    A review of 35 cases of asymmetric crying facies: Congenital asymmetric crying facies (ACF) is caused by congenital hypoplasia or agenesis of the depressor anguli oris muscle (DAOM) on one side of the mouth. It is well known that this anomaly is frequently associated with cardiovascular, head and neck, musculoskeletal, respiratory, gastrointestinal, central nervous system, and genitourinary anomalies. In this article we report 35 ACF patients (28 children and 7 adults) and found additional abnormalities in 16 of them (i.e. 45%). The abnormalities were cerebral and cerebellar atrophy, mega-cisterna magna, mental motor retardation, convulsions, corpus callosum dysgenesis, cranial bone defect, dermoid cyst, spina bifida occulta, hypertelorism, micrognatia, retrognatia, hemangioma on the lower lip, short frenulum, cleft palate, low-set ears, preauricular tag, mild facial hypoplasia, sternal cleft, congenital heart defect, renal hypoplasia, vesicoureteral reflux, hypertrophic osteoarthropathy, congenital joint contractures, congenital hip dislocation, polydactyly, and umbilical and inguinal hernia. Besides these, one infant was born to a diabetic mother, and had atrial septal defect and the four other children had 4p deletion, Klinefelter syndrome, isolated CD4 deficiency and Treacher-Collins like facial appearance, respectively Although many of these abnormalities were reported in association with ACF, cerebellar atrophy, sternal cleft, cranial bone defect, infant of diabetic mother, 4p deletion, Klinefelter syndrome, isolated CD4 deficiency and Treacher-Collins like facial appearance were not previously published.

  5. Surgical treatment of tumours of the sternum – 10 years’ experience

    PubMed Central

    Kozak, Katarzyna; Białas, Adam; Rusinek, Michał; Kozak, Józef

    2016-01-01

    Introduction Tumours of the sternum are rare and can be malignant, benign or inflammatory. Aim To determine the clinical, pathological and therapeutic options for tumours of the sternum. Material and methods We report a series of 30 cases of sternal tumours treated in our institution in the period 2006–2015. There were 10 malignant tumours located in the body of the sternum, 2 in the manubrium (metastases of kidney and thyroid carcinoma) and 18 benign tumours located in different parts of the sternum. Diagnosis was obtained by computed tomography scan of the chest, surgical biopsy or excision of the tumours. Results Malignant tumours were excised radically. Reconstruction of the sternum was obtained by allogenic mesh (polypropylene) and local tissues (mainly pectoralis major muscle). There was 1 postoperative cardiac death. Patients with malignancy were referred for adjuvant chemoradiotherapy. After 2 years there were 4 cases of recurrence of chondrosarcoma (1 case of local recurrence and 3 cases of pulmonary metastases). Recurrence of other tumors were not observed. Conclusions The management of sternal tumours is dependent on the histological type and the possibility of surgical excision. Reconstruction of the chest wall can be achieved by autogenic or allogenic materials. PMID:27785134

  6. Chemical communication in termites: syn-4,6-dimethylundecan-1-ol as trail-following pheromone, syn-4,6-dimethylundecanal and (5E)-2,6,10-trimethylundeca-5,9-dienal as the respective male and female sex pheromones in Hodotermopsis sjoestedti (Isoptera, Archotermopsidae).

    PubMed

    Lacey, Michael J; Sémon, Etienne; Krasulová, Jana; Sillam-Dussès, David; Robert, Alain; Cornette, Richard; Hoskovec, Michal; Záček, Petr; Valterová, Irena; Bordereau, Christian

    2011-12-01

    The trail-following pheromone and sex pheromones were investigated in the Indomalayan termite Hodotermopsis sjoestedti belonging to the new family Archotermopsidae. Gas chromatography coupled to mass spectrometry (GC-MS) after solid phase microextraction (SPME) of the sternal gland secretion of pseudergates and trail-following bioassays demonstrated that the trail-following pheromone of H. sjoestedti was syn-4,6-dimethylundecan-1-ol, a new chemical structure for termite pheromones. GC-MS after SPME of the sternal gland secretion of alates also allowed the identification of sex-specific compounds. In female alates, the major sex-specific compound was identified as (5E)-2,6,10-trimethylundeca-5,9-dienal, a compound previously identified as the female sex pheromone of the termite Zootermopsis nevadensis. In male alates, the major sex-specific compound was identified as syn-4,6-dimethylundecanal, a homolog of syn-4,6-dimethyldodecanal, which has previously been confirmed as the male sex pheromone of Z. nevadensis. The presence of sex-specific compounds in alates of H. sjoestedti strongly suggests for this termite the presence of sex-specific pairing pheromones which were only known until now in Z. nevadensis. Our results showed therefore a close chemical relationship between the pheromones of the taxa Hodotermopsis and Zootermopsis and, in contrast, a clear difference with the taxa Stolotermes and Porotermes, which is in total agreement with the recent creation of the families Archotermopsidae and Stolotermitidae as a substitute for the former family Termopsidae.

  7. Effects of Bedding Material on the Lying Behavior in Stabled Horses

    PubMed Central

    NINOMIYA, Shigeru; AOYAMA, Masato; UJIIE, Yumiko; KUSUNOSE, Ryo; KUWANO, Atsutoshi

    2008-01-01

    The objective of this study was to investigate the effect of straw, sawdust, coconut husk (husk), and coconut fiber (fiber) on the welfare of stable horses by observing their resting behavior. Twenty horses with ages ranging from 3 to 21 years were used at the Equine Research Institute of the Japan Racing Association, Utsunomiya, Japan. Five horses were allocated to each bedding condition. The behavior of each horse was recorded by video camera for 3 days and was continuously sampled from 17:00 to 05:00. The total duration, the number of bouts, and the mean and the maximum duration of bouts in standing rest, sternal lying, and lateral lying were calculated and analysed by the Kruskal-Wallis test and post hoc Steel-Dwass test. There was no difference in the standing rest and the sternal lying among beddings. Significant differences were observed in these values in the lateral lying among the different beddings (P<0.05). The values of the means of the total duration, the number of bouts, and the mean and the maximum duration of bout in the lateral lying were greater when husk was used as the bedding material than when sawdust were used (P<0.05). The results of the observations show that the new bedding materials would be as usable as straw. However, lateral lying was observed less frequently when sawdust were used as bedding; this indicates that use of sawdust as bedding material will decrease the welfare of stabled horses. PMID:24833955

  8. Bone scan appearances following bone and bone marrow biopsy

    SciTech Connect

    McKillop, J.H.; Maharaj, D.; Boyce, B.F.; Fogelman, I.

    1984-01-01

    Bone marrow and bone biopsies are performed not infrequently in patients referred for bone scans and represent a potential cause of a ''false positive'' focal abnormality on the bone scan. The authors have therefore examined the scan appearances in a series of patients who had undergone either sternal marrow biopsy, (Salah needle, diameter 1.2 mm) trephine iliac crest marrow biopsy (Jamshidi 11 gauge needle, diameter 3.5 mm) or a transiliac bone biopsy (needle diameter 8 mm). Of 18 patients studied 1 to 45 days after sternal marrow 17 had normal scan appearances at the biopsy site and 1 had a possible abnormality. None of 9 patients studied 4 to 19 days after trephine iliac crest marrow biopsy had a hot spot at the biopsy site. A focal scan abnormality was present at the biopsy site in 9/11 patients studied 5 to 59 days after a trans iliac bone biopsy. No resultant scan abnormality was seen in 4 patients imaged within 3 days of the bone biopsy or in 3 patients imaged 79 to 138 days after the procedure. Bone marrow biopsy of the sternum or iliac crest does not usually cause bone scan abnormalities. A focal abnormality at the biopsy site is common in patients imaged 5 days to 2 months after bone biopsy. The gauge of the needle employed in the biopsy and thus the degree of bone trauma inflicted, is likely to be main factor determining the appearance of bone scan abnormalities at the biopsy site.

  9. Nonadecadienone, a new termite trail-following pheromone identified in Glossotermes oculatus (Serritermitidae).

    PubMed

    Hanus, Robert; Šobotník, Jan; Krasulová, Jana; Jiroš, Pavel; Žáček, Petr; Kalinová, Blanka; Dolejšová, Klára; Cvačka, Josef; Bourguignon, Thomas; Roisin, Yves; Lacey, Michael J; Sillam-Dussès, David

    2012-01-01

    Within the multitude of chemical signals used by termites, the trail marking by means of pheromones is ubiquitous. Chemistry and biology of the trail-following communication have been described in more than 60 species from all families except for the Neotropical Serritermitidae. The chemical ecology of Serritermitidae is of special interest not only as a missing piece of knowledge on the diversity and evolution of isopteran pheromones but also because it may contribute to the debate on the phylogenetic position of this family, which is still unresolved. Therefore, we aimed in this study to identify the trail-following pheromone of the serritermitid Glossotermes oculatus. Based on a combined approach of analytical chemistry, electrophysiology, and behavioral bioassays, we propose (10Z,13Z)-nonadeca-10,13-dien-2-one to be the trail-following pheromone of G. oculatus, secreted by the sternal gland of pseudergates. Thus, we report on a new termite trail-following pheromone of an unexpected chemical structure, a ketone with 19 carbons, contrasting with unsaturated alcohols containing 12 carbons as trail-following pheromones in other advanced termite families. In addition to this unique trail-following pheromone, we also describe the sternal gland in pseudergates as an organ of unusual shape, size, and structure when compared with other isopteran species. These results underline the peculiarity of the family Serritermitidae and prompt our interest in the chemistry of pheromones in the other genus of the family, Serritermes.

  10. Atypical Fracture of the Sternum After Long-Term Alendronate Plus Cholecalciferol Treatment: A Case Report.

    PubMed

    Martín Arias, Luis H; García Ortega, Pilar; Sáinz Gil, María; Navarro García, Ester; Treceño Lobato, Carlos; Delgado Armas, Virginia

    2017-12-01

    A 55-year-old woman developed an atraumatic sternum fracture during treatment with alendronate for osteoporosis. The woman received alendronate 70 mg in combination with cholecalciferol 5600 IU once weekly, as well as nonsteroidal anti-inflammatory drugs. After 4 years of treatment, following a dorsal flexion with no direct thoracic trauma, the patient suffered a fracture of the sternum, with an X-ray revealing sternal body fracture. This fracture was seen to be transverse, noncomminuted and without displacement. Magnetic resonance imaging was carried out to rule out the presence of either a pathological fracture or a fracture resulting from osteoporotic fragility, and showed a triple sternal fracture involving the body, as well as the upper and lower manubrium of the sternum. This fracture presented the features of an atypical femur fracture, except for the location. The alendronate and cholecalciferol combination was discontinued and denosumab was prescribed. After the withdrawal of alendronate, the patient showed clinical improvement, with a decrease in pain, and is currently having routine checkups. The causality algorithm of the Spanish Pharmacovigilance System shows a score of 5, indicating a possible relationship between the patient's sternum fracture and her use of the suspect drug (Naranjo scale 6 = probable).

  11. A prospective randomized multicenter trial shows improvement of sternum related complications in cardiac surgery with the Posthorax support vest.

    PubMed

    Gorlitzer, Michael; Wagner, Florian; Pfeiffer, Steffen; Folkmann, Sandra; Meinhart, Johann; Fischlein, Theodor; Reichenspurner, Hermann; Grabenwöger, Martin

    2010-05-01

    Sternal instability, dehiscence and mediastinitis are major causes of morbidity and mortality in cardiac surgery. The aim of this analysis is to determine the effect of a Posthorax support vest (Epple Inc, Vienna, Austria) after median sternotomy. One thousand five hundred and sixty cases were included in a prospective randomized multicenter trial. Patients were randomized as follows: 905 received a flexible dressing postoperatively (group A) and 655 patients were given a Posthorax support vest (group B). Patients in groups A and B were well matched. Their mean age was 68 years (range: 34-87 years). The patient characteristics and operative data were equally distributed in both groups. The mean total hospital stay was significantly shorter in group B than in group A (A: 17.33+/-17.5; B: 14.76+/-7.7; P=0.04). Sternal wound complications necessitating reoperation during the 90 days follow-up period were observed in 4.5%. Reoperation rates were as follows: 3.9% in group A and 0.6% in group B (P<0.05). The use of the Posthorax sternum support vest is a valuable adjunct to prevent sternum-related complications after cardiac surgery. In the 90 days follow-up period, additional surgical procedures were significantly reduced by the use of the support vest.

  12. Non-reducible collagen cross-linking in cartilage from broiler chickens with tibial dyschondroplasia.

    PubMed

    Orth, M W; Leach, R M; Vailas, A C; Cook, M E

    1994-01-01

    Recent work has shown that hydroxylysylpyridinoline (HP), a non-reducible cross-link that stabilizes the collagen fibril network, is significantly greater (over 10-fold) in dyschondroplastic cartilage than in normal growth-plate cartilage in the tibiotarsi of chickens with homocysteine-induced tibial dyschondroplasia (TD). In the present study, broiler chicks with a genetic disposition to TD, as well as normal broiler chicks on a copper-deficient diet alone or supplemented with copper and thiram, were raised for 3 to 4 weeks (Expts. 1 and 2). Their dyschondroplastic cartilage from the proximal tibiotarsus was collected and analyzed for HP as well as lysylpyridinoline (LP) cross-links. Normal growth plate cartilage was obtained from chicks on the copper-deficient diet supplemented with copper. In a third experiment, another set of broiler chicks was raised on a corn/soybean meal-based diet with or without homocysteine, and their articular and sternal cartilage were isolated for cross-link analysis. In the first two experiments, dyschondroplastic cartilage from all birds with induced TD had higher HP and LP concentrations than growth-plate cartilage from birds without TD, although the ratios of HP to LP varied. In the third experiment, the sternal and articular cartilage from birds with homocysteine-induced TD appeared normal, having similar HP concentrations in the same types of cartilage in birds without TD.

  13. Age-at-death estimation based on radiological and image analysis methods in clavicle in a current Spanish population.

    PubMed

    Benito, María; Sánchez, José Antonio; Codinha, Sónia

    2014-05-01

    Age-at-death estimation in adult individuals is one of the most challenging issues in forensic anthropology, namely, due to the large age intervals provided by the current methods, which demand the development of more reliable investigations. The clavicle has been studied as an age-at-death indicator in many researches for its accessibility, low biomechanical implication in locomotion and accuracy to predict age at death when other age indicators are not available. The present study was developed on a sample of 332 clavicles from adult individuals of known sex and age from the current Spanish population. They were x-rayed and digitalized, in a standardized way, using a Sedecal X-ray generator, model SHF 415. Three indices were calculated at the mid-diaphysis point (anterior index, posterior index, and total index) which relate the cortical thickness and the total clavicle thickness to age at death. The average grey level was also calculated in a 0.5-cm(2) area of the sternal and acromial ends (sternal grey average, acromial grey average), using Image J software. The data were subjected to a statistical analysis, using SPSS, version 15.0. The results show that average grey level has a weaker correlation with age than the variables which are based on the cortical thickness. On the other hand, the regression equations, which were calculated combining all the variables, provided smaller age-at-death intervals, demonstrating the usefulness of this method for adult age-at-death estimation in forensic anthropology.

  14. VAC therapy for the treatment of complex wounds after cardio-thoracic surgery.

    PubMed

    De Caridi, Giovanni; Serra, Raffaele; Massara, Mafalda; Barone, Mario; Grande, Raffaele; Butrico, Lucia; Mastroroberto, Pasquale; de Franciscis, Stefano; Monaco, Francesco

    2016-10-01

    The aim of this study is to report our experience about the treatment of complex sternal and thoracic wounds following cardiothoracic surgery, using vacuum-assisted closure (VAC therapy. Twelve patients presenting with sternal (five cases) and thoracic (seven cases) wounds that were difficult to heal were treated through VAC therapy after the first surgical debridement. The duration of VAC application ranged from 12 to 36 days with an average hospital stay of 24·6 ± 11·4 days. During a mean follow-up of 12 months, we observed complete wound healing in seven cases (58·3%), in an average period of 25·5 ± 14·3 days; one patient died during follow-up, two patients were lost to follow-up and two patients required definitive surgical closure of the wound cavity. In conclusion, VAC therapy promotes faster wound healing, with shorter hospital stay and subsequent lesser in-hospital cost, reducing the mortality rate in the long run. It also promotes early rehabilitation and alleviates the need for a second procedure, thus improving patient satisfaction, with minimal discomfort or inconvenience.

  15. Robotic-assisted mitral valve repair: surgical technique.

    PubMed

    Algarni, Khaled D; Suri, Rakesh M; Daly, Richard C

    2014-01-01

    Robotic-assisted mitral valve repair represents the least invasive surgical approach currently available for anatomical mitral valve repair in patients with myxomatous mitral valve disease. Standard mitral valve repair techniques utilized during conventional sternotomy/right thoracotomy are exactly replicated with the robotic instrumentation through 1-2 cm port-like incisions with superior 3D visualization. This is performed on cardiopulmonary bypass by peripheral cannulation of the femoral vessels/right internal jugular vein. The ascending aorta is occluded with a transthoracic aortic cross-clamp. Antegrade cardioplegia is delivered centrally into the aortic root through a cardioplegia vent catheter. By replicating conventional mitral valve repair done via an open sternotomy approach, the quality of mitral valve repair is ensured while providing the patients with advantages of less invasive surgery including shorter hospital stay, rapid recovery and return to normal activities, less blood transfusion, superior cosmesis and complete elimination of sternotomy-related morbidities such as deep sternal wound infection and sternal dehiscence. We reviewed the first consecutive 200 patients undergoing robotic mitral valve repair at Mayo Clinic Rochester between 24 January 2008 and 28 January 2011. Successful mitral valve repair was completed in all patients. There were no early (30-day) deaths. One patient suffered a stroke (0.5%). One patient required reoperation for bleeding (0.5%). Two patients (1%) required reoperation for recurrent mitral regurgitation. Twelve patients (6%) required transfusion of allogeneic blood products. We have noted a significant reduction in operative times and resource utilization over time.

  16. Stature estimation in a contemporary Japanese population based on clavicular measurements using multidetector computed tomography.

    PubMed

    Torimitsu, Suguru; Makino, Yohsuke; Saitoh, Hisako; Sakuma, Ayaka; Ishii, Namiko; Yajima, Daisuke; Inokuchi, Go; Motomura, Ayumi; Chiba, Fumiko; Yamaguchi, Rutsuko; Hashimoto, Mari; Hoshioka, Yumi; Iwase, Hirotaro

    2017-03-08

    The aims of this study was to assess the correlation between stature and clavicular measurements in a contemporary Japanese population using three-dimensional (3D) computed tomographic (CT) images, and to establish regression equations for predicting stature. A total of 249 cadavers (131 males, 118 females) underwent postmortem CT scanning and subsequent forensic autopsy between October 2011 and May 2016 in our department. Four clavicular variables (linear distances between the superior margins of the left and right sternal facets to the anterior points of the left and right acromial ends and between the superior margins of the left and right sternal facets to the left and right conoid tubercles) were measured using 3D CT reconstructed images that extracted only bone data. The correlations between stature and each of the clavicular measurements were assessed with Pearson product-moment correlation coefficients. These clavicular measurements correlated significantly with stature in both sexes. The lowest standard error of estimation value in all, male, and female subjects was 3.62cm (r(2)=0.836), 3.55cm (r(2)=0.566), and 3.43cm (r(2)=0.663), respectively. In conclusion, clavicular measurements obtained from 3D CT images may be useful for stature estimation of Japanese individuals, particularly in cases where better predictors, such as long bones, are not available.

  17. Development of the turtle plastron, the order-defining skeletal structure.

    PubMed

    Rice, Ritva; Kallonen, Aki; Cebra-Thomas, Judith; Gilbert, Scott F

    2016-05-10

    The dorsal and ventral aspects of the turtle shell, the carapace and the plastron, are developmentally different entities. The carapace contains axial endochondral skeletal elements and exoskeletal dermal bones. The exoskeletal plastron is found in all extant and extinct species of crown turtles found to date and is synaptomorphic of the order Testudines. However, paleontological reconstructed transition forms lack a fully developed carapace and show a progression of bony elements ancestral to the plastron. To understand the evolutionary development of the plastron, it is essential to know how it has formed. Here we studied the molecular development and patterning of plastron bones in a cryptodire turtle Trachemys scripta We show that plastron development begins at developmental stage 15 when osteochondrogenic mesenchyme forms condensates for each plastron bone at the lateral edges of the ventral mesenchyme. These condensations commit to an osteogenic identity and suppress chondrogenesis. Their development overlaps with that of sternal cartilage development in chicks and mice. Thus, we suggest that in turtles, the sternal morphogenesis is prevented in the ventral mesenchyme by the concomitant induction of osteogenesis and the suppression of chondrogenesis. The osteogenic subroutines later direct the growth and patterning of plastron bones in an autonomous manner. The initiation of plastron bone development coincides with that of carapacial ridge formation, suggesting that the development of dorsal and ventral shells are coordinated from the start and that adopting an osteogenesis-inducing and chondrogenesis-suppressing cell fate in the ventral mesenchyme has permitted turtles to develop their order-specific ventral morphology.

  18. Fatal Scopulariopsis infection in a lung transplant recipient: lessons of organ procurement.

    PubMed

    Shaver, C M; Castilho, J L; Cohen, D N; Grogan, E L; Miller, G G; Dummer, J S; Gray, J N; Lambright, E S; Loyd, J E; Robbins, I M

    2014-12-01

    Seventeen days after double lung transplantation, a 56-year-old patient with idiopathic pulmonary fibrosis developed respiratory distress. Imaging revealed bilateral pulmonary infiltrates with pleural effusions and physical examination demonstrated sternal instability. Broad-spectrum antibacterial and antifungal therapy was initiated and bilateral thoracotomy tubes were placed. Both right and left pleural cultures grew a mold subsequently identified as Scopulariopsis brumptii. The patient underwent pleural irrigation and sternal debridement three times but pleural and wound cultures continued to grow S. brumptii. Despite treatment with five antifungal agents, the patient succumbed to his illness 67 days after transplantation. Autopsy confirmed the presence of markedly invasive fungal disease and pleural rind formation. The patient's organ donor had received bilateral thoracostomy tubes during resuscitation in a wilderness location. There were no visible pleural abnormalities at the time of transplantation. However, the patient's clinical course and the location of the infection, in addition to the lack of similar infection in other organ recipients, strongly suggest that Scopulariopsis was introduced into the pleural space during prehospital placement of thoracostomy tubes. This case of lethal infection transmitted through transplantation highlights the unique risk of using organs from donors who are resuscitated in an outdoor location.

  19. [Mediastinitis after sternotomy. Mortality and hospital length of stay. Groupe parisien détude des sternotomies].

    PubMed

    Lucet, J C; Batisse, D; Brücker, G

    1997-04-01

    The morbidity of deep sternal wound infections after sternotomy was assessed by a case-controlled study. The 41 cases were identified by a prospective enquiry over 4 months in 10 centres of cardiac surgery in the Paris region. The cases were compared with 41 non-infected controls, paired by centre, age, gender, ASA anaesthetic risk, stage of cardiac failure and type of surgery. The criteria of pairing were respected in 96% of cases. The mortality was 12% in the study population and 5% in the controls. Thirty-two of the 41 cases required reoperation for the sternal wound infection, usually to insert Redon drains after debridement of the wound. The total duration of the hospital stay was 53 days in the study cases and 30 days in controls, a median prolongation of the hospital stay of 23 days. The authors conclude that deep wound infection after sternotomy is responsible for almost doubling the duration of hospital stay. The economic consequences alone justify active research into the prevention of this complication.

  20. Pressure distribution under three different types of harnesses used for guide dogs.

    PubMed

    Peham, C; Limbeck, S; Galla, K; Bockstahler, B

    2013-12-01

    The aim of this study was to evaluate the pressure distribution under three different types of harnesses used for guide dogs (designated H1, H2 and H3). The dogs (n = 8) led a trainer through a course including a range of exercises (straight line, curve left, curve right, upstairs and downstairs). All dogs were clinically sound and showed no sign of lameness. The pressures beneath the harnesses were determined by sensor strips and related to the gait. In all harnesses, the highest pressures were found in the right sternal region (H1 2.02 ± 0.6N/cm(2); H2 1.76 ± 0.4N/cm(2); H3 1.14 ± 0.5 N/cm(2)). In all other regions, the pressures were in the range of 0-1.32 N/cm(2). The right and left sternal regions were almost constantly loaded. Contrary to previous assumptions, the back regions had minimal loading. This investigation demonstrated that there were significant differences among the harnesses.

  1. Therapy-related myelodysplastic syndrome and acute myeloid leukemia following chemotherapy (paclitaxel and carboplatin) and radiation therapy in ovarian cancer: a case report.

    PubMed

    Ishikawa, M; Nakayama, K; Rahman, M T; Rahman, M; Katagiri, H; Katagiri, A; Ishibashi, T; Iida, K; Nakayama, N; Miyazaki, K

    2014-01-01

    In recent years, the incidence of therapy-related myelodysplastic syndrome (t-MDS) and therapy-related acute myeloid leukemia (t-AML) that occur during chemotherapy for ovarian cancer has increased. While alkylating agents and topoisomerase II inhibitors are particularly mutagenic and have strong leukemogenic potential, paclitaxel and combination chemotherapy/radiation therapy also appear to induce t-MDS. The present authors report a case of t-MDS that developed during chemotherapy and radiation therapy for ovarian cancer. The patient was a 75-year-old woman who received six courses of cyclophosphamide/doxorubicin/cisplatin (CAP) therapy after initial surgery for Stage IIIc grade ovarian cancer in 1995. Beginning in February 2005, the patient experienced multiple recurrences due to sternal metastasis. Chemotherapy, including paclitaxel and carboplatin (TC), was administered intermittently and was combined with radiation therapy to a sternal metastatic lesion. Pancytopenia was observed in December 2008, and she was diagnosed with t-MDS (WHO subtype, refractory cytopenias with multilineage dysplasia [RCMD]): the time from first chemotherapy to t-MDS onset was 106 months. Without evidence of blast crisis, the recurrent lesions continued to grow and caused multiple cerebral infarctions, from which she eventually died. The cumulative doses of paclitaxel and carboplatin administered to this patient were 1,968 mg and 6,480 mg, respectively.

  2. Enterococcus faecium Mediastinitis Complicated by Disseminated Candida parapsilosis Infection after Congenital Heart Surgery in a 4-Week-Old Baby

    PubMed Central

    Renk, Hanna; Neunhoeffer, Felix; Hölzl, Florian; Hofbeck, Michael; Kumpf, Matthias

    2015-01-01

    Background. Cardiac surgery offers multiple treatment options for children with congenital heart defects. However, infectious complications still remain a major cause of morbidity and mortality in these patients. Mediastinitis is a detrimental complication in children undergoing cardiac surgery. The risk of mediastinitis after delayed sternal closure is up to 10%. Case Presentation. We report a case of Enterococcus faecium mediastinitis in a 4-week-old female baby on extracorporeal membrane oxygenation after Norwood procedure. Although repeated antibiotic irrigation, debridement, and aggressive antibiotic treatment were started early, the pulmonary situation deteriorated. Candida parapsilosis was isolated from bronchoalveolar lavage after pulmonary hemorrhage. Disseminated C. parapsilosis infection with pulmonary involvement was treated with liposomal amphotericin B. Subsequently, inflammatory markers increased again and eventually C. parapsilosis was isolated from the central venous catheter. Conclusion. Children undergoing delayed sternal closure have a higher risk of mediastinitis. Therefore, antibiotic prophylaxis, for example, for soft tissue infection seems justified. However, long-term antibiotic treatment is a risk factor for fungal superinfection. Antifungal treatment of disseminated C. parapsilosis infection may fail in PICU patients with nonbiological material in place due to capacity of this species to form biofilms on medical devices. Immediate removal of central venous catheters and other nonbiological material is life-saving in these patients. PMID:26605096

  3. A comparison of two morphine doses on the quality of recovery from general anaesthesia in horses.

    PubMed

    Chesnel, M A; Clutton, R E

    2013-12-01

    Previous studies indicated that perioperative morphine improves recovery quality after general anaesthesia in horses. This clinical trial investigated whether this effect was dose-dependant. Twenty-six horses anaesthetised for surgery were block-randomised to receive one of two intraoperative morphine treatments: Treatment M1 consisted of a constant rate infusion (CRI) of morphine at 0.1mg/kg/h, begun after a loading dose (LD) of 0.15 mg/kg. Treatment M2 was a CRI of 0.2mg/kg/h preceded by an LD of 0.3mg/kg. During recovery, times at the first attempt and at achieving sternal recumbency and standing, and the total recovery duration were not different between groups. Total recovery quality score was not significantly different between groups. Scores for the "sternal phase" were higher (of poorer quality) for M2 but scores in both groups were low. Morphine doses of M2, which are greater than those described previously, do not appear to alter or improve the quality or duration of recovery in horses after surgical anaesthesia.

  4. Pectoralis Major Tear: An Unusual and Rare Presentation

    PubMed Central

    Kadu, Vikram V; Saindane, K A; Godghate, Ninad; Godghate, Neha

    2016-01-01

    Introduction: The pectoralis major is a very powerful muscle that forms the chest prominence and. It moves the shoulder forward and across your chest. It is best known as the muscle that you develop with the bench press exercise in gymnasium. The pectoralis major attaches to the humerus bone and is divided into two parts. The upper part is known as the “clavicular head” and the lower part the “sternal head,” based on their origins from the clavicle and sternal bones, respectively. Ruptures of the pectoralis major muscle are becoming more common due to the increase in power sports weight training. Case Report: A About 25-year-old male presented to Out Patient Department with bruising and swelling over the anterior wall of left axilla. The patient was engineer and amateur weight lifter. Clinically, the swelling was tender, and movements of left arm were restricted. Muscle tear was suspected and hence magnetic resonance imaging (MRI) was advised which showed tear of tendon of pectoralis major muscle. The patient was treated surgically and has got full range of movements of the arm. Conclusion: MRI is the mainstay for diagnosing pectoralis major tear. The earlier a repair is performed the easier the surgery and the better the outcome of surgery. PMID:27299117

  5. [Basic research of applying extracorporeal shockwaves on the musculoskeletal system. An assessment of current status].

    PubMed

    Maier, M; Milz, S; Wirtz, D C; Rompe, J D; Schmitz, C

    2002-07-01

    Detailed knowledge concerning the action of extracorporeal shock waves on the locomotor system as well as concerning possible side effects of extracorporeal shock wave therapy (ESWT) are crucial to optimize the clinical use of ESWT for the treatment of illnesses such as calcific tendinitis of the shoulder, tennis elbow, plantar fasciitis, aseptic pseudarthrosis, and aseptic hip necrosis. This study presents the current knowledge gained from animal experiments, which have yielded important findings, in particular concerning possible side effects of ESWT. Very recent studies have also provided valuable insights into the molecular actions of extracorporeal shock waves on the locomotor system. Further intensified experimental animal research will greatly improve the scientific basis for the clinical use of ESWT in the near future.

  6. Gadopentetate-dimeglumine-enhanced MR imaging of osteonecrosis and osteochondritis dissecans of the elbow: initial experience.

    PubMed

    Peiss, J; Adam, G; Casser, R; Urhahn, R; Günther, R W

    1995-01-01

    Magnetic resonance imaging (MRI) was performed on seven patients with aseptic osteonecrosis (n = 4) and osteochondritis dissecans (OCD; n = 3) of the elbow. Precontrast MRI was superior to plain radiographs, which did not show any abnormality in three cases of osteonecrosis. On gadopentetate-dimeglumine-enhanced T1-weighted images, which were obtained in three patients with osteonecrosis and three patients with OCD, all cases of osteonecrosis demonstrated homogeneous enhancement of the lesions. All cases of OCD were diagnosed on plain radiographs. On MRI one showed significant enhancement of the loose body. In another case an incompletely enhancing loose body was surrounded by a diffusely enhancing region. In the third patient only a small marginal enhancement of the defect was observed. Our results suggest that MRI can improve the accuracy in diagnosis of aseptic osteonecrosis of the elbow. The use of gadopentetate dimeglumine allows the viability of the lesions or the loose bodies to be demonstrated and reparative tissue to be detected.

  7. Recurrent meningitis in a child with IgG3 subclass deficiency.

    PubMed

    Vehapoglu, Aysel; Ozgurhan, Gamze; Demir, Aysegul Dogan; Uzuner, Selcuk; Nursoy, Mustafa Atilla; Turkmen, Serdar

    2014-08-01

    Recurrent meningitis is an uncommon life-threatening condition. Here, the case of a 6-year-old boy is reported who had two episodes of meningitis with an IgG3 subclass deficiency. The boy had aseptic meningitis at the age of 3 years, followed by bacterial meningitis at the age of 4 years. Primary immunoglobulin deficiencies are a group of disorders associated with an increased incidence and/or severity of infection. Recurrent infections, sinusitis, bronchitis, and pneumonia are the most frequently observed illnesses in patients with IgG subclass deficiencies, of which an IgG3 subclass deficiency is the most common, especially in adults. Although cases of recurrent viral or bacterial meningitis have been reported, herein a patient is presented with recurrence of aseptic and bacterial meningitis 1 year after the initial episode. Some researchers recommend that all children with episodes of recurrent meningitis should be screened for primary immunoglobulin or complement deficiencies.

  8. In vitro plant development and root colonization of Coleus forskohlii by Piriformospora indica.

    PubMed

    Das, Aparajita; Tripathi, Swati; Varma, Ajit

    2014-03-01

    The present study was conducted for optimization of in vitro substrates under aseptic conditions for interaction of Piriformospora indica with the medicinal plant Coleus forskohlii. It aims to test the effects of different substrates on P. indica colonization as well as growth parameters of the in vitro raised C. forskohlii. Interaction of in vitro C. forskohlii with root endophyte P. indica under aseptic condition resulted in increase in growth parameters in fungus colonized plants. It was observed that P. indica promoted the plant's growth in all irrespective of substrates used for co-culture study. The growth was found inferior in liquid compared to semisolid medium as well as there was problem of hyperhydricity in liquid medium. P. indica treated in vitro plantlets were better adapted for establishment under green house compared to the non treated plants due to fungal intervention.

  9. Nineteen year results of THA using modular 9 mm S-ROM femoral component in patients with small femoral canals.

    PubMed

    Drexler, Michael; Dwyer, Tim; Marmor, Meir; Abolghasemian, Mansour; Chakravertty, Rajesh; Chechik, Ofir; Cameron, Hugh U

    2013-10-01

    A retrospective analysis was undertaken of 30 consecutive THA performed in 25 patients with hypoplastic proximal femurs, who had received a 9-mm uncemented modular S-ROM stem. The mean patient age was 42 years (17-69 years), mean height was 152.5 cm (130-170.5 cm), mean weight was 63 kg (39-90 kg), and mean follow-up period was 19 years (range, 12-23 years). Subsidence was seen in 2 hips, with asymptomatic femoral osteolysis present in 11 hips; overall survival of the femoral stem was 93.3%, with two revisions of the femoral component required for aseptic loosening. After a mean follow-up of 19 years, the use of the S-ROM 9 mm femoral stem in the patient with the small femur was associated with a low revision rate due to aseptic loosening of the stem.

  10. [The Brill-Zinsser disease still occurs in Croatia: retrospective analysis of 25 hospitalized patients].

    PubMed

    Turcinov, Drago; Kuzman, Ilija; Puljiz, Ivan

    2002-10-01

    The article presents epidemiological, clinical, laboratory and therapeutic characteristics of Brill-Zinsser disease (BZD). A total of 25 cases of BZD were retrospectively analyzed during the period from January 1, 1980 through December 31, 2000, and etiology was confirmed by rickettsial complement-fixation test (CFT). The majority of cases 15 (60%) quoted history of primary attack of epidemic typhus during or after the World War II. During the course of the disease in our patients different organic systems were involved. Aseptic meningitis was verified in 21 (84%) patients, rash in 17 (68%), liver lesion in 14 (56%), pneumonitis in 7 (28%), myopericarditis in 7 (28%) and 5 (20%) had renal lesion. Not a single clinical symptom or finding of disease has a diagnostic particularity. However, long term fever, headache, rash and aseptic meningitis, or information of infestation with lice in childhood, or a history of epidemic typhus should arouse a suspicion of this disease, which still occurs in Croatia.

  11. Mars Analog Rio Tinto Experiment (MARTE): 2003 Drilling Campaign to Search for a Subsurface Biosphere at Rio Tinto Spain

    NASA Technical Reports Server (NTRS)

    Stoker, Carol; Dunagan, Stephen; Stevens, Todd; Amils, Ricardo; Gomez-Elvira, Javier; Fernandez, David; Hall, James; Lynch, Kennda; Cannon, Howard; Zavaleta, Jhony

    2004-01-01

    The MARTE (Mars Astrobiology Research and Technology Experiment) project, an ASTEP field experiment, is exploring for a hypothesized subsurface anaerobic chemoautotrophic biosphere in the region of the Tinto River- or Rio Tinto- in southwestern Spain. It is also demonstrating technology needed to search for a subsurface biosphere on Mars. The project has three primary objectives: (1) search for and characterize subsurface life at Rio Tinto along with the physical and chemical properties and sustaining energy sources of its environment, (2) perform a high fidelity simulation of a robotic Mars drilling mission to search for life, and (3) demonstrate the drilling, sample handling, and instrument technologies relevant to searching for life on Mars. The simulation of the robotic drilling mission is guided by the results of the aseptic drilling campaign to search for life at Rio Tinto. This paper describes results of the first phase of the aseptic drilling campaign.

  12. Comparative surface morphology of marine coelomic gregarines (Apicomplexa, Urosporidae): Pterospora floridiensis and Pterospora schizosoma.

    PubMed

    Landers, Stephen C; Leander, Brian S

    2005-01-01

    Two species in the aseptate gregarine genus Pterospora from the Pacific and Gulf coasts were analyzed by scanning electron microscopy, which revealed characteristics not reported in other gregarines. The gamonts of these species had branching trunks that ended in terminal digits, and both species moved by cytoplasmic streaming and peristalsis. Pterospora floridiensis had surface pits and tracts of parallel ridges that bended and connected with one another. Pterospora schizosoma had irregular-shaped surface swellings that were usually arranged in rosette patterns. These unique surface features have not been reported for other gregarines, and are strikingly different from the surface features of many septate and aseptate gregarines that inhabit the intestinal lumena of their hosts and move by gliding. The correlation of Pterospora's unique pellicular features to the habitat and cytoplasmic streaming characteristic of the genus may be significant, and may reflect an adaptation for development in coelomic environments.

  13. Observation on Monocystis constricta n. sp. (Protozoa: Apicomplexa: Monocystidae) from an Indian earthworm, Eutyphoeus quaripapillatus Michelsen, 1907.

    PubMed

    Bandyopadhyay, Probir K; Mitra, Amlan Kumar; Göçmen, Bayram

    2009-01-01

    A biodiversity survey of aseptate gregarines in earthworm hosts in the Calcutta district of West Bengal State revealed the existence of a new species of aseptate gregarine under the genus Monocystis Stein, 1848. The monocystid gregarines obtained from the earthworm host, Eutyphoeus quaripapillatus Michelsen, 1907 have been identified as a new species. The mucron was indistinct. The gamonts are elongated, ovoid, have a hood like structure at the anterior end and measure 150.1-212.4 (188.1+/-2.1) micromx66.1-112.1 (72.3+/-1.1) microm. The gametocysts are ellipsoid and measure 92.3-136.3 microm (111.2+/-2.1)x78.3-114.4 microm (82.6+/-3.6) microm. Prominent syzygy was apparent. Oocysts are navicular, measuring 14.1-22.3 (18.1+/-3.2) micromx9.1-15.2 (11.9+/-1.1) microm.

  14. Sequential technetium-99m HMDP-gallium-67 citrate imaging for the evaluation of infection in the painful prosthesis

    SciTech Connect

    Merkel, K.D.; Brown, M.L.; Fitzgerald, R.H. Jr.

    1986-09-01

    In order to evaluate the clinical utility of sequential technetium-99m HMDP-gallium-67 scanning in patients with painful orthopedic prosthesis, a retrospective review was made of 154 sequential scans performed in 130 patients. Criteria for a positive study included spatially incongruent gallium-technetium uptake or gallium uptake that was congruent but more intense than technetium. Images were interpreted as negative if gallium was congruent and less intense than technetium. Sixty-six patients underwent surgery (31 infected, 35 aseptic), and 64 were evaluated clinically (3 infected, 61 aseptic). The combined results of the surgical and nonsurgical patients yielded a sensitivity of 66%, a specificity of 81%, and an accuracy of 77%. In this series, the technetium-gallium scan combination has proven to be helpful but more recent techniques such as indium-111-labeled leukocytes may prove to be superior to sequential technetium-gallium imaging.

  15. The effect of obesity on mechanical failure after total knee arthroplasty

    PubMed Central

    Fessy, Michel-Henri

    2015-01-01

    “Increased aseptic tibial failures in patients with a BMI ≥35 and well-aligned total knee arthroplasties” published in The Journal of Arthroplasty on July 2, 2015 draws the conclusion that the risk of revision total knee arthroplasties (TKA) due to aseptic tibial component loosening is two times greater in patients with a BMI ≥35 kg/m2, independent of age or limb alignment. This result confirms that obese patients are at a higher risk of mechanical complications after performing TKA, independently from the risk of infection. This study suggests that the management of obese patients for TKA must be meticulous, careful, and should inspire from great bone deformations in valgus of varus when choosing implants. PMID:26697470

  16. [The daily life of patients at the Hôtel-Dieu in Lyon in the nineteenth century].

    PubMed

    Bel, Jean-Christophe; Feireisen, Marie; Fessy, Michel-Henri; Broussolle, Christiane; Neidhardt, Jean-Pierre Hano; Ferrandis, Jean-Jacques

    2015-01-01

    In 1802 the Hôtel-Dieu in Lyons was incorporated in the so-called Hospices Civils de Lyon. This allowed the expansion and renovation of buildings, as well as the improvement of the conditions of hygiene and comfort of the patients. This hospital was devoted only to the most severely ill or injured adults. 1100 patients were treated by seven doctors, a main surgeon and his deputy, residents and sisters. Broadly speaking the evolution of surgery can be divided into two periods: that of before anesthesia and septic surgery and that of antiseptic and aseptic surgery. We have to mention Gensoul and the resection of the maxillary before anesthesia, Bonnet and Ollier who were devoted to osteo-articular surgery (Ollier's disease), Poncet who built the first aseptic theater, Jaboulay and the resident Carrel who were transplantation's pioneers, Bouveret (paroxysmal tachycardia and Bouveret syndrome), Destot who did the first medical use of X-rays in 1895.

  17. Innate immunity sensors participating in pathophysiology of joint diseases: a brief overview.

    PubMed

    Gallo, Jiri; Raska, Milan; Konttinen, Yrjo T; Nich, Christophe; Goodman, Stuart B

    2014-01-01

    The innate immune system consists of functionally specialized "modules" that are activated in response to a particular set of stimuli via sensors located on the surface or inside the tissue cells. These cells screen tissues for a wide range of exogenous and endogenous danger/damage-induced signals with the aim to reject or tolerate them and maintain tissue integrity. In this line of thinking, inflammation evolved as an adaptive tool for restoring tissue homeostasis. A number of diseases are mediated by a maladaptation of the innate immune response, perpetuating chronic inflammation and tissue damage. Here, we review recent evidence on the cross talk between innate immune sensors and development of rheumatoid arthritis, osteoarthritis, and aseptic loosening of total joint replacements. In relation to the latter topic, there is a growing body of evidence that aseptic loosening and periprosthetic osteolysis results from long-term maladaptation of periprosthetic tissues to the presence of by-products continuously released from an artificial joint.

  18. Molecular characterization of enteroviruses associated with neurological infections in Spain, 2008.

    PubMed

    Cabrerizo, M; Trallero, G; Echevarría, J E; Moreno-Docón, A; Pena, M J; Pérez-Ruiz, M; Avellón, A; de Ory, F

    2013-11-01

    In order to investigate the etiology of viral neurological infections in Spain, a national study was performed in 2008. The results obtained have been published. Enteroviruses were the most frequent cause of the aseptic meningitis and infant febrile syndromes. The present report supplements the previous study with the genotyping of the detected enteroviruses. Typing was by amplification of partial VP1 region and sequencing in 70 (53%) of the 132 available cerebrospinal fluid samples positive for enteroviruses. Twelve different genotypes within the B species were identified. Echovirus 4 was predominant (24%), followed by echovirus 30 (19%), echovirus 9 (17%), and echovirus 6 (14%). In summary, a co-circulation of several enterovirus types associated with meningitis in children under 15 years old was observed. Although infrequently detected, echovirus 4 was the predominant genotype identified due to an aseptic meningitis outbreak which occurred in the Canary Islands in 2008.

  19. Fully-automated roller bottle handling system for large scale culture of mammalian cells.

    PubMed

    Kunitake, R; Suzuki, A; Ichihashi, H; Matsuda, S; Hirai, O; Morimoto, K

    1997-01-20

    A fully automatic and continuous cell culture system based on roller bottles is described in this paper. The system includes a culture rack storage station for storing a large number of roller bottles filled with culture medium and inoculated with mammalian cells, mass-handling facility for extracting completed cultures from the roller bottles, and replacing the culture medium. The various component units of the system were controlled either by a general-purpose programmable logic controller or a dedicated controller. The system provided four subsequent operation modes: cell inoculation, medium change, harvesting, and medium change. The operator could easily select and change the appropriate mode from outside of the aseptic area. The development of the system made large-scale production of mammalian cells, and manufacturing and stabilization of high quality products such as erythropoietin possible under total aseptic control, and opened up the door for industrial production of physiologically active substances as pharmaceutical drugs by mammalian cell culture.

  20. A Pilot Study on Effects of Hydraulic Dredging and Disposal on Water Quality of the Upper Mississippi River (July 1976). GREAT I Water Quality Work Group

    DTIC Science & Technology

    1976-07-01

    followed by a hexane rinse followed by thorough drying) but were not sterile. Aseptic technique was employed only after the samples . were collected...variety of sampling techniques . The study took place at river mile 827 on the Upper Mississippi River immediately down- steam of the Minneapolis-St. Paul...dredging and disposal using a variety of sampling techniques . The study took place at river mile 827 on the Upper Mississippi River immediately downstream