Dunne, Ben; Murphy, Mark; Skiba, Rohen; Wang, Xiao; Ho, Kwok; Larbalestier, Robert; Merry, Christopher
2016-05-01
Deep sternal wound infection is a devastating complication of cardiac surgery. In the current era of increasing patient comorbidity, newer techniques must be evaluated in attempts to reduce the rates of deep sternal wound infection. A randomized controlled trial comparing sternal closure with traditional sternal wires in figure-8 formation with the Pioneer cabling system® from Medigroup after adult cardiac surgery was performed. A total of 273 patients were enrolled with 137 and 135 patients randomized to sternal wires and cables group, respectively. Baseline characteristics between the two groups were well balanced. Deep sternal wound infection occurred in 0.7% of patients in the wires group and 3.7% of patients in the cables group (absolute risk difference = -3.0%, 95% confidence interval: -7.7 to 0.9%; P = 0.12). Patients in the cables group were extubated slightly earlier than those in the sternal wires group postoperatively (9.7 vs 12.8 h; P = 0.03). There was, however, no significant difference in hospital and follow-up pain scores or analgesia requirements. The Pioneer sternal cabling system appears to facilitate early extubation after adult cardiac surgery, but it does not reduce the rate of deep sternal infectionAustralian New Zealand Clinical Trials Registry: ANZCTR-ACTRN12615000973516. © The Author 2016. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.
Dunne, Ben; Murphy, Mark; Skiba, Rohen; Wang, Xiao; Ho, Kwok; Larbalestier, Robert; Merry, Christopher
2016-01-01
OBJECTIVES Deep sternal wound infection is a devastating complication of cardiac surgery. In the current era of increasing patient comorbidity, newer techniques must be evaluated in attempts to reduce the rates of deep sternal wound infection. METHODS A randomized controlled trial comparing sternal closure with traditional sternal wires in figure-8 formation with the Pioneer cabling system® from Medigroup after adult cardiac surgery was performed. RESULTS A total of 273 patients were enrolled with 137 and 135 patients randomized to sternal wires and cables group, respectively. Baseline characteristics between the two groups were well balanced. Deep sternal wound infection occurred in 0.7% of patients in the wires group and 3.7% of patients in the cables group (absolute risk difference = −3.0%, 95% confidence interval: −7.7 to 0.9%; P = 0.12). Patients in the cables group were extubated slightly earlier than those in the sternal wires group postoperatively (9.7 vs 12.8 h; P = 0.03). There was, however, no significant difference in hospital and follow-up pain scores or analgesia requirements. CONCLUSIONS The Pioneer sternal cabling system appears to facilitate early extubation after adult cardiac surgery, but it does not reduce the rate of deep sternal infection Australian New Zealand Clinical Trials Registry: ANZCTR—ACTRN12615000973516. PMID:26912576
Is sternal rewiring mandatory in surgical treatment of deep sternal wound infections?
Rashed, Aref; Gombocz, Karoly; Alotti, Nasri; Verzar, Zsofia
2018-04-01
Deep sternal wound infections (DSWIs) are a rare but serious complication after median sternotomy, and treatment success depends mainly on surgical experience. We compared treatment outcomes after conventional sternal rewiring and reconstruction with no sternal rewiring in patients with a sternal wound infection. We retrospectively enrolled patients who developed a DSWI after an open-heart procedure with median sternotomy at the Department of Cardiac Surgery, at the St. Rafael Hospital, Zalaegerszeg, Hungary, between 2012 and 2016. All patients received negative pressure wound and antibiotic therapy before surgical reconstruction. Patients were divided into groups determined by the reconstruction technique and compared. Subjects were followed up for 12 months, and the primary end-points were readmission and 90-day mortality. Among 3,177 median sternotomy cases, 60 patients developed a DSWI, 4 of whom died of sepsis before surgical treatment. Fifty-six patients underwent surgical reconstruction with conventional sternal rewiring (23 cases, 41%) or another interventions with no sternal refixation (33 cases, 59%). Eighty-one percent of sternal wound infections followed coronary bypass surgery (alone or combinated with another procedures), and 60% were diagnosed after hospital discharge. Staphylococcus aureus was cultured in 30% of all wounds and, 56.5% of cases reconstructed by sternal rewiring vs. 26.5% with no sternal rewiring, (P=0.022). Hospital readmission occurred in 63.6% of the sternal rewiring group vs. 14.7% of the no sternal rewiring group. The rate of death before wound healing or the 90 th postoperative day was 21.7% in the sternal rewiring group vs. 0% in the no sternal rewiring group. The median hospital stay was longer in the sternal rewiring group than in the other group (51 vs. 30 days, P=0.006). Sternal rewiring may be associated with a higher rate of treatment failure than other forms of treatment for sternal wound infections.
Paria, Nandina; Cho, Tae-Joon; Choi, In Ho; Kamiya, Nobuhiro; Kayembe, Kay; Mao, Rong; Margraf, Rebecca L.; Obermosser, Gerlinde; Oxendine, Ila; Sant, David W.; Song, Mi Hyun; Stevenson, David A.; Viskochil, David H.; Wise, Carol A.; Kim, Harry K.W.; Rios, Jonathan J
2014-01-01
Neurofibromatosis type 1 (NF1) is an autosomal dominant disease caused by mutations in NF1. Among the earliest manifestations is tibial pseudoarthrosis and persistent nonunion after fracture. To further understand the pathogenesis of pseudoarthrosis and the underlying bone remodeling defect, pseudoarthrosis tissue and cells cultured from surgically resected pseudoarthrosis tissue from NF1 individuals were analyzed using whole-exome and whole-transcriptome sequencing as well as genomewide microarray analysis. Genomewide analysis identified multiple genetic mechanisms resulting in somatic bi-allelic NF1 inactivation; no other genes with recurring somatic mutations were identified. Gene expression profiling identified dysregulated pathways associated with neurofibromin deficiency, including phosphoinosital-3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) signaling pathways. Unlike aggressive NF1-associated malignancies, tibial pseudoarthrosis tissue does not harbor a high frequency of somatic mutations in oncogenes or other tumor-suppressor genes, such as p53. However, gene expression profiling indicates pseudoarthrosis tissue has a tumor-promoting transcriptional pattern, despite lacking tumorigenic somatic mutations. Significant over-expression of specific cancer-associated genes in pseudoarthrosis highlights a potential for receptor tyrosine kinase inhibitors to target neurofibromin-deficient pseudoarthrosis and promote proper bone remodeling and fracture healing. PMID:24932921
Sternal plate fixation for sternal wound reconstruction: initial experience (Retrospective study)
2011-01-01
Background Median sternotomy infection and bony nonunion are two commonly described complications which occur in 0.4 - 5.1% of cardiac procedures. Although relatively infrequent, these complications can lead to significant morbidity and mortality. The aim of this retrospective study is to evaluate the initial experience of a transverse plate fixation system following wound complications associated with sternal dehiscence with or without infection following cardiac surgery. Methods A retrospective chart review of 40 consecutive patients who required sternal wound reconstruction post sternotomy was performed. Soft tissue debridement with removal of all compromised tissue was performed. Sternal debridement was carried using ronguers to healthy bleeding bone. All patients underwent sternal fixation using three rib plates combined with a single manubrial plate (Titanium Sternal Fixation System®, Synthes). Incisions were closed in a layered fashion with the pectoral muscles being advanced to the midline. Data were expressed as mean ± SD, Median (range) or number (%). Statistical analyses were made by using Excel 2003 for Windows (Microsoft, Redmond, WA, USA). Results There were 40 consecutive patients, 31 males and 9 females. Twenty two patients (55%) were diagnosed with sternal dehiscence alone and 18 patients (45%) with associated wound discharge. Thirty eight patients went on to heal their wounds. Two patients developed recurrent wound infection and required VAC therapy. Both were immunocompromised. Median post-op ICU stay was one day with the median hospital stay of 18 days after plating. Conclusion Sternal plating appears to be an effective option for the treatment of sternal wound dehiscence associated with sternal instability. Long-term follow-up and further larger studies are needed to address the indications, benefits and complications of sternal plating. PMID:21529357
Gucu, Arif; Toktas, Faruk; Eris, Cuneyt; Ata, Yusuf; Turk, Tamer
2012-01-01
Postoperative sternal dehiscence is a potentially catastrophic sequela to median sternotomy that can cause not only chest-wall discomfort and pulmonary dysfunction but infection, both superficial and mediastinal. Nitinol thermoreactive clips use a novel material in the treatment of sternal dehiscence. We sought to determine whether the use of these clips is an effective remedy for noninfective sternal dehiscence. From January 2008 through December 2011, we retrospectively studied the data on 10 patients whose sternums had been closed with nitinol thermoreactive clips after the development of noninfective sternal dehiscence. Diagnosis was made on the bases of clinical criteria, chest radiography, and microbiological investigation. There was no control group. No procedure-related sequelae occurred. There was no recurrent sternal instability and dehiscence, sternal-related hemorrhage, superficial wound infection, or mediastinal infection. We believe that the use of nitinol thermoreactive clips is a safe, easy, and efficient method of secondary sternal closure for noninfective sternal dehiscence. PMID:22949767
Kirbas, Ahmet; Celik, Sezai; Gurer, Onur; Yildiz, Yahya; Isik, Omer
2011-01-01
Osteoporosis, a major risk factor for sternum-related morbidity after median sternotomy, is quite prevalent among the elderly. In this prospective study, we investigated the potential of sternal protection by use of the "sternal wrapping method" in elderly osteoporotic patients who were undergoing median sternotomy.For this study, we chose 100 elderly osteoporotic patients who were scheduled to undergo median sternotomy. During surgery, we wrapped the sternal edges with polyvinyl chloride tubing in 50 patients (group 1) and omitted the sternal wrapping in the remaining 50 patients (group 2). We then compared the groups with regard to postoperative pain, bleeding, early and late sternum-related morbidity, sternal fractures, and duration of hospitalization.Sternal wrapping was associated with fewer sternal fractures, less chest pain, and shorter hospital stays. Overall sternal morbidity was significantly less common among patients with sternal wrapping (4% vs. 20%, P = 0.03); however, the difference in individual rates for early and late dehiscence or deep sternal infection did not reach statistical significance.Sternal wrapping using polyvinyl chloride tubes provides mechanical protection and, apparently, less postoperative chest pain and shorter hospitalizations. Probably, it reduces sternum-related complications, particularly in high-risk patients. Its benefits, however, should be confirmed in larger studies.
Kirbas, Ahmet; Celik, Sezai; Gurer, Onur; Yildiz, Yahya; Isik, Omer
2011-01-01
Osteoporosis, a major risk factor for sternum-related morbidity after median sternotomy, is quite prevalent among the elderly. In this prospective study, we investigated the potential of sternal protection by use of the “sternal wrapping method” in elderly osteoporotic patients who were undergoing median sternotomy. For this study, we chose 100 elderly osteoporotic patients who were scheduled to undergo median sternotomy. During surgery, we wrapped the sternal edges with polyvinyl chloride tubing in 50 patients (group 1) and omitted the sternal wrapping in the remaining 50 patients (group 2). We then compared the groups with regard to postoperative pain, bleeding, early and late sternum-related morbidity, sternal fractures, and duration of hospitalization. Sternal wrapping was associated with fewer sternal fractures, less chest pain, and shorter hospital stays. Overall sternal morbidity was significantly less common among patients with sternal wrapping (4% vs 20%, P = 0.03); however, the difference in individual rates for early and late dehiscence or deep sternal infection did not reach statistical significance. Sternal wrapping using polyvinyl chloride tubes provides mechanical protection and, apparently, less postoperative chest pain and shorter hospitalizations. Probably, it reduces sternum-related complications, particularly in high-risk patients. Its benefits, however, should be confirmed in larger studies. PMID:21494519
Placement of trans-sternal wires according to an ellipsoid pressure vessel model of sternal forces.
Casha, Aaron R; Manché, Alex; Gauci, Marilyn; Camilleri-Podesta, Marie-Therese; Schembri-Wismayer, Pierre; Sant, Zdenka; Gatt, Ruben; Grima, Joseph N
2012-03-01
Dehiscence of median sternotomy wounds remains a clinical problem. Wall forces in thin-walled pressure vessels can be calculated by membrane stress theory. An ellipsoid pressure vessel model of sternal forces is presented together with its application for optimal wire placement in the sternum. Sternal forces were calculated by computational simulation using an ellipsoid chest wall model. Sternal forces were correlated with different sternal thicknesses and radio-density as measured by computerized tomography (CT) scans of the sternum. A comparison of alternative placement of trans-sternal wires located either at the levels of the costal cartilages or the intercostal spaces was made. The ellipsoid pressure vessel model shows that higher levels of stress are operative at increasing chest diameter (P < 0.001). CT scans show that the thickness of the sternal body is on average 3 mm and 30% thicker (P < 0.001) and 53% more radio-dense (P < 0.001) at the costal cartilage levels when compared with adjacent intercostal spaces. This results in a decrease of average sternal stress from 438 kPa at the intercostal space level to 338 kPa at the costal cartilage level (P = 0.003). Biomechanical modelling suggests that placement of trans-sternal wires at the thicker bone and more radio-dense level of the costal cartilages will result in reduced stress.
Operative treatment of sternal fractures.
Al-Qudah, Abdullah
2006-10-01
Four patients with displaced sternal fractures complained of intractable pain following road traffic accidents. They all had bone deformities, but only one had associated traumatic injuries. All patients underwent operative reduction and fixation of the fractured sternum using a T-shaped compression-tension stainless steel plate and screws. Pain relief was often dramatic and all patients progressed to sternal union. None required reoperation. No infections occurred. Two plates have subsequently been removed. On follow-up, all patients had excellent results. Sternal plating, which is based on the tension-band principle, is an effective treatment for displaced sternal fractures.
Failure analysis of explanted sternal wires.
Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che
2005-05-01
To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires.
Treatment of sternal nonunion with the Dall-Miles cable system.
Eich, B S; Heinz, T R
2000-10-01
We have used this technique in two patients. One had early sternal dehiscence with presternal infection, and the other had late sternal nonunion. Uncomplicated sternal union was achieved in both patients. The cables were nonpalpable in both patients, but they were removed in one patient at that patient's request. This method of using Dall-Miles cerclage cables is a straightforward and efficacious method of open reduction and internal fixation of the sternum. It is indicated for patients with chronic sternal nonunion or early postoperative separation of the sternal fragments and may be used even in the presence of an infection limited to the presternal space after adequate debridement and irrigation have been performed. Any recurrent superficial infection, although unlikely, can be cured by hardware removal after osseous union has been obtained. For sternal separation without fractures, four cables may simply be placed around the sternal halves and their tension increased. In the case of sternal fractures, the cables may be placed in figures of eight or in other woven configurations as needed for each individual case.
Pedicled Sensate Composite Calcaneal Flap in Children With Congenital Tibial Pseudoarthrosis.
Mongon, Mauricio L D; Ribera, Fernando C; de Souza, Antonio M A; Sposito, Aurelio L; Belangero, William D; Livani, Bruno
2017-06-01
The preservation and functionality of a limb affected by a malformation (such as congenital pseudoarthrosis of the tibia) or a severely mangled lower limb in children, despite modern reconstructive techniques, remains challenging, often eventually requiring amputation to achieve a better outcome. The classical Syme and Boyd procedures are functionally better than transtibial (TT) amputation, but are not feasible for congenital tibial pseudoarthrosis. TT amputation delivers an excellent, effective, and functional stump that usually leads, after prosthetization, to a functional gait. Unfortunately, in some situations, particularly when amputation is performed conventionally, the stump is also associated with complications. Future surgical revisions are often needed, particularly in children, because of stump overgrowth. Between 2008 and 2010, three patients diagnosed with congenital pseudoarthrosis of the tibia associated with neurofibromatosis who were indicated for TT amputation with calcaneal flap after failure of all previous surgical reconstructive procedures were selected. The chosen method for osteosynthesis was an external fixator of Ilizarov. At 12 weeks of follow-up, the stump had healed in all three patients, and tibiocalcaneal fusion was achieved without complications. All patients were prosthetized and had an asymptomatic gait. After a minimum follow-up of 6 years, all three cases with the pedicled sensate composite calcaneal flap still had a strong, full weight-bearing surface and have adapted easily to the conventional prosthesis, providing a painless stump with excellent functionality. With a 0 rate of needed revisions, all 3 cases with the pedicled sensate composite calcaneal flap preserving the hind foot still have a strong, full weight-bearing surface and have easily adapted to the conventional prosthesis, providing a painless and excellent functional stump that could last a lifetime. Level IV.
Novel Sternal Protection Device for Cardiac Surgery Via Median Sternotomy Incision.
Marasco, Silvana F; McGiffin, David C; Zimmet, Adam D; Solis, Pablo C; Bingham, Judy M; Moshinsky, Randall A
Sternal bleeding during cardiac surgery is currently controlled using bone wax or other chemical substances that may result in adverse effects and affect wound healing and recovery. The purpose of this study was to identify a safe, cost-effective, and easy-to-use technique to reduce sternal bleeding and sternal trauma during cardiac surgery. After sternotomy, a sternal protection device was placed over each hemisternal section before insertion of the retractor and remained in situ until the end of surgery. Sternal bleeding and ease of use were assessed and recorded during surgery. Sternal trauma was assessed and recorded within 5 minutes of removal of the device, and overall satisfaction (Global Impression) and any intraoperative adverse events or device malfunction were reported at surgery completion. Patients were followed up 24 hours and 4 weeks after surgery. Twelve patients completed the study. Adverse events reported were not considered related to the device. No sternal trauma was identified in any patient. In 9 of 11 patients, sternal bleeding was reduced after insertion of the device. The device was generally considered easy to use, although some difficulty was encountered when used with the Internal Mammary Artery retractor. Our data suggest that the device is safe and able to reduce sternal bleeding during surgery using sternal retractors. We recommend further studies in a larger population of patients with a control group to evaluate the device's ability to reduce the morbidity associated with sternal bleeding and sternal trauma.
Novel Sternal Protection Device for Cardiac Surgery Via Median Sternotomy Incision
Marasco, Silvana F.; McGiffin, David C.; Zimmet, Adam D.; Solis, Pablo C.; Bingham, Judy M.; Moshinsky, Randall A.
2017-01-01
Objective Sternal bleeding during cardiac surgery is currently controlled using bone wax or other chemical substances that may result in adverse effects and affect wound healing and recovery. The purpose of this study was to identify a safe, cost-effective, and easy-to-use technique to reduce sternal bleeding and sternal trauma during cardiac surgery. Methods After sternotomy, a sternal protection device was placed over each hemisternal section before insertion of the retractor and remained in situ until the end of surgery. Sternal bleeding and ease of use were assessed and recorded during surgery. Sternal trauma was assessed and recorded within 5 minutes of removal of the device, and overall satisfaction (Global Impression) and any intraoperative adverse events or device malfunction were reported at surgery completion. Patients were followed up 24 hours and 4 weeks after surgery. Results Twelve patients completed the study. Adverse events reported were not considered related to the device. No sternal trauma was identified in any patient. In 9 of 11 patients, sternal bleeding was reduced after insertion of the device. The device was generally considered easy to use, although some difficulty was encountered when used with the Internal Mammary Artery retractor. Conclusions Our data suggest that the device is safe and able to reduce sternal bleeding during surgery using sternal retractors. We recommend further studies in a larger population of patients with a control group to evaluate the device's ability to reduce the morbidity associated with sternal bleeding and sternal trauma. PMID:29023352
Postoperative sternal dehiscence in obese patients: incidence and prevention.
Molina, J Ernesto; Lew, Rachel Saik-Leng; Hyland, Kasi J
2004-09-01
Obesity has been identified as the single most important risk factor for postoperative sternal infection in coronary bypass surgery patients. It is also a major risk factor for sternal dehiscence, with or without infection, for any type of cardiac operation. We assessed whether prophylactic measures could prevent this complication. Two studies were conducted. In study A, 3,158 heart surgery patients were analyzed at 3 cardiac units. Obesity was defined as body mass index (BMI) more than 30. Group I (1,253 obese [39.7%]) was compared with group II (1,905 nonobese [60.3%]). Sternal closure was done at the surgeon's preference: (a) plain wires through and through the bone; (b) peristernal figure-of-eight wires; or (c) peristernal method, using stainless-steel cables. In study B, 123 obese patients were prospectively divided into 2 subgroups. Group B-1 (54 patients) underwent lateral prophylactic sternal reinforcement before placement of peristernal wires. Group B-2 (69 patients) had standard sternal closure, as in study A. In study A, group I had 81 dehiscences (6.46%); 78 also suffered deep sternal infection and mediastinitis (96%). Despite treatment, dehiscence recurred in 13, and mortality was 38.4%. In group II nonobese patients, 31 dehisced (1.6%, p = 0.000), with no mortality. In study B, group B-1 (54) had 0% dehiscence versus group B-2 (69) with 6 dehiscences (8.7%). In our study, the rate of obesity is high ( approximately 40%). Sternal dehiscence is real when the BMI is more than 30 (6.46%), and has high morbidity and mortality. Prophylactic sternal reinforcement seems to prevent this complication.
Sternal approximation for bilateral anterolateral transsternal thoracotomy for lung transplantation.
McGiffin, David C; Alonso, Jorge E; Zorn, George L; Kirklin, James K; Young, K Randall; Wille, Keith M; Leon, Kevin; Hart, Katherine
2005-02-01
The traditional incision for bilateral sequential lung transplantation is the bilateral anterolateral transsternal thoracotomy with approximation of the sternal fragments with interrupted stainless steel wire loops; this technique may be associated with an unacceptable incidence of postoperative sternal disruption causing chronic pain and deformity. Approximation of the sternal ends was achieved with peristernal cables that passed behind the sternum two intercostal spaces above and below the sternal division, which were then passed through metal sleeves in front of the sternum, the cables tensioned, and the sleeves then crimped. Forty-seven patients underwent sternal closure with this method, and satisfactory bone union occurred in all patients. Six patients underwent removal of the peristernal cables: 1 for infection (with satisfactory bone union after the removal of the cables), 3 for cosmetic reasons, 1 during the performance of a median sternotomy for an aortic valve replacement, and 1 in a patient who requested removal before commencing participation in football. This technique of peristernal cable approximation of sternal ends has successfully eliminated the problem of sternal disruption associated with this incision and is a useful alternative for preventing this complication after bilateral lung transplantation.
Improvement of sternal closure stability with reinforced steel wires.
McGregor, Walter E; Payne, Maryann; Trumble, Dennis R; Farkas, Kathleen M; Magovern, James A
2003-11-01
Sternal dehiscence occurs when steel wires pull through sternal bone. This study tests the hypothesis that closure stability can be improved by jacketing sternal wires with stainless steel coils, which distribute the force exerted on the bone over a larger area. Midline sternotomies were performed in 6 human cadavers (4 male). Two sternal closure techniques were tested: (1) approximation with six interrupted wires, and (2) the same closure technique reinforced with 3.0-mm-diameter stainless steel coils that jacket wires at the lateral and posterior aspects of the sternum. Intrathoracic pressure was increased with an inflatable rubber bladder placed beneath the anterior chest wall, and sternal separation was measured by means of sonomicrometry crystals. In each trial, intrathoracic pressure was increased until 2.0 mm of motion was detected. Differences in displacement pressures between groups were examined at 0.25-mm intervals using the paired Student's t test. The use of coil-reinforced closures produced significant improvement in sternal stability at all eight displacement levels examined (p < 0.03). Mean pressure required to cause displacement increased 140% (15.5 to 37.3 mm Hg) at 0.25 mm of separation, 103% (34.3 to 69.8 mm Hg) at 1.0 mm of separation, and 122% (46.8 to 103.8 mm Hg) at 2.0 mm of separation. Reinforcement of sternal wires with stainless steel coils substantially improves stability of sternotomy closure in a human cadaver model.
Estimation of stature from sternal lengths. A correlation meta-analysis.
Yammine, Kaissar; Assi, Chahine
2017-01-01
Methods based on the positive linear relationship existing between stature and long bones are most commonly used to estimate living stature in forensic anthropology. The length of the sternum and its parts has been advanced as a plausible alternative to estimate stature when such long bones are missing or damaged. This meta-analysis aims to quantify evidence on the correlation between the sternum/sternal parts length and stature. Nine studies were included with 1118 sternal bones. Analyses showed that the length of the meso-sternum (manubrium + body) yielded the best correlation with stature; 53.5% and 55.42% for men and women, respectively. The second best variable is the total sternal length with correlations of 44.3% and 55% for men and women, respectively. Subgroup analysis of autopsy studies demonstrated even a higher correlation of 58.2% for the meso-sternal length. Manubrium and body lengths showed the least correlation values. Except for the body length, females exhibit a better correlation than man between all other sternal lengths and stature. While the meso-sternal length is found to be the most correlated variable with stature, all sternal lengths are to be considered with caution when estimating stature. The relatively low values of the weighted correlation results should raise the question of reliability and limit the use of sternal length when long bones are available. Future research using larger samples from different populations and taking into account the fusion status of the sternum are needed.
Complicated sternal dehiscence: reconstruction with plates, cables, and cannulated screws.
Voss, Bernhard; Bauernschmitt, Robert; Brockmann, Gernot; Krane, Markus; Will, Albrecht; Lange, Rüdiger
2009-04-01
Sternal dehiscence after median sternotomy can be a challenging problem in case of multiple fractures or infection. For sternal refixation, the principles of rigid plate and screw osteosynthesis gained from orthopedic surgery have been recommended by several authors. We present a new system for sternal reconstruction consisting of reconstruction plates, steel cables, and cannulated screws.
Macki, Mohamed; Syeda, Sbaa; Kerezoudis, Panagiotis; Bydon, Ali; Witham, Timothy F; Sciubba, Daniel M; Wolinsky, Jean-Paul; Bydon, Mohamad; Gokaslan, Ziya
2016-10-01
The objective of this independent study is to determine the impact of recombinant human bone morphogenetic protein 2 (rhBMP-2) on reoperation for pseudarthrosis and/or instrumentation failure. A nested case-control study of first-time posterolateral, instrumented fusion of the lumbar spine for degenerative spinal disease was undertaken. Cases of reoperation for pseudoarthrosis and/or instrumentation failure were assigned to controls, who did not experience the primary outcome measure at the time of reoperation. Cases and controls were matched on number of interspaces fused and inclusion of interbody. Predictors of reoperation for pseudoarthrosis and/or instrumentation failure were assessed with a conditional logistical regression controlling for rhBMP-2, age, obesity, and smoking. Of the 448 patients, 155 cases of reoperation for pseudoarthrosis and/or instrumentation were matched with 293 controls. Twenty-six percent of first-time surgeries included rhBMP-2, which was statistically more commonly used in the control cohort (33.11%) versus the case cohort (12.90%) (Unadjusted odds ratio [ORunadj]=0.28) (95% confidence interval [CI]: 0.16-0.49). Following a multivariate analysis controlling for age, obesity, and smoking, the rhBMP-2 recipients incurred a 73% lower odds of reoperation for pseudoarthrosis and/or instrumentation failure (95% CI, 0.15-0.48). Neither sarcomatous nor osseous neoplasm was detected in the study population. Mean follow up did not differ between the cases (81.57±standard deviation [SD] 4.98months) versus controls (74.75±2.49month) (ORunadj=1.01) (95% CI: 1.00-1.01). rhBMP-2 in lumbar fusion constructs protects against reoperation for pseudoarthrosis and/or instrumentation failure. However, the decision to include fusion supplements should be weighted between surgical determinants and clinical outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Measurement of sternal curvature angle on patients with pectus excavatum.
Lee, Cory; Zavala-Garcia, Abraham; Teekappanavar, Neha; Lee, Catherine; Idowu, Olajire; Kim, Sunghoon
2017-01-01
Pectus excavatum (PE) is a chest deformity characterized by marked sternal depression. The objective of this study was to quantify the sternal curvature observed in patients diagnosed with PE using the sternal curvature angle (SCA). A retrospective review of lateral chest X-rays of patients with PE from 2006 to 2013 was performed. The SCA was measured in a manner similar to the method of Cobb's angle is used to measure spinal curvature. SCA and Haller index were calculated from the chest X-rays for all patients. Lateral chest X-rays of 202 PE and 196 normal control patients were analyzed. The mean SCA ± SD of PE patients was 40.56° ± 12.88° compared to 22.02° ± 7.65° for normal patients. The difference was statistically significant with a p value of <0.0001. No significant concordance between SCA and Haller index measurements in the PE group was found (Kendall τ = -0.00015, p value = 0.9975). The difference in sternal curvature as measured by the sternal curvature angle between the pectus excavatum and normal patients was statistically significant. Our data suggest that sternal depression evident in PE patients is not a simple linear depression of the sternum but due to curvature in the sternal body.
Vural, A Hakan; Yalçinkaya, Serhat; Türk, Tamer; Oztürk, Alpaslan; Sezen, Mustafa; Yavuz, Senol; Ozyazicioglu, Ahmet
2007-01-01
When a sternotomy cannot be performed at the midline and/or there is infection at the operation site, sternotomy revision can cause problems that increase the mortality and morbidity of the patients. There is no agreement on the best treatment method. In this paper we present a modified wiring technique. This technique consisted of wrapping wires twice around each rib head and placing standard circumferential wire sutures, thus providing full stability by decreasing the load on the sternum using only steel wires. The study group included 23 patients with sternal dehiscence because of inappropriate sternotomy (n = 10) and/or mediastinitis (n = 13). Two mediastinal tubes were placed for irrigation in 13 patients with mediastinitis and/or wound infection, and mobilization and interposition of omentum as an axial graft was performed in 2 patients. Irrigation and antibiotherapy were continued for 4 to 6 weeks. Complete wound healing was obtained in all patients. Twenty-two patients treated with this technique survived. One patient died on postoperative 42nd day because of renal insufficiency and multi-organ failure. Early and aggressive debridement of infected and necrotic tissue, irrigation, and antibiotics are necessary for successful treatment, but we believe that the most important factor is full stabilization of the sternal tissue with minimal use of foreign stabilization material. Despite the limited number of cases, we suggest that our stabilization technique seems to be successful in achieving full stabilization even in infected and fragile sternal bony tissue in patients with sternal dehiscence and/or inappropriate sternotomy.
Sternal exploration or closure
... Beauchamp RD, Evers BM, Mattox KL, eds. Sabiston Textbook of Surgery . 20th ed. Philadelphia, PA: Elsevier; 2017:chap 12. Singh K, Anderson E. Harper JG. Overview and management of sternal wound infection. Semin Plast Surg . 2011; ...
TECHNIQUES IN ASEPTIC RODENT SURGERY
Hoogstraten-Miller, Shelley L.; Brown, Patricia A.
2008-01-01
Performing aseptic survival surgery in rodents can be challenging. This unit describes some basic principles to assist clinicians, researchers, and technicians in becoming proficient in performing aseptic rodent surgery. PMID:18729061
Preliminary experience with a new device for delayed sternal closure strategy in cardiac surgery.
Santini, Francesco; Onorati, Francesco; Telesca, Mariassunta; Faggian, Giuseppe; Mazzucco, Alessandro
2012-06-01
Open chest management with delayed sternal closure (DSC) is a valuable strategy in the management of patients with postcardiotomy hemodynamic instability or severe coagulopathy. The conventional extemporized material available for off-label sternal stenting however may limit its efficacy. We evaluated outcomes of patients with refractory severe postcardiotomy cardiogenic shock (SPCCS) treated with DSC using a novel temporary sternal spreader (NTSS) which allows myocardial recovery by progressive controlled approximation of the sternal edges. Seven patients (4 male, mean age 66.5 ± 5 years) with refractory SPCCS showing acute hemodynamic instability at sternal closure, were implanted with the NTSS, consisting of stainless-steel branches linked to 2 diverging plates of polyether-ether ketone, whose progressive opening/closing mechanism can be controlled from outside the chest with a rotating steel wire. The sternal wound was closed by an elastic membrane to achieve a sterile field. Swan-Ganz monitoring was employed, and clinical outcomes evaluated. The device was successfully implanted in all patients without device-related complications or failures. Progressive approximation of sternal edges, titrated on cardiac index values, was successfully completed allowing subsequent uneventful sternal closure in all. Mean time from SPCCS to sternal closure was 70 ± 21 hours. No patient developed infective complications or late hemodynamic instability after device removal and sternal closure. One patient (14%) died of multiorgan failure on postoperative day 9. Despite the limited number of patients enrolled, the NTSS proved safe and effective in allowing complete myocardial recovery after SPCCS, avoiding hemodynamic instability related to abrupt sternal closure, with no occurrence of infective complications.
Late Complications of Chest Wall Reconstruction: Management of Painful Sternal Nonunion
Chepla, Kyle J.; Salgado, Christopher J.; Tang, Cathy J.; Mardini, Samir; Evans, Karen K.
2011-01-01
Although rare, sternal nonunion after median sternotomy or traumatic injury is associated with a high rate of morbidity. Pain and sternal clicking are two of the most common complaints and reasons these patients seek evaluation and treatment. Diagnosis of sternal nonunion is based on a thorough history and physical examination and can be confirmed with subsequent radiographic imaging. The treatment for symptomatic sternal nonunion requires stable fixation of the bony fragments and chest wall after the debridement of all nonviable bony and soft tissue by the cardiothoracic or reconstructive surgery team. Multiple fixation techniques have been described and incorporate a wide variety of materials including combinations of wires, cables, pins, bands, staples, and plates. Most recently, several new commercially available plating systems have demonstrated low recurrence and complication rates and resolution of the patient's symptoms on follow-up evaluation. Included in this review are three cases demonstrating the management of symptomatic sternal nonunion using these new techniques and review the history, diagnosis, risk factor, and classification, as well as several of the previously described fixation methods. PMID:22294948
La tuberculose sternale: à propos de 2 cas
Ouarssani, Aziz; Atoini, Fouad; Ait Lhou, Fatima; Idrissi Rguibi, Mustapha
2012-01-01
La tuberculose ostéoarticulaire touche surtout le rachis. L’atteinte sternale est rare, elle représente moins de 1% des ostéomyélites tuberculeuses. L’abcès froid compliqué par une fracture pathologique constitue le mode de révélation le plus fréquent. Le traitement chirurgical assure l’évacuation des abcès et permet le diagnostique histologique et bactériologique. On rapporte deux cas de tuberculose sternale âgés respectivement de 45 ans et de 10ans, colligés au service de pneumologie, l’examen histologique et bactériologique ont permis d’affirmer le diagnostic de tuberculose, et le traitement antibacillaire a permis une évolution favorable .A la lumière de ces observations, les auteurs proposent de faire une mise au point sur l’ostéite sternale tuberculeuse. PMID:22514767
Sternal foramina and variant xiphoid morphology in a Kenyan population.
El-Busaid, H; Kaisha, W; Hassanali, J; Hassan, S; Ogeng'o, J; Mandela, P
2012-02-01
Sternal foramina may pose a great hazard during sternal puncture, due to inadvertent cardiac or great vessel injury. They can also be misinterpreted as osteolytic lesions in cross-sectional imaging of the sternum. On the other hand, variant xiphoid morphology such as bifid, duplicated, or trifurcated may be mistaken for fractures during imaging. The distribution of these anomalies differs between populations, but data from Africans is scarcely reported. This study therefore aimed to investigate the distribution and frequency of sternal foramina and variant xiphoid morphology in a Kenyan population. Eighty formalin-fixed adult sterna (42 males [M], 38 females [F]) of age range 18-45 years were studied during dissection at the Department of Human Anatomy, University of Nairobi. Soft tissues were removed from the macerated sterna by blunt dissection and foramina recorded in the manubrium, body, and xiphoid process. The xiphisternal ending was classified as single, bifurcated (2 xiphoid processes with a common stem), or duplicated (2 xiphoid processes with separate stems). Results were analysed using SPSS version 17.0. Foramina were present in 11 specimens (13.8%): 7 M, 4 F. The highest frequency was in the sternal body (n = 9), where they predominantly occurred at the 5th intercostal segment. Xiphoid foramina were present in 2 specimens (both males) (2.5%), while manubrial foramen was not encountered. The xiphisternum ended as a single process in 64 cases (34 M, 30 F) (80%). It bifurcated in 10 cases (5 M, 5 F) (12.5%), and duplicated in 6 cases (4 M, 2 F) (7.5%). There were no cases of trifurcation. Sternal foramina in Kenyans vary in distribution and show higher frequency than in other populations. These variations may complicate sternal puncture, and due caution is recommended. The variant xiphisternal morphology may raise alarm for xiphoid fractures and may therefore be considered a differential.
[Isolated sternal tuberculosis in immunocompétent adult].
Feki, W; Ketata, W; Mkaouar, N; Charfi, S; Moussa, N; Yangui, I; Kammoun, S
2018-04-01
Isolated sternal tuberculosis is a rarely described entity even in countries where tuberculosis is endemic. We report the case of 25 old years patient who presented with a chest wall mass. Imaging concluded to a (ring-enhancing hypodense soft tissue mass surrounding the sternum with sternal fracture). Malignancy was eliminated by a core needle biopsy. We noted clinical and radiological recovery with medical tuberculosis treatment. Neoplastic origin was removed by biopsy and anatomopathological study of the lesion. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
[Plastic Reconstruction with a Vascular Pedicle Latissimus Dorsi Flap after Sternal Osteomyelitis].
Spindler, N; Langer, S
2017-10-01
Objective: Sternal bone and soft tissue debridement after osteomyelitis of the sternum with simultaneous defect coverage using a vascular pedicle latissimus dorsi flap. Indication: Profound sternal wound healing disorders may be covered with various flap grafts. The latissimus dorsi flap provides a fast, sufficient and reliable option to cover sternal defects. If the bone and soft tissue debridement has been very radical, coverage may be performed in a one-stage procedure. Method: The individual surgical steps for sternal debridement with simultaneous defect coverage using a vascular pedicle latissimus dorsi flap are shown. Conclusion: The radicality of debridement is crucial to treatment success and allows debridement and flap graft coverage to be performed at the same time. If two surgeons work simultaneously, the duration of surgery may be significantly reduced. Georg Thieme Verlag KG Stuttgart · New York.
Variations in aseptic technique and implications for infection control.
Aziz, Anne Marie
Healthcare-acquired infections (HAIs) are a serious concern, costing the NHS 1 billion pounds a year and causing 5000 deaths annually despite increased funding. A contributing factor is the variety of aseptic techniques in use in different hospitals and even within a single hospital. These cause problems for healthcare workers as well as increasing the risk of HAI. This article examines a number of traditional approaches to aseptic technique, highlighting their differences and the implications for infection control. It concludes that improvement in aseptic technique could be achieved by implementation of a single unified approach to aseptic technique that can be standardized and audited annually, such as the aseptic non-touch technique (ANTT), which has been recommended for adoption throughout the UK. It ends with suggestions for measures that could be introduced and strengthened to improve aseptic technique, and ultimately reduce the rate of HAI.
Radiation sterilization of aseptically manufactured products.
Fairand, Barry P; Fidopiastis, Niki
2010-01-01
This paper discusses an approach for establishing a sterilization dose for an aseptically processed product after the product is in its final packaged state, in other words, terminal sterilization. It applies to aseptic processes where the fill/finish operation is conducted in a closed system using isolator or restricted access barrier technology, that is, no human intervention. The example that is given in this paper uses gamma radiation as the sterilizing agent. Other forms of radiation such as high-energy electrons or X-rays also could serve as the sterilizing agent. The proposed approach involves irradiation of the aseptically processed product at very low doses of radiation, which is possible due to the extremely low levels of bioburden that may be present on the product following a fill/finish operation. Rather than sacrificing a large number of product units that may be required to obtain a statistically significant sampling of the product for bioburden analysis and other test purposes, the test unit is a surrogate consisting of actual pharmaceutical product that was inoculated with a highly radiation-resistant micro-organism. Selection of the microorganism was based on analysis of a library of environmental monitoring data taken from the aseptic area. Because of microbial diversity between different aseptic processing facilities, selection of the test microorganism would depend on the aseptic area under study. The approach that is discussed in this paper addresses selection and preparation of the surrogate, test of sterility of the surrogate following irradiation, determination of the radiation resistance of the test microorganism, and application of the approach to calculate a sterilization dose that is less than 10 kGy. At this low dose, it may be possible to terminally sterilize radiation-sensitive pharmaceutical products, for example, those in liquid form. Additional studies are warranted to determine the general applicability of the proposed approach.
Periosteal infusion of bupivacaine/morphine post sternal fracture: a new analgesic technique.
Duncan, Michael A; McNicholas, Walter; O'Keeffe, Declan; O'Reilly, Maeve
2002-01-01
Sternal fracture pain is severe and is difficult to alleviate due to the forces acting on the chest wall during respiration. We describe a continuous infusion regional analgesic technique for pain due to sternal fracture. A 47-year-old woman presented with a spontaneous sternal fracture, precluding effective coughing. Diclofenac and increasing doses of opioids did not give adequate pain relief and led to opioid toxicity. Two brief periods of analgesia were achieved with deep subcutaneous infiltration of bupivacaine. An epidural catheter was positioned periosteally, and an infusion of bupivacaine was commenced at 5 mL/h, achieving long-lasting analgesia. The bupivacaine concentration was reduced in a stepwise fashion from 0.5% to 0.25% and was changed to levobupivacaine after 3 days. Adding morphine (5 mg/60 mL levobupivicaine) permitted a reduction in infusion rate. The catheter was removed after 14 days because a local infection developed that resolved uneventfully with antibiotic therapy. Continuous infusion of local anesthetic and opioid to a sternal fracture site using a periosteally positioned catheter led to successful analgesia and hence improved respiratory function. Clinicians should consider placing a periosteal catheter when pain associated with sternal fracture cannot be adequately controlled with conventional methods.
Knobloch, K; Wagner, S; Haasper, C; Probst, C; Krettek, C; Vogt, P M; Otte, D; Richter, M
2008-01-01
Sternal fractures are a rare entity. We hypothesised that a sternal fracture is an indicator of injury severity following traffic accidents. Analysis of technical indicators of the collision, preclinical and clinical data of patients with sternal fractures from 1985 to 2004 among 42,055 injured patients assessed by an Accident Research Unit. Only 267/42,055 patients (0.64%) suffered a sternal fracture within the 20-year period. Soft tissue bruises are most often concomitant injuries (55%), followed by cervical spine injuries (23%), multiple rib fractures (14%) and lung injuries (12%). Eighteen percent of patients were polytraumatised, with 11.2% dying at the scene, 2.3% in hospital. Deceleration velocity (DeltaV) was significantly correlated with injury severity score (ISS, r2=0.92, y=0.408x-4.1573) as with maximal abbreviated injury scale (MAIS, r2=0.81). Patients suffering a sternal fracture being polytraumatised had significantly higher deceleration velocity (60+/-17km/h versus 37+/-16km/h [37.3+/-10.6mph versus 23+/-9.9mph], p=0.0001). Patients dying with a sternal fracture had a significant higher deceleration velocity (61km/h, 37.9mph) versus those surviving (38km/h, 23.6mph, p=0.0001). Regarding the vehicle type, the majority occurred after car accidents in 0.81% (251/31,183 patients), followed by 0.19% (5/2633 patients) driving motorbikes, and 0.11% (4/3258 patients) driving a truck. Only 13% of all passengers suffering a sternal fracture had an airbag on board (33/255 car/trucks), with an airbag malfunction in 18%. 22% were not admitted to hospital, 28% were admitted to a trauma ICU with a sternal fracture. In 1/5 of cases sternal fractures encountered in polytraumatised patients following significantly higher deceleration velocities during the crash. Typically car drivers without a functioning airbag suffer a sternal fracture.
Enhanced Sternal Healing via Platelet-Rich Plasma and Biodegradable Gelatin Hydrogel.
Shibata, Masafumi; Takagi, Gen; Kudo, Mitsuhiro; Kurita, Jiro; Kawamoto, Yoko; Miyagi, Yasuo; Kanazashi, Mikimoto; Sakatani, Takashi; Naito, Zenya; Tabata, Yasuhiko; Miyamoto, Masaaki; Nitta, Takashi
2018-05-16
Platelet-rich plasma (PRP) contains numerous growth factors and promotes bone fracture healing. The aim of this study was to evaluate the effectiveness of the controlled release of PRP from biodegradable gelatin hydrogel for promoting healing in a rabbit ischemic sternal model. PRP was prepared from the whole blood of a Japanese white rabbit. Sixteen rabbits were randomized into four groups (each n = 4) and all underwent median sternotomy and bilateral internal thoracic artery removal. Before the sternum was closed, the following solutions were applied between the sternum incisions in three of the groups: 30 mg of gelatin hydrogel incorporating 300 μL of phosphate-buffered saline, 300 μL of a solution form of PRP, or 30 mg of gelatin hydrogel incorporating 300 μL of PRP (PRP+Gel). The fourth group acted as a control. Sternal healing was evaluated by histology and micro-computed tomography 7 days after the intervention. The PRP+Gel group showed a significantly higher proportion of fibrosis within the fracture area (an indicator of sternal healing) than the other groups and a significantly higher mean intensity of osteocalcin. These results indicate that the controlled release of PRP from locally applied gelatin hydrogel was markedly effective in enhancing sternal healing in the early postoperative period. This novel therapy could potentially help prevent complications such as deep sternal wound infection and could result in early postoperative ambulation after median sternotomy.
Vestergaard, Rikke Falsig; Søballe, Kjeld; Hasenkam, John Michael; Stilling, Maiken
2018-05-18
A small, but unstable, saw-gap may hinder bone-bridging and induce development of painful sternal dehiscence. We propose the use of Radiostereometric Analysis (RSA) for evaluation of sternal instability and present a method validation. Four bone analogs (phantoms) were sternotomized and tantalum beads were inserted in each half. The models were reunited with wire cerclage and placed in a radiolucent separation device. Stereoradiographs (n = 48) of the phantoms in 3 positions were recorded at 4 imposed separation points. The accuracy and precision was compared statistically and presented as translations along the 3 orthogonal axes. 7 sternotomized patients were evaluated for clinical RSA precision by double-examination stereoradiographs (n = 28). In the phantom study, we found no systematic error (p > 0.3) between the three phantom positions, and precision for evaluation of sternal separation was 0.02 mm. Phantom accuracy was mean 0.13 mm (SD 0.25). In the clinical study, we found a detection limit of 0.42 mm for sternal separation and of 2 mm for anterior-posterior dislocation of the sternal halves for the individual patient. RSA is a precise and low-dose image modality feasible for clinical evaluation of sternal stability in research. ClinicalTrials.gov Identifier: NCT02738437 , retrospectively registered.
Deep Sternal Wound Infection after Open-Heart Surgery: A 13-Year Single Institution Analysis.
Juhl, Alexander Andersen; Hody, Sofie; Videbaek, Tina Senholt; Damsgaard, Tine Engberg; Nielsen, Per Hostrup
2017-04-20
The present study aimed to compare the clinical outcome for patients with or without muscle flap reconstruction after deep sternal wound infection due to open-heart surgery. The study was a retrospective cohort study, including patients who developed deep sternal wound infection after open-heart surgery in the Western Denmark Region from 1999 to 2011. Journals of included patients were reviewed for clinical data regarding the treatment of their sternal defect. Patients were divided into two groups depending on whether they received a muscle-flap-based sternal reconstruction or traditional rewiring of the sternum. A total of 130 patients developed deep sternal wound infection in the study period. In all, 12 patients died before being discharged, leaving a total of 118 patients for analysis. Of these, 50 (42%) patients received muscle flap reconstruction. Muscle flap recipients had significantly longer total hospital stays (p <0.001). However, after receiving muscle flap reconstruction, patients were discharged after a median of 14 days, with 74% not needing additional surgery. It is difficult to predict which patients eventually require muscle flap reconstruction after deep sternal wound infection. Although patients receiving muscle flap reconstructions have longer hospital stays, they are quickly discharged after the reconstruction.
Sun, I-Feng; Lee, Su-Shin; Chiu, Chaw-Chi; Lin, Sin-Daw; Lai, Chung-Sheng
2008-01-01
Sternal osteomyelitis is a potentially lethal complication after cardiac surgery. It may be the cause of postoperative morbidity and mortality. We present a case of deep sternal wound infection after sternotomy. The patient received three treatments of surgical debridement, irrigation, topical negative pressure (TNP) dressing, and hyperbaric oxygen (HBO) therapy. Forty-five HBO therapy sessions were administered. After nine weeks, the sternal wound was healed and completely epithelialized. This conservative therapy can be an alternative and inexpensive method for the difficult sternal wound infection patient.
Association of sternal wound infection with parasternal muscle sutures.
Stahl, Kenneth D; Moon, Harry K; Gorensek, Margaret J; McCarthy, Patrick; Cosgrove, Delos M
2002-01-01
Sternal wound infection complicating open-heart surgery is a potentially devastating complication that has been associated with a number of risk factors. We recently consulted on three consecutive patients with this complication who had heavy nonabsorbable parasternal sutures placed in muscle tissue adjacent to the sternum. The aim of this report is to document our findings and caution that this technique to control bleeding from the parasternal intercostal muscles my increase risk of infection. The pathology, surgical findings, and microbiology of these three cases are analyzed for similarity and possible cause of infection. By surgical observation and culture reports, each infection appeared to have originated at the site of nonabsorbable suture in devascularized parasternal muscle tissue. Sinus tracts could be probed to a similar site in each patient. Placement of sutures in the parasternal muscles where the sternal wires wrap around the bone leads to compression and necrosis of muscle tissue. We caution that this technique to control bleeding may cause a nidus of infection and increase the risk of deep sternal wound infection.
Katijjahbe, Md Ali; Denehy, Linda; Granger, Catherine L; Royse, Alistair; Royse, Colin; Bates, Rebecca; Logie, Sarah; Clarke, Sandy; El-Ansary, Doa
2017-06-23
The routine implementation of sternal precautions to prevent sternal complications that restrict the use of the upper limbs is currently worldwide practice following a median sternotomy. However, evidence is limited and drawn primarily from cadaver studies and orthopaedic research. Sternal precautions may delay recovery, prolong hospital discharge and be overly restrictive. Recent research has shown that upper limb exercise reduces post-operative sternal pain and results in minimal micromotion between the sternal edges as measured by ultrasound. The aims of this study are to evaluate the effects of modified sternal precautions on physical function, pain, recovery and health-related quality of life after cardiac surgery. This study is a phase II, double-blind, randomised controlled trial with concealed allocation, blinding of patients and assessors, and intention-to-treat analysis. Patients (n = 72) will be recruited following cardiac surgery via a median sternotomy. Sample size calculations were based on the minimal important difference (two points) for the primary outcome: Short Physical Performance Battery. Thirty-six participants are required per group to counter dropout (20%). All participants will be randomised to receive either standard or modified sternal precautions. The intervention group will receive guidelines encouraging the safe use of the upper limbs. Secondary outcomes are upper limb function, pain, kinesiophobia and health-related quality of life. Descriptive statistics will be used to summarise data. The primary hypothesis will be examined by repeated-measures analysis of variance to evaluate the changes from baseline to 4 weeks post-operatively in the intervention arm compared with the usual-care arm. In all tests to be conducted, a p value <0.05 (two-tailed) will be considered statistically significant, and confidence intervals will be reported. The Sternal Management Accelerated Recovery Trial (S.M.A.R.T.) is a two-centre randomised
PECTUS CARINATUM: A NOVEL METHOD OF STERNAL FIXATION.
Taha, Assad; Sfeir, Pierre; Al-Taki, Muhyeddine
2016-01-01
The traditional method for fixing the sternum during surgical repair of pectus carinatum is through the use of a stainless steel bar (Adkin’s strut). In this article we describe a new method of sternal fixation using nonabsorbable sutures which are placed in a transverse and crossed fashion anterior to the sternum. This method provides stable sternal fixation and spares the patient a second operation to remove the steel bar. The absence of metallic implants allows clearer view of the thoracic structures in future X-rays, CT scans and MRI, and is likely to be more acceptable to patients than the implantation of a metallic strut in their chest. In addition, it is less costly.
Sternal Cleft Associated with Cantrell's Pentalogy in a German Shepherd Dog.
Benlloch-Gonzalez, Manuel; Poncet, Cyrill
2015-01-01
A 5 mo old male German shepherd dog weighing 15.5 kg was presented with an abdominal wall hernia and exercise intolerance. Physical examination showed a grade II/VI systolic heart murmur and an area of cutaneous atrophy overlying a midline supraumbilical wall defect. Thoracic radiography, computed tomography, and ultrasound examination revealed a congenital caudal sternal cleft, a supraumbilical diastasis rectus, and a patent ductus arteriosus. Exploratory surgery confirmed defects of the pars sternalis of the diaphragm and caudoventral pericardium and a persistent left cranial vena cava. Those findings were compatible with Cantrell's pentalogy. Surgical treatment included ligation of the patent ductus arteriosus through the sternal cleft, diaphragmatic reconstruction with paracostal extension of the diaphragmatic defect, pericardial and linea alba appositional reconstruction, and primary approximation of the sternal halves. Growth and exercise activity were normal 10 mo after surgery. The discovery of a midline cranial abdominal wall, pericardial, diaphragmatic, or sternal defect should prompt a thorough examination to rule out any possible associated syndrome. Cantrell's pentalogy presents various degrees of expression and is rare in dogs. Management involves early surgical repair of congenital anomalies to protect the visceral structures. The prognosis in dogs with mild forms of the syndrome is encouraging.
Aseptic meningitis in children: analysis of 506 cases.
Michos, Athanasios G; Syriopoulou, Vassiliki P; Hadjichristodoulou, Christos; Daikos, George L; Lagona, Evagelia; Douridas, Panagiotis; Mostrou, Glykeria; Theodoridou, Maria
2007-08-01
Non-polio human enteroviruses are the leading cause of aseptic meningitis in children. The role of enterovirus PCR for diagnosis and management of aseptic meningitis has not been fully explored. A retrospective study was conducted to determine the epidemiological, clinical, and laboratory characteristics of aseptic meningitis and to evaluate the role of enterovirus PCR for the diagnosis and management of this clinical entity. The medical records of children who had as discharge diagnosis aseptic or viral meningitis were reviewed. A total of 506 children, median age 5 years, were identified. The annual incidence rate was estimated to be 17/100,000 children less than 14 years of age. Most of the cases occurred during summer (38%) and autumn (24%). The dominant clinical symptoms were fever (98%), headache (94%) and vomiting (67%). Neck stiffness was noted in 60%, and irritation in 46% of the patients. The median number of CSF cell count was 201/mm(3) with polymorphonuclear predominance (>50%) in 58.3% of the cases. Enterovirus RNA was detected in CSF in 47 of 96 (48.9%) children tested. Children with positive enterovirus PCR had shorter hospitalization stay as compared to children who had negative PCR or to children who were not tested (P = 0.01). There were no serious complications or deaths. Enteroviruses accounted for approximately one half of cases of aseptic meningitis. PCR may reduce the length of hospitalization and plays important role in the diagnosis and management of children with aseptic meningitis.
Fuller, Louise M; El-Ansary, Doa; Button, Brenda; Bondarenko, Janet; Marasco, Silvana; Snell, Greg; Holland, Anne E
2018-01-25
A surgical incision for bilateral sequential lung transplantation (BSLTX) is the "clam shell" (CSI) approach via bilateral anterior thoracotomies and a transverse sternotomy to allow for sequential replacement of the lungs. This can be associated with significant post-operative pain, bony overriding or sternal instability. The sternal instability scale (SIS) is a non-invasive manual assessment tool that can be used to detect early bony non-union or instability following CSI; however, its reliability is unknown. This prospective blinded reliability study aimed to assess intra-rater and inter-rater reliability of the SIS following lung transplantation. Participants post BSLTX aged older than 18 years underwent sternal assessment utilizing the SIS. Two assessors examined the sternum using a standardized protocol at two separate time points with a test-re-test time of 48 hours. The outcome measure was SIS tool using four categories from 0 (clinically stable) to 3 (separated sternum with overriding). In total, 20 participants (75% female) with a mean age of 48 years (SD 17) and mean pain score of 3 out of 10 were included, 60% having well healed wounds and 25% reporting symptoms of sternal clicking. The most painful self-reported painful activity was coughing. The SIS demonstrated excellent reliability with a kappa = 0.91 by different assessors on the same day, and kappa = 0.83 for assessments by the same assessor on different days. The SIS is a reliable manual assessment tool for evaluation of sternal instability after CSI following BSLTX and may facilitate the timely detection and management of sternal instability.
Femoral pseudoarthrosis and knee stiffness: long-term results of a one-stage surgical approach.
Gomes, João L Ellera; Ruthner, Roberto P; Moreira, Luiz
2010-02-01
The objective of this study was to analyze the surgical results of the simultaneous treatment of femoral pseudoarthrosis and knee stiffness using a combined one-stage approach (quadricepsplasty + osteoperiosteal decortications + bone autografting + fracture stabilization). Twelve patients (six men) followed up for a minimum of 10 years and who had undergone surgery for these combined procedures were contacted for evaluation. Their mean age at the time of the surgery was 30 years (standard deviation, SD 15; range 22-65 years), and mean time from initial trauma was 16 months (SD 6, range 10-32 months). Mean range of motion improved from 10 degrees (SD 9) to 112 degrees (SD 13) postoperatively. Fractures healed in all patients, and improvement in their range of motion was statistically significant (Student's t-test = 31; P
Oh, You Na; Ha, Keong Jun; Kim, Joon Bum; Jung, Sung-Ho; Choo, Suk Jung; Chung, Cheol Hyun; Lee, Jae Won
2015-08-01
Stainless steel wiring remains the most popular technique for primary sternal closure. Recently, a multifilament cable wiring system (Pioneer Surgical Technology Inc., Marquette, MI, USA) was introduced for sternal closure and has gained wide acceptance due to its superior resistance to tension. We aimed to compare conventional steel wiring to multifilament cable fixation for sternal closure in patients undergoing major cardiac surgery. Data were collected retrospectively on 1,354 patients who underwent sternal closure after major cardiac surgery, using either the multifilament cable wiring system or conventional steel wires between January 2009 and October 2010. The surgical outcomes of these two groups of patients were compared using propensity score matching based on 18 baseline patient characteristics. Propensity score matching yielded 392 pairs of patients in the two groups whose baseline profiles showed no significant differences. No significant differences between the two groups were observed in the rates of early mortality (2.0% vs. 1.3%, p=0.578), major wound complications requiring reconstruction (1.3% vs. 1.3%, p>0.99), minor wound complications (3.6% vs. 2.0%, p=0.279), or mediastinitis (0.8% vs. 1.0%, p=1.00). Patients in the multifilament cable group had fewer sternal bleeding events than those in the conventional wire group, but this tendency was not statistically significant (4.3% vs. 7.4%, p=0.068). The surgical outcomes of sternal closure using multifilament cable wires were comparable to those observed when conventional steel wires were used. Therefore, the multifilament cable wiring system may be considered a viable option for sternal closure in patients undergoing major cardiac surgery.
Mayberry, John C; Ham, L Bruce; Schipper, Paul H; Ellis, Thomas J; Mullins, Richard J
2009-03-01
Rib and sternal fracture repair are controversial. The opinion of surgeons regarding those patients who would benefit from repair is unknown. Members of the Eastern Association for the Surgery of Trauma, the Orthopedic Trauma Association, and thoracic surgeons (THS) affiliated with teaching hospitals in the United States were recruited to complete an electronic survey regarding rib and sternal fracture repair. Two hundred thirty-eight trauma surgeons (TRS), 97 orthopedic trauma surgeons (OTS), and 70 THS completed the survey. Eighty-two percent of TRS, 66% of OTS, and 71% of THS thought that rib fracture repair was indicated in selected patients. A greater proportion of surgeons thought that sternal fracture repair was indicated in selected patients (89% of TRS, 85% of OTS, and 95% of THS). Chest wall defect/pulmonary hernia (58%) and sternal fracture nonunion (>6 weeks) (68%) were the only two indications accepted by a majority of respondents. Twenty-six percent of surgeons reported that they had performed or assisted on a chest wall fracture repair, whereas 22% of surgeons were familiar with published randomized trials of the surgical repair of flail chest. Of surgeons who thought rib fracture or sternal fracture repair was rarely, if ever, indicated, 91% and 95%, respectively, specified that a randomized trial confirming efficacy would be necessary to change their negative opinion. A majority of surveyed surgeons reported that rib and sternal fracture repair is indicated in selected patients; however, a much smaller proportion indicated that they had performed the procedures. The published literature on surgical repair is sparse and unfamiliar to most surgeons. Barriers to surgical repair of rib and sternal fracture include a lack of expertise among TRS, lack of research of optimal techniques, and a dearth of randomized trials.
Molecular Identification of Bacteria from Aseptically Loose Implants
Kobayashi, Naomi; Procop, Gary W.; Krebs, Viktor; Kobayashi, Hideo
2008-01-01
Polymerase chain reaction (PCR) assays have been used to detect bacteria adherent to failed orthopaedic implants, but some PCR assays have had problems with probable false-positive results. We used a combination of a Staphylococcus species-specific PCR and a universal PCR followed by DNA sequencing to identify bacteria on implants retrieved from 52 patients (92 implants) at revision arthroplasty. We addressed two questions in this study: (1) Is this method able to show the existence of bacterial DNA on presumed aseptic loosed implants?; and (2) What proportion of presumed aseptic or culture-negative implants was positive for bacterial DNA by PCR? Fourteen implants (15%) were believed infected, whereas 74 implants (85%) were believed aseptic. Each implant was sonicated and the resulting solution was submitted for dual real-time PCR assay and culture. All implants believed aseptically loose were culture-negative, but nine of the 74 (12%) had bacterial DNA by PCR; two (2.7%) were PCR-positive and also showed histologic findings suggestive of infection. Uniquely developed PCR and bacterial sequencing assays showed bacterial DNA on 12% of implants removed for presumed aseptic loosening. Additional studies are needed to determine the clinical importance of bacterial DNA detected by PCR but not by conventional culture. Level of Evidence: Level III, diagnostic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18438724
Raza, Irfan; Narayanan, Madankumar; Venkataraju, Arun; Ciocarlan, Alexandra
2016-01-01
Sternal fractures occur after deceleration injuries such as falls and road traffic accidents. Recovery from isolated fractures is excellent, but mortality increases dramatically with concurrent chest injuries such as rib fractures and soft tissue injuries. Short-term complications include chest pain, which prevents patients from taking deep breaths and coughing, thereby predisposing them to chest infections. We present a case of a 73-year-old woman with sternal fracture in whom enteral analgesia was inadequate and who was intolerant to intravenous opiates. The patient was successfully treated with a continuous infusion of local anesthetic into the subpectoral interfascial plane. We also discuss the use and potential benefits of the subpectoral interfascial plane block in the treatment of pain from sternal fractures.
Revision total knee arthroplasty for septic versus aseptic failure.
Rajgopal, Ashok; Vasdev, Attique; Gupta, Himanshu; Dahiya, Vivek
2013-12-01
To compare the medium-term outcome of revision total knee arthroplasty (TKA) for septic versus aseptic failure. Records of 142 patients who underwent revision TKA by a single senior surgeon for septic (n=65) or aseptic (n=77) failure were reviewed. In the septic group, 67 knees in 42 women and 23 men were included. In the aseptic group, 88 knees in 51 women and 26 men were included. The Knee Society Score was measured. The Kaplan Meier survival curve at months 36, 60, and 95 was plotted, with revision as the end point. The survival rates at each specific time point between the 2 groups were compared using the Z test. The Knee Society Scores improved 18% from 51 to 69 in the septic group and 18% from 52 to 70 in the aseptic group (p=0.72). The range of motion improved 30% from 72 to 102 degrees in the septic group and 39% from 62 to 100 degrees in the aseptic group (p<0.001). Results of the 2 groups were similar in terms of the Knee Society Score, range of motion, and the Kaplan-Meier survivorship.
Video-assisted structured teaching to improve aseptic technique during neuraxial block.
Friedman, Z; Siddiqui, N; Mahmoud, S; Davies, S
2013-09-01
Teaching epidural catheter insertion tends to focus on developing manual dexterity rather than improving aseptic technique which usually remains poor despite increasing experience. The aim of this study was to compare epidural aseptic technique performance, by novice operators after a targeted teaching intervention, with operators taught aseptic technique before the intervention was initiated. Starting July 2008, two groups of second-year anaesthesia residents (pre- and post-teaching intervention) performing their 4-month obstetric anaesthesia rotation in a university affiliated centre were videotaped three to four times while performing epidural procedures. Trained blinded independent examiners reviewed the procedures. The primary outcome was a comparison of aseptic technique performance scores (0-30 points) graded on a scale task-specific checklist. A total of 86 sessions by 29 residents were included in the study analysis. The intraclass correlation coefficient for inter-rater reliability for the aseptic technique was 0.90. The median aseptic technique scores for the rotation period were significantly higher in the post-intervention group [27.58, inter-quartile range (IQR) 22.33-29.50 vs 16.56, IQR 13.33-22.00]. Similar results were demonstrated when scores were analysed for low, moderate, and high levels of experience throughout the rotation. Procedure-specific aseptic technique teaching, aided by video assessment and video demonstration, helped significantly improve aseptic practice by novice trainees. Future studies should consider looking at retention over longer periods of time in more senior residents.
The use of sternal wedge osteotomy in pectus surgery: when is it necessary?
Kara, Murat; Gundogdu, Ahmet Gokhan; Kadioglu, Salih Zeki; Cayirci, Ertug Can; Taskin, Necati
2016-09-01
The Ravitch procedure is a well-established surgical procedure for correction of chest wall deformities. Sternal wedge osteotomy is an important part of this procedure. We studied the incidence of wedge osteotomy with respect to the type of chest wall deformity in patients undergoing surgical correction with the use of a recently developed chest wall stabilization system. A total of 47 patients, 39 (83%) male and 8 (17%) female with a mean age of 14.9 ± 2.1 years, underwent the Ravitch procedure. Twenty-four (51.1%) had pectus carinatum, 19 (40.4%) had pectus excavatum, and 4 (8.5%) had pectus arcuatum. A conventional or oblique sternal wedge osteotomy was performed as indicated, followed by chest wall stabilization using the MedXpert system. Of the 47 patients, 27 (57.4%) had a sternal wedge osteotomy. All cases of pectus arcuatum and redo cases underwent sternal wedge osteotomy. Pectus excavatum cases tended to have a greater incidence of wedge osteotomy compared to pectus carinatum cases (68.4% vs. 41.7%, p = 0.052). Patients with more resected ribs had a greater rate of wedge osteotomy (63.4%) compared to those with fewer resected ribs (16.7%, p = 0.043). A sternal wedge osteotomy is more commonly performed in patients with pectus excavatum compared to those with pectus carinatum. All redo and pectus arcuatum cases need a wedge osteotomy for proper correction. Wedge osteotomy is very likely in more aggressive corrections with more rib resections. © The Author(s) 2016.
Propeller flap for treatment of a poststernotomy sternal fistula: a case report.
Corradino, Bartolo; Di Lorenzo, Sara; Hubova, Martina; Cordova, Adriana
2014-11-01
The treatment of post-operative deep sternal wound infections is a real challenge for surgeons. Conservative treatment with debridement and vacuum-assisted closure (VAC) therapy is not always successful. In the most severe and chronic cases, a surgical debridement and reconstruction of the defect is mandatory. In this report, the authors present a case of a 61-year-old female patient with a chronic cutaneous fistula in the sternal region following a median sternotomy after coronary artery bypass. The patient had already undergone treatment with antibiotics, drainage of an abscess and local debridement, but the infection continued to relapse periodically. The authors decided to treat the fistula with debridement and reconstruction with a local freestyle propeller flap mobilised from the right parasternal region. The fistula healed without any complications. There has been no relapse, and the aesthetic result is satisfactory. The scar at the donor site is acceptable with a minimum alteration to the mammary region. Sternal fistulas after medial sternotomy are difficult to treat. The treatment method of debridement followed, in certain cases, by VAC therapy is quite controversial. A surgical procedure is sometimes necessary to speed healing. Mobilisation of a freestyle propeller flap represents a less invasive surgical approach to the treatment of sternal fistulas in cases of conservative treatment failure. Copyright © 2014 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Aseptic meningitis and viral myelitis.
Irani, David N
2008-08-01
Meningitis and myelitis represent common and very infrequent viral infections of the central nervous system, respectively. The number of cases of viral meningitis that occurs annually exceeds the total number of meningitis cases caused by all other etiologies combined. Focal central nervous system infections, such as occur in the spinal cord with viral myelitis, are much less common and may be confused with noninfectious disorders that cause acute flaccid paralysis. This article reviews some of the important clinical features, epidemiology, diagnostic approaches, and management strategies for patients with aseptic meningitis and viral myelitis. Particular focus is placed on the diseases caused by enteroviruses, which as a group account for most aseptic meningitis cases and many focal infections of the spinal cord.
Real-world injury patterns associated with Hybrid III sternal deflections in frontal crash tests.
Brumbelow, Matthew L; Farmer, Charles M
2013-01-01
This study investigated the relationship between the peak sternal deflection measurements recorded by the Hybrid III 50th percentile male anthropometric test device (ATD) in frontal crash tests and injury and fatality outcomes for drivers in field crashes. ATD sternal deflection data were obtained from the Insurance Institute for Highway Safety's 64 km/h, 40 percent overlap crashworthiness evaluation tests for vehicles with seat belt crash tensioners, load limiters, and good-rated structure. The National Automotive Sampling System Crashworthiness Data System (NASS-CDS) was queried for frontal crashes of these vehicles in which the driver was restrained by a seat belt and air bag. Injury probability curves were calculated by frontal crash type using the injuries coded in NASS-CDS and peak ATD sternal deflection data. Fatality Analysis Reporting System (FARS) front-to-front crashes with exactly one driver death were also studied to determine whether the difference in measured sternal deflections for the 2 vehicles was related to the odds of fatality. For center impacts, moderate overlaps, and large overlaps in NASS-CDS, the probability of the driver sustaining an Abbreviated Injury Scale (AIS) score ≥ 3 thoracic injury, or any nonextremity AIS ≥ 3 injury, increased with increasing ATD sternal deflection measured in crash tests. For small overlaps, however, these probabilities decreased with increasing deflection. For FARS crashes, the fatally injured driver more often was in the vehicle with the lower measured deflection in crash tests (55 vs. 45%). After controlling for other factors, a 5-mm difference in measured sternal deflections between the 2 vehicles was associated with a fatality odds ratio of 0.762 for the driver in the vehicle with the greater deflection (95% confidence interval = 0.373, 1.449). Restraint systems that reduce peak Hybrid III sternal deflection in a moderate overlap crash test are beneficial in real-world crashes with similar or greater
Failure analysis of the fractured wires in sternal perichronal loops.
Chao, Jesús; Voces, Roberto; Peña, Carmen
2011-10-01
We report failure analysis of sternal wires in two cases in which a perichronal fixation technique was used to close the sternotomy. Various characteristics of the retrieved wires were compared to those of unused wires of the same grade and same manufacturer and with surgical wire specifications. In both cases, wire fracture was un-branched and transgranular and proceeded by a high cycle fatigue process, apparently in the absence of corrosion. However, stress anlysis indicates that the effective stress produced during strong coughing is lower than the yield strength. Our findings suggest that in order to reduce the risk for sternal dehiscence, the diameter of the wire used should be increased. Copyright © 2011 Elsevier Ltd. All rights reserved.
Straightened sternal wire causes iatrogenic pectus carinatum after cardiac surgery.
Thompson, Jess L; Teodori, Michael F
2013-03-01
Pectus carinatum is a protrusion deformity of the anterior chest wall that is most likely caused by a disproportionate growth of the costal cartilages compared with the remainder of the thoracic skeleton. A young boy had previously undergone corrective congenital heart operation, after which a prominent sternal protrusion was noted. During the past year, the protrusion had greatly increased in size and had become recurrently infected. Chest X-ray showed that a sternal wire, the ends of which were pointing toward the skin, had straightened. Operative intervention included removal of the offending wire, draining a chronic abscess, and shaving the protruding sternum so that it conformed to the rest of the sternum.
Nishida, Yoshihiro; Tsukushi, Satoshi; Urakawa, Hiroshi; Toriyama, Kazuhiro; Kamei, Yuzuru; Yokoi, Kohei; Ishiguro, Naoki
2015-12-01
Sternal resection is occasionally required for patients with malignant tumors, particularly sarcomas, in the sternal region. Few reports have described post-operative respiratory and shoulder function after sternal resection for patients with bone and soft-tissue sarcomas. Eight consecutive patients with bone and soft tissue sarcomas requiring sternal resection were the focus of this study. Chest wall was reconstructed with a non-rigid or semi-rigid prosthesis combined, in most cases, with soft tissue flap reconstruction. Clinical outcomes investigated included complications, shoulder function, evaluated with Musculoskeletal Tumor Society-International Symposium of Limb Salvage system, and respiratory function, evaluated by use of spirometry. The anterior chest wall was reconstructed with non-rigid strings for 3 patients and with polypropylene mesh for 5. There were no severe post-operative complications, for example surgical site infection or pneumonia. All 3 patients with non-rigid reconstruction experienced paradoxical breathing, whereas none with polypropylene mesh did so. Post-operatively, FEV(1)% was unchanged but %VC was significantly reduced (p = 0.01), irrespective of the reconstruction method used (strings or polypropylene mesh). Shoulder function was not impaired. Among patients undergoing sternal resection, post-operative shoulder function was excellent. Pulmonary function was slightly restricted, but not sufficiently so to interfere with the activities of daily living (ADL). Paradoxical breathing is a slight concern for non-rigid reconstruction.
Surgical repair of a congenital sternal cleft in a cat.
Schwarzkopf, Ilona; Bavegems, Valerie C A; Vandekerckhove, Peter M F P; Melis, Sanne M; Cornillie, Pieter; de Rooster, Hilde
2014-07-01
To describe the clinical findings, diagnosis, and treatment of an incomplete cleft of the 5th-8th sternebra and a cranioventral abdominal wall hernia in a 2 month old Ragdoll kitten and to evaluate the short- and long-term outcome. Clinical report. Ragdoll cat (n = 1), 2 months old. Sternal cleft was confirmed by thoracic radiographs. Computed tomography (CT) was used to plan an optimal surgical approach. A ventral median incision was made, starting at the 3rd sternebra and extended into the abdomen. Ostectomy of the proximal part of the 5th left sternebra was performed. Lateral periosteal flaps were created, unfolded, and absorbable monofilament sutures preplaced to facilitate closure and the repair was reinforced by 2 peristernal sutures. A bone graft was applied, and the free margin of the omentum was sutured to the cranial aspect of the wound. No major complications occurred. At 3 weeks, CT scan confirmed approximation of the hemisternebrae and at 10 months, complete fusion of the hemisternebrae had not occurred, but a strong connection of the sternal bars was present. Sternal cleft is a rare congenital abnormality that can be corrected surgically with favorable outcome. © Copyright 2014 by The American College of Veterinary Surgeons.
A meta-analysis of platelet gel for prevention of sternal wound infections following cardiac surgery
Kirmani, Bilal H.; Jones, Siôn G.; Datta, Subir; McLaughlin, Edward K.; Hoschtitzky, Andreas J.
2017-01-01
Deep sternal wound infection and bleeding are devastating complications following cardiac surgery, which may be reduced by topical application of autologous platelet gel. Systematic review identified seven comparative studies involving 4,692 patients. Meta-analysis showed significant reductions in all sternal wound infections (odds ratio 3.48 [1.08–11.23], p=0.04) and mediastinitis (odds ratio 2.69 [1.20–6.06], p=0.02) but not bleeding. No adverse events relating to the use of topical platelet-rich plasma were reported. The use of autologous platelet gel in cardiac surgery appears to provide significant reductions in serious sternal wound infections, and its use is unlikely to be associated with significant risk. PMID:27177403
Aseptic Meningitis and Viral Myelitis
Irani, David N.
2008-01-01
SYNOPSIS Meningitis and myelitis represent common and very infrequent viral infections of the central nervous system (CNS), respectively. Indeed, the number of cases of viral meningitis that occurs annually exceeds the total number of meningitis cases caused by all other etiologies combined. Focal CNS infections, on the other hand, such as occur in the spinal cord with viral myelitis, are much less common and may be confused with non-infectious disorders that cause acute flaccid paralysis (AFP). This chapter will review some of the important clinical features, epidemiology, diagnostic approaches, and management strategies for patients with aseptic meningitis and viral myelitis. Particular focus will be placed on the diseases caused by enteroviruses (EVs), which as a group account for the vast majority of all aseptic meningitis cases as well as many focal infections of the spinal cord. PMID:18657719
Racine, Samuel; Émond, Marcel; Audette-Côté, Jean-Sébastien; Le Sage, Natalie; Guimont, Chantal; Moore, Lynne; Chauny, Jean-Marc; Bergeron, Éric; Vanier, Laurent
2016-09-01
The aim of this study was to determine the incidence of delayed complications, specifically hemothorax, and functional outcome in patients with isolated sternal fracture discharged from the emergency department (ED) compared to patients with other minor thoracic trauma. This prospective cohort study was conducted in four university-affiliated Canadian EDs. Patients ages 16 and older discharged from the ED with an isolated minor thoracic injury were included and categorized as isolated sternal fracture, rib fracture, or no fracture. A standardized clinical and radiological follow-up was performed at 7 and 14 days as well as a phone follow-up at 30 and 90 days post-injury. Functional outcome was determined using the Medical Outcome Short-Form Health Survey (SF-12). A total of 969 patients were included, of whom 32 (3.3%) had an isolated sternal fracture, 304 (31.3%) had rib fracture, and 633 (65.3%) had no fracture. Within 14 days, 112 patients presented with a delayed hemothorax: 12.5% of sternal fracture patients, 23% of rib fracture(s) patients, and 6% of minor thoracic injury patients without fracture (p<0.05). At 90 days, 57.1% of patients with sternal fracture had moderate to severe disability compared to 25.4% and 21.2% for both of the other groups, respectively (p<0.001). In this prospective study, we found that 12.5% (n=4, p<0.05) of patients with sternal fracture developed a delayed hemothorax, but the clinical significance of this remains questionable. The proportion of patients with sternal fracture who had moderate to severe disability was significantly higher than that of patients with other minor thoracic trauma.
Corrosion of stainless steel sternal wire after long-term implantation.
Tomizawa, Yasuko; Hanawa, Takao; Kuroda, Daisuke; Nishida, Hiroshi; Endo, Masahiro
2006-01-01
A variety of metallic components have been used in medical devices where lifelong durability and physical strength are demanded. To investigate the in vivo changes of implanted metallic medical devices in humans, stainless steel sternal wires removed from patients were evaluated. Stainless steel (316L) sternal wires removed from four patients after 10, 13, 22, and 30 years of implantation were evaluated using scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Macroscopically, the removed specimens maintained their metallic luster and color. Under SEM, small holes were observed sporadically at 10 years and they tended to connect in the drawing direction. The longer the implanted duration, the more numerous and deeper were the crevices observed. By EDS, sulfur, phosphorus, and calcium were identified in all areas at 10 years, in addition to the component elements of stainless steel, comprising iron, chromium, nickel, and manganese. Corrosion products observed at 30 years were identified as calcium phosphate. In conclusion, stainless steel sternal wires develop corroded pores that grow larger and deeper with time after implantation; however, the pores remain shallow even after decades of implantation and they may not be a cause of mechanical failure. An amount of metal ions equivalent to the corroded volume must have been released into the human body, but the effect of these metal ions on the body is not apparent.
Microbial Load in Septic and Aseptic Procedure Rooms.
Harnoss, Julian-Camill; Assadian, Ojan; Diener, Markus Karl; Müller, Thomas; Baguhl, Romy; Dettenkofer, Markus; Scheerer, Lukas; Kohlmann, Thomas; Heidecke, Claus-Dieter; Gessner, Stephan; Büchler, Markus Wolfgang; Kramer, Axel
2017-07-10
Highly effective measures to prevent surgical wound infections have been established over the last two decades. We studied whether the strict separation of septic and aseptic procedure rooms is still necessary. In an exploratory, prospective observational study, the microbial concentration in an operating room without a room ventilating system (RVS) was analyzed during 16 septic and 14 aseptic operations with the aid of an air sampler (50 cm and 1 m from the operative field) and sedimentation plates (1 m from the operative field, and contact culture on the walls). The means and standard deviations of the microbial loads were compared with the aid of GEE models (generalized estimation equations). In the comparison of septic and aseptic operations, no relevant differences were found with respect to the overall microbial concentration in the room air (401.7 ± 176.3 versus 388.2 ± 178.3 CFU/m 3 ; p = 0.692 [CFU, colony-forming units]) or sedimentation 1 m from the operative field (45.3 ± 22.0 versus 48.7 ± 18.5 CFU/m 2 /min; p = 0.603) and on the walls (35.7 ± 43.7 versus 29.0 ± 49.4 CFU/m 2 /min; p = 0.685). The only relevant differences between the microbial spectra associated with the two types of procedure were a small amount of sedimentation of Escherichia coli and Enterococcus faecalis in septic operations, and of staphylococcus aureus and pseudomonas stutzeri in aseptic operations, up to 30 minutes after the end of the procedure. These data do not suggest that septic and aseptic procedure rooms need to be separated. In interpreting the findings, one should recall that the study was not planned as an equivalence or non-inferiority study. Wherever patient safety is concerned, high-level safety concepts should only be demoted to lower levels if new and convincing evidence becomes available.
Sex estimation from sternal measurements using multidetector computed tomography.
Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur
2014-12-01
We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation.
Sex Estimation From Sternal Measurements Using Multidetector Computed Tomography
Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur
2014-01-01
Abstract We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation. Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30–60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090
2012-01-01
Background Wire closure still remains the preferred technique despite reasonable disadvantages. Associated complications, such as infection and sternal instability, cause time- and cost-consuming therapies. We present a new tool for sternal closure with its first clinical experience and results. Methods The sternal ZipFixTM System is based on the cable-tie principle. It primarily consists of biocompatible Poly-Ether-Ether-Ketone implants and is predominantly used peristernally through the intercostal space. The system provides a large implant-to-bone contact for better force distribution and for avoiding bone cut through. Results 50 patients were closed with the ZipFixTM system. No sternal instability was observed at 30 days. Two patients developed a mediastinitis that necessitated the removal of the device; however, the ZipFixTM were intact and the sternum remained stable. Conclusions In our initial evaluation, the short-term results have shown that the sternal ZipFixTM can be used safely and effectively. It is fast, easy to use and serves as a potential alternative for traditional wire closure. PMID:22731778
Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th.; Mauerer, Andreas; Hennig, Friedrich F.; Buder, Thomas
2015-01-01
Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture’s morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology. PMID
Morphology of the sternal gland in workers of Coptotermes gestroi (Isoptera, Rhinotermitidae).
Costa-Leonardo, A M
2006-01-01
The sternal gland is considered the only source of trail pheromones in termites. The morphology of the sternal gland was investigated in workers of Coptotermes gestroi using transmission and scanning electron microscopy. The results showed a small bilobed gland at the anterior part of the fifth abdominal sternite. The cuticular surface of the sternal gland showed a V-shaped structure with two peg sensilla in elevated socket and various campaniform sensilla. Pores and cuticular scale-like protuberances also occur in the glandular area. The ultrastructure showed a gland composed of class 1 cells and two different types of class 3 cells distinguished by location, different size and electron-density of secretory vesicles. Small class 3 cells (type 1) of the anterior lobe are inserted among class 1 cells and have weakly electron-dense vesicles associated with mitochondria, glycogen and smooth endoplasmic reticulum. The class 3 cells (type 2) of posterior lobe showed many round electron-lucent vesicles of secretion, abundant free ribosomes and a well-developed Golgi apparatus. Each class 3 cell is connected to the cuticle by a cuticular duct constituted by the receiving canal and the conducting canal. The secretion of class 1 cells is stored in an inner subcuticular reservoir that is delimited by the microvilli of these cells. This inner reservoir is large and crossed by the campaniform sensilla and ducts of two types of class 3 cells that open outside of the insect body. An exterior reservoir also is present between the fourth and fifth sternite. The complex structure of the sternal gland suggests multicomponents for the trail pheromone in the worker of C. gestroi.
Lan, Hong-Jing; Wu, Zhi-Qiang; Gong, Dong-Ge; Zheng, Wang-Yong; Jin, Yun
2017-11-01
Metachronous sternal metastasis of thyroid carcinoma was a rare disease. There was no consensus in the treatment for bone metastasis after the initial thyroid carcinoma surgery. A 53-year-old female patient was hospitalized due to recurrent dull chest pains, with a history of radical right side thyroid carcinoma 4 years ago. On examination, there was an irregular mass on the lower left half of the sternum. Computerized tomography scan showed sternal bone destruction with a soft tissue mass. Metachronous sternal metastasis of thyroid carcinoma. Partial resection of the sternum and reconstruction with a titanium alloy mesh were performed. After a 3-year follow-up, the patient had no recurrence. Surgical resection may be a sufficient treatment for metachronous sternal metastasis of thyroid carcinoma. Biosynthesis material mesh is preferred to be used.
[Aseptic cutaneous breast abscesses associated with ulcerative colitis].
Sallé de Chou, C; Ortonne, N; Hivelin, M; Wolkenstein, P; Chosidow, O; Valeyrie-Allanore, L
2016-02-01
Inflammatory bowel diseases are associated with a broad range of cutaneous lesions. Herein we report the first case of aseptic skin abscesses associated with ulcerative colitis. Since March 2008, a 40-year-old woman presented with bilateral mammary abscesses, relapsing despite repeated antibiotic treatment. She was followed for ulcerative colitis diagnosed in 2011 by means of a rectal biopsy. Despite four surgical procedures, there was no improvement in her mammary abscesses and bilateral mastectomy was then proposed because of the persistent symptoms. Her general state of health remained stable. Clinically, there were bilateral inflammatory nodes with fistulae and pus. These lesions were extremely painful. Mild inflammatory syndrome was noted, but the immunological tests revealed nothing of note. Bacteriological, parasitological and mycological tests on biopsy specimens were negative. Histological examination of a surgical biopsy revealed lymphoplasmacytic infiltration of the dermis and subcutis with altered polymorphonuclear cells and epithelioid granuloma. The CT-scan showed no other remote lesions. The final diagnosis was cutaneous aseptic abscess syndrome associated with ulcerative colitis. Colchicine 1mg/day was initiated and resulted in regression of the skin lesions, with complete remission at one year of follow-up. Aseptic abscess syndrome must be considered in the event of recurrent aseptic cutaneous abscesses which may be associated with inflammatory bowel disease. Surgery should be avoided and treatment should be based on suitable drug therapy. Copyright © 2016. Published by Elsevier Masson SAS.
Kuriyama, Motone; Yoshida, Yukitaka; Ninomiya, Hitoshi; Yamamoto, Shin; Sasaguri, Shiro; Akita, Shinsuke; Mitsukawa, Nobuyuki
2018-05-01
Poststernotomy deep sternal wound infections are persistent and occasionally fatal, especially in cases involving prosthetic grafts, because of their complicated structure and virtual impossibility of removal. We aimed to verify the influence of cooperation with plastic surgeons and our novel strategy for treating deep sternal wound infection after aortic replacement on cardiovascular surgery outcomes. Nine hundred eighty-three consecutive patients were divided into two groups: an early group (2012-2013) and a late group (2014-2015). The late group had received cooperatively improved perioperative wound management: our novel strategy of deep sternal infection based on radical debridement and immediate reconstruction decided by reference to severities of the patient's general condition and widespread infection by early intervention of plastic surgeons. The groups were analysed retrospectively. Binary variables were analysed statistically with the Fisher exact test and continuous variables with the Mann-Whitney U test. Inter-group differences were assessed with the chi-square test. Twenty of 390 cases in the early group and 13 of 593 cases in the late group were associated with deep sternal infection. Morbidity rates of deep sternal wound infection and associated mortality rates 1 year after reconstruction surgery were significantly less (p <0.05 for both) in the late group. Intervention by plastic surgeons improved perioperative wound management outcomes. Our treatment strategy for deep sternal wound infection also reduced associated mortality rates. Facilities should consider the early inclusion of plastic surgeons in the treatment of patients undergoing aortic replacement to facilitate better outcomes. Copyright © 2018 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Changes in the management of deep sternal wound infections: a 12-year review.
Lonie, Sarah; Hallam, Jane; Yii, Michael; Davis, Philip; Newcomb, Andrew; Nixon, Ian; Rosalion, Alexander; Ricketts, Sophie
2015-11-01
Deep sternal wound infection (DSWI) is a rare but life-threatening complication following cardiac surgery associated with increased morbidity and mortality. Management of these patients has evolved over the years and can include sternal rewiring, mediastinal irrigation, negative-pressure wound therapy (NPWT) dressing or repair with flaps. We reviewed changes in our management of DSWI and outcomes. Using the Australian and New Zealand Society of Cardiac and Thoracic Surgeons database, 5472 underwent cardiac surgery at St Vincent's Hospital, Melbourne, and 42 were identified as developing DSWI requiring re-operation between June 2002 and September 2014. Data were collected pertaining to risk factors for DSWI, management strategies and outcomes. Patients were compared from a period prior to NPWT dressing use (June 2002-February 2006, n = 14) and since the NPWT has been used regularly in the management of DSWI (from March 2006, n = 28). Patients were also compared based on the requirement for flap closure of their sternal wound. Because of the widespread use of NPWT dressings, there is a trend towards fewer sternal infections requiring flap closure (25 versus 42.8%) and less post-operative complications after definitive closure (7.1 versus 28.6%). Before and after widespread NPWT use, patients require similar number of re-operations before closure and have no significant differences in time to definitive closure or length of hospital stay. The use of NPWT dressings as a bridge to definitive closure may reduce the need for more burdensome flap reconstruction, does not delay definitive reconstruction or prolong hospital stay and may reduce post-reconstruction complications requiring re-operation. © 2015 Royal Australasian College of Surgeons.
Singh, Jagmahender; Pathak, R K; Chavali, Krishnadutt H
2011-03-20
Skeletal height estimation from regression analysis of eight sternal lengths in the subjects of Chandigarh zone of Northwest India is the topic of discussion in this study. Analysis of eight sternal lengths (length of manubrium, length of mesosternum, combined length of manubrium and mesosternum, total sternal length and first four intercostals lengths of mesosternum) measured from 252 male and 91 female sternums obtained at postmortems revealed that mean cadaver stature and sternal lengths were more in North Indians and males than the South Indians and females. Except intercostal lengths, all the sternal lengths were positively correlated with stature of the deceased in both sexes (P < 0.001). The multiple regression analysis of sternal lengths was found more useful than the linear regression for stature estimation. Using multivariate regression analysis, the combined length of manubrium and mesosternum in both sexes and the length of manubrium along with 2nd and 3rd intercostal lengths of mesosternum in males were selected as best estimators of stature. Nonetheless, the stature of males can be predicted with SEE of 6.66 (R(2) = 0.16, r = 0.318) from combination of MBL+BL_3+LM+BL_2, and in females from MBL only, it can be estimated with SEE of 6.65 (R(2) = 0.10, r = 0.318), whereas from the multiple regression analysis of pooled data, stature can be known with SEE of 6.97 (R(2) = 0.387, r = 575) from the combination of MBL+LM+BL_2+TSL+BL_3. The R(2) and F-ratio were found to be statistically significant for almost all the variables in both the sexes, except 4th intercostal length in males and 2nd to 4th intercostal lengths in females. The 'major' sternal lengths were more useful than the 'minor' ones for stature estimation The universal regression analysis used by Kanchan et al. [39] when applied to sternal lengths, gave satisfactory estimates of stature for males only but female stature was comparatively better estimated from simple linear regressions. But they
Adams, Jenny; Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L; Schussler, Jeffrey M
2016-01-01
Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying "the" appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum.
Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)
NASA Astrophysics Data System (ADS)
Ghiron, Kenneth; Litchfield, Bruce
1997-04-01
Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.
Degradation of 316L stainless steel sternal wire by steam sterilization.
Shih, Chun-Che; Su, Yea-Yang; Chen, Lung-Ching; Shih, Chun-Ming; Lin, Shing-Jong
2010-06-01
Sterilization is an important step prior to the implantation of medical devices inside the human body. In this work we studied the influence of steam sterilization cycles on the oxide film properties of stainless steel sternal wire. Characterization techniques such as open- circuit potential, potentiodynamic measurement, electrochemical impedance spectroscopy, cathodic stripping, transmission electron microscopy, atomic force microscopy and scanning electron microscopy were employed to investigate the cycles of steam sterilization on the corrosion behavior of sternal wire. The results showed that the oxide properties are a function of the number of steam sterilization cycles and deteriorate as the number of cycles increases. Steam sterilization might damage the implant integrity and heavy metals could be released to the surrounding tissues due to deterioration of the oxide film. Copyright 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Modified closure technique for reducing sternal dehiscence; a clinical and in vitro assessment.
John, Lindsay C H
2008-05-01
Although the incidence of sternal dehiscence is low its mortality can be high. An alternative technique is described (modified closure) which aims to redistribute the dehiscence force into the longer longitudinal axis rather than the shorter transverse axis, thereby maximising the closure strength. Four ethibond sutures, which interlock anteriorly, are used in addition to eight transverse sternal wires. The aim of the study was to assess the modified closure using both an in vitro and a clinical study. (a) In vitro study: A weight and traction pulley system applied a force of 0.1kN to pairs of silicone rubber hemisterna approximated to each other using alternative closure techniques. The dehiscence tendency (DT) was measured as the amount of separation under tension. Using 10 pairs of hemisterna for each closure technique the measured DT for the modified closure (MC) was compare with those for each of five alternative closures (two figure-of-eight and four transverse sutures (2C), 6 (6T), 8 (8T), 10 (10T) and 12 transverse sutures (12T)). (b) Clinical study: The incidence of sternal dehiscence for the first 4 years of a consultants' practice (using 8T) was compared with the second 4 years (using MC). (a) Measured DT (mean+/-SEM), (MC: 149+/-14; 6T: 256+/-13; 8T: 223+/-9; 10T: 213+/-13; 12T: 203+/-8; 2C: 294+/-15). DT was significantly smaller for MC (p<0.003). (b) The incidence of dehiscence was significantly smaller in the second 4 years (MC) than in the first (8T): 0.2% (1/529) versus 1.6% (13/788); p=0.01 In vitro and clinical studies suggest that the modified closure technique can reduce the incidence of sternal dehiscence.
2014-01-01
Background Aseptic technique and handwashing have been shown to be important factors in perioperative bacterial transmission, however compliance often remains low despite guidelines and educational programs. Infectious complications of neuraxial (epidural and spinal) anesthesia are severe but fortunately rare. We conducted a survey to assess aseptic technique practices for neuraxial anesthesia in Israel before and after publication of international guidelines (which focused on handwashing, jewelry/watch removal and the wearing of a mask and cap). Methods The sampling frame was the general anesthesiology workforce in hospitals selected from each of the four medical faculties in Israel. Data was collected anonymously over one week in each hospital in two periods: April 2006 and September 2009. Most anesthesiologists received the questionnaires at departmental staff meetings and filled them out during these meetings; additionally, a local investigator approached anesthesiologists not present at these staff meetings individually. Primary endpoint questions were: handwashing, removal of wristwatch/jewelry, wearing mask, wearing hat/cap, wearing sterile gown; answering options were: "always", "usually", "rarely" or "never". Primary endpoint for analysis: respondents who both always wash their hands and always wear a mask ("handwash-mask composite") - "always" versus "any other response". We used logistic regression to perform the analysis. Time (2006, 2009) and hospital were included in the analysis as fixed effects. Results 135/160 (in 2006) and 127/164 (in 2009) anesthesiologists responded to the surveys; response rate 84% and 77% respectively. Respondents constituted 23% of the national anesthesiologist workforce. The main outcome "handwash-mask composite" was significantly increased after guideline publication (33% vs 58%; p = 0.0003). In addition, significant increases were seen for handwashing (37% vs 63%; p = 0.0004), wearing of mask (61% vs 78%; p < 0
Neaman, Keith C; Blount, Andrew L; Kim, John A; Renucci, John D; Hooker, Robert L
2011-03-01
Deep sternal infections secondary to bony instability and malunion, can result in mediastinitis. Previous authors have described the use of prophylactic rigid plate fixation in high-risk patients. The purpose of our study is to review the use of prophylactic sternal platting with pectoralis advancement flaps in high-risk patients with a history of chest irradiation. Fourteen patients (July 2003-September 2008) with a history of chest irradiation who underwent a median sternotomy followed by prophylactic rigid plate fixation of the sternum were reviewed. Breast cancer was the most common etiology of chest irradiation (n=11, 78%). The average EuroSCORE was 24.06% with 72% of patients having a preoperative New York Heart Association (NYHA) class≥III. There were no episodes of sternal non-union, mediastinitis or death. Follow-up was 100% with a 0% 30-day and a 7.1% one-year mortality rate (non-cardiac). A comparison between mean preoperative left ventricular ejection fraction (LVEF) (49.6%) and postoperative LVEF (59.7%) was statistically significant (P<0.0001). All living patients currently maintain a NYHA class I/II. Prophylactic rigid plate fixation and pectoralis flap coverage decreases the risk of developing sternal dehiscence and postoperative wound complications and should therefore be considered in high-risk patients with a history of chest irradiation.
Song, David H; Wu, Liza C; Lohman, Robert F; Gottlieb, Lawrence J; Franczyk, Mieczyslawa
2003-01-01
A method to refine the treatment of sternal wounds using Vacuum Assisted Closure (V.A.C.) therapy as the bridge between débridement and delayed definitive closure is described. A retrospective review of 35 consecutive patients with sternal wound complications over a 2-year period (March of 1999 to March of 2001) was performed. The treatment of sternal wounds with traditional twice-a-day dressing changes was compared with the treatment with the wound V.A.C. device. An analysis of the number of days between initial débridement and closure, number of dressing changes, number and types of flaps needed for reconstruction, and complications was performed. Eighteen patients were treated with traditional twice-a-day dressing changes and 17 patients were treated with V.A.C. therapy alone. The two groups were similar regarding age, sex, type of cardiac procedure, and type of sternal wound. The V.A.C. therapy group had a trend toward a shorter interval between débridement and closure, with a mean of 6.2 days, whereas the dressing change group had mean of 8.5 days. The V.A.C. therapy group had a significantly lower number of dressing changes, with a mean of three, whereas the twice-a-day dressing change group had a mean of 17 (p < 0.05). Reconstruction required an average of 1.5 soft-tissue flaps per patient treated with traditional dressing changes versus 0.9 soft-tissue flaps per patient for those treated with V.A.C. therapy (p < 0.05). Before closure, there was one death among patients undergoing dressing changes and three in the V.A.C. therapy group, all of which were unrelated to the management of the sternal wound. Patients with sternal wounds who have benefited from V.A.C. therapy alone have a significant decrease in the number of dressing changes and number of soft-tissue flaps needed for closure. Finally, the V.A.C. therapy group had a trend toward a decreased number of days between débridement and closure.
Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B.; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L.; Schussler, Jeffrey M.
2016-01-01
Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying “the” appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187
Day, Kevin; Oliva, Isabel; Krupinski, Elizabeth; Marcus, Frank
2015-01-01
Precordial ECG lead placement is difficult in obese patients with increased chest wall soft tissues due to inaccurate palpation of the intercostal spaces. We investigated whether the length of the sternum (distance between the sternal notch and xiphoid process) can accurately predict the location of the 4th intercostal space, which is the traditional location for V1 lead position. Fifty-five consecutive adult chest computed tomography examinations were reviewed for measurements. The sternal notch to right 4th intercostal space distance was 67% of the sternal notch to xiphoid process length with an overall correlation of r=0.600 (p<0.001). The above measurement may be utilized to locate the 4th intercostal space for accurate placement of the precordial electrodes in adults in whom the 4th intercostal space cannot be found by physical exam. Copyright © 2015 Elsevier Inc. All rights reserved.
[Recurrent aseptic meningitis secondary to taking ibuprofen and ketorolac].
Cano Vargas-Machuca, E; Mondéjar-Marín, B; Navarro-Muñoz, S; Pérez-Molina, I; Garrido-Robres, J A; Alvarez-Tejerina, A
Aseptic meningitis is a process that is characterised by an inflammatory reaction of the meninges that is not due to any infectious agent. Its aetiology is varied and is most frequently caused by rheumatologic and/or autoimmune processes, chemical or medication-induced meningitis, the most notable drugs involved being antibiotics and non-steroidal anti-inflammatory drugs (NSAI). We report the case of a 70-year-old male, with no relevant history, who was admitted to hospital five times over a period of 16 months because of acute meningitis with polymorphonuclear pleocytosis, high protein levels in cerebrospinal fluid and normal glucose in cerebrospinal fluid. No evidence of an infectious causation, chemical meningitis, carcinomatosis or autoimmune disease was found and the patient was diagnosed with recurrent aseptic meningitis. It was found that the patient had taken ibuprofen or ketorolac on several occasions, a few hours before the appearance of symptoms. These episodes were quickly resolved after withdrawal of this medication. A number of NSAI have been reported as inducers of aseptic meningitis, one of the most notable being ibuprofen. We report the case of a patient who, as a consequence of taking ibuprofen and ketorolac, presented episodes of recurrent aseptic meningitis. To our knowledge this side effect of ketorolac has not been reported before. Its clinical features are impossible to differentiate from those of infectious meningitis. Diagnosis is reached by exclusion and a careful pharmacological study, including over-the-counter drugs like some of the NSAI, must be performed in patients with this condition, since it is a problem that can easily be solved by withdrawing the drug that causes it.
Anderson, N M; Walker, P N
2011-08-01
This study was carried out to investigate segmented-flow aseptic processing of particle foods. A pilot-scale continuous steam sterilization unit capable of producing shelf stable aseptically processed whole and sliced mushrooms was developed. The system utilized pressurized steam as the heating medium to achieve high temperature-short time processing conditions with high and uniform heat transfer that will enable static temperature penetration studies for process development. Segmented-flow technology produced a narrower residence time distribution than pipe-flow aseptic processing; thus, whole and sliced mushrooms were processed only as long as needed to achieve the target F₀ = 7.0 min and were not overcooked. Continuous steam sterilization segmented-flow aseptic processing produced shelf stable aseptically processed mushrooms of superior quality to conventionally canned mushrooms. When compared to conventionally canned mushrooms, aseptically processed yield (weight basis) increased 6.1% (SD = 2.9%) and 6.6% (SD = 2.2%), whiteness (L) improved 3.1% (SD = 1.9%) and 4.7% (SD = 0.7%), color difference (ΔE) improved 6.0% (SD = 1.3%) and 8.5% (SD = 1.5%), and texture improved 3.9% (SD = 1.7%) and 4.6% (SD = 4.2%), for whole and sliced mushrooms, respectively. Segmented-flow aseptic processing eliminated a separate blanching step, eliminated the unnecessary packaging of water and promoted the use of bag-in-box and other versatile aseptic packaging methods. Segmented-flow aseptic processing is capable of producing shelf stable aseptically processed particle foods of superior quality to a conventionally canned product. This unique continuous steam sterilization process eliminates the need for a separate blanching step, reduces or eliminates the need for a liquid carrier, and promotes the use of bag-in-box and other versatile aseptic packaging methods. © 2011 Institute of Food Technologists®
Aseptic and Bacterial Meningitis: Evaluation, Treatment, and Prevention.
Mount, Hillary R; Boyle, Sean D
2017-09-01
The etiologies of meningitis range in severity from benign and self-limited to life-threatening with potentially severe morbidity. Bacterial meningitis is a medical emergency that requires prompt recognition and treatment. Mortality remains high despite the introduction of vaccinations for common pathogens that have reduced the incidence of meningitis worldwide. Aseptic meningitis is the most common form of meningitis with an annual incidence of 7.6 per 100,000 adults. Most cases of aseptic meningitis are viral and require supportive care. Viral meningitis is generally self-limited with a good prognosis. Examination maneuvers such as Kernig sign or Brudzinski sign may not be useful to differentiate bacterial from aseptic meningitis because of variable sensitivity and specificity. Because clinical findings are also unreliable, the diagnosis relies on the examination of cerebrospinal fluid obtained from lumbar puncture. Delayed initiation of antibiotics can worsen mortality. Treatment should be started promptly in cases where transfer, imaging, or lumbar puncture may slow a definitive diagnosis. Empiric antibiotics should be directed toward the most likely pathogens and should be adjusted by patient age and risk factors. Dexamethasone should be administered to children and adults with suspected bacterial meningitis before or at the time of initiation of antibiotics. Vaccination against the most common pathogens that cause bacterial meningitis is recommended. Chemoprophylaxis of close contacts is helpful in preventing additional infections.
Benedetto, Umberto; Raja, Shahzad G
2014-11-01
The effectiveness of the routine retrosternal placement of a gentamicin-impregnated collagen sponge (GICS) implant before sternotomy closure is currently a matter of some controversy. We aimed to develop a scoring system to guide decision making for the use of GICS to prevent deep sternal wound infection. Fast backward elimination on predictors, including GICS, was performed using the Lawless and Singhal method. The scoring system was reported as a partial nomogram that can be used to manually obtain predicted individual risk of deep sternal wound infection from the regression model. Bootstrapping validation of the regression models was performed. The final populations consisted of 8750 adult patients undergoing cardiac surgery through full sternotomy during the study period. A total of 329 patients (3.8%) received GICS implant. The overall incidence of deep sternal wound infection was lower among patients who received GICS implant (0.6%) than patients who did not (2.01%) (P=.02). A nomogram to predict the individual risk for deep sternal wound infection was developed that included the use of GICS. Bootstrapping validation confirmed a good discriminative power of the models. The scoring system provides an impartial assessment of the decision-making process for clinicians to establish if GICS implant is effective in reducing the risk for deep sternal wound infection in individual patients undergoing cardiac surgery through full sternotomy. Copyright © 2014 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.
Mumps vaccine virus strains and aseptic meningitis.
Bonnet, Marie-Claude; Dutta, Anil; Weinberger, Clement; Plotkin, Stanley A
2006-11-30
Mumps immunization can easily be included in national schedules, particularly if combined with measles or measles and rubella vaccines, but debate continues concerning the relative safety of various licensed mumps vaccine strains. The opportunities for control of mumps are also being affected by differences in the cost of the vaccines prepared with different strains of mumps virus. The present report evaluates available data on the association of the Urabe and other strains of mumps vaccine with the occurrence of aseptic meningitis. We also review the comparative immunogenicity and efficacies of the most widely used mumps vaccines in controlled clinical trials and field evaluations, and briefly examine relative cost as it relates to the implementation of national immunization programs. We conclude that extensive experience with the most widely used mumps vaccine strains in many countries has shown that the risk-benefit ratio of live mumps vaccines is highly favourable for vaccination, despite the occasional occurence of aseptic meningitis.
Diabetes Mellitus and Hyperglycemia and the Risk of Aseptic Loosening in Total Joint Arthroplasty.
Maradit Kremers, Hilal; Schleck, Cathy D; Lewallen, Eric A; Larson, Dirk R; Van Wijnen, Andre J; Lewallen, David G
2017-09-01
It is unknown to what extent diabetes mellitus modifies the long-term risk of aseptic loosening in total hip arthroplasty (THA) and total knee arthroplasty (TKA). We examined the association between diabetes mellitus, perioperative hyperglycemia, and the likelihood of revisions for aseptic loosening. We studied 16,085 primary THA and TKA procedures performed at a large tertiary care hospital between 2002 and 2009. All blood glucose values around the time of surgery (within 1 week) were retrieved. Subsequent revision surgeries and the reasons for revision were ascertained through the institutional joint registry. Multivariate Cox models were used to estimate the hazard ratios (HRs) and 95% confidence intervals (CIs) for aseptic loosening associated with diabetes mellitus and hyperglycemia adjusting for age, gender, body mass index, and surgery type. A total of 2911 (18%) surgeries had a diagnosis of diabetes mellitus at the time of surgery. Glucose testing was performed at least once in 7055 (44%) procedures within ±1 week of surgery. Although diabetic patients did not experience a higher risk of revision for aseptic loosening (HR, 0.87; 95% CI, 0.55-1.38), higher preoperative glucose values on the day before surgery were significantly associated with both the overall risk of revisions (HR, 2.80; 95% CI, 1.00-7.85) and revisions for aseptic loosening (HR, 4.95; 95% CI, 1.26-19.54). High preoperative hyperglycemia is a potential risk factor for aseptic loosening in THA and TKA. Copyright © 2017 Elsevier Inc. All rights reserved.
Failure of aseptic revision total knee arthroplasties
Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove
2015-01-01
Background and purpose In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. Method This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. Results 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). Interpretation In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties. PMID:25267502
Estimating Age of Mature Adults from the Degeneration of the Sternal End of the Clavicle
Falys, Ceri G; Prangle, Dennis
2015-01-01
The sternal end of the clavicle has been illustrated to be useful in aging young adults, however, no studies have investigated what age-related changes occur to the sternal end post epiphyseal fusion. In this study, three morphological features (i.e., surface topography, porosity, and osteophyte formation) were examined and scored using 564 clavicles of individuals of European ancestry (n = 318 males; n = 246 females), with known ages of 40+ years, from four documented skeletal collections: Hamann-Todd, Pretoria, St. Bride's, and Coimbra. An ordinal scoring method was developed for each of the three traits. Surface topography showed the strongest correlation with age, and composite scores (formed by summing the three separate trait scores) indicated progressive degeneration of the surface with increasing chronological age. Linear regression analyses were performed on the trait scores to produce pooled-sample age estimation equations. Blind tests of the composite score method and regression formulae on 56 individuals, aged 40+ years, from Christ Church Spitalfields, suggest accuracies of 96.4% for both methods. These preliminary results display the first evidence of the utility of the sternal end of the clavicle in aging older adult individuals. However, in the current format, these criteria should only be applied to individuals already identified as over 40 years in order to refine the age ranges used for advanced age. These findings do suggest the sternal end of the clavicle has potential to aid age estimates beyond the traditional “mature adult” age category (i.e., 46+ years), and provides several suggestions for future research. Am J Phys Anthropol 156:203–214, 2015. © 2014 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc. PMID:25327699
Early Migration Predicts Aseptic Loosening of Cementless Femoral Stems: A Long-term Study.
Streit, Marcus R; Haeussler, Daniel; Bruckner, Thomas; Proctor, Tanja; Innmann, Moritz M; Merle, Christian; Gotterbarm, Tobias; Weiss, Stefan
2016-07-01
Excessive early migration of cemented stems and cups after THA has been associated with poor long-term survival and allows predictable evaluation of implant performance. However, there are few data regarding the relationship between early migration and aseptic loosening of cementless femoral components, and whether early migration might predict late failure has not been evaluated, to our knowledge. Einzel-Bild-Röntgen-Analyse-femoral component analysis (EBRA-FCA) is a validated technique to accurately measure axial femoral stem migration without the need for tantalum markers, can be performed retrospectively, and may be a suitable tool to identify poor performing implants before their widespread use. We asked: (1) Is axial migration within the first 24 months as assessed by EBRA-FCA greater among cementless stems that develop aseptic loosening than those that remain well fixed through the second decade; (2) what is the diagnostic performance of implant migration at 24 months postoperatively to predict later aseptic loosening of these components; and (3) how does long-term stem survivorship compare between groups with high and low early migration? We evaluated early axial stem migration in 158 cementless THAs using EBRA-FCA. The EBRA-FCA measurements were performed during the first week postoperatively (baseline measurement) and at regular followups of 3, 6, and 12 months postoperatively and annually thereafter. The mean duration of followup was 21 years (range, 18-24 years). The stems studied represented 45% (158 of 354) of the cementless THAs performed during that time, and cementless THAs represented 34% (354 of 1038) of the THA practice during that period. No patient enrolled in this study was lost to followup. Multivariate survivorship analysis using Cox's regression model was performed with an endpoint of aseptic loosening of the femoral component. Loosening was defined according to the criteria described by Engh et al. and assessed by two independent
Aseptic meningitis in children--the Singapore experience.
Tee, W S N; Choong, C T; Lin, R V T P; Ling, A E
2002-11-01
To study the incidence, aetiology, clinical characteristics and management of paediatric aseptic meningitis in a paediatric hospital in Singapore. Patients with cerebrospinal fluid (CSF) pleocytosis, a negative Gram stain and bacterial culture were reviewed retrospectively from 1 January to 31 December 2000. Eighty-seven patients who fulfilled the criteria for aseptic meningitis and without neurological deficits were studied. In addition, reverse transcriptase polymerase chain reaction (RT-PCR) using pan enterovirus primers was subsequently performed on 73 of these CSF specimens which were available for storage. The incidence of aseptic meningitis was approximately 37 cases per 10,000 admissions. Non-polio enteroviruses were isolated from 29 of 64 (45.3%) CSF and 38 of 52 (73.1%) stool samples. RT-PCR was positive in 43 (58.9%) of the archived CSF specimens. The aetiologies of the remaining cases were mostly unidentified. Their ages ranged from 5 days to 12 years (median, 2 months). All patients except 1 had fever. Vomiting or poor feeding occurred in 44.7%, cough or running nose in 35.3%, irritability was observed in 35.3%, seizures in 7.1%, a rash in 10.6% and diarrhoea in 5.9%. All patients recovered without sequelae. The median CSF white cell count was 212 cells/mm3 (range, 7 to 12,000). The median glucose concentration was 2.7 mmol/L (range, 1.6 to 4.4). The median CSF/blood glucose ratio was 0.52 (range, 0.23 to 0.73). Median length of stay was 7 days (range, 4 to 17). Eighty-four patients (96.6%) received antibiotics for a median of 5.5 days (range, 2 to 14). Enteroviruses were the most common aetiologic agent identified. A method of early diagnosis using RT-PCR for enteroviruses is necessary to reduce the current duration of antibiotic usage and to decrease the length of hospital stay.
Proposal for a new categorization of aseptic processing facilities based on risk assessment scores.
Katayama, Hirohito; Toda, Atsushi; Tokunaga, Yuji; Katoh, Shigeo
2008-01-01
Risk assessment of aseptic processing facilities was performed using two published risk assessment tools. Calculated risk scores were compared with experimental test results, including environmental monitoring and media fill run results, in three different types of facilities. The two risk assessment tools used gave a generally similar outcome. However, depending on the tool used, variations were observed in the relative scores between the facilities. For the facility yielding the lowest risk scores, the corresponding experimental test results showed no contamination, indicating that these ordinal testing methods are insufficient to evaluate this kind of facility. A conventional facility having acceptable aseptic processing lines gave relatively high risk scores. The facility showing a rather high risk score demonstrated the usefulness of conventional microbiological test methods. Considering the significant gaps observed in calculated risk scores and in the ordinal microbiological test results between advanced and conventional facilities, we propose a facility categorization based on risk assessment. The most important risk factor in aseptic processing is human intervention. When human intervention is eliminated from the process by advanced hardware design, the aseptic processing facility can be classified into a new risk category that is better suited for assuring sterility based on a new set of criteria rather than on currently used microbiological analysis. To fully benefit from advanced technologies, we propose three risk categories for these aseptic facilities.
Risk factors for total hip arthroplasty aseptic revision.
Khatod, Monti; Cafri, Guy; Namba, Robert S; Inacio, Maria C S; Paxton, Elizabeth W
2014-07-01
The purpose of this study was to evaluate patient, operative, implant, surgeon, and hospital factors associated with aseptic revision after primary THA in patients registered in a large US Total Joint Replacement Registry. A total of 35,960 THAs registered from 4/2001-12/2010 were evaluated. The 8-year survival rate was 96.7% (95% CI 96.4%-97.0%). Females had a higher risk of aseptic revision than males. Hispanic and Asian patients had a lower risk of revision than white patients. Ceramic-on-ceramic, ceramic-on-conventional polyethylene, and metal-on-conventional polyethylene bearing surfaces had a higher risk of revision than metal-on-highly cross-linked polyethylene. Body mass index, health status, diabetes, diagnosis, fixation, approach, bilateral procedures, head size, surgeon fellowship training, surgeon and hospital volume were not revision risk factors. Copyright © 2014 Elsevier Inc. All rights reserved.
[Recent advances in treatment of aseptic femoral shaft nonunion].
Zhang, Wei; Chen, Hua; Tang, Peifu
2018-05-01
To review the recent advances in treatment of aseptic femoral shaft nonunion. The clinical studies about the treatments of aseptic femoral shaft nonunion in recent years were widely reviewed and analyzed. There are several surgical methods for aseptic femoral shaft nonunion. Due to uncertain clinical outcome, dynamization of nail should be carefully selected. The exchange nailing is suitable for the hypertrophic nonunion of the isthmal femoral shaft fracture. The exchange lateral plating is suitable for nonunion with obvious malformation. However, wave plate or dual plate should be chosen when the bone nonuinon is combined with the medial defect. The augmentation plating improves the success rate of nailing for femoral shaft nonunion, but it should be carefully selected for patients with obvious deformity or bone defect. Ilizarov technique is suitable for various bone nonunion, especially with complicated or large segmental bone defects. Induced membrane technique is also an important method for the treatment of bone nonunion with large bone defects. The clinical efficacy of the blocking screw remains to be supported by further evidence. Biological stimulants are mainly used for atrophic nonunion, and the clinical efficacy of them alone are still controversial. Due to lack of comparative studies between different surgical methods, the orthopedist should choose the appropriate treatment according to the individual situations of the patient and the types of bone nonunion.
Gothesen, Oystein; Lygre, Stein Hakon L; Lorimer, Michelle; Graves, Stephen; Furnes, Ove
2017-01-01
Background and purpose — Given similar functional outcomes with mobile and fixed bearings, a difference in survivorship may favor either. This study investigated the risk of aseptic loosening for the most used subtypes of mobile-bearing rotating-platform knees, in Norway and Australia. Patients and methods — Primary TKRs reported to the Norwegian and Australian joint registries, between 2003 and 2014, were analyzed with aseptic loosening as primary end-point and all revisions as secondary end-point. We hypothesized that no difference would be found in the rate of revision between rotating-platform and the most used fixed-bearing TKRs, or between keeled and non-keeled tibia. Kaplan–Meier estimates and curves, and Cox regression relative risk estimates adjusted for age, sex, and diagnosis were used for comparison. Results — The rotating-platform TKRs had an increased risk of revision for aseptic loosening compared with the most used fixed-bearing knees, in Norway (RR =6, 95% CI 4–8) and Australia (RR =2.1, 95% CI 1.8–2.5). The risk of aseptic loosening as a reason for revision was highest in Norway compared with Australia (RR =1.7, 95% CI 1.4–2.0). The keeled tibial component had the same risk of aseptic loosening as the non-keeled tibia (Australia). Fixation method and subtypes of the tibial components had no impact on the risk of aseptic loosening in these mobile-bearing knees. Interpretation — The rotating-platform TKRs in this study appeared to have a higher risk of revision for aseptic loosening than the most used fixed-bearing TKRs. PMID:28929828
Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen
2017-01-01
Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they
[Early aseptic loosening of the CF 30 femoral stem].
Kovanda, M; Havlícek, V; Hudec, J
2007-02-01
The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months
Lähdeoja, Tuomas; Pajarinen, Jukka; Kouri, Vesa-Petteri; Sillat, Tarvo; Salo, Jari; Konttinen, Yrjö T
2010-02-01
Bacterial remnants and subclinical biofilms residing on prosthesis surfaces have been speculated to play a role in hip implant loosening by opsonizing otherwise relatively inert wear particles. The innate immune system recognizes these microbial pathogen-associated molecular patterns (PAMPs) using Toll-like receptors (TLRs). Our objective was to evaluate the possible presence of TLRs in aseptic synovial membrane-like interface tissue. Bacterial culture-negative, aseptic (n = 4) periprosthetic synovial membrane-like tissue was compared to osteoarthritis synovial membrane (n = 5) for the presence of cells positive for all known human functional TLRs, stained using specific antibodies by immunohistochemistry, and evaluated using morphometry. In comparison to osteoarthtritic synovium, the number of TLR-positive cells was found to be increased in the aseptic setting, reflecting the considerable macrophage infiltration to the tissues investigated. Thus aseptic periprosthetic tissue seems to be very reactive to PAMPs. It has been recently recognized that TLR do not only respond to traditional PAMPs, but also to endogenous alarmings or danger signals released from necrotic and activated cells. Alarming-TLR interaction in the periprosthetic tissue might be a novel mechanism of aseptic loosening of endoprosthesis. (c) 2009 Orthopaedic Research Society.
Optic neuritis following aseptic meningitis associated with modified measles: a case report.
Nakajima, Nobuhito; Ueda, Masayuki; Yamazaki, Mineo; Takahashi, Toshiyuki; Katayama, Yasuo
2013-01-01
In this study, we report the case of a 35-year-old woman with modified measles complicated by aseptic meningitis and subsequent optic neuritis. Although her initial manifestations were only flu-like symptoms without any Koplik's spots or skin rashes, virological testing confirmed an acute measles infection. Subsequently, right optic neuritis appeared after aseptic meningitis and was completely resolved following steroid pulse therapy. In general, modified measles is believed to be associated with mild symptoms and few neurological complications; however, our present observations demonstrated that modified measles can cause rapid neurological complications.
Choi, Young Jin; Park, Kwi Sung; Baek, Kyoung Ah; Jung, Eun Hye; Nam, Hae Seon; Kim, Yong Bae; Park, Joon Soo
2010-03-01
Evaluation of the primary etiologic agents that cause aseptic meningitis outbreaks may provide valuable information regarding the prevention and management of aseptic meningitis. In Korea, an outbreak of aseptic meningitis caused by echovirus type 30 (E30) occurred from May to October in 2008. In order to determine the etiologic agent, CSF and/or stool specimens from 140 children hospitalized for aseptic meningitis at Soonchunhyang University Cheonan Hospital between June and October of 2008 were tested for virus isolation and identification. E30 accounted for 61.7% (37 cases) and echovirus 6 accounted for 21.7% (13 cases) of all the human enteroviruses (HEVs) isolates (60 cases in total). For the molecular characterization of the isolates, the VP1 gene sequence of 18 Korean E30 isolates was compared pairwise using the MegAlign with 34 reference strains from the GenBank database. The pairwise comparison of the nucleotide sequences of the VP1 genes demonstrated that the sequences of the Korean strains differed from those of lineage groups A, B, C, D, E, F and G. Reconstruction of the phylogenetic tree based on the complete VP1 nucleotide sequences resulted in a monophyletic tree, with eight clustered lineage groups. All Korean isolates were segregated from other lineage groups, thus suggesting that the Korean strains were a distinct lineage of E30, and a probable cause of this outbreak. This manuscript is the first report, to the best of our knowledge, of the molecular characteristics of E30 strains associated with an aseptic meningitis outbreak in Korea, and their respective phylogenetic relationships.
Woodward, Cathy; Taylor, Richard; Son, Minnette; Taeed, Roozbeh; Jacobs, Marshall L; Kane, Lauren; Jacobs, Jeffrey P; Husain, S Adil
2017-07-01
Children undergoing cardiac surgery are at risk for sternal wound infections (SWIs) leading to increased morbidity and mortality. Single-center quality improvement (QI) initiatives have demonstrated decreased infection rates utilizing a bundled approach. This multicenter project was designed to assess the efficacy of a protocolized approach to decrease SWI. Pediatric cardiac programs joined a collaborative effort to prevent SWI. Programs implemented the protocol, collected compliance data, and provided data points from local clinical registries using Society of Thoracic Surgery Congenital Heart Surgery Database harvest-compliant software or from other registries. Nine programs prospectively collected compliance data on 4,198 children. Days between infections were extended from 68.2 days (range: 25-82) to 130 days (range: 43-412). Protocol compliance increased from 76.7% (first quarter) to 91.3% (final quarter). Ninety (1.9%) children developed an SWI preprotocol and 64 (1.5%) postprotocol, P = .18. The 657 (15%) delayed sternal closure patients had a 5% infection rate with 18 (5.7%) in year 1 and 14 (4.3%) in year 2 P = .43. Delayed sternal closure patients demonstrated a trend toward increased risk for SWI of 1.046 for each day the sternum remained open, P = .067. Children who received appropriately timed preop antibiotics developed less infections than those who did not, 1.9% versus 4.1%, P = .007. A multicenter QI project to reduce pediatric SWIs demonstrated an extension of days between infections and a decrease in SWIs. Patients who received preop antibiotics on time had lower SWI rates than those who did not.
Femoral Component Varus Malposition is Associated with Tibial Aseptic Loosening After TKA.
Lee, Bum-Sik; Cho, Hyun-Ik; Bin, Seong-Il; Kim, Jong-Min; Jo, Byeong-Kyu
2018-02-01
The notion that neutral alignment is mandatory to assure long-term durability after TKA has been based mostly on short-film studies. However, this is challenged by recent long-film studies. We conducted this long-film study to know (1) whether the risk of aseptic revision for nontraumatic reasons was greater among knees with greater than 3° varus or valgus (defined as "outliers") than those that were aligned within 3° of neutral on long-standing mechanical axis (hip to knee) radiographs; and (2) what the failure mechanisms were and whether the malalignment was femoral or tibial in origin, or both, among those in the outlier group. Between November 1998 and January 2009 we performed 1299 cemented, posterior cruciate ligament-substituting TKAs in 867 patients for primary osteoarthritis. We had inadequate long-standing radiographs to analyze postoperative alignment for 124 of those knees, and an additional 24 were excluded for prespecified reasons. Consequently, 1151 knees were enrolled in our study. Of these, 982 (85%) in 661 patients (620 women and 41 men) who had followup greater than 24 months were analyzed. The knees were divided according to whether the postoperative mechanical axis was neutral (0° ± 3°), varus (> 3°), or valgus (< -3°) alignment on long-standing radiographs. The survivorships free from aseptic revision for nontraumatic reasons were compared among groups. The mechanical femoral and the tibial component alignment (MFCA and MTCA, respectively) were investigated to know the origin of overall mechanical malalignment of the outlier knees. The mean duration of followup was 8 ± 4 years (range, 2-17 years). Thirty-five knees (4%) showed aseptic loosening at 7 ± 4 years (range, 0.1-14 years) and five (1%) showed polyethylene wear at 12 ± 1 years (range, 10-13 years). Tibial loosening (73%) was the most common reason for aseptic revision followed by femoral loosening (30%). Of this cohort, 687 (70%), 250 (25%), and 45 (5%) knees had overall
Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia
2016-01-01
Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to
Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia
2016-01-01
Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or
Viral etiology of aseptic meningitis among children in southern Iran.
Hosseininasab, Ali; Alborzi, Abdolvahab; Ziyaeyan, Mazyar; Jamalidoust, Marzieh; Moeini, Mahsa; Pouladfar, Gholamreza; Abbasian, Amin; Kadivar, Mohamad Rahim
2011-05-01
Aseptic meningitis refers to a clinical syndrome of meningeal inflammation in which bacteria cannot be identified in the cerebrospinal fluid (CSF). The viral etiology and the epidemiological, clinical, and laboratory characteristics of aseptic meningitis among children aged 2 months to 15 years in Shiraz, southern Iran were determined. From May 2007 to April 2008, 65 patients were admitted to the hospital with aseptic meningitis. Seven viruses, non-polio human enteroviruses, mumps virus, herpes simplex virus (HSV), varicella-zoster virus (VZV), human cytomegalovirus (HCMV), human herpes virus type 6 (HHV-6), and Epstein-Barr virus (EBV) were investigated by polymerase chain reaction (PCR) method. Viruses were detected in 30 (46.2%) patients in whom non-polio human enterovirus and mumps virus were detected in 13 (43.3%) and 11 (36.7%), respectively. The remaining 6 (20%) of the cases were caused by HSV, VZV, HCMV, and HHV-6. Haemophilus influenzae and non-polio human enterovirus were detected in one patient simultaneously. Viral meningitis was found to be more frequent during spring and summer. The majority (66.6%) of the patients were treated in the hospital for 10 days and had received antibiotics in the case of bacterial meningitis. Rapid diagnosis of viral meningitis using PCR testing of CSF can help shorten hospitalization, and avoid the unnecessary use of antibiotics. Copyright © 2011 Wiley-Liss, Inc.
Guinet, Roland; Berthoumieu, Nicole; Dutot, Philippe; Triquet, Julien; Ratajczak, Medhi; Thibaudon, Michel; Bechaud, Philippe; Arliaud, Christophe; Miclet, Edith; Giordano, Florine; Larcon, Marjorie; Arthaud, Catherine
Environmental monitoring and aseptic process simulations represent an integral part of the microbiological quality control system of sterile pharmaceutical products manufacturing operations. However, guidance documents and manufacturers practices differ regarding recommendations for incubation time and incubation temperature, and, consequently, the environmental monitoring and aseptic process simulation incubation strategy should be supported by validation data. To avoid any bias coming from in vitro studies or from single-site manufacturing in situ studies, we performed a collaborative study at four manufacturing sites with four samples at each location. The environmental monitoring study was performed with tryptic soy agar settle plates and contact plates, and the aseptic process simulation study was performed with tryptic soy broth and thioglycolate broth. The highest recovery rate was obtained with settle plates (97.7%) followed by contact plates (65.4%) and was less than 20% for liquid media (tryptic soy broth 19% and thioglycolate broth 17%). Gram-positive cocci and non-spore-forming Gram-positive rods were largely predominant with more than 95% of growth and recovered best at 32.5 °C. The highest recovery of molds was obtained at 22.5 °C alone or as the first incubation temperature. Strict anaerobes were not recovered. At the end of the five days of incubation no significant statistical difference was obtained between the four conditions. Based on these data a single incubation temperature at 32.5 °C could be recommended for these four manufacturing sites for both environmental monitoring and aseptic process simulation, and a second plate could be used, periodically incubated at 22.5 °C. Similar studies should be considered for all manufacturing facilities in order to determine the optimal incubation temperature regime for both viable environmental monitoring and aseptic process simulation. Microbiological environmental monitoring and aseptic process
Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel
1977-06-01
Health, Education, and Welfare, Washington, D.C. Kawashima, M., T. Torisu, K. Hayashi, and Y. Kamo. 1974. Avascular bone necrosis in Japanese diving...5ÜL ^4- P=- 7 RESEM^a^ATORY SUBMARINE BASE, GROTON, CONN. REPORT NUMBER 854 ASEPTIC BONE NECROSIS AMONG U. S. NAVY DIVERS: Survey of 934...Approved for public release; distribution unlimited SUMMARY PAGE THE PROBLEM Aseptic boire~ necrosis tABN) has beelTknown toT5e~ associated with
Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie
2013-04-01
Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing
Cunha, Burke A; Warren-Favorito, Heather; Mickail, Nardeen
2011-01-01
Chickenpox is caused by the varicella zoster virus (VZV) and may be more severe in adults than in children. Central nervous system (CNS) manifestations of chickenpox and VZV are uncommon, for example, encephalitis and cerebellar ataxis. Viral (aseptic) meningitis is a rare CNS complication of VZV. The cerebrospinal fluid (CSF) profile in VZV viral (aseptic) meningitis is indistinguishable from other causes of viral meningitis. The clue to most of the diagnoses of VZV aseptic meningitis is based on the temporal relationship between antecedent or concomitant chickenpox. Chickenpox is a clinical diagnosis based on the appearance and distribution of the rash. The rash of chickenpox is vesicular/pruritic and typically appears in crops over 3 successive days. VZV vesicles are fragile, superficial, and surrounded by a erythematous halo. Common nonspecific laboratory findings in chickenpox include leukopenia, thrombocytopenia, and elevated serum transaminases (serum glutamate-oxaloacetate transaminase/serum glutamate-pyruvate transaminase). The erythrocyte sedimentation rate (ESR) is not highly elevated in chickenpox. In VZV aseptic meningitis, the CSF shows a lymphocytic pleocytosis with normal protein, glucose, and lactic acid levels. CSF red blood cells are not a feature of VZV meningitis. We present the case of a healthy unimmunized adult who was hospitalized with chickenpox complicated by VZV aseptic meningitis with an unusually severe headache and nuchal rigidity that occurred during hospitalization. Copyright © 2011 Elsevier Inc. All rights reserved.
Cheon, Doo-Sung; Lee, Jiwon; Lee, Kangbum; Lee, Sunhwa; Park, Kwisung; Ahn, Jungbae; Jee, Youngmee; Yoon, Jaedeuk; Cho, Haewol
2004-07-01
During 2002, several epidemics of aseptic meningitis were attributed to echovirus 13 in Korea. The causative agents of these outbreaks were isolated and identified using rhabdosarcoma cells, HEp-2 and Buffalo green monkey kidney cells, and a neutralization test using monospecific antiserum. Fifty-four echovirus 13 isolates were isolated from patients with aseptic meningitis in the provinces, Seoul, Kyonggi, Gwangju, Jeonju, Busan, and Ulsan. Symptoms associated with aseptic meningitis infection in patients included the occurrence of headaches and mild fever. Molecular characterization of echovirus 13 samples was achieved by sequence and phylogenetic analyses on partial VP1 sequences from 20 Korean isolates and 10 foreign isolates listed in Genbank. Minor variation was observed among the Korean isolates, which formed a unique cluster with isolates of German and Japanese origin. The marked similarities between isolates could be attributed to a relatively recent arrival of the virus in Korea. This is the first such investigation of aseptic meningitis caused by echovirus 13 on the Korean peninsula. Copyright 2004 Wiley-Liss, Inc.
Aseptic Handling of the MOMA Mass Spectrometer After Dry Heat Microbial Reduction
NASA Technical Reports Server (NTRS)
Lalime, Erin
2017-01-01
Mars Organic Molecule Analyzer Mass Spectrometer (MOMA-MS) is an instrument in the larger MOMA instrument suite for the European Space Agency (ESA) ExoMars 2020 Rover. As a life-detection instrument on a Mars landing mission, MOMA-MS has very stringent Planetary Protection (PP) bioburden requirements. Within the MOMA instrument suite, the hardware surfaces of the sample path must be cleaned to a level of 0.03 spore/sq m. To meet this requirement, a process called Dry Heat Microbial Reduction (DHMR) is used to decrease the number of viable spores by 4 orders of magnitude. Before DHMR, the hardware is handled using standard cleanroom practices, while after DHMR, all sample path surfaces must be handled aseptically when exposed. Aseptic handling of the sample path involves a number of strategies and protocols including working only in an aseptic ISO class 5 work space, limiting the amount of time of exposure, using sterile garmenting with sterile gloves, and using sterile tools. Before work begins, the aseptic workspace will be tested for bioburden and particle fallout, and all tools that will contact sample path surfaces must be sterilized. During the exposure activity, sterile garments will be worn, sterile tools will be handled in a 2 person set up so that the operator touches only the sterile tool and not the exterior surfaces of the sterile pouch, and the environment will be monitored with active and passive fallout for bioburden and particle levels. Any breach in the planetary protection cleanliness can necessitate repeating DHMR, which not only has significant cost and schedule implications, it also become a risk to hardware that is not rated for repeated long exposures to high temperatures.
The Role of TLR and Chemokine in Wear Particle-Induced Aseptic Loosening
Gu, Qiaoli; Shi, Qin; Yang, Huilin
2012-01-01
Wear particle-induced periprosthetic osteolysis remains the principal cause of aseptic loosening of orthopaedic implants. Monocytes/macrophages phagocytose wear particles and release cytokines that induce inflammatory response. This response promotes osteoclast differentiation and osteolysis. The precise mechanisms by which wear particles are recognized and induce the accumulation of inflammatory cells in the periprosthetic tissue have not been fully elucidated. Recent studies have shown that toll-like receptors (TLRs) contribute to the cellular interaction with wear particles. Wear particles are recognized by monocytes/macrophages through TLRs coupled with the adaptor protein MyD88. After the initial interaction, wear particles induce both local and systemic migration of monocytes/macrophages to the periprosthetic region. The cellular migration is mediated through chemokines including interleukin-8, macrophage chemotactic protein-1, and macrophage inhibitory protein-1 in the periprosthetic tissues. Interfering with chemokine-receptor axis can inhibit cellular migration and inflammatory response. This paper highlights recent advances in TLR, and chemokine participated in the pathogenesis of aseptic loosening. A comprehensive understanding of the recognition and migration mechanism is critical to the development of measures that prevent wear particle-induced aseptic loosening of orthopaedic implants. PMID:23193363
Tabaja, Hussam; Hajar, Zeina; Kanj, Souha S
2017-10-01
Sternal wound infection with Mycobacterium tuberculosis is an uncommon yet highly challenging disease that can be quite insidious with various presentations. We hereby provide a review of 10 cases in current literature and describe an additional case which illustrates the difficulties associated with diagnosis. We used PubMed and Google search engine to search the literature for all published papers reporting on cases of sternal M. tuberculosis infections post open-heart surgeries. A total of 11 cases were presented, including a case of our own. The majority were males and were exposed to endemic areas. The average age was 59.6 ± 15.5 years. Coronary artery bypass surgery accounted for 73% of procedures and the average time to symptoms onset was 12.2 ± 16.6 months. Diabetes was the most reported non-cardiac comorbidity. Presenting symptoms varied and only 5 patients had other organs involved. Blood tests and radiographic studies were neither sensitive nor specific. M. tuberculosis culture on debrided tissues was the most sensitive test but often forgotten initially. Diagnostic delay was seen in almost all cases, often leading to unnecessary courses of antibiotics and aggressive surgical interventions. Finally, all patients responded well to anti-tuberculosis treatment, with reported treatment duration ranging from 9 to 12 months. M. tuberculosis infection of the sternum should be suspected in late-onset sternal wound infections post open-heart surgery especially when the course is chronic and indolent.
Haraguchi, Shuji; Yamashita, Yasuo; Yamashita, Koji; Hioki, Masafumi; Matsumoto, Koshi; Shimizu, Kazuo
2004-04-01
A case of 69-year-old woman with a solitary sternal bone metastasis from thyroid carcinoma undergoing surgical therapy was reported here. On admission, most part of the body of the sternum was destroyed by tumor. Subtotal sternectomy was performed and a part of the major pectoral muscles adherent to the sternal tumor was also resected. The chest wall defect was reconstructed with a sandwiched Marlex and stainless steel mesh. Pathological examination of the resected specimen revealed metastatic papillary carcinoma of the thyroid. Her postoperative course was uneventful. The reconstruction with Marlex and stainless steel mesh seemed to be an appropriate procedure to prevent paradoxical movement of the thorax and protect the intrathoracic organs. Stainless steel mesh compensated for limited resiliency of Marlex mesh and remained rigid in all directions.
Neville, Michael W; Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie
2015-08-25
To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students' aseptic technique at the conclusion of the semester. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos.
Jansen, Philipp; Mumme, Torsten; Randau, Thomas; Gravius, Sascha; Hermanns-Sachweh, Benita
2014-01-01
The differentiation between aseptic loosening and periprosthetic joint infection (PJI) after total joint arthroplasty is essential for successful therapy. A better understanding of pathogenesis of aseptic loosening and PJI may help to prevent or treat these complications. Previous investigations revealed an increased vascularization in the periprosthetic membrane in cases of PJI via PET signals. Based on these findings our hypothesis was that PJI is associated with an increased neovascularization in the periprosthetic membrane. Tissue samples from periprosthetic membranes of the bone-implant interface were investigated histologically for inflammation, wear particles, vascularization and fibrosis. To identify vascular structures antibodies against CD 31, CD 34, factor VIII and CD 105 (endoglin) were applied for immunohistochemical investigations. According to a consensus classification of Morawietz the tissue samples were divided into four types: type I (wear particle induced type, n = 11), type II (infectious type, n = 7), type III (combined type, n = 7) and type IV (indeterminate type, n = 7). Patients with PJI (type II) showed a pronounced infiltration of neutrophil granulocytes in the periprosthetic membrane and an enhanced neovascularization indicated by positive immunoreaction with antibodies against CD 105 (endoglin). Tissue samples classified as type I, type III and type IV showed significantly less immune reaction for CD 105. In cases of aseptic loosening and PJI vascularization is found in different expression in periprosthetic membranes. However, in aseptic loosening, there is nearly no neovascularization with CD 105-positive immune reaction. Therefore, endoglin (CD 105) expression allows for differentiation between aseptic loosening and PJI.
Sadeghi, Farzin; Talebi-Nesami, Masoumeh; Barari-Savadkouhi, Rahim; Bijani, Ali; Ferdosi-Shahandashti, Elahe; Yahyapour, Yousef
2017-01-01
Enterovirus (EV) infections are one of the most common causes of aseptic meningitis in pediatrics. To diagnose EV meningitis, virus isolation in cell cultures is often time consuming and lacks sensitivity to be of clinical relevance. This makes the virus culture results difficult to interpret. The rapid detection of EVs in cerebrospinal fluid (CSF) by molecular diagnostic techniques may improve the management of patients with aseptic meningitis. The purpose of the present study was to develop a more convenient and sensitive alternative technique to viral culture. The current investigation aimed to explore the prevalence of EVs in CSF of children with suspected aseptic meningitis in northern Iran, between June 2014 and March 2015 via the one-step real-time RT-PCR technique. A single center cross-sectional study was carried out on 50 children suspected with aseptic meningitis, aged 6 months to 13 years. The presence of EV RNA in CSF samples was screened by the use of qualitative one-step real-time RT-PCR. Enteroviral RNA was detected in 9 (18%) subjects using the one-step real-time RT-PCR assay. There was significant difference between EV positive and negative subjects regarding mean age (P=0.023), mean lymphocyte percentage (P=0.001) and mean glucose levels in CSF (P=0.037). The disease onset data indicate that the majority of EV meningitis occurred in the summer. This study provides the first data on the prevalence and epidemiology of EV infections in children with suspected aseptic meningitis in northern Iran.
Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie
2015-01-01
Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278
L’investigation de la contusion myocardique pour la fracture sternale à l’urgence
Audette, Jean-Sébastien; Émond, Marcel; Scott, Hugh; Lortie, Gilles
2014-01-01
Résumé Objectif Décrire la pratique d’acquisition d’un électrocardiogramme (ECG) initial, d’ECG de contrôle ou d’un monitoring équivalent et du dosage des troponines chez les patients avec une fracture sternale évalués au département d’urgence ou par un médecin de première ligne. Type d’étude Étude rétrospective descriptive multicentrique. Contexte Deux centres académiques de traumatologie de la région de Québec au Canada. Participants 54 patients ayant subi une fracture sternale traumatique. Interventions Évaluation de l’acquisition d’ECG initial et à 6 heures post-traumatisme ou un monitoring équivalent ainsi que le dosage des troponines sanguines. Principaux paramètres à l’étude En ce qui concerne l’ECG, les critères de comparaison de qualité furent sélectionnés à partir d’opinions d’experts rapportées dans quatre études. L’utilisation d’un ECG initial et de contrôle 6 heures post-traumatisme ou d’un monitoring cardiaque de 6 heures représente la pratique recommandée par la plupart de ceux-ci pour le diagnostic de la contusion myocardique dans la fracture sternale. L’utilisation des troponines I sanguines, 4 à 8 heures suivant un traumatisme thoracique, a également été proposée par certains auteurs comme méthode de détection efficace des arythmies significatives secondaires à la contusion myocardique. Des analyses descriptives univariées et des tests de chi-carré furent effectués. Une valeur P < ,05 fut considérée significative. Résultats Trente-neuf (72 %) patients ont été évalués initialement avec un ECG, tandis que 18 (33 %) de ces patients ont eu une évaluation par ECG ou monitoring cardiaque après 6 heures à l’urgence. Seize patients (30 %) ont été évalués à l’aide du dosage des troponines I. Deux patients (4 %) ont présenté des anomalies électrocardiographiques et un seul patient (2 %) a présenté des troponines I élevées. Conclusion Les urgentologues
Muta, Hiromi; Nagai, Takao; Ito, Yuhei; Ihara, Toshiaki; Nakayama, Tetsuo
2015-11-09
The purpose of this study was to determine the risk of aseptic meningitis after mumps vaccination in younger children compared with older children. This prospective cohort study included a total of 21,465 children under 18 years of age who had received the first dose of three of the Japanese mumps monovalent vaccine. We compared the cumulative incidence of aseptic meningitis for 30 days after vaccination among the following age groups: ≤ 1, 2, 3-4, and ≥ 5 years old. We also investigated the cumulative incidence of salivary gland swelling, a fever (≥ 38°C) lasting at least 3 days during the 10 to 25 days following immunization, vomiting of 3 times or more, headache, and seizure. A total of 10 aseptic meningitis, 551 salivary gland swelling, 844 fevers, 669 vomiting, 757 headaches, and 29 seizure cases were identified. The cumulative incidence of aseptic meningitis increased with age (0.016%, 0.021%, 0.066%, and 0.096%, respectively). Statistical significance was observed between children ≥ 3 years old and those < 3 years of age [0.078% vs. 0.018%, RR 4.35 (95% CI 1.05-18.2), p=0.04]. The cumulative incidence of salivary gland swelling also increased with age (1.8%, 3.0%, 3.5%, and 4.5%, respectively). For non-specific adverse events, the cumulative incidence of fever or seizure decreased with age. In contrast, the cumulative incidence of headache increased with age. The cumulative incidence of vomiting was similar among children ≤ 4 years of age; however, that in those children ≥ 5 years old was significantly lower. The first dose of mumps vaccine that is currently available for use in Japan may be administered in children less than 3 years of age in order to complicate a less aseptic meningitis after immunization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Spindler, Nick; Kaatz, Florian; Feja, Christine; Etz, Christian; Mohr, Friedrich-Wilhelm; Bechmann, Ingo; Josten, Christoph; Langer, Stefan; Loeffler, Sabine
2017-01-01
Introduction: Deep sternal wound infections (DSWI) are a rare but devastating complication after median sternotomy. Minor perfusion in bone and soft tissue, especially after recruiting the internal mammary artery for bypass supports the development of wound infection and nonunion of the sternal bone. The aim of the study was the macroscopic and radiological presentation of the vascular system supplying the sternum, in particular the compensating blood supply routes in the event that the internal mammary artery is no longer available after use as a bypass vessel. Method: This anatomic study was carried out on the anterior chest wall of 7 specimens. The thorax plates of 7 specimens were analyzed macroscopically after microsurgical preparation. Different anatomic preparations were produced using different contrast or form-giving substances. Radiological analysis and three-dimensional reconstructions were performed to show alternative, collateral sternal vessel perfusion under estimation of the loss of the internal thoracic artery due to a bypass. Results: The length of the ITA (internal thoracic artery), measured from the beginning of the first rib to the division into the superior epigastric artery and musculophrenic artery, was an average of 16.3 cm. On average, 18.5 branches were delivered from each artery, 10 medially to the sternum supply, and 8 to the intercostal muscle. Conclusion: Our analysis gives an overview of the macroanatomic vessel system supplying the sternal bone, describing especially a common trunk deriving from the ITA and supplying multiple branches and playing an important role in building a collateral circulation of the sternum. For better evaluation, in vivo CT analysis with contrast media should be performed in patients prior to the operation and directly after the use of the double ITA to demonstrate the change in perfusion of the sternum. In the future, preconditioning of the sternum by coiling the deriving branches could become an option
Hoyer, C; Eisele, P; Ebert, A D; Schneider, S; Gass, A; Fatar, M; Szabo, K; Alonso, A
2016-11-01
The term "aseptic meningitis" encompasses cases of meningitis with negative bacterial CSF culture, which predominantly are of viral etiology. While the clinical course is usually benign, complications such as encephalitic involvement resulting in a more severe clinical course may occur. Dysfunction of the blood-brain-barrier (BBB), which is a prerequisite for viral entry into the brain parenchyma, can be approximated using the CSF/serum albumin ratio, readily obtainable in routine CSF analysis. Analysis of CSF patterns in patients with aseptic meningitis/meningoencephalitis with a focus on BBB dysfunction as a marker for encephalitic involvement. Retrospective chart review of patients admitted to our hospital between 2004 and 2016 with a diagnosis of aseptic meningitis/meningoencephalitis. Patients with aseptic meningitis displaying clinical, MR-tomographic or electroencephalographic signs of encephalitic involvement were significantly older than patients without these features (47.4 vs. 35.5 yrs., p=0.002). In patients with meningoencephalitis, CSF analysis revealed a more severe disruption of BBB, approximated by the CSF/serum albumin ratio (p=0.002). Compromised BBB function correlated positively with length of hospitalization (p=0.007), indicative of a more severe clinical course. The number of CSF lymphocytes was found to predict the severity of the BBB disruption, which additionally was more frequently observed when herpesviridae were identified as infectious agents. We suggest that the CSF/serum albumin ratio as an estimate for BBB function should be attended to in the evaluation of patients with aseptic meningitis. Severe BBB dysfunction, older age and infection with herpesviridae appear to raise the risk for encephalitic involvement. Copyright © 2016 Elsevier B.V. All rights reserved.
Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.
Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie
2015-01-02
Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability
Krueger, Stephanie; Subramanian, Sevgan; Niassy, Saliou; Moritz, Gerald B
2015-09-01
Sternal pores are important features for identification of male thrips, especially within the subfamily Thripinae. They vary in shape, size and distribution even between species of one genus. Their functional role is speculated to be that of sex- and/or aggregation pheromone production. Yet, sexual aggregations are not reported in Echinothrips americanus, known to have sternal pores, while we observed aggregations in Megalurothrips sjostedti, previously reported to lack them. We examined the sternal glands and pores of the thripine species E. americanus and M. sjostedti males, in comparison with those of Frankliniella occidentalis using light microscopy, as well as scanning and transmission electron microscopy. Pore plates of F. occidentalis were ellipsoid and medial on sternites III-VII, while in E. americanus they were distributed as multiple micro pore plates on sternites III-VIII. In M. sjostedti they appeared as an extremely small pore in front of the posterior margin of each of sternites IV-VII. Pore plate and pore plate area were distributed similarly on sternites III-VII in F. occidentalis. However, in E. americanus the total pore plate area increased significantly from sternites III to VIII. Ultrastructure of cells associated with sternal glands showed typical characteristics of gland cells that differ in size, shape and number. The function of sternal glands is further discussed on the basis of morphological comparisons with other thrips species. Copyright © 2015 Elsevier Ltd. All rights reserved.
LaPier, Tanya Kinney; Shaw, Donald K.
2011-01-01
The processes that occur with normal sternal healing and potential complications related to median sternotomy are of particular interest to physical therapists. The premise of patients following sternal precautions (SP) or specific activity restrictions is the belief that avoiding certain movements will reduce risk of sternal complications. However, current research has identified that many patients remain functionally impaired long after cardiothoracic surgery. It is possible that some SP may contribute to such functional impairments. Currently, SP have several limitations including that they: (1) have no universally accepted definition, (2) are often based on anecdotal/expert opinion or at best supported by indirect evidence, (3) are mostly applied uniformly for all patients without regard to individual differences, and (4) may be overly restrictive and therefore impede ideal recovery. The purpose of this article is to present an overview of current research and commentary on median sternotomy procedures and activity restrictions. We propose that the optimal degree and duration of SP should be based on an individual patient's characteristics (eg, risk factors, comorbidities, previous activity level) that would enable physical activity to be targeted to particular limitations rather than restricting specific functional tasks and physical activity. Such patient-specific SP focusing on function may be more likely to facilitate recovery after median sternotomy and less likely to impede it. PMID:21448343
Dual infection with hepatitis A and E virus presenting with aseptic meningitis: a case report.
Naha, Kushal; Karanth, Suman; Prabhu, Mukhyaprana; Sidhu, Manpreet Singh
2012-07-01
We report the case of a young male who presented with features of aseptic meningitis and elevated serum liver enzymes, but no symptoms or signs suggestive of an acute hepatitis. Subsequently, he was diagnosed with dual infection with hepatitis A and E viruses, and recovered completely with symptomatic therapy. Isolated aseptic meningitis, unaccompanied by hepatitic features is an unusual presentation of a hepatotrophic viral infection, and is yet to be reported with hepatitis A and E virus co-infection. Copyright © 2012 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Knobloch, Karsten; Wagner, Sebastian; Haasper, Carl; Probst, Christian; Krettek, Christian; Otte, Dietmar; Richter, Martinus
2006-08-01
The incidence and treatment of sternal fractures caused by traffic accidents is of increasing importance to ensure best possible outcomes. Analysis of technical indicators of the collision, preclinical, and clinical data of patients with sternal fractures from 1985 to 2004 among 42,055 injured patients was assessed by an Accident Research Unit. Two time groups were categorized: 1985 to 1994 (group A) versus 1995 to 2004 (group B). Of 42,055 patients, 267 (0.64%) suffered a sternal fracture. Regarding the vehicle type, the majority occurred after car accidents in 0.81% (251 of 31,183 patients), followed by 0.19% (5 of 2,633 patients) driving motorbike, and 0.11% (4 of 3,258 patients) driving a truck. Ninety-one percent wore a safety belt. Only 13% of all passengers suffering a sternal fracture had an airbag on board (33 of 255 car/trucks), with an airbag malfunction in 18%. The steering column was deformed in 39%, the steering wheel in 36%. Cars in the recent years were significantly older (group B, 7.67 +/- 5 years, versus group A, 5.88 +/- 5 years; p = 0.003). Cervical spine injuries are frequent (23% versus 22%), followed by multiple rib fractures (14% versus 12%) and lung contusions (12% versus 11%). We found 9 of 146 (6%) and 3 of 121 patients (3%) with heart contusion among the 267 sternal fractures. Maximal abbreviated injury scale score was 2.56 +/- 1.3 versus 2.62 +/- 1.3 (group A versus B, p = 0.349). Eighteen percent of patients were polytraumatized, with 11.2% dying at the scene, 2.3% in the hospital. Sternal fractures occur most often in old cars to seat-belted drivers often without any airbag. Severe multiple rib fractures and lung contusion are concomitant injuries in more than 10% each, indicating the severity of the crash. Over a 20-year period, the injury severity encountered was not different, with 18% polytrauma patients suffering sternal fractures.
Sternal uptake of 99mTc-MAA in thoracic outlet syndrome.
Matsusaka, Yohji; Nakahara, Tadaki; Iwabuchi, Yu; Kameyama, Masashi; Murakami, Koji
2015-12-01
Tc-macroaggregated albumin (MAA) uptake in the vertebrae has been reported in central vein occlusion, although its sternal uptake is rarely seen. We present a case in which Tc-MAA SPECT/CT showed spotty uptake in the sternum. Contrast-enhanced CT revealed marked narrowing of the left subclavian vein at the thoracic outlet with a developed collateral vein running, in the left anterior chest subcutaneous tissue, between the sternum and left axilla. In this case, IV injection of Tc-MAA from the left forearm probably led to bone marrow uptake in the sternum due to retrograde venous flow through the collateral vein.
Aseptic meningitis outbreak caused by echovirus 30 in two regions in Bulgaria, May-August 2012.
Mladenova, Z; Buttinelli, G; Dikova, A; Stoyanova, A; Troyancheva, M; Komitova, R; Stoycheva, M; Pekova, L; Parmakova, K; Fiore, L
2014-10-01
An aseptic meningitis outbreak emerged in two regions in Bulgaria in 2012 and echovirus 30 (E30) was established as the aetiological agent by cell culture isolation, serological test, and molecular-based techniques. A total of 157 patients with aseptic meningitis were investigated, of which 117 were confirmed as having E30-associated disease. Molecular analysis of 12 E30 isolates revealed 99-100% nucleotide and amino-acid identity between them and a close correlation with a Greek strain involved in an E30 outbreak in 2012. Children aged 5-14 years were mainly affected, which could reflect the absence of E30 epidemics in Bulgaria for a period of 11 years. The first case with E30 isolation (a 2-year-old patient from Plovdiv) was notified at the end of April 2012. This was most likely the index case, from which the spread of the virus started, causing sporadic cases first, which later led to an aseptic meningitis outbreak facilitated by person-to-person viral transmission.
Aseptic nonunion of the tibia treated by intramedullary osteosynthesis.
Gualdrini, G; Rollo, G; Montanari, A; Zinghi, G F
1996-01-01
The authors report 52 cases of aseptic nonunion of the tibia treated by intramedullary osteosynthesis. The means of synthesis used were the Küntscher nail, the Eiffel Tower Rush nail, and the Grosse-Kempf nail. Which means of synthesis was used depended on the site and the features of the nonunion. Healing occurred in all of the cases after an average of 5 months. Mean follow-up was 4.5 years.
Early and mid-term outcomes of trans-sternal and video-assisted thoracoscopic surgery for thymoma.
Manoly, Imthiaz; Whistance, Robert N; Sreekumar, Rahul; Khawaja, Saud; Horton, Joanne M; Khan, Ali Zamir; Casali, Gianluca; Thorpe, James A; Amer, Khalid; Woo, Edwin
2014-06-01
Video-assisted thoracoscopic surgery (VATS) for thymoma has uncertain safety and effectiveness in comparison with trans-sternal resection. This feasibility study compared short- and mid-term outcomes for patients undergoing these two procedures, highlights weaknesses in current research and makes recommendations for long-term technological evaluations in this field. Consecutive thymoma cases between 2004 and 2010 were identified. Patients were divided into two groups according to surgical approach (Group I trans-sternal; Group II VATS) and comparisons were made between groups. The primary outcome was overall survival. Secondary outcomes included operative morbidity and mortality, hospital stay, recurrence rate and disease-free survival. Thirty-nine patients were included (Group I: n = 22 vs Group II: n = 17). There were no differences between groups at baseline for all measured covariates. No deaths occurred within 30 days of surgery. More patients in Group I developed complications (Group I: n = 10 vs Group II: n = 3; P = 0.093), while hospital stay was shorter in Group II (Group I: 6.4 ± 4.6 days vs Group II: 4.4 ± 1.8 days; P = 0.030). Five-year overall survival (Group I: 93.8 ± 6.1% vs Group II: 83.3 ± 11.2%; P = 0.425), 5-year disease-free survival (Group I: 71.0 ± 15.3% vs Group II: 83.3 ± 11.2%; P = 0.827) and recurrence rates at final follow-up (Group I: n = 2 vs Group II: n = 1; P = 0.363) were similar between the groups. VATS thymectomy for thymoma is feasible, safe and has comparable mid-term oncological outcomes to trans-sternal thymectomy. Future research is required to evaluate long-term oncological outcomes of VATS thymectomy for thymoma in national registries and randomized, controlled trials. © The Author 2014. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.
Bertz, S; Kriegsmann, J; Eckardt, A; Delank, K-S; Drees, P; Hansen, T; Otto, M
2006-01-01
Aseptic hip prosthesis loosening is the most important long-term complication in total hip arthroplasty. Polyethylene (PE) wear is the dominant etiologic factor in aseptic loosening, which together with other factors induces mechanisms resulting in bone loss, and finally in implant loosening. The single-shot radiograph analysis (EBRA, abbreviation for the German term "Einzel-Bild-Röntgenanalyse") is a computerized method for early radiological prediction of aseptic loosening. In this study, EBRA parameters were correlated with histomorphological parameters of the periprosthetic membrane. Periprosthetic membranes obtained from 19 patients during revision surgery of loosened ABG I-type total hip pros-theses were analyzed histologically and morphometrically. The pre-existing EBRA parameters, the thickness of the PE debris lay-er and the dimension of inclination and anteversion, were compared with the density of macrophages and giant cells. Addi-tionally, the semiquantitatively determined density of lymphocytes, plasma cells, giant cells and the size of the necrotic areas were correlated with the EBRA results. All periprosthetic membranes were classified as debris-induced type membranes. We found a positive correlation between the number of giant cells and the thickness of the PE debris layer. There was no significant correlation between the number of macrophages or all semiquantitative parameters and EBRA parameters. The number of giant cells decreased with implant duration. The morphometrically measured number of foreign body giant cells more closely reflects the results of the EBRA. The semiquantitative estimation of giant cell density could not substitute for the morphometrical analysis. The density of macrophages, lymphocytes, plasma cells and the size of necrotic areas did not correlate with the EBRA parameters, indicating that there is no correlation with aseptic loosening.
Ozkaya, Etem; Uysal, Gülnar; Atak, Tunca; Alkan, Mehmet
2005-01-01
Enteroviruses have major clinical and public health importance and are one of the leading causes of aseptic meningitis. There are many diseases with similar clinical symptoms and cerebrospinal fluid (CSF) findings of aseptic meningitis, thus virus isolation and identification is crucial for definitive diagnosis. Virological diagnosis is nonetheless important to distinguish between induced meningitis and other treatable causes of disease with a similar clinical picture. A total of 249 samples obtained from 246 cases (age range: 0-15 years), prediagnosed as aseptic meningitis, were sent to Virology Laboratory of Refik Saydam Hygiene Center. The patients were followed at Department of Pediatric Infectious Diseases in the Social Security Hospital, Ankara, Turkey, between 2001 and 2004. Stool (n: 180), CSF (n: 54) and throat swab (n: 15) samples have been inoculated to RD (rhabdomyosarcoma), Hep-2 (human epithelioma) and L20B (transgenic mice) cell lines, and followed up for the presence of cytopathic effects. A total of 95 enterovirus strains were isolated from 85 (34.6%) cases, and serotyped by using RIVM (National Institute of Public and the Environment, Nederlands) antisera with microneutralization method. As a result, the most frequently isolated types were found as echovirus type 30 (n: 24) and coxsackievirus type B (n: 19), which were most frequently isolated between July to October. This is the first report from Turkey for aseptic meningitis cases due to echovirus type 25 (n:3), 18 (n:2), 14 (n:1), 13 (n:4), 11 (n:6), 9 (n:1), 6 (n:9), 5 (n:1), 4 (n:1) and coxsackievirus type A9 (n:1).
Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations
2010-02-19
ISS022-E-068638 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.
Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations
2010-02-19
ISS022-E-068640 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.
Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations
2010-02-19
ISS022-E-068645 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.
Molecular identification of enteroviruses associated with aseptic meningitis in children from India.
Kumar, Arvind; Shukla, Deepti; Kumar, Rashmi; Idris, Mohammad Z; Jauhari, Prashant; Srivastava, Shalini; Dhole, Tapan N
2013-01-01
We identified and characterized enteroviruses associated with aseptic meningitis in children between April 2009 and March 2010. Enterovirus RNA was detected in 51 (45.5 %) of 112 CSF samples. Molecular typing by RT-PCR and sequencing of a partial VP1 region revealed the predominance of echovirus (ECV) 32 (n = 20), followed by ECV 11 (n = 10), ECV 13 and ECV 14 (n = 5 each), coxsackievirus (CV) B3 and CV B6 (n = 3 each), CV A2, CV A10 and ECV 30 (n = 1 each). Phylogenetic analysis of ECV 32 showed 0 to 4 % sequence divergence among strains of the present study and 20-23 % from the prototype Puerto Rico strain at the nucleotide level. This is the first report of ECV 32 associated with an aseptic meningitis epidemic and identification of seven different enterovirus serotypes (CV A2, CV A10, CV B3, CV B6, ECV 13, ECV 14 and ECV 32) in meningitis cases from India.
Itokawa, Kaori; Fukui, Miki; Nakazato, Yoshihiko; Yamamoto, Toshimasa; Tamura, Naotoshi; Sannohe, Seiya; Shimazu, Kunio
2008-04-01
We report a 29-year-old man with subacute necrotizing lymphadenitis (SNL) associated with recurrent aseptic meningitis following an 11-year remission period. In both episodes, headache and fever were followed by lymphadenopathy, with increased serum IgE level. Although pleocytosis in cerebrospinal fluid was confirmed at admission in the first episode, it appeared at one week after admission in the second episode. Administration of glucocorticoid was effective for treating meningitis. The present case suggests a pathomechanism for SNL that involves both an immunological background and an acute viral infection as triggers of exacerbation of aseptic meningitis.
Rubino, M; Cavagnaro, L; Sansone, V
2016-09-01
We describe a technique for treating Eaton stage IV osteoarthritis of the first ray, which is a development of our previously published technique for treating trapeziometacarpal arthritis. This simple technique is based on a limited resection arthroplasty of the first trapeziometacarpal and the scaphotrapezial joints, with the aim of inducing the formation of a narrow pseudoarthrosis at both sites. A total of 26 consecutive patients were treated for Eaton stage IV arthritis at a mean follow-up of 4.7 years (range 3.2-6.6). There were statistically significant improvements in all clinical parameters: mean appositional and oppositional pinch strength, mean DASH score (65 points pre-operatively to 8.7 points at final follow-up), and in mean visual analogue scale score (8.6 to 0.2 points). Although a larger cohort and a longer follow-up will be necessary to evaluate this new technique fully, these results encourage us to believe that the limited excision arthroplasty of the trapeziometacarpal and scaphotrapezial joints is a viable alternative to the existing surgical treatments for stage IV thumb arthritis. 4. © The Author(s) 2015.
Kouadria, R; Derkaoui, M
2018-03-01
Dermoid cysts of central nervous system are very rare. The usual clinical presentation is dominated by intracranial hypertension, epilepsy and cranial palsy. The revelation mode could be recurrent aseptic meningitis. The aim of this case report is to consider the dermoid cyst as regards the differential diagnosis in children treated for recurrent aseptic meningitis to avoid misdiagnosis and ice qui a orienté le diagnostic à une méningitnadequate treatment. Two children were admitted in the pediatric department for recurrent aseptic meningitis. The MRI confirmed the presence of a posterior fossa dermoid cyst. Loss of meningitis after microsurgical resection. The diagnosis of dermoid cyst is performed and reconsidered at an early stage in aseptic meningitis in order to establish an adequate therapy, which is surgery. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Cooper, D M; McIver, R; Bianco, R
2000-11-01
A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.
Ingemansson, Richard; Malmsjö, Malin; Lindstedt, Sandra
2014-01-01
Right ventricular rupture, resulting in serious bleeding, is a life-threatening complication associated with negative-pressure wound therapy (NPWT) in cardiac surgery. The use of a rigid barrier between the heart and the sharp sternal edges has been successfully tested on pigs. In the present article, we demonstrate increased safety in NPWT through the use of the HeartShield device. Six patients were treated with a specially designed device in combination with NPWT. The device consists of a horizontally placed disk covered in foam. The back of the T-shaped device sticks up between the sternal edges and up above skin level. This part of the device is also covered in foam. Drainage is performed through two holes at the top of the device. The device and foam are changed every second to third day, and -120 mm Hg of continuous therapy is used. Six patients were treated with traditional NPWT, serving as control group. No signs of calluslike formation were seen on the right ventricle in the group treated with the HeartShield device. In the conventional NPWT control group, all six patients had calluslike formation (>1 × 2 cm2) on the anterior part of the right ventricle. All patients in the HeartShield group had grade 1 epicardial petechial bleeding (<0.5 cm2) on the right ventricle. In the control group, one patient had grade 1 (<0.5 cm2), three patients had grade 2 (0.5-2.0 cm2), and two patients had grade 3 (>2.0 cm2) epicardial petechial bleeding on the right ventricle. No major bleeding or mortality was observed in either group during the course of the study. The use of the HeartShield device significantly minimizes the contact between the right ventricle and the sternal edges, thereby decreasing the risk for life-threatening complications due to bleeding.
Piantadosi, Anne; Mukerji, Shibani S; Chitneni, Pooja; Cho, Tracey A; Cosimi, Lisa A; Hung, Deborah T; Goldberg, Marcia B; Sabeti, Pardis C; Kuritzkes, Daniel R; Grad, Yonatan H
2017-01-01
Enteroviruses cause a wide spectrum of clinical disease. In this study, we describe the case of a young man with orchitis and aseptic meningitis who was diagnosed with enterovirus infection. Using unbiased "metagenomic" massively parallel sequencing, we assembled a near-complete viral genome, the first use of this method for full-genome viral sequencing from cerebrospinal fluid. We found that the genome belonged to the subgroup echovirus 30, which is a common cause of aseptic meningitis but has not been previously reported to cause orchitis.
Gorlitzer, Michael; Wagner, Florian; Pfeiffer, Steffen; Folkmann, Sandra; Meinhart, Johann; Fischlein, Theodor; Reichenspurner, Hermann; Grabenwoeger, Martin
2013-01-01
OBJECTIVES A prospective randomized multicentre trial was performed to analyse the efficacy of a vest (Posthorax support vest®) to prevent sternal wound infection after cardiac surgery, and to identify risk factors. METHODS From September 2007 to March 2010, 2539 patients undergoing cardiac surgery via median sternotomy were prospectively randomized into those who received a Posthorax® vest and those who did not. Patients were instructed to wear the vest postoperatively for 24 h a day for at least 6 weeks; the duration of follow-up was 90 days. Patients who did not use the vest within a period of 72 h postoperatively were regarded as study dropouts. Statistical calculations were based on an intention-to-treat (ITT) analysis. Further evaluations comprised all subgroups of patients. RESULTS Complete data were available for 2539 patients (age 67 ± 11years, 45% female). Of these, 1351 were randomized to receive a vest, while 1188 received no vest. No significant differences were observed between groups regarding age, gender, diabetes, body mass index, chronic obstructive pulmonary disease (COPD), renal failure, the logistic EuroSCORE and the indication for surgery. The frequency of deep wound complications (dWC: mediastinitis and sternal dehiscence) was significantly lower in vest (n = 14; 1.04%) vs non-vest (n = 27; 2.27%) patients (ITT, P < 0.01), but superficial complications did not differ between groups. Subanalysis of vest patients revealed that only 933 (Group A) wore the vest according to the protocol, while 202 (Group BR) refused to wear the vest (non-compliance) and 216 (Group BN) did not use the vest for other reasons. All dWC occurred in Groups BR (n = 7) and BN (n = 7), although these groups had the same preoperative risk profile as Group A. Postoperatively, Group BN had a prolonged intubation time, a longer stay in the intensive care unit, greater use of intra-aortic balloon pump, higher frequency of COPD and a larger percentage of patients who
Rafael, Aldo Elmer; Keshavamurthy, Suresh; Sepulveda, Edgardo; Miranda, Cyndee Cruz; Okamoto, Toshihiro; Pettersson, Gosta Bengt
2014-06-01
Cutaneous fistula as a clinical presentation of intracardiac abscess of the right side is such an unusual occurrence that it has not until now been reported in the English-language medical literature. We present a rare case of right-sided infective endocarditis caused by Achromobacter xylosoxidans in which recurrent infection presented as sternal wound discharge. The infection was found to have an intracardiac origin and was successfully managed by radical débridement on cardiopulmonary bypass.
Keshavamurthy, Suresh; Sepulveda, Edgardo; Miranda, Cyndee Cruz; Okamoto, Toshihiro; Pettersson, Gosta Bengt
2014-01-01
Cutaneous fistula as a clinical presentation of intracardiac abscess of the right side is such an unusual occurrence that it has not until now been reported in the English-language medical literature. We present a rare case of right-sided infective endocarditis caused by Achromobacter xylosoxidans in which recurrent infection presented as sternal wound discharge. The infection was found to have an intracardiac origin and was successfully managed by radical débridement on cardiopulmonary bypass. PMID:24955054
Quennedey, André; Sillam-Dussès, David; Robert, Alain; Bordereau, Christian
2008-05-01
Thirty-nine species belonging to different families of termites are studied to give a comprehensive view of the evolution of the sternal glands. Several modifications occurring at cuticular and cytological levels are described in neuter castes. The outer epicuticle is always pierced by epicuticular pores. In advanced termites the epicuticular filaments greatly increase in number and length creating a thick layer. The pore canals gradually enlarge while the cuticle changes into a lattice structure lining an extracellular space in which the secretion is stored. Two classes of cells are present in basal termites (Mastotermitidae, Hodotermitidae, Termopsidae and Kalotermitidae) but their glandular structures greatly differ between families. A more complex organization with three classes of cells is found in the Serritermitidae and Rhinotermitidae. A regressive evolution occurs in the Termitidae where only two classes of cells are present. A dual nervous control (campaniform sensilla and neurosecretory fibers) is found in lower termites, except for the Hodotermitidae which have mechanosensory bristles. In the other families, neurosecretory fibers are lacking. A comparison with phylogenetic data is given. A more versatile role of sternal glands in neuter castes is hypothesized.
Dong, F M; Hashisaka, A E; Rasco, B A; Einstein, M A; Mar, D R; Aker, S N
1992-06-01
Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovery immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be "market-tested" by the targeted patient population before inclusion in the menu.
Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices
Mulcahy, Daniel M.
2013-01-01
animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.
Moody, Colleen A.; Eckel, Stephen F.; Amerine, Lindsey B.
2015-01-01
Background: Microbial contamination of compounded medications is a serious concern within hospital pharmacies as it can lead to severe patient injury. The United States Pharmacopeia <797> mandates that pharmacy personnel responsible for preparing compounded sterile preparations must annually demonstrate competency in aseptic technique by performing a media-fill challenge test. Objective: The purpose of this study is to evaluate the sensitivity of a commonly used media-fill test through proper and improper compounding techniques. Methods: Two aseptically trained pharmacy technicians performed media-fill challenge testing by carrying out 5 separate manipulations 5 times each for a total of 25 trials. Sterile vials, syringes, and intravenous bags were prepared. The first manipulation followed best-practice aseptic technique and sterile compounding procedures. Each of the following 4 manipulations removed one aspect of best-practice aseptic technique. The prepared products were incubated at 20°C to 25°C. A positive result for microbial contamination is indicated by visible turbidity within the vials, syringes, and intravenous bags at the following check points: 24 hours, 72 hours, 7 days, 14 days, 21 days, and >30 days. Results: Twenty-five trials, each containing 10 distinct admixtures, resulted in a total of 250 compounded preparations. No single preparation showed signs of turbidity, sedimentation, or visible microbial growth at any of the 6 checkpoints yielding a 0% contamination rate. However, the positive controls inoculated with bacteria did have positive microbial growth results. Conclusion: A more sensitive test needs to be developed to provide assurances that all poor aseptic practices are detected in compounding personnel.
Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery
LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie
2015-01-01
Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458
Performance analysis of exam gloves used for aseptic rodent surgery.
LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie
2015-05-01
Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.
Role of free radicals in aseptic loosening of hip arthroplasty.
Kinov, Plamen; Leithner, Andreas; Radl, Roman; Bodo, Koppany; Khoschsorur, Gholam-Ali; Schauenstein, Konrad; Windhager, Reinhard
2006-01-01
Fibrous pseudocapsule around hip implants is an invariable finding at revision operations and is believed to release inflammatory mediators that stimulate bone resorption. Reactive oxygen species have been proposed to be causative factors in various disorders with tissue fibrosis. We were interested in investigating whether aseptic loosening is connected with high oxidative stress, and in showing the underlying mechanism of periprosthetic fibrosis and its role in loosening. Levels of oxidative stress markers reduced (GSH) and oxidized (GSSG) gluthatione and malondialdehyde (MDA) were assayed in 28 loose hips and in 12 stable hips revised for high rate of wear and osteolysis. Collagen in the periprosthetic tissues was measured as hydroxyproline content. Osteolysis and polyethylene wear were graded. Increased oxidative stress measured by low GSH/GSSG ratio as well as by increased MDA level was established in patients compared to controls. Oxidative stress markers intercorrelated significantly. MDA and both GSH and GSSG levels correlated significantly with hydroxyproline level. Levels of GSSG and MDA were higher in hips with greater polyethylene wear. The results suggest that high oxidative stress may play a role in formation of a fibrous membrane observed at revision of loose hips. The fibrous pseudocapsule is probably related to high intraarticular pressure and expansion of the effective joint space. This study may elicit some aspects of the pathogenesis of aseptic hip loosening and aid in future investigations aiming at prevention of this complication.
Landgraeber, Stefan; von Knoch, Marius; Löer, Franz; Brankamp, Jochen; Tsokos, Michael; Grabellus, Florian; Schmid, Kurt Werner; Totsch, Martin
2009-01-01
Particle-induced osteolysis is a major cause of aseptic loosening after total joint replacement. While the osteolytic cascade initiated by cytokine release from macrophages has been studied extensively, the involvement of T-lymphocytes in this context is controversial and has been addressed by only a few authors. In a former study we detected that the quantity of T-lymphocytes may be influenced by apoptosis in patients with aseptic loosening. In this study we intended to find out more details about the apoptosis-induced shifting of the T-cell number. We focused our interest on the CD4+ and CD8+ T-cells and their relative ratio. Caspase-3 cleaved was evaluated immunohistochemically to detect apoptotic T-cells in capsules and interface membranes from patients with aseptic hip implant loosening and a varying degree of caspase-3 cleaved expression in CD4+ and CD8+ T-lymphocytes was detected. Moreover, a relationship between the intensity of the apoptotic reactions and the radiological extent of osteolysis was observed. The number of CD4+ cells was decreased in the presence of strong apoptotic reactions, respectively extensive osteolysis, while CD8+ cells were affected to a much lower degree. Thus, the CD4+/CD8+ ratio changed from 1.0 in cases with only small areas of periprosthetic osteolysis and minimally intense apoptosis to 0.33 in cases with large areas of osteolysis. This may suggest a causal relationship between the apoptosis-induced shift in the CD4+/CD8+ ratio and the osteolysis respectively aseptic loosening. It is possible that these findings may lead to a new understanding of particle-induced osteolysis. PMID:19214244
Gorgievski-Hrisoho, Meri; Schumacher, Jean-Daniel; Vilimonovic, Nevenka; Germann, Daniel; Matter, Lukas
1998-01-01
Enteroviruses (EV) are among the most common causes of aseptic meningitis. Standard diagnostic techniques are often too slow and lack sensitivity to be of clinical relevance. EV RNA can be detected within 5 h by a commercially available reverse transcription-PCR (RT-PCR) test kit. Cerebrospinal fluid (CSF) samples from 68 patients presenting with aseptic meningitis during a summer outbreak in Switzerland were examined in parallel with cell culture and commercial RT-PCR. RT-PCR was positive in all 16 CSF specimens positive by cell culture (100%). In addition, 42 of 52 (80%) CSF samples negative by cell culture were PCR positive. In 26 of these 42 (62%) patients, viral culture from other sites (throat swab or stool) was also positive. The CSF virus culture took 3 to 7 days to become positive. Echovirus 30 was the type most often isolated in this outbreak. The sensitivity of CSF RT-PCR based on clinical diagnosis during this aseptic meningitis outbreak in patients with negative bacterial culture results was 85%, i.e., considerably higher than the sensitivity of CSF virus culture (24%). We conclude that this commercial RT-PCR assay allows a positive diagnosis with minimal delay and may thus influence clinical decisions. PMID:9705364
Intramedullary nailing in the treatment of aseptic tibial nonunion.
Megas, P; Panagiotopoulos, E; Skriviliotakis, S; Lambiris, E
2001-04-01
Fifty patients suffering from aseptic tibial nonunion underwent reamed intramedullary nailing (I.N.) and were retrospectively reviewed. Thirty-six patients were initially treated with external fixation, six with plate and screws, one with a static I.N., and seven with plaster of Paris. Eighteen of the fractures were initially open (A: 5, B: 6, and C: 7 according to the Gustilo classification). In 34 cases a closed procedure was performed, whereas in sixteen, an opening at the nonunion site was unavoidable either to remove metalwork or realign the fragments. Following failed external fixation, secondary I.N. was performed at least 10 days after removal of the device. Bone grafts from the iliac crest were used in three cases, and a fibular osteotomy was performed in 33. Patients were followed up for an average of 2.5 years after nailing, ranging from 10 months to 7 years. A solid union was achieved in all patients within a period of 6 months. One patient developed late infection, which settled after nail removal and one patient developed impending compartment syndrome which was detected on the first post-operative day and was treated with a fasciotomy. Transient peroneal nerve palsy occurred in one patient and this recovered in 3 months, whereas in nine patients a clinically acceptable deformity was noticed. In conclusion, we believe that reamed intramedullary nailing is a highly effective treatment for aseptic tibial nonunions. Early and late complications are rare and bone graft is rarely needed. The method allows early weight bearing even before solid union occurs, short hospitalisation time and early return to work without external support.
da Silveira, Claudio Marcos; Kmetzsch, Claudete Iris; Mohrdieck, Renate; Sperb, Alethea Fagundes; Prevots, D Rebecca
2002-10-01
Few data are available on the risk of aseptic meningitis following vaccination with the Leningrad-Zagreb (L-Z) strain of mumps vaccine. In 1997 the mumps vaccine was introduced into the state of Rio Grande do Sul in Brazil through mass vaccination with mumps-measles-rubella (MMR), targeting children aged 1-11 years. Five municipalities used exclusively MMR vaccine containing the L-Z strain of mumps. An outbreak of aseptic meningitis was observed shortly after the mass campaign. To estimate the risk of aseptic meningitis associated with this strain, we analysed vaccination and meningitis case surveillance data from the selected municipalities. A case of vaccine-associated aseptic meningitis was defined as one with a pleocytosis of 10-1,500 leukocytes/ml and occurring within 15-35 days after vaccine receipt. We estimated a risk of 2.9 cases per 10,000 doses of L-Z administered, equivalent to 1 case per 3,390 doses administered. The overall risk of aseptic meningitis following the campaign was increased 12.2-fold (95% CI: 6.0-24.7) compared with the same period in 1995-1996. Following the mass campaign, the incidence of mumps declined 93% during 1998-2000. Vaccination with the L-Z strain of mumps vaccine as part of a mass campaign was associated with a significantly increased risk of aseptic meningitis. Decisions about type of mumps vaccine and mumps vaccination strategies must consider vaccine safety issues in addition to other criteria.
Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.
Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W
1996-01-01
A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis. PMID:8748304
Kaminski, M; Grummel, V; Hoffmann, D; Berthele, A; Hemmer, B
2017-08-01
Aseptic infections of the central nervous system (CNS) are frequently observed in Germany. However, no study has systematically addressed the spectrum of aseptic CNS infections in Germany. Data on 191 adult patients diagnosed from January 2007 to December 2014 with aseptic meningitis or encephalitis/meningoencephalitis at our hospital were collected by chart review and analyzed for demographic, clinical and laboratory findings. Patients were stratified according to the causative virus and findings were compared between groups. In our cohort, meningitis was caused in 36% by enterovirus (EV), 15% by herpes simplex virus (HSV), 12% by varicella zoster virus (VZV) and 5% by tick borne encephalitis (TBE). Encephalitis/meningoencephalitis was caused in 13% by HSV, 13% by VZV, and three out of 11 tested patients were positive for TBE. The highest incidence of EV infections was between 25 and 35 years and of HSV infections between 30 and 60 years. VZV infections had a bimodal distribution peaking below 30 and above 70 years. VZV and EV infections were more frequently observed during summer, whereas HSV infections showed no seasonal preference. Inflammatory changes in cerebrospinal fluid (CSF) were highest in HSV and lowest in EV infections. Polymerase chain reaction tests for HSV, VZV and EV in CSF and TBE serology determined the causative virus in over 60% of tested patients. The age of affected patients, seasonal distribution, disease course and inflammatory changes in CSF differ between groups of patients affected by the most common viral infections. © 2017 EAN.
Henderson, Fraser; Takacs, Istvan
2017-01-01
Troubleshooting of deep brain stimulators (DBSs, Activa SC/PC/RC Medtronic PLC, Minneapolis, Minnesota, USA) sometimes results in a decision to replace a tunneled stretch-coil extension cable. We present a simple technique to accomplish this atraumatically without a tunneling tool. In the treatment of patients with a DBS, complication avoidance and efficiency of operative time are paramount. We sought to find the safest, most effective, and fastest method of performing the conceptually simple yet technically nuanced act of replacing lead extension cables. We connected #6 (8.0 metric) surgical steel 18″ (45-cm) monofilament (Ethicon US, LLC, Somerville, New Jersey, USA), also known as #6 sternal wire, in line with DBS extension cables (Medtronic DBS Extension 37086-60) in novel fashion to overcome intraprocedural hurdles encountered during the past decade in a busy functional neurosurgery service. Patients tolerate the procedure well and return home shortly after recovery with no complications. A less expensive and faster technique for passing pulse generator extension cables may be the use of a sternal wire. Using the described technique, pulse generators may be quickly and safely adjusted from side to side and site to site as the clinical situation dictates. Copyright © 2016 Elsevier Inc. All rights reserved.
Martinez, Alexander A; Castillo, Juan; Sanchez, Mirla C; Zaldivar, Yamitzel; Mendoza, Yaxelis; Tribaldos, Maribel; Acosta, Pablo; Smith, Rebecca E; Pascale, Juan Miguel
2012-12-15
Aseptic meningitis outbreaks are commonly caused by viral pathogens with enterovirus a common etiological agent. Between May and June of 2008, an outbreak of 173 cases of aseptic meningitis occurred in the Chiriqui Province of Panama. Molecular techniques were used to identify the etiological agent. Cerebrospinal fluid (CSF) samples from 75 patients were received at the Gorgas Memorial Institute for Health Studies. RNA extraction and one-step RT-PCR were performed on each sample to determine the presence of enterovirus. Thirty-four samples which were positive for enterovirus were subject to group-specific PCR, sequencing, and phylogenetic analysis to identify the etiological agent of the outbreak. The CSF of 58 subjects was found positive for the enterovirus family using RT-PCR. Thirty-four samples were found to belong to the enterovirus B group. Phylogenetic analysis of four successfully sequenced samples revealed echovirus 30 as the etiological agent. Echovirus 30 is reported as the likely cause of an outbreak of aseptic meningitis in Panama, the first since the 1980s.
Abou-Foul, Ahmad K; Buhary, Thajunisha M; Gayed, Sedki L
2014-01-01
Cases of idiopathic recurrent benign aseptic meningitis were first described by Mollaret. Today, herpes simplex virus (HSV) is considered the cause of most cases of Mollaret's meningitis. A 40-year-old male was referred to our genitourinary medicine clinic with recurrent genital herpetic lesions. He had HSV-2-positive genital ulcers 8 years earlier. One year after the first infection, he developed severe recurrent attacks of headache associated with meningitis symptoms. The results of all radiological and biochemical tests were normal, but the patient reported a correlation between his attacks and genital herpes flare-ups. We diagnosed the patient with Mollaret's meningitis and started him on continuous suppressive acyclovir therapy, which resulted in marked clinical improvement. Mollaret's meningitis is a rare form of idiopathic recurrent aseptic meningitis that has a sudden onset, short duration, and spontaneous remission with unpredictable recurrence. We believe that the presence of concurrent or recurrent mucocutaneous herpetic lesions can aid its diagnosis, prior to which, affected patients usually have many unnecessary investigations and treatments. Therefore, detailed sexual history should be sought in all patients with aseptic meningitis, and clinicians should also ask about history of recurrent headaches in all patients with recurrent herpetic anogenital lesions. Continuous suppressive acyclovir therapy may reduce the frequency and severity of attacks and can dramatically improve lifestyle.
Aseptic necrosis of the femoral head after pregnancy: a case report.
Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa
2016-01-01
A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy.
Lv, S; Zhao, J; Zhang, J; Kwon, S; Han, M; Bian, R; Fu, H; Zhang, Y; Pan, H
2014-08-01
In our previous study, tumor necrosis factor α (TNF-α) was identified as an effective target for sepsis patients (Int J Clin Pract, 68, 2014, 520). TNF-α in cerebrospinal fluid (CSF) was also investigated for its utility in the differential diagnosis of bacterial and aseptic meningitis. However, there has been neither definite nor convincing evidence so far. Here the overall diagnostic accuracy of TNF-α in differentiation between bacterial and aseptic meningitis was evaluated through the meta-analysis of diagnostic tests. The sensitivity, specificity and other measures of accuracy were pooled using random effect models. Summary receiver operating characteristic curves were used to assess overall test performance. Publication bias was evaluated using funnel plots, and sensitivity analysis was also introduced. A total of 21 studies involving bacterial meningitis (678) and aseptic meningitis (694) involved a total of 1372 patients. The pooled sensitivity and specificity for the TNF-α test were 0.83 [95% confidence interval (CI) 0.80-0.86, I(2) = 65.1] and 0.92 (95% CI 0.89-0.94, I(2) = 61.8), respectively. The positive likelihood ratio was 12.05 (95% CI 7.41-19.60, I(2) = 36.5), the negative likelihood ratio was 0.17 (95% CI 0.13-0.24, I(2) = 59.4), and TNF-α was significantly associated with bacterial meningitis, with a diagnostic odds ratio of 49.84 (95% CI 28.53-87.06, I(2) = 47.9). The overall accuracy of the TNF-α test was very high with the area under the curve 0.9317. Publication bias was absent, and sensitivity analysis suggested that our results were highly stable. Our meta-analysis suggested that TNF-α could be recommended as a useful marker for diagnosis of bacterial meningitis and differential diagnosis between bacterial and aseptic meningitis with high sensitivity and specificity. Thus, hospitals should be encouraged to conduct TNF-α tests in CSF after lumbar puncture. © 2014 The Author(s) European Journal of Neurology © 2014 EAN.
[Synovial fluid from aseptically failed total hip or knee arthroplasty is not toxic to osteoblasts].
Gallo, J; Zdařilová, A; Rajnochová Svobodová, A; Ulrichová, J; Radová, L; Smižanský, M
2010-10-01
A failure of total hip or knee artroplasty is associated with an increased production of joint fluid. This contains wear particles and host cells and proteins, and is assumed to be involved in the pathogenesis of aseptic loosening and periprosthetic osteolysis. This study investigated the effect of synovial fluid from patients with aseptically failed joint prostheses on osteoblast cultures. Synovial fluid samples were obtained from patients with failed total joint prostheses (TJP; n=36) and from control patient groups (n = 16) involving cases without TJP and osteoarthritis, without TJP but with osteoarthritis, and with stable TJP. The samples were treated in the standard manner and then cultured with the SaOS-2 cell line which shows the characteristics and behaviour of osteoblasts. Each fluid sample was also examined for the content of proteins, cells and selected cytokines (IL-1ß, TNF-α, IL-6, RANKL and OPG detected by ELISA). We tested the hypothesis assuming that the fluids from failed joints would show higher cytotoxicity to osteoblast culture and we also expected higher levels of IL-1ß, TNF-α, IL-6, and RANKL in patients with TJP failure and/ or with more severe bone loss. The statistical methods used included the Kruskal-Wallis ANOVA and Mann-Whitney U test. The fluids from failed TJPs showed the highest RANKL and the lowest OPG levels resulting in the highest RANKL/OPG ratio. However, there was no evidence suggesting that the joint fluids from failed TJPs would be more toxic to osteoblast culture than the fluids from control groups. In addition, no correlation was found between the fluid levels of molecules promoting inflammation and osteoclastic activity and the extent of bone loss in the hip (in terms of Saleh's classification) or the knee (AORI classification). In fact, the fluids from failed TJPs had higher protein levels in comparison with the controls, but the difference was not significant. The finding of high RANKL levels and low OPG
Janson, Jacques T; Rossouw, Gawie J
2013-02-01
An unstable anterior or posterior sternoclavicular joint dislocation can cause severe morbidity with poor shoulder movement and strength. These dislocations need to be repaired, which can be challenging. Many different procedures have been described to obtain a stable joint fixation with varying results. We report a new technique for repairing a sternoclavicular joint dislocation by using a figure-of-eight sternal cable system. This procedure is relatively simple and reproducible to create a stable and functional sternoclavicular joint. Copyright © 2013 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
Aseptic Meningitis Caused by Lassa Virus: Case Series Report
Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.
2016-01-01
The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363
Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng
2015-10-01
Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.
Espinoza, Andreas; Bergsland, Jacob; Lundblad, Runar; Fosse, Erik
2012-01-01
The internal mammary artery (IMA) is routinely used for grafting of the left anterior descending coronary artery (LAD), providing good flow to the anterior left ventricle (LV) wall. Impeded IMA-to-LAD flow may result in myocardial ischaemia and haemodynamic deterioration. From a study population, we describe two incidents where myocardial ischaemia was observed during off-pump coronary artery bypass surgery (CABG), with a confirmed reduction in the IMA-to-LAD flow in one patient. In patient no. 1, normal IMA flow was assessed by transit-time flow measurement after a complete IMA-to-LAD anastomosis. The anterior LV wall thickening was monitored continuously by epicardial ultrasonic transducers. Normal wall thickening was confirmed after IMA grafting. During a wide sternal opening for circumflex grafting the anterior wall motion displayed an ischaemic pattern, with reduced systolic and increased post-systolic wall thickening. IMA flow was reduced simultaneously. When easing the sternal opening, IMA flow normalized, as did the motion pattern in the anterior LV wall. In patient no. 2, similar changes in wall thickening occurred during a wide sternal opening after IMA-to-LAD grafting. When easing the retractor, the wall thickening normalized. It is important for the surgeon to be aware of this possible cause of myocardial ischaemia, with a risk of subsequent haemodynamic deterioration. This may not only be of great importance during off-pump CABG, but can also be significant for successful weaning from the cardiopulmonary bypass machine. PMID:22499803
Nagai, Takao; Okafuji, Teruo; Miyazaki, Chiaki; Ito, Yuhei; Kamada, Makoto; Kumagai, Takuji; Yuri, Kenji; Sakiyama, Hiroshi; Miyata, Akiko; Ihara, Toshiaki; Ochiai, Hitoshi; Shimomura, Kunihisa; Suzuki, Eitaro; Torigoe, Sadayoshi; Igarashi, Masahiro; Kase, Tetsuo; Okuno, Yoshinobu; Nakayama, Tetsuo
2007-03-30
To compare the incidence of aseptic meningitis associated with symptomatic natural mumps infection and in mumps vaccine recipients, we conducted a prospective comparative study. Consecutive samples of 1051 children with mumps were enrolled by 10 pediatricians and 21,465 vaccine recipients by 143 pediatric primary care practitioners, from January 1, 2000 to January 1, 2003. Parents used a daily diary to record symptoms during the period of illness (15 days) or 30-day period following immunization. Mumps infection was confirmed by virus isolation and/or detection of mumps virus genome in salivary and CSF samples. The incidence of aseptic meningitis was 13/1051 (1.24%) in patients with symptomatic natural mumps infection and was estimated to be 0.7-1.1% of overall infection in considering asymptomatic infection, and 10/21,465 (0.05%) in vaccine recipients. Although aseptic meningitis is a clear side effect of the mumps vaccine, the incidence is considerably lower than among those with symptomatic natural infection. Our results provide an informative data for consideration to resume mumps vaccine as a part of routine immunization schedule for Japanese children.
Nakamura, Yoshitsugu; Nakajima, Hideto; Kano, Yosuke; Unoda, Kiichi; Ishida, Shimon; Kimura, Fumiharu
2016-11-29
A 55-year-old woman was diagnosed with aseptic meningitis at the age of 43 and 44. She developed sudden fever and headache, and she showed nuchal rigidity. Cerebrospinal fluid examination revealed pleocytosis (cell count 208/mm 3 ) and was positive for herpes simplex virus type 2 (HSV-2) DNA by PCR. Acyclovir was started on the first day of admission, and she was complete recovery. Preserved cerebrospinal fluid specimen from aseptic meningitis at the age of 44 was also positive for HSV-2 DNA by PCR. She was diagnosed with HSV-2 associated recurrent aseptic meningitis (Mollaret's meningitis) with a recurrence after 11-year interval. She repeatedly relapsed genital herpes after 44 years old and she was treated with valacyclovir whenever genital herpes relapses. But she showed no genital herpes at the onset of meningitis. Because HSV-2 is one of the most significant causes of recurrent meningitis, we would like to stress that HSV-2 infection and antiviral therapy should always be kept in mind for a recurrent meningitis case.
Salimi, Fereshte; Imani, Mohammad Reza; Ghasemi, Navab; Keshavarzian, Amir; Jazi, Amir Hosein Davarpanah
2013-01-01
Background: Long-term tunneled catheters are used for the hemodialysis or chemotherapy in many patients. Proper placement of the catheter tip could reduce early and late catheter related complications. Aim of the present study was to evaluate a new formula for proper placement of tunneled hemodialysis or infusion port device by using an external anatomic landmark. Materials and Methods: A total of 64 adult patients undergoing elective placement of tunneled Central Venous Catheter (CVC) requiring hemodialysis or chemotherapy were enrolled in this prospective study during 2011-2012 in the university hospital. The catheter length to be inserted in the right internal jugular vein (IJV) was calculated by adding two measurements (the shortest straight length between the insertion point of the needle and the suprasternal notch plus and half of sternal length). The catheter position was considered correct if the tip was positioned in the right atrium (RA) or Superior vena cava (SVC)-RA junction. Results: The patients were 55.28 ± 19.85 years of age, weighed 5.78 ± 16.62 kg and were 166.07 ± 10.27 cm tall. Catheters were inserted successfully in 88% of patients (n = 56). Catheter tip positions in the failures were SVC (n = 5), tricuspid valve (n = 2), and right ventricle (n = 1) in our patients. Conclusion: Long-term hemodialysis or port CVC could easily insert in the right IJV by using half of the sternal length as an external land marks among adult patients. PMID:24174941
Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo
2005-05-01
Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.
Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie
2015-10-15
In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic
Croker, Curtis; Civen, Rachel; Keough, Kathleen; Ngo, Van; Marutani, Amy; Schwartz, Benjamin
2015-01-02
On August 4, 2014, the Acute Communicable Disease Control Program of the Los Angeles County Department of Public Health received a report of three aseptic meningitis cases among football players at a county high school. An investigation was conducted to determine the extent of the outbreak, identify potential exposures, and recommend control measures. An outbreak-associated aseptic meningitis case was defined as an illness of any team or family member with onset during July 28-August 11 with 1) cerebrospinal fluid pleocytosis and negative bacterial culture or 2) an emergency department visit with headache, fever, and stiff neck. Ten cases were identified; nine in males, and one in a female; patient ages ranged from 13 to 17 years. All the patients sought care at an emergency department, and five were hospitalized, resulting in 12 total hospital days. All 10 patients have recovered. Eight patients were football players, and two were siblings of football players. The most affected subgroup was the junior varsity football team, with seven cases out of 57 players (attack rate = 12.3%); the relative risk for aseptic meningitis was higher among players who were linemen than among those who were not linemen (relative risk = 5.4 [p = 0.03]). Of the 10 patients, eight tested positive by polymerase chain reaction for enterovirus, and two were not tested. Echovirus testing was performed at the California Viral and Rickettsial Disease Laboratory. Of the eight specimens testing positive for enterovirus, seven tested positive for echovirus 30, and one specimen could not be typed because of insufficient quantity.
Ye, Hongyan; Yan, Juying; Xie, Guoliang; Cui, Dawei; Yu, Fei; Wang, Yiyin; Yang, Xianzhi; Zhou, Fangman; Zhang, Yanjun; Tian, Xueli; Chen, Yu
2016-01-01
Echovirus 30 (E30) is a major pathogen associated with aseptic meningitis. In the summer of 2014, a family clustering aseptic meningitis outbreak occurred in urban–rural fringe of Ningbo city in Zhejiang Province in China. To identify the etiologic agent, specimens were tested by cell culture and reverse transcriptase–polymerase chain reaction. Pathogenic examination confirmed that the outbreak is caused by E30. The first case is a 6-year-old child, who studied in kindergarten in local, suffered from headache and fever. Same symptoms appeared in his parents, aunts, and other six relatives continuously. Meanwhile, vomiting occurred in majority of the patients and diarrhea in parts of them. White blood cells in cerebrospinal fluid (CSF) exceeded normal range in all patients. Protein levels in CSF were above normal range in half of the patients. Glucose levels in CSF were within normal range in all patients. We isolated six strains E30 in the stool specimens of patients, and carried out sequencing analysis to VP1 region. Sequencing results showed that 100% sequence identity was seen in both nucleotide and amino acid levels. Phylogenetic analysis discovered that isolate in this study was grouped into sublineage D2 together with sequences isolated from other areas of China in the 2000s and 2010s. Our study is the first family clustering outbreak of aseptic meningitis caused by E30 in Zhejiang Province in China. It is essential to establish an enterovirus molecular surveillance system in China to prevent mass outbreaks in Zhejiang. PMID:27646838
Zheng, Shufa; Ye, Hongyan; Yan, Juying; Xie, Guoliang; Cui, Dawei; Yu, Fei; Wang, Yiyin; Yang, Xianzhi; Zhou, Fangman; Zhang, Yanjun; Tian, Xueli; Chen, Yu
2016-09-01
Echovirus 30 (E30) is a major pathogen associated with aseptic meningitis. In the summer of 2014, a family clustering aseptic meningitis outbreak occurred in urban-rural fringe of Ningbo city in Zhejiang Province in China. To identify the etiologic agent, specimens were tested by cell culture and reverse transcriptase-polymerase chain reaction. Pathogenic examination confirmed that the outbreak is caused by E30. The first case is a 6-year-old child, who studied in kindergarten in local, suffered from headache and fever. Same symptoms appeared in his parents, aunts, and other six relatives continuously. Meanwhile, vomiting occurred in majority of the patients and diarrhea in parts of them. White blood cells in cerebrospinal fluid (CSF) exceeded normal range in all patients. Protein levels in CSF were above normal range in half of the patients. Glucose levels in CSF were within normal range in all patients. We isolated six strains E30 in the stool specimens of patients, and carried out sequencing analysis to VP1 region. Sequencing results showed that 100% sequence identity was seen in both nucleotide and amino acid levels. Phylogenetic analysis discovered that isolate in this study was grouped into sublineage D2 together with sequences isolated from other areas of China in the 2000s and 2010s. Our study is the first family clustering outbreak of aseptic meningitis caused by E30 in Zhejiang Province in China. It is essential to establish an enterovirus molecular surveillance system in China to prevent mass outbreaks in Zhejiang.
Latif, Rana K; Bautista, Alexander F; Memon, Saima B; Smith, Elizabeth A; Wang, Chenxi; Wadhwa, Anupama; Carter, Mary B; Akca, Ozan
2012-03-01
Our goal was to determine whether simulation combined with didactic training improves sterile technique during ultrasound (US)-guided central venous catheter (CVC) insertion compared with didactic training alone among novices. We hypothesized that novices who receive combined didactic and simulation-based training would perform similarly to experienced residents in aseptic technique, knowledge, and perception of comfort during US-guided CVC insertion on a simulator. Seventy-two subjects were enrolled in a randomized, controlled trial of an educational intervention. Fifty-four novices were randomized into either the didactic group or the simulation combined with didactic group. Both groups received didactic training but the simulation combined with didactic group also received simulation-based CVC insertion training. Both groups were tested by demonstrating US-guided CVC insertion on a simulator. Aseptic technique was scored on 8 steps as "yes/no" and also using a 7-point Likert scale with 7 being "excellent technique" by a rater blinded to subject randomization. After initial testing, the didactic group was offered simulation-based training and retesting. Both groups also took a pre- and posttraining test of knowledge and rated their comfort with US and CVC insertion pre- and posttraining on a 5-point Likert scale. Subsequently, 18 experienced residents also took the test of knowledge, rated their comfort level, and were scored while performing aseptic US-guided CVC insertion using a simulator. The simulation combined with didactic group achieved a 167% (95% confidence interval [CI] 133%-167%) incremental increase in yes/no scores and 115% (CI 112%-127%) incremental increase in Likert scale ratings on aseptic technique compared with novices in the didactic group. Compared with experienced residents, simulation combined with didactic trained novices achieved an increase in aseptic scores with a 33.3% (CI 16.7%-50%) increase in yes/no ratings and a 20% (CI 13
[Aseptic non-touch technique in the operating room: keep it simple].
Pans, Solange J A; Molmans, Eva; Marczinski, Susanne C; Bijker, Jilles B; Snijdelaar, Dik G
2015-01-01
The Dutch national patient safety platform developed a protocol for the preparation of intravenous medication; the Aseptic Non-Touch Technique (ANTT). Use of ANTT on nursing wards has shown to reduce contamination of intravenous medication. Therefore it is dictated by the Dutch Healthcare Inspectorate that this technique has to be used at all departments in the hospital, including the operating theatre. However, because of the use of air treatment and operating theatre uniforms, the operating theatre cannot be compared with a nursing ward. In this study, the bacterial contamination of syringes prepared in the operating theatre by anesthesia nurses was determined. Simulation study 45 anesthesia nurses prepared 1000 syringes of 10 ml bacterial culture medium, using their routine method of drawing up iv medication from vials. Turbidity in a syringe after culturing for 14 days at 30° C was used as evidence for bacterial contamination. Using questionnaires, nurses were interviewed in what degree their working method equals ANTT-protocol. We calculated how much extra time must be invested when using the strict ANTT-protocol in the operating theatre. Six syringes (0,6%) were contaminated. Normal dermal bacteria were identified in all syringes. The nurses who prepared the contaminated syringes worked similar manner as their colleagues. It takes an additional 54 minutes per day per operating theatre to work strictly using the ANTT technique. Contamination rates of aseptic preparations in the OR are very low, and are as low as ANTT preparations in a GMP-certified hospital pharmacy. Therefore it is legitimate to develop a modified ANTT-protocol for use in the operating theatre.
Bjerkvig, Christopher Kalhagen; Fosse, Theodor Kaurin; Apelseth, Torunn Oveland; Sivertsen, Joar; Braathen, Hanne; Eliassen, Håkon Skogrand; Guttormsen, Anne Berit; Cap, Andrew P; Strandenes, Geir
2018-06-01
Intraosseous (IO) vascular access is increasingly used as an emergency tool for achieving access to the systemic circulation in critically ill patients. The role of IO transfusion of blood in damage control resuscitation is however questionable due to possible inadequate flow rate and hemolysis. Some experts claim that IO transfusion is contraindicated. In this study, we have challenged this statement by looking at flow rates of autologous fresh whole blood reinfusion and hemolysis using two of the commonly used Food and Drug Administration-approved and Conformité Européenne (CE)-marked sternal needles. Additionally, the success rate of sternal access between the two devices is evaluated. Volunteer professional military personnel, were enrolled prospectively in a nonrandomized observational study design. We collected 450 mL of autologous whole blood from each participant. Participants were divided into the following three groups of 10: Tactically Advanced Lifesaving IO Needle (T.A.L.O.N.) IO, FAST1 IO, and intravenous group. The reinfusion was done by gravity only. Blood sampling was performed before blood collection and 30 minutes after reinfusion. Investigation of hemolysis was performed by measurements of haptoglobin and lactate dehydrogenase. Success rate was evaluated by correct aspiration of bone marrow. Median reinfusion rate was 46.2 mL/min in the FAST1 group, 32.4 mL/min in the T.A.L.O.N. group, and 74.1 mL/min in the intravenous group. Blood samples from all participants were within normal ranges. There was no statistically significant difference in haptoglobin and lactate dehydrogenase between the groups. In the FAST1 group, 1 (9%) of 11 procedures failed. In the T.A.L.O.N. group, 4 (29%) of 14 procedures failed. Although preferable, achieving peripheral venous access in the bleeding patient is a major problem. Our findings suggest that fresh whole-blood transfusion through the IO route is safe, reliable, and provide sufficient flow for resuscitation
Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer
NASA Astrophysics Data System (ADS)
Lalime, Erin N.; Berlin, David
2016-09-01
Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.
[Validation of a clinical prediction rule to distinguish bacterial from aseptic meningitis].
Agüero, Gonzalo; Davenport, María C; Del Valle, María de la P; Gallegos, Paulina; Kannemann, Ana L; Bokser, Vivian; Ferrero, Fernando
2010-02-01
Despite most meningitis are not bacterial, antibiotics are usually administered on admission because bacterial meningitis is difficult to be rule-out. Distinguishing bacterial from aseptic meningitis on admission could avoid inappropriate antibiotic use and hospitalization. We aimed to validate a clinical prediction rule to distinguish bacterial from aseptic meningitis in children, on arriving to the emergency room. This prospective study included patients aged < 19 years with meningitis. Cerebrospinal fluid (CSF) and peripheral blood neutrophil count were obtained from all patients. The BMS (Bacterial Meningitis Score) described by Nigrovic (Pediatrics 2002; 110: 712), was calculated: positive CSF Gram stain= 2 points, CSF absolute neutrophil count > or = 1000 cells/mm(3), CSF protein > or = 80 mg/dl, peripheral blood absolute neutrophil count > or = 10.000/mm(3), seizure = 1 point each. Sensitivity (S), specificity (E), positive and negative predictive values (PPV and NPV), positive and negative likelihood ratios (PLR and NLR) of the BMS to predict bacterial meningitis were calculated. Seventy patients with meningitis were included (14 bacterial meningitis). When BMS was calculated, 25 patients showed a BMS= 0 points, 11 BMS= 1 point, and 34 BMS > or = 2 points. A BMS = 0 showed S: 100%, E: 44%, VPP: 31%, VPN: 100%, RVP: 1,81 RVN: 0. A BMS > or = 2 predicted bacterial meningitis with S: 100%, E: 64%, VPP: 41%, VPN: 100%, PLR: 2.8, NLR:0. Using BMS was simple, and allowed identifying children with very low risk of bacterial meningitis. It could be a useful tool to assist clinical decision making.
Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer
NASA Technical Reports Server (NTRS)
Lalime, Erin N.; Berlin, David
2016-01-01
Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.
Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer
NASA Technical Reports Server (NTRS)
Lalime, Erin
2016-01-01
Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.
Sharma, H J; Oun, S Aly; Bakr, S S Abou; Kapre, S V; Jadhav, S S; Dhere, R M; Bhardwaj, S
2010-04-01
To address the claim that the Leningrad-Zagreb (L-Z) mumps vaccine strain is causally associated with aseptic meningitis, a prospective, post-marketing safety study was conducted with a measles-mumps-rubella vaccine (MMR) (TRESIVAC(R); Serum Institute of India Ltd., Pune, India), which uses the L-Z strain as its mumps component in Egypt. In all, 453 119 children (65 423 children aged 16-24 months and 329 211 children aged 5-7 years) received MMR. The control groups which, as a result of local health regulations, were slightly younger than vaccinees, comprised 12 253 and 46 232 children, respectively. Using questionnaires, the parents recorded solicited local, systemic and neurological adverse events for up to 42 days post-vaccination. All data were analysed externally on an intention-to-treat basis by individuals not participating in the study. Local and/or systemic reactions were reported in a small percentage of participants, with pain, fever and parotitis being the most common signs among vaccinees in both age groups. No case of aseptic meningitis, encephalitis, anaphylaxis or convulsions was observed in any participant. Thus, in this series of more than 450 000 Egyptian children, the L-Z mumps vaccine strain in this vaccine did not cause aseptic meningitis. The vaccine is considerably cheaper than Western competitors and a valid alternative to other MMR vaccines.
Jacobs, A M E; Bénard, M; Meis, J F; van Hellemondt, G; Goosen, J H M
2017-11-01
Positive cultures are not uncommon in cases of revision total knee and hip arthroplasty (TKA and THA) for presumed aseptic causes. The purpose of this study was to assess the incidence of positive intra-operative cultures in presumed aseptic revision of TKA and THA, and to determine whether the presence of intra-operative positive cultures results in inferior survival in such cases. A retrospective cohort study was assembled with 679 patients undergoing revision knee (340 cases) or hip arthroplasty (339 cases) for presumed aseptic causes. For all patients three or more separate intra-operative cultures were obtained. Patients were diagnosed with a previously unsuspected prosthetic joint infection (PJI) if two or more cultures were positive with the same organism. Records were reviewed for demographic details, pre-operative laboratory results and culture results. The primary outcome measure was infection-free implant survival at two years. The incidence of unsuspected PJI was 27 out of 340 (7.9%) in TKA and 41 out of 339 (12.1%) in THA. Following revision TKA, the rate of infection-free implant survival in patients with an unsuspected PJI was 88% (95% confidence intervals (CI) 60 to 97) at two years compared with 98% (95% CI 94 to 99) in patients without PJI (p = 0.001). After THA, the rate of survival was similar in those with unsuspected PJI (92% (95% CI 73 to 98) at two years) and those without (94% (95% CI 89 to 97), p = 0.31). Following revision of TKA and THA for aseptic diagnoses, around 10% of cases were found to have positive cultures. In the knee, such cases had inferior infection-free survival at two years compared with those with negative cultures; there was no difference between the groups following THA. Cite this article: Bone Joint J 2017;99-B:1482-9. ©2017 The British Editorial Society of Bone & Joint Surgery.
Bismuth, Camille; Deroy, Claire
2017-01-01
Case summary Cranial ventral midline hernias, most often congenital, can be associated with other congenital abnormalities, such as sternal, diaphragmatic or cardiac malformations. A 4-year-old multiparous queen with a substernal hernia was admitted for evaluation of a mammary mass. During CT examination, a bifid sternum, the abdominal hernia containing the intestines, spleen, omentum, three fetuses, a mammary mass and an incidental peritoneopericardial diaphragmatic hernia were identified. Surgery consisted of a standard ovariohysterectomy and repair of the peritoneopericardial hernia. Primary closure of the abdominal hernia was attempted but deemed impossible even after the ovariohysterectomy, splenectomy and a partial omentectomy. An external abdominal oblique muscle flap was used to close with no tension on the cranial part of the hernia. One month postoperatively, the queen had no respiratory abnormalities and the herniorrhaphy was fully healed. Relevance and novel information This case is the first description of a 4-year-old multiparous pregnant queen with complex congenital malformations and surgical correction of a peritoneopericardial hernia and a 6 × 8 cmsubsternal hernia with an external abdominal oblique muscle flap. Life-threatening sequelae associated with large abdominal hernias can be attributed to space-occupying effects known as loss of domain and compartment syndrome, which is why a muscle flap was used in this case. The sternal cleft was not repaired because of the size of the cleft and the age of the cat. PMID:29318024
Mertz, Harold J; Prasad, Priya; Dalmotas, Dainius J; Irwin, Annette L
2016-11-01
Injury Risk Curves are developed from cadaver data for sternal deflections produced by anterior, distributed chest loads for a 25, 45, 55, 65 and 75 year-old Small Female, Mid-Size Male and Large Male based on the variations of bone strengths with age. These curves show that the risk of AIS ≥ 3 thoracic injury increases with the age of the person. This observation is consistent with NASS data of frontal accidents which shows that older unbelted drivers have a higher risk of AIS ≥ 3 chest injury than younger drivers.
Milia, Maria Grazia; Cerutti, Francesco; Gregori, Gabriella; Burdino, Elisa; Allice, Tiziano; Ruggiero, Tina; Proia, Maria; De Rosa, Giulia; Enrico, Eugenia; Lipani, Filippo; Di Perri, Giovanni; Ghisetti, Valeria
2013-11-01
Enteroviruses (EVs) are common human viral pathogens, causing a variety of diseases, including aseptic meningitis. Recently, EV aseptic meningitis outbreaks have been reported across Europe, but, in Italy, knowledge of recent EV molecular epidemiology is very limited. We report an outbreak of EV aseptic meningitis in 10 adults in North-Western Italy, from October to November 2012. Patients were parents or close relatives of children <5 years old attending the same class of a nursery school, suffering from a mild febrile upper respiratory disease. Phylogenetic relationship with other European circulating strains was analyzed updating E30 circulation in Italy in recent years. EVs were detected from cerebrospinal fluid (CSF) specimens with a real-time reverse transcription polymerase chain reaction and virus isolation was achieved from rectal and pharyngeal swabs. For cluster definition and phylogenetic studies, viral VP1 region was directly amplified and sequenced from CSF. EVs were identified in CSF from all patients and from rectal and pharyngeal swabs in 7 of them. Direct sequencing of CSF revealed the presence of the same Echovirus 30 (E30) in all patients and phylogenetic analysis identified it as a diverging clade within E30 genotype VII, the most recent strain circulating in UK, Finland and Denmark since 2006. Molecular techniques allowed the rapid identification and typing of E30 from CSF. Phylogenetic analysis revealed that the cluster might be due to a new E30 variant within the genotype VII currently circulating in Europe, thus updating the epidemiology of EV circulation in Italy. Copyright © 2013 Elsevier B.V. All rights reserved.
Das, Sakti Prasad; Ganesh, Shankar; Pradhan, Sudhakar; Singh, Deepak; Mohanty, Ram Narayan
2014-09-01
Despite the popularity and an increased use of bone morphogenetic protein to improve bone healing in patients with congenital pseudoarthrosis of the tibia (CPT), no previous study has compared its efficacy against any other procedure. We randomised 20 consecutive patients (mean age 4.1 years) with CPT (Crawford type IV) associated with neurofibromatosis type 1(NF1) and no previous history of surgery into two groups. Group 1 received recombinant human bone morphogenetic protein-7 (rhBMP-7) along with intramedullary Kirschner (K)-wire fixation and autologous bone grafting; group 2 received only K wire and grafting. Outcome measures were time to achieve union, Johnston grade, tibial length and the American Orthopaedic Foot and Ankle Society (AOFAS) score, which were evaluated preoperatively and at five year follow-up. Study results showed that patients in group 1 achieved primary bone union at a mean of 14.5 months [standard error (SE) 5.2], whereas group 2 took a mean of 17.11 months (SE 5.0). However, the log-rank test showed no difference in healing times between groups at all time points (P = 0.636). There was a statistically significant pre- to post operative improvement (P < 0.05) within groups for the other outcome measures. In a five year follow-up, these results suggest that rh-BMP-7 and autologous bone grafting is no better than autologous grafting alone.
Tschopp, Emanuel; Mateus, Octávio
2013-01-01
Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles – which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a
Tschopp, Emanuel; Mateus, Octávio
2013-03-01
Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a
Cloning higher plants from aseptically cultured tissues and cells
NASA Technical Reports Server (NTRS)
Krikorian, A. D.
1982-01-01
A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.
Dumaidi, Kamal; Al-Jawabreh, Amer
2017-01-01
Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period.
Dumaidi, Kamal; Al-Jawabreh, Amer
2017-01-01
Background Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. Aim To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. Methods During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. Results HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. Conclusion HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period. PMID:28225788
Logotheti, Maria; Pogka, Vasiliki; Horefti, Elina; Papadakos, Konstantinos; Giannaki, Maria; Pangalis, Anastasia; Sgouras, Dionyssios; Mentis, Andreas
2009-11-01
Aseptic meningitis is the most commonly observed CNS infection and is mainly attributed to Non-Polio Enteroviruses (EV). Identification and genetic analysis of the EV involved in the recent aseptic meningitis outbreak which occurred in Greece, during the summer of 2007. In total, 213 CSF and faecal samples were examined for EV presence by culture, while enteroviral RNA detection was performed by nucleic acid sequence-based amplification assay (NASBA). EV strains were typed by seroneutralization, as well as nested RT-PCR followed by VP1-2A gene partial sequencing. Phylogenetic analysis was carried out for the identification of the genetic relatedness among the isolated EV strains. EV detection rate in CSF and faecal samples was 43.9% and 70.8%, respectively. EV serotyping and VP1 region analysis revealed the predominance of echovirus 4 (ECV4) serotype and the circulation of ECV6, 9, 14, 25, Coxsackie A6, A15, A24 and Coxsackie B1 serotypes. All ECV4 isolates presented a 98.7% similarity in nucleotide sequence, with a Spanish ECV4 strain, isolated during a meningitis outbreak in 2006. It is the first time that ECV4 is associated with an aseptic meningitis outbreak in Greece, during which 9 different EV serotypes were co-circulating. All Greek ECV4 isolates were closely related to the Spanish ECV4 strain. Genetic analysis of the VP1 gene can significantly contribute to the revelation of the endemic EV strains circulation pattern and their phylogenetic relationship with enteroviruses involved in epidemics of distant geographical areas at different time periods.
Elsen, A.; Lens, K.; Nguyet, D. T. M.; Broos, S.; Stoffelen, R.; De Waele, D.
2001-01-01
Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana. PMID:19266012
Sternal skin conductance: a reasonable surrogate for hot flash measurement?
Pachman, Deirdre R; Loprinzi, Charles L; Novotny, Paul J; Satele, Daniel V; Linquist, Breanna M; Wolf, Sherry; Barton, Debra L
2013-11-01
This study aims to examine the accuracy of a new sternal skin conductance (SSC) device in measuring hot flashes and to assess the acceptability of the device by women. Three small descriptive pilot studies were performed using two sequential prototypes of the SSC device developed by an engineering device company in the Midwest. The devices were worn either in a monitored setting for 24 hours or in an ambulatory setting for 5 weeks. During the study period, women recorded hot flashes in a prospective hot flash diary and answered questions about the acceptability of wearing the SSC device. The first prototype was not able to collect any analyzable skin conductance data owing to various malfunction issues, including poor conductance and battery failure. However, 16 women wore the device for 5 weeks and reported that wearing the device was acceptable, although 31% stated that it interfered with daily activities. Hot flash data from the second prototype revealed a 24% concordance rate between self-reported and device-recorded hot flashes. Findings from these studies support discordance between device-recorded and self-reported hot flashes. In addition, the studies reveal further limitations of SSC monitoring, including difficulties with data collection and lack of consistency in interpretation. Based on these results and other recent trials identifying issues with SSC methodology, it is time to find a better physiologic surrogate measure for hot flashes.
Endotoxin as a cause of aseptic meningitis after radionuclide cisternography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooper, J.F.; Harbert, J.C.
1975-09-01
The role of pyrogens in aseptic meningitis after radionuclide cisternography was studied by means of the Limulus test, a sensitive detector of endotoxin. During a 15-month period, 39 reactions associated with cisternography were reported. Ten samples of specific lots of the radioactive drugs implicated in 20 of these reactions were tested and all reacted strongly positive to the Limulus test. The less sensitive rabbit pyrogen test was negative for these preparations when tested on a dose-per-weight basis. Our findings apparently provide clinical evidence for the observation made in animals that endotoxin is at least 1,000 times more toxic intrathecally thanmore » intravenously. The data implicate endotoxin contamination as a cause of adverse reactions to radionuclide cisternography. We conclude that the USP pyrogen test is insufficiently sensitive for intrathecal injectables and should be supplemented by the Limulus test. (auth)« less
Aseptic minimum volume vitrification technique for porcine parthenogenetically activated blastocyst.
Lin, Lin; Yu, Yutao; Zhang, Xiuqing; Yang, Huanming; Bolund, Lars; Callesen, Henrik; Vajta, Gábor
2011-01-01
Minimum volume vitrification may provide extremely high cooling and warming rates if the sample and the surrounding medium contacts directly with the respective liquid nitrogen and warming medium. However, this direct contact may result in microbial contamination. In this work, an earlier aseptic technique was applied for minimum volume vitrification. After equilibration, samples were loaded on a plastic film, immersed rapidly into factory derived, filter-sterilized liquid nitrogen, and sealed into sterile, pre-cooled straws. At warming, the straw was cut, the filmstrip was immersed into a 39 degree C warming medium, and the sample was stepwise rehydrated. Cryosurvival rates of porcine blastocysts produced by parthenogenetical activation did not differ from control, vitrified blastocysts with Cryotop. This approach can be used for minimum volume vitrification methods and may be suitable to overcome the biological dangers and legal restrictions that hamper the application of open vitrification techniques.
Anagnostou, Tilemahos L; Kazakos, George M; Savvas, Ioannis; Kostakis, Charalampos; Papadopoulou, Paraskevi
2017-01-01
The aim of this study was to investigate whether an increased frequency of gastro-oesophageal reflux (GOR) is more common in large-sized, deep-chested dogs undergoing spinal surgery in sternal recumbency than in small-sized, barrelchested dogs. Prospective, cohort study. Nineteen small-sized, barrel-chested dogs (group B) and 26 large-sized, deep-chested dogs (group D). All animals were premedicated with intramuscular (IM) acepromazine (0.05 mg kg -1 ) and pethidine (3 mg kg -1 ) IM. Anaesthesia was induced with intravenous sodium thiopental and maintained with halothane in oxygen. Lower oesophageal pH was monitored continuously after induction of anaesthesia. Gastro-oesophageal reflux was considered to have occurred whenever pH values > 7.5 or < 4 were recorded. If GOR was detected during anaesthesia, measures were taken to avoid aspiration of gastric contents into the lungs and to prevent the development of oesophagitis/oesophageal stricture. The frequency of GOR during anaesthesia was significantly higher in group D (6/26 dogs; 23.07%) than in group B (0/19 dogs; 0%) (p = 0.032). Signs indicative of aspiration pneumonia, oesophagitis or oesophageal stricture were not reported in any of the GOR cases. In large-sized, deep-chested dogs undergoing spinal surgery in sternal recumbency, it would seem prudent to consider measures aimed at preventing GOR and its potentially devastating consequences (oesophagitis/oesophageal stricture, aspiration pneumonia). Copyright © 2016 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.
Hao, Daifeng; Feng, Guang; Li, Tao; Chu, Wanli; Chen, Zequn; Li, Shanyou; Zhang, Xinjian; Zhao, Jingfeng; Zhao, Fan
2016-06-01
To observe the curative effects of platelet-rich plasma (PRP) combined with negative-pressure wound therapy (NPWT) on patients with sternal osteomyelitis and sinus tract after thoracotomy. Sixty-two patients with sternal osteomyelitis and sinus tract after thoracotomy, hospitalized from March 2011 to June 2015, were retrospectively analyzed. Based on whether receiving PRP or not, patients were divided into two groups, group NPWT ( 22 patients hospitalized from March 2011 to December 2012) and combination treatment group (CT, 40 patients hospitalized from January 2013 to June 2015). After debridement, patients in group NPWT were treated with continuous NPWT (negative pressure values from -15.96 to -13.30 kPa), while those in group CT were treated with PRP gel (blood platelet counts in PRP ranged from 1 450×10(9)/L to 1 800×10(9)/L, with 10-15 mL in each dosage) made on the surgery day to fill the sinus tract and wound, followed by NPWT. Negative pressure materials were changed every 5 days until 20 days after surgery in patients of both groups. PRP gel was replenished before changing of negative pressure materials in patients of group CT. The sinus tract sealing time, wound healing time, number of patients who had secondary repair surgery, number of patients who had recurrence of sinus tract within three months after wound healing, and length of hospital stay were recorded. Data were processed with t test, Fisher's exact test, and chi-square test. The sinus tract sealing time, wound healing time, and length of hospital stay in patients of group CT were (16±8), (27±13), and (43±13) d respectively, which were all significantly shorter than those in group NPWT [(29±14), (41±17), and (60±20) d, with t values from 3.88 to 4.67, P values below 0.01]. The number of patients who had secondary repair surgery in group CT was less than that in group NPWT (P<0.01). There was no statistically significant difference in the number of patients who had recurrence of sinus
Powers, Jan
2016-12-01
Catheter associated urinary tract infections (CAUTI) are a common complication in the hospital, especially in intensive care units (ICU). These infections are directly linked to the use of an indwelling urinary catheter. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. The primary purpose of this observational study was to assess if there is a relationship between CAUTI incidence and breaking the closed drainage system using an aseptic procedure. A process improvement effort was developed to ensure an aseptic technique was utilised when there was a need to break the integrity of the urinary drainage system. Because this was a new practice and not supported by the Centres for Disease Control (CDC) recommendations, this change in practice was evaluated as an observational study. In an eight month period there were 53 documented breaks in the urinary drainage system. There were 28 total cases of CAUTI overall during this same time period. Only four patients with a system break developed a CAUTI (7.5%). In almost 93% of the patients where aseptic technique was used for breaks in the drainage system, there was no occurrence of CAUTI. A follow-up evaluation was performed after a year of this practice in three adult ICUs. During this three month evaluation period, there were 47 documented cases of breaking this system using aseptic technique. Of the patients who had a documented break in their drainage system, none developed subsequent CAUTIs. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. This observational study found that utilising an aseptic technique to break the integrity system did not result in an associated increase in CAUTI
Sternal Skin Conductance: A reasonable surrogate for Hot Flash Measurement?
Pachman, Deirdre R.; Loprinzi, Charles L.; Novotny, Paul J; Satele, Daniel V; Linquist, Breanna M.; Wolf, Sherry; Barton, Debra L.
2013-01-01
Objective The aim of this study was to examine the accuracy of a new sternal skin conductance (SSC) device for the measurement of hot flashes, and secondly, to assess the acceptability of the device by women. Methods Three small descriptive pilot studies were performed utilizing two sequential prototypes of the SSC device developed by an engineering device company in the Midwest. The devices were worn either in a monitored setting for 24 hours or in an ambulatory setting for 5 weeks. During the study period, women recorded hot flashes in a prospective hot flash diary and also answered questions about the acceptability of wearing the SSC device. Results The first prototype was not able to collect any analyzable skin conductance data due to various malfunction issues; including poor conductance and battery failure. However, 16 patients did wear the device for 5 weeks and reported that wearing the device was acceptable, although 31% stated that it did interfere with daily activities. Hot flash data from the second prototype revealed a concordance rate between patient reported and device recorded hot flashes of 24%. Conclusions Findings from these studies support the discordance between SSC recorded and patient reported hot flashes. In addition, the studies reveal further limitations of SSC monitoring, including difficulties with data collection and lack of consistency in interpretation. Based on these results and other recent trials identifying issues with SSC methodology, it is time to find a better physiologic surrogate measure for hot flashes. PMID:23571528
Aseptic laboratory techniques: plating methods.
Sanders, Erin R
2012-05-11
Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak
Aseptic Laboratory Techniques: Plating Methods
Sanders, Erin R.
2012-01-01
Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the
Aseptic technique in microgravity.
McCuaig, K
1992-11-01
Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus
Amirhosseini, Mehdi; Andersson, Göran; Aspenberg, Per; Fahlgren, Anna
2017-12-01
Wear debris particles released from prosthetic bearing surfaces and mechanical instability of implants are two main causes of periprosthetic osteolysis. While particle-induced loosening has been studied extensively, mechanisms through which mechanical factors lead to implant loosening have been less investigated. This study compares the transcriptional profiles associated with osteolysis in a rat model for aseptic loosening, induced by either mechanical instability or titanium particles. Rats were exposed to mechanical instability or titanium particles. After 15 min, 3, 48 or 120 h from start of the stimulation, gene expression changes in periprosthetic bone tissue was determined by microarray analysis. Microarray data were analyzed by PANTHER Gene List Analysis tool and Ingenuity Pathway Analysis (IPA). Both types of osteolytic stimulation led to gene regulation in comparison to unstimulated controls after 3, 48 or 120 h. However, when mechanical instability was compared to titanium particles, no gene showed a statistically significant difference (fold change ≥ ± 1.5 and adjusted p-value ≤ 0.05) at any time point. There was a remarkable similarity in numbers and functional classification of regulated genes. Pathway analysis showed several inflammatory pathways activated by both stimuli, including Acute Phase Response signaling, IL-6 signaling and Oncostatin M signaling. Quantitative PCR confirmed the changes in expression of key genes involved in osteolysis observed by global transcriptomics. Inflammatory mediators including interleukin (IL)-6, IL-1β, chemokine (C-C motif) ligand (CCL)2, prostaglandin-endoperoxide synthase (Ptgs)2 and leukemia inhibitory factor (LIF) showed strong upregulation, as assessed by both microarray and qPCR. By investigating genome-wide expression changes we show that, despite the different nature of mechanical implant instability and titanium particles, osteolysis seems to be induced through similar biological and
Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi
2015-01-01
The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. Copyright © 2014 Elsevier Ltd. All rights reserved.
von Rüden, Christian; Morgenstern, Mario; Friederichs, Jan; Augat, Peter; Hackl, Simon; Woltmann, Alexander; Bühren, Volker; Hierholzer, Christian
2016-11-01
The purpose of this study was to evaluate the clinical and radiological outcome following compression plate fixation in combination with autologous bone grafting, with and without additional application of recombinant human bone morphogenetic protein (rhBMP) for treatment of aseptic clavicle non-union. Between April 2004 and April 2015, 82 patients were treated for clavicle fracture and had developed aseptic clavicle non-union. Seventy-three out of 82 patients were available for follow-up at least one year after revision surgery; among them, 27 women and 46 men, with a median age of 49 (range, 19-86) years. Forty-five patients received compression plate osteosynthesis with autologous bone grafting, and 28 patients obtained compression plate fixation with autologous bone grafting and additional application of rhBMP-2 (3/28 patients) or rhBMP-7 (25/28 patients). Seventy out of 73 non-unions (96 %) healed within 12 months after revision surgery. Functional outcome according to the DASH Outcome Measure (with rhBMP, 33.16 ± 1.17 points; without rhBMP, 30.58 ± 2.12 points [mean ± SEM]; p = 0.81), non-union healing (p = 0.86), time interval between revision surgery and bone healing (p = 0.37), as well as post-operative complications, did not demonstrate relevant differences between the treatment groups and were not age-dependent. Functional and radiological results demonstrate that successful healing of aseptic clavicle non-union is dependent on radical resection of non-union tissue, restoration of length of the shoulder girdle and application of stable locking-plate osteosynthesis in combination with autologous bone grafting, but not dependent on application of additional rhBMP.
Himeno, Takahiro; Shiga, Yuji; Takeshima, Shinichi; Tachiyama, Keisuke; Kamimura, Teppei; Kono, Ryuhei; Takemaru, Makoto; Takeshita, Jun; Shimoe, Yutaka; Kuriyama, Masaru
2018-01-26
We treated 437 cases of adult aseptic meningitis and 12 cases (including 2 recurrent patients; age, 31.8 ± 8.9 years; 7 females) of herpes simplex meningitis from 2004 to 2016. The incidence rate of adult herpes simplex meningitis in the cases with aseptic meningitis was 2.7%. One patient was admitted during treatment of genital herpes, but no association was observed between genital herpes and herpes simplex meningitis in the other cases. The diagnoses were confirmed in all cases as the cerebrospinal fluid (CSF) was positive for herpes simplex virus (HSV)-DNA. For diagnosis confirmation, the DNA test was useful after 2-7 days following initial disease onset. Among other types of aseptic meningitis, the patients with herpes simplex meningitis showed relatively high white blood cell counts and relatively high CSF protein and high CSF cell counts. CSF cells showed mononuclear cell dominance from the initial stage of the disease. During same period, we also experienced 12 cases of herpes simplex encephalitis and 21 cases of non-hepatic acute limbic encephalitis. Notably, the patients with herpes simplex meningitis were younger and their CSF protein and cells counts were higher than those of the patients with herpes simplex encephalitis.
Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight
NASA Technical Reports Server (NTRS)
Levine, H. G.; Krikorian, A. D.
1992-01-01
Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings
Neri, Iria; Raone, Beatrice; Dondi, Arianna; Misciali, Cosimo; Patrizi, Annalisa
2013-01-01
Idiopathic facial aseptic granuloma (IFAG), or pyodermite froide du visage, is a skin disease reported only in children and characterized by painless red nodules usually located on the cheeks. Its etiology is still unclear, but some authors considered the possibility that IFAG might be included in the spectrum of granulomatous rosacea (GR). The histopathological features of IFAG and GR are quite similar, showing perifolliculitis, granulomas, folliculitis, and lymphocytes and plasmacells around epithelioid histiocytes. In the present article, we discuss three cases in which an association between a facial nodule, compatible with both IFAG and GR, and recurrent chalazia make us support the hypothesis that IFAG should be considered as GR. © 2012 Wiley Periodicals, Inc.
Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan
2017-01-01
To evaluate Bacterial Meningitis Score (BMS) on its own and in association with Cerebrospinal Fluid (CSF) lactate dosage in order to distinguish bacterial from aseptic meningitis. Children diagnosed with meningitis at a tertiary hospital between January/2011 and December/2014 were selected. All data were obtained upon admission. BMS was applied and included: CSF Gram staining (2 points); CSF neutrophil count ≥1,000 cells/mm3 (1 point); CSF protein ≥80 mg/dL (1 point); peripheral blood neutrophil count ≥10,000 cells/mm3 (1 point) and seizures upon/before arrival (1 point). Cutoff value for CSF lactate was ≥30 mg/dL. Sensitivity, specificity and negative predictive value of several BMS cutoffs and BMS associated with high CSF lactate were evaluated for prediction of bacterial meningitis. Among 439 eligible patients, 94 did not have all data available to complete the score, and 345 patients were included: 7 in bacterial meningitis group and 338 in aseptic meningitis group. As predictive factors of bacterial meningitis, BMS ≥1 had 100% sensitivity (95%CI 47.3-100), 64.2% specificity (58.8-100) and 100% negative predictive value (97.5-100); BMS ≥2 or BMS ≥1 associated with high CSF lactate also showed 100% sensitivity (47.3-100); but 98.5% specificity (96.6-99.5) and 100% negative predictive value (98.3-100). 2 point BMS in association with CSF lactate dosage had the same sensitivity and negative predictive value, with increased specificity for diagnosis of bacterial meningitis when compared with 1-point BMS.
Takeshima, Shinichi; Shiga, Yuji; Himeno, Takahiro; Tachiyama, Keisuke; Kamimura, Teppei; Kono, Ryuhei; Takemaru, Makoto; Takeshita, Jun; Shimoe, Yutaka; Kuriyama, Masaru
2017-09-30
We treated 11 cases (52.7 ± 14.9 years, all male) with varicella zoster virus (VZV) meningitis and 437 cases with adult aseptic meningitis from 2004 to 2016. The incidence rate of adult VZV meningitis in the cases with aseptic meningitis was 2.5%. Herpes zoster infections are reported to have occurred frequently in summer and autumn. VZV meningitis also occurred frequently in the similar seasons, in our patients. The diagnoses were confirmed in 9 cases with positive VZV-DNA in the cerebrospinal fluid and in 2 cases with high VZV-IgG indexes (> 2.0). For diagnosis confirmation, the former test was useful for cases within a week of disease onset, and the latter index was useful for cases after a week of disease onset. Zoster preceded the meningitis in 8 cases, while the meningitis preceded zoster in 1 case, and 2 cases did not have zoster (zoster sine herpete). Two patients were carriers of the hepatitis B virus, 1 patient was administered an influenza vaccine 4 days before the onset of meningitis, and 1 patient was orally administered prednisolone for 2 years, for treatment. Their immunological activities might have been suppressed. The neurological complications included trigeminal neuralgia, facial palsy (Ramsay Hunt syndrome), glossopharyngeal neuralgia, and Elsberg syndrome. Because the diseases in some patients can become severe, they require careful treatment.
Nelson-McMillan, Kristen; Hornik, Christoph P; He, Xia; Vricella, Luca A; Jacobs, Jeffrey P; Hill, Kevin D; Pasquali, Sara K; Alejo, Diane E; Cameron, Duke E; Jacobs, Marshall L
2016-11-01
Delayed sternal closure (DSC) is commonly used to optimize hemodynamic stability after neonatal and infant heart surgery. We hypothesized that duration of sternum left open (SLO) was associated with rate of infection complications, and that location of sternal closure may mitigate infection risk. Infants (age ≤365 days) undergoing index operations with cardiopulmonary bypass and DSC at STS Congenital Heart Surgery Database centers (from 2007 to 2013) with adequate data quality were included. Primary outcome was occurrence of infection complication, defined as one or more of the following: endocarditis, pneumonia, wound infection, wound dehiscence, sepsis, or mediastinitis. Multivariable regression models were fit to assess association of infection complication with: duration of SLO (days), location of DSC procedure (operating room versus elsewhere), and patient and procedural factors. Of 6,127 index operations with SLO at 100 centers, median age and weight were 8 days (IQR, 5-24) and 3.3 kg (IQR, 2.9-3.8); 66% of operations were STAT morbidity category 4 or 5. At least one infection complication occurred in 18.7%, compared with 6.6% among potentially eligible neonates and infants without SLO. Duration of SLO (median, 3 days; IQR, 2-5) was associated with an increased rate of infection complications (p < 0.001). Location of DSC procedure was operating room (16%), intensive care unit (67%), or other (17%). Location of DSC was not associated with rate of infection complications (p = 0.45). Rate of occurrence of infectious complications is high among infants with sternum left open following cardiac surgery. Longer duration of SLO is associated with increased infection complications. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
Banche, Giuliana; Bistolfi, Alessandro; Allizond, Valeria; Galletta, Claudia; Iannantuoni, Maria Rita; Marra, Elisa Simona; Merlino, Chiara; Massè, Alessandro; Cuffini, Anna Maria
2018-06-18
Prosthetic joint infection diagnosis is often difficult since biofilm-embedded microorganisms attach well to the prosthetic surfaces and resist their detection by conventional methods. DL-dithiothreitol has been described as a valid method for biofilm detachment on orthopedic devices. We report the case of an occasional detection of Listeria monocytogenes in a non immuno-compromised patient with a preoperative diagnosis of aseptic loosening. The infection diagnosis due to such rare bacteria was made postoperatively, thanks to a DL-dithiothreitol-based device. This may be considered a feasible approach for the microbiological analysis of prosthetic joint infection, considering that a prompt diagnosis of such biofilm-associated infections could bring some advantages, such as an early and appropriate antibiotic therapy administration and a reduction of undiagnosed infections.
Effect of pilot-scale aseptic processing on tomato soup quality parameters.
Colle, Ines J P; Andrys, Anna; Grundelius, Andrea; Lemmens, Lien; Löfgren, Anders; Buggenhout, Sandy Van; Loey, Ann; Hendrickx, Marc Van
2011-01-01
Tomatoes are often processed into shelf-stable products. However, the different processing steps might have an impact on the product quality. In this study, a model tomato soup was prepared and the impact of pilot-scale aseptic processing, including heat treatment and high-pressure homogenization, on some selected quality parameters was evaluated. The vitamin C content, the lycopene isomer content, and the lycopene bioaccessibility were considered as health-promoting attributes. As a structural characteristic, the viscosity of the tomato soup was investigated. A tomato soup without oil as well as a tomato soup containing 5% olive oil were evaluated. Thermal processing had a negative effect on the vitamin C content, while lycopene degradation was limited. For both compounds, high-pressure homogenization caused additional losses. High-pressure homogenization also resulted in a higher viscosity that was accompanied by a decrease in lycopene bioaccessibility. The presence of lipids clearly enhanced the lycopene isomerization susceptibility and improved the bioaccessibility. The results obtained in this study are of relevance for product formulation and process design of tomato-based food products. © 2011 Institute of Food Technologists®
Innovative food processing technology using ohmic heating and aseptic packaging for meat.
Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko
2014-02-01
Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage. © 2013. Published by Elsevier Ltd on behalf of The American Meat Science Association. All rights reserved.
Takeo, H; Sakurai, T; Amaki, I
1983-01-01
The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.
Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan
2017-01-01
ABSTRACT Objective: To evaluate Bacterial Meningitis Score (BMS) on its own and in association with Cerebrospinal Fluid (CSF) lactate dosage in order to distinguish bacterial from aseptic meningitis. Methods: Children diagnosed with meningitis at a tertiary hospital between January/2011 and December/2014 were selected. All data were obtained upon admission. BMS was applied and included: CSF Gram staining (2 points); CSF neutrophil count ≥1,000 cells/mm3 (1 point); CSF protein ≥80 mg/dL (1 point); peripheral blood neutrophil count ≥10,000 cells/mm3 (1 point) and seizures upon/before arrival (1 point). Cutoff value for CSF lactate was ≥30 mg/dL. Sensitivity, specificity and negative predictive value of several BMS cutoffs and BMS associated with high CSF lactate were evaluated for prediction of bacterial meningitis. Results: Among 439 eligible patients, 94 did not have all data available to complete the score, and 345 patients were included: 7 in bacterial meningitis group and 338 in aseptic meningitis group. As predictive factors of bacterial meningitis, BMS ≥1 had 100% sensitivity (95%CI 47.3-100), 64.2% specificity (58.8-100) and 100% negative predictive value (97.5-100); BMS ≥2 or BMS ≥1 associated with high CSF lactate also showed 100% sensitivity (47.3-100); but 98.5% specificity (96.6-99.5) and 100% negative predictive value (98.3-100). Conclusions: 2 point BMS in association with CSF lactate dosage had the same sensitivity and negative predictive value, with increased specificity for diagnosis of bacterial meningitis when compared with 1-point BMS. PMID:29185620
El-Warrak, Alexander O; Olmstead, Marvin; Schneider, Rebecca; Meinel, Lorenz; Bettschart-Wolfisberger, Regula; Akens, Margarete K; Auer, Joerg; von Rechenberg, Brigitte
2004-01-01
Background Aseptic loosening of hip prosthesis as it occurs in clinical cases in human patients was attributed to wear particles of the implants, the response of the tissue dominated by macrophages and the production of inflammatory mediators and matrix degrading enzymes; however, the cascade of events initiating the process and their interaction regarding the time course is still open and discussed controversially. Therefore, the goal of this study was to establish an experimental animal model in sheep allowing to follow the cascade of early mechanical and biochemical events within the interface membrane and study the sequence of how they contribute to the pathological bone resorption necessary for aseptic loosening of the implant. Methods A cemented modular system (Biomedtrix) was used as a hip replacement in 24 adult Swiss Alpine sheep, with one group receiving a complete cement mantle as controls (n = 12), and the other group a cement mantle with a standardized, lateral, primary defect in the cement mantle (n = 12). Animals were followed over time for 2 and 8.5 months (n = 6 each). After sacrifice, samples from the interface membranes were harvested from five different regions of the femur and joint capsule. Explant cell cultures were performed and supernatant of cultures were tested and assayed for nitric oxide, prostaglandin E2, caseinolytic and collagenolytic activity. RNA extraction and quantification were performed for inducible nitric oxide synthase, cyclooxygenase-2, interleukin 1, and interleukin 6. Overall differences between groups and time periods and interactions thereof were calculated using a factorial analysis of variance (ANOVA). Results The development of an interface membrane was noticed in both groups at both time points. However, in the controls the interface membrane regressed in thickness and biological activity, while both variables increased in the experimental group with the primary cement mantle defect over time. Nitric oxide (NO) and
Tsurko, V V; Ivanova, M M; Sysoev, V F; Pushkova, O V; Badokina, G I
1988-01-01
Clinical, x-ray and scintigraphic investigations were performed in 34 patients with systemic lupus erythematosus (SLE): 24 patients with SLE complicated by osteonecrosis of the head of the femur (the 1st group) and 10 patients with SLE without clinicoroentgenological signs of aseptic necrosis (the 2nd group). Analysis of the results of scintigraphic investigation showed that the coefficient of radionuclide absorption in the SLE patients with suspected osteonecrosis (stage I) as compared to the controls and patients with stage II osteonecrosis of the head of the femur turned out to be significantly discernible (p less than 0.001). Thus, an early stage of osteonecrosis of the head of the femur can be reliably diagnosed by scintigraphy. Quantitative scintigraphy can be effectively used for dynamic observation and objectification of applied therapy.
Cadosch, Dieter; Chan, Erwin; Gautschi, Oliver P; Filgueira, Luis
2009-12-15
Metal implants are essential therapeutic tools for the treatment of bone fractures and joint replacements. The metals and metal alloys used in contemporary orthopedic and trauma surgery are well tolerated by the majority of patients. However, complications resulting from inflammatory and immune reactions to metal implants have been well documented. This review briefly discusses the different mechanisms of metal implant corrosion in the human body, which lead to the release of significant levels of metal ions into the peri-implant tissues and the systemic blood circulation. Additionally, this article reviews the effects of the released ions on bone metabolism and the immune system and discusses their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity in patients with metal implants.
2013-01-01
Background An unusually high incidence of aseptic meningitis caused by enteroviruses was noted in Alberta, Canada between March and October 2010. Sequence based typing was performed on the enterovirus positive samples to gain a better understanding of the molecular characteristics of the Coxsackie A9 (CVA-9) strain responsible for most cases in this outbreak. Methods Molecular typing was performed by amplification and sequencing of the VP2 region. The genomic sequence of one of the 2010 outbreak isolates was compared to a CVA-9 isolate from 2003 and the prototype sequence to study genetic drift and recombination. Results Of the 4323 samples tested, 213 were positive for enteroviruses (4.93%). The majority of the positives were detected in CSF samples (n = 157, 73.71%) and 81.94% of the sequenced isolates were typed as CVA-9. The sequenced CVA-9 positives were predominantly (94.16%) detected in patients ranging in age from 15 to 29 years and the peak months for detection were between March and October. Full genome sequence comparisons revealed that the CVA-9 viruses isolated in Alberta in 2003 and 2010 were highly homologous to the prototype CVA-9 in the structural VP1, VP2 and VP3 regions but divergent in the VP4, non-structural and non-coding regions. Conclusion The increase in cases of aseptic meningitis was associated with enterovirus CVA-9. Sequence divergence between the prototype strain of CVA-9 and the Alberta isolates suggests genetic drifting and/or recombination events, however the sequence was conserved in the antigenic regions determined by the VP1, VP2 and VP3 genes. These results suggest that the increase in CVA-9 cases likely did not result from the emergence of a radically different immune escape mutant. PMID:23521862
Yan, Ju-Ying; Lu, Yi-Yu; Xu, Chang-Ping; Yu, Zhao; Gong, Li-Ming; Chen, Yin; Zhang, Yan-Jun
2011-09-01
In order to confirm the cause of the outbreak of aseptic meningitis in Zhejiang Province in 2002-2004, trace the pathogen and analyze the molecular characteristics, 271 cerebrospinal fluid (CSF) and faeces specimens were collected from suspected patients. The virus strains from the specimens were isolated with RD and Hep-2 cell lines. The VP1 and VP4/VP2 genes of the isolated viruses were sequenced, and their phylogenetic and homology trees were also constructed. Of the total 271 samples, 78 Echovirus type 30 (E30) strains were isolated. All of the complete VP1 genes in 31 sequenced virus isolates of E30 were composed of 876 nt without any insertion or deletion, encoding 292 amino acids (aa). The identity of nucleotide and amino acid in VP1 gene were 84.7%-86.3% and 92.1%-94.2% between the 31 Zhejiang strains and the prototype strain Bastianni of E30, and 87.1%-99.4% and 96.2%-100% among the 31 Zhejiang strains, respectively. The Zhejiang strains of E30 in the phylogenetic tree of the VP1 gene were attributed into two branches of the G and H genotype, respectively. In G genotype, the Shangdong and Jiangsu E30 strains in 2003 among domestic strains and Ukraine E30 strain in 1999 among overseas strains had maximum similarity with the Zhejiang strains, while H genotype had maximum similarity with the Korea E30 strains in 2008. The phylogenetic tree of the VP4/VP2 genes was similar to that of VP1 gene. The results indicated that the outbreak of aseptic meningitis in Zhejiang Provinec in 2002-2004 was caused by the G and H genotypes of E30 strains existing simultaneously. The H genotype was a new variant strain, which was first isolated in Zhejiang Province in 2002.
Histopathology of aseptic necrosis of the femoral head in sickle cell disease.
Mukisi-Mukaza, Martin; Gomez-Brouchet, Anne; Donkerwolcke, Monique; Hinsenkamp, Maurice; Burny, Franz
2011-08-01
This study compares the histopathology of bone biopsies from patients suffering from sickle cell anaemia (homozygote SS) to heterozygote patients (SA) and homozygotes with aseptic osteonecrosis (AA). The sensitivity to bacterial infection of sickle cell patients raises the question of the aetiology of sepsis in the onset of the necrosis. To our knowledge this study is the first to analyse the histopathology of osteonecrosis of the femoral head, at its early stages, in sickle cell anaemia. At the University Hospital of Pointe-à-Pitre, from 1994 to 2007, 38 bone biopsies were obtained from adult patients with avascular necrosis of the femoral head at the time of a core decompression procedure (SS, SC: 27; AS: 5; AA: 6). The histology of the biopsies confirmed the necrosis; all bacteriological cultures were negative. Patients displaying one S gene (SS, SC, AS) compared to homozygote subjects (AA) showed a significant increase of a nonspecific inflammatory granulomatosis (p = 0.003). No relationship was observed between the radiological stages and the histology whatever the genotype (p = 0.1). Inflammatory histopathology without sepsis or advanced alteration characterises the early stages of sickle cell necrosis. This inflammatory process is absent in idiopathic avascular necrosis.
NASA Technical Reports Server (NTRS)
Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.
2001-01-01
Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.
2007-01-01
including scoliosis and pseudoarthrosis, which are compounded by osteoporosis and poor bone healing. Corrective orthopaedic intervention often fails...3 - Introduction: A large proportion of patients with Neurofibromatosis Type 1 display skeletal abnormalities including scoliosis and...abnormalities including alterations in bone size and shape, the presence of scoliosis , and a tendency to develop pseudoarthrosis. These skeletal
Megas, Panagiotis; Syggelos, Spyros A; Kontakis, Georgios; Giannakopoulos, Andreas; Skouteris, Georgios; Lambiris, Elias; Panagiotopoulos, Elias
2009-07-01
This retrospective, multicentre study aimed to evaluate reamed intramedullary nailing (IMN) for the treatment of 30 cases of aseptic femoral shaft non-union after plating failure. Following nailing, 29 non-unions had healed by a mean 7.93 months. In one case a hypertrophic non-union required renailing after 8 months, using a nail of greater diameter, and united within five further months. Healing times were not related to whether the fracture was open or closed, the type non-union or the type of fracture. The delay from the initial plating to intramedullary nailing had a statistically significant effect on healing time and final outcome. This treatment is cost effective and should be implemented as soon as the non-union is diagnosed.
Erichsen Andersson, Annette; Frödin, Maria; Dellenborg, Lisen; Wallin, Lars; Hök, Jesper; Gillespie, Brigid M; Wikström, Ewa
2018-01-04
Hand hygiene and aseptic techniques are essential preventives in combating hospital-acquired infections. However, implementation of these strategies in the operating room remains suboptimal. There is a paucity of intervention studies providing detailed information on effective methods for change. This study aimed to evaluate the process of implementing a theory-driven knowledge translation program for improved use of hand hygiene and aseptic techniques in the operating room. The study was set in an operating department of a university hospital. The intervention was underpinned by theories on organizational learning, culture and person centeredness. Qualitative process data were collected via participant observations and analyzed using a thematic approach. Doubts that hand-hygiene practices are effective in preventing hospital acquired infections, strong boundaries and distrust between professional groups and a lack of psychological safety were identified as barriers towards change. Facilitated interprofessional dialogue and learning in "safe spaces" worked as mechanisms for motivation and engagement. Allowing for the free expression of different opinions, doubts and viewing resistance as a natural part of any change was effective in engaging all professional categories in co-creation of clinical relevant solutions to improve hand hygiene. Enabling nurses and physicians to think and talk differently about hospital acquired infections and hand hygiene requires a shift from the concept of one-way directed compliance towards change and learning as the result of a participatory and meaning-making process. The present study is a part of the Safe Hands project, and is registered with ClinicalTrials.gov (ID: NCT02983136 ). Date of registration 2016/11/28, retrospectively registered.
Aseptic loosening of cobalt chromium monoblock sockets after hip resurfacing.
Amstutz, Harlan C; Le Duff, Michel J
2015-01-01
Acetabular component loosening is a leading cause for revision after metal-on-metal hip resurfacing arthroplasty (MMHRA). We aimed to identify potential risk factors and determine radiographic signs associated with this mode of failure. From a series of 1375 hips treated with MMHRA, 21 (20 patients) underwent revision surgery secondary to aseptic loosening of the acetabular component and 6 patients had a radiographically loose acetabular component. A control group of 27 hips (26 patients) was selected among the patients that did not have a revision, and was matched for age, gender, component size and diagnosis. Mean time to revision in the loosening group was 103.0 months and the mean time of follow-up in the control group was 161.4 months. We found greater activity levels, range of motion scores, and cup abduction angles in the loosening group. The centre-edge (CE) angle of Wiberg was 10° lower in the loosening group compared with the control group. In addition, 11 of the hips from the study group presented a sclerotic halo superior to the cup on the last radiograph vs. none in the control group. There was no difference in the prevalence of postoperative reaming gaps or radiographic signs of neck-cup impingement between the 2 groups. Risk factors for acetabular loosening included hip dysplasia with low CE angle, and a large cup abduction angle. The patient's level of activity influences the appearance of symptoms and the time to revision. We recommend selecting patients with a sufficient CE angle and properly orienting the cup.
Chen, Peng; Lin, Xiaojuan; Liu, Guifang; Wang, Suting; Song, Lizhi; Tao, Zexin; Xu, Aiqiang
2018-03-01
We reviewed the epidemiological and clinical characteristics of 927 aseptic meningitis patients in Shandong in 2014, and the phylogeny of predominant enterovirus (EV) types causing this disease was analyzed. A total of 209 patients that were positive for EV were identified by both cell culture and a reverse transcription-seminested PCR in cerebrospinal fluid samples. The positive patients were most likely to be children within 15 years of age, had symptoms such as fever, vomiting and nausea (P< .05). The 209 EV sequences belonged to 11 types, and coxsackievirus B5, echovirus types 6 and 30 were predominant types. VP1 analysis exhibited multiple lineages were co-circulating. The significance of the study could come from the fact that surveillance is important to monitor the prevalence of EV types in population, which shows enterovirus meningitis maintains an important public health problem in China. Copyright © 2018 Elsevier Inc. All rights reserved.
Werle, Stephan; AbuNahleh, Kais; Boehm, Heinrich
2016-08-01
Potential adverse and unknown long-term effects as well as additional costs limit the use of BMPs (Bone morphogenetic proteins) in primary fusion procedures. However, the proven osteoinductive properties render BMPs attractive for the attempt to reach fusion of symptomatic non-unions. The aim of this study is to evaluate the fusion rate and potential disadvantages of eptotermin alfa (rhBMP-7) used with autologous bone graft in revision procedures for lumbar pseudoarthrosis. At our institution, rhBMP-7 has been used to improve fusion rates in revision surgery for symptomatic pseudoarthrosis during the past 10 years. Eighty-four fusion procedures using rhBMP-7 between 08/2003 and 07/2011 were revisions due to symptomatic lumbar pseudoarthrosis. The surgical approach was posterior in three and combined anterior-posterior in 71 patients. Of those, 74 patients had either reached fusion or had follow-up of at least 39.5 months (range 21-80 months) in the case of pseudoarthrosis. These 74 patients have been included in a retrospective follow-up study. In 60 patients (81.1 %) the rhBMP-7 procedure was successful. In 14 patients, pseudoarthrosis persisted or fusion was questionable. Of those patients 12 accounted for persisting L5-S1 non-union. Persisting non-unions were found in 26.7 % of the study after four or more segment instrumentations compared to the 16.9 % after mono-, bi-, or three-segment instrumentation, and in four of 14 patients with spondylodesis of three or more levels above a pseudoarthrotic lumbosacral junction. Adverse effects related to the use of eptotermin alfa were rare in this group with symptomatic ectopic bone formation in one patient. Using rhBMP-7 with autologous bone graft in revisions for lumbar pseudoarthrosis via an anterior approach is safe and can lead to fusion even under unfavorable biomechanical conditions. However, successful outcome depends on the individual constellation. Treatment of non-unions of the lumbosacral junction
Randau, Thomas M; Friedrich, Max J; Wimmer, Matthias D; Reichert, Ben; Kuberra, Dominik; Stoffel-Wagner, Birgit; Limmer, Andreas; Wirtz, Dieter C; Gravius, Sascha
2014-01-01
The preoperative differentiation between septic and aseptic loosening after total hip or knee arthroplasty is essential for successful therapy and relies in part on biomarkers. The objective of this study was to assess synovial and serum levels of inflammatory proteins as diagnostic tool for periprosthetic joint infection and compare their accuracy with standard tests. 120 patients presenting with a painful knee or hip endoprosthesis for surgical revision were included in this prospective trial. Blood samples and samples of intraoperatively acquired joint fluid aspirate were collected. White blood cell count, C-reactive protein, procalcitonin and interleukin-6 were determined. The joint aspirate was analyzed for total leukocyte count and IL-6. The definite diagnosis of PJI was determined on the basis of purulent synovial fluid, histopathology and microbiology. IL-6 in serum showed significantly higher values in the PJI group as compared to aseptic loosening and control, with specificity at 58.3% and a sensitivity of 79.5% at a cut-off value of 2.6 pg/ml. With a cut-off >6.6 pg/ml, the specificity increased to 88.3%. IL-6 in joint aspirate had, at a cut-off of >2100 pg/ml, a specificity of 85.7% and sensitivity of 59.4%. At levels >9000 pg/ml, specificity was almost at 100% with sensitivity just below 50%, so PJI could be considered proven with IL-6 levels above this threshold. Our data supports the published results on IL-6 as a biomarker in PJI. In our large prospective cohort of revision arthroplasty patients, the use of IL-6 in synovial fluid appears to be a more accurate marker than either the white blood cell count or the C-reactive protein level in serum for the detection of periprosthetic joint infection. On the basis of the results we recommend the use of the synovial fluid biomarker IL-6 for the diagnosis of periprosthetic joint infection following total hip and knee arthroplasty.
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Tall, M L; Salmon, D; Diouf, E; Drai, J; Filali, S; Lépilliez, V; Pioche, M; Laleye, D; Dhelens, C; Ponchon, T; Pivot, C; Pirot, F
2015-03-01
As part of a hospital clinical research program on endoscopic curative treatment for early epithelial neoplastic lesions of the gastrointestinal tract, a new hospital sterile and non-pyrogenic preparation of fructose (5%)-glycerol (10%) was realized. Under pharmaceutical legislation, the provision of this hospital preparation involves of aseptic process validation and achieve a stability study. After the aseptic process validation with Mediafill Test, the preparation was made under aseptic conditions associated with a sterilizing filtration according to the good practices preparation. Prepared flexible bags (100mL of solution) were stored for one year in a climatic chamber (25±2°C). To assess stability, the physicochemical controls (fructose concentration, glycerol concentration, hydroxy-methyl-5 furfural [5-HMF] concentration, sodium concentration, pH measure, osmolality and sub-visible particles count) and microbiological (bioburden, bacterial endotoxin and sterility) were performed at regular intervals for one year. Neither significant decrease of fructose concentration, glycerol concentration and sodium concentration nor pH, 5-HMF, osmolality variations out of specifications were observed for one year. The sub-visible particles count, the bacterial endotoxin and sterility were in accordance with the European pharmacopoeia attesting limpidity, apyrogenicity and sterility of this injectable preparation. The hospital preparation was stable over one year at 25±2°C, ensuring safe administration in humans within the framework of this clinical research. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Joshi, V; Vaja, R; Richens, D
2016-01-01
The use of antibiotic-impregnated sponges (Collatamp) during cardiac surgery is controversial. We analysed the cost-effectiveness of its selective use in patients at high-risk of sternal wound infection (SWI). Postoperative costs were analysed in two groups of patients undergoing heart surgery between 2011 and 2013: those with SWI (group 1) and in high-risk patients without SWI (group 2). The potential cost of gentamicin-impregnated collagen sponges (GCS) use in high-risk patients was compared with our current practice. We identified 1,251 patients with at least one recognised risk factor for developing SWI in this period. Of these, 18 developed SWI (incidence 1.4%). The median postoperative cost per patient without SWI was £9,617. The additional cost per patient incurred by SWI was £4,860.75. The annual additional cost for treating patients with SWI was £43,749. With a 50% reduction in SWI, the annual additional cost of treating these patients would be reduced to £21,873. The cost of GCS is £80 per patient. Adding this to £21,873 gives a potential total cost of £71,913 in the treated high-risk cohort. In our practice the annual cost of treating SWI in high-risk patients without use of GCS is lower than the annual cost of using GCS in all high-risk patients (£43,749 versus £71,913) if it produces a 50% reduction in SWI. The reduction in the incidence of SWI poses no economic benefit when the cost of the product is factored in.
Liu, Dong; Wang, Wenzhang; Cai, Aibing; Han, Zhiyi; Li, Xiyuan; Ma, Jiagui
2015-03-01
To analyze and summarize the clinical features and experience in surgical treatment of deep sternal infection (DSWI). This was a retrospective study. From January 2008 to December 2013, 189 patients with secondary DSWI after cardiac surgery underwent the pectoralis major muscle flap transposition in our department. There were 116 male and 73 female patients. The mean age was (54 ± 21) years, the body mass index was (26. 1 ± 1. 3) kg/m2. The incidence of postoperation DSWI were after isolated coronary artery bypass grafting (CABG) in 93 patients, after other heart surgery plus CABG in 13 patients, after valve surgery in 47 patients, after thoracic aortic surgery in 16 patients, after congenital heart disease in 18 patients, and after cardiac injury in 2 patients. Clean patients' wound and extract secretions, clear the infection thoroughly by surgery and select antibiotics based on susceptibility results, and then repair the wound with appropriate muscle flap, place drain tube with negative pressure. Of all the 189 patients, 184 used isolate pectoralis, 1 used isolate rectus, and 4 used pectoralis plus rectus. The operative wounds of 179 patients were primary healing (94. 7%). Hospital discharge was postponed by 1 week for 7 patients, due to subcutaneous wound infection. Subcutaneous wound infection occurred again in 8 patients 1 week after hospital discharge, and their wounds healed after wound dressing. Nine patients (4. 7%) did not recover, due to residue of the sequestrum and costal chondritis, whom were later cured by undergoing a second treatment of debridement and pectoralis major muscle flap transposition. Eight patients died, in which 2 died of respiratory failure, 2 died of bacterial endocarditis with septicemia, 2 died of renal failure, 1 died of intraoperative bleeding leading to brain death and the 1 died of heart failure. The mortality rate was 4. 2% . The average length of postoperative hospital stay was (14 ± 5) days. The longest postoperative
Shekalaghe, Seif; Rutaihwa, Mastidia; Billingsley, Peter F.; Chemba, Mwajuma; Daubenberger, Claudia A.; James, Eric R.; Mpina, Maximillian; Ali Juma, Omar; Schindler, Tobias; Huber, Eric; Gunasekera, Anusha; Manoj, Anita; Simon, Beatus; Saverino, Elizabeth; Church, L. W. Preston; Hermsen, Cornelus C.; Sauerwein, Robert W.; Plowe, Christopher; Venkatesan, Meera; Sasi, Philip; Lweno, Omar; Mutani, Paul; Hamad, Ali; Mohammed, Ali; Urassa, Alwisa; Mzee, Tutu; Padilla, Debbie; Ruben, Adam; Lee Sim, B. Kim; Tanner, Marcel; Abdulla, Salim; Hoffman, Stephen L.
2014-01-01
Controlled human malaria infection (CHMI) by mosquito bite has been used to assess anti-malaria interventions in > 1,500 volunteers since development of methods for infecting mosquitoes by feeding on Plasmodium falciparum (Pf) gametocyte cultures. Such CHMIs have never been used in Africa. Aseptic, purified, cryopreserved Pf sporozoites, PfSPZ Challenge, were used to infect Dutch volunteers by intradermal injection. We conducted a double-blind, placebo-controlled trial to assess safety and infectivity of PfSPZ Challenge in adult male Tanzanians. Volunteers were injected intradermally with 10,000 (N = 12) or 25,000 (N = 12) PfSPZ or normal saline (N = 6). PfSPZ Challenge was well tolerated and safe. Eleven of 12 and 10 of 11 subjects, who received 10,000 and 25,000 PfSPZ respectively, developed parasitemia. In 10,000 versus 25,000 PfSPZ groups geometric mean days from injection to Pf positivity by thick blood film was 15.4 versus 13.5 (P = 0.023). Alpha-thalassemia heterozygosity had no apparent effect on infectivity. PfSPZ Challenge was safe, well tolerated, and infectious. PMID:25070995
Calpe-Berdiel, Laura; Escolà-Gil, Joan Carles; Benítez, Sonia; Bancells, Cristina; González-Sastre, Francesc; Palomer, Xavier; Blanco-Vaca, Francisco
2007-05-01
Although most studies have focused on the cholesterol-lowering activity of phytosterols, other biological actions have been ascribed to these plant sterol compounds, one of which is a potential immune modulatory effect. To gain insight into this issue, we used a mouse model of acute, aseptic inflammation induced by a single subcutaneous turpentine injection. Hypercholesterolemic apolipoprotein E-deficient (apoE(-/-)) mice, fed with or without a 2% phytosterol supplement, were treated with turpentine or saline and euthanized 48 h later. No differences were observed in spleen lymphocyte subsets between phytosterol- and control-fed apoE(-/-) mice. However, cultured spleen lymphocytes of apoE(-/-) mice fed with phytosterols and treated with turpentine showed increased IL-2 and IFN-gamma secretion (T-helper type1, Th1 lymphocyte cytokines) compared with turpentine-treated, control-fed animals. In contrast, there was no change in Th2 cytokines IL-4 and IL-10. Phytosterols also inhibit intestinal cholesterol absorption in wild-type C57BL/6J mice but, in this case, without decreasing plasma cholesterol. Spleen lymphocytes of turpentine-treated C57BL/6J mice fed with phytosterols also showed increased IL-2 production, but IFN-gamma, IL-4 and IL-10 production was unchanged. The Th1/Th2 ratio was significantly increased both in phytosterol-fed apoE(-/-) and C57BL/6J mice. We conclude that phytosterols modulate the T-helper immune response in vivo, in part independently of their hypocholesterolemic effect in a setting of acute, aseptic inflammation. Further study of phytosterol effects on immune-based diseases characterized by an exacerbated Th2 response is thus of interest.
Smith, Samuel; Borgkvist, Bradley; Kist, Teara; Annelin, Jason; Johnson, Don; Long, Robert
2016-01-01
This study compared the effects of amiodarone via sternal intraosseous (SIO) and intravenous (IV) routes on return of spontaneous circulation (ROSC), time to ROSC, concentration maximum (C max ), time to maximum concentration (T max ), and mean concentrations over time in a hypovolemic cardiac arrest model. Prospective, between subjects, randomized experimental design. TriService Research Facility. Yorkshire-cross swine (n = 28). Swine were anesthetized and placed into cardiac arrest. After 2 minutes, cardiopulmonary resuscitation was initiated. After an additional 2 minutes, amiodarone 300 mg was administered via the tibial intraosseous TIO or the IV route. Blood samples were collected over 5 minutes. The plasma concentrations were analyzed using high-performance liquid chromatography tandem mass spectrometry. ROSC, time to ROSC, C max , T max , and mean concentrations over time. A multivariate analyses of variance indicated that there were no significant differences in the SIO and IV groups in ROSC (p = 0.191), time to ROSC (p > 0.05), T max mean 88.1 ± 24.8 seconds versus 49.5 ± 21.8 seconds (p = 0.317), or C max mean 92,700 ± 161,112 ng/mL versus 64,159.8 ± 14,174.8 ng/mL (p = 0.260). A repeated analyses of variance indicated that there were no significant differences between the groups relative to concentrations over time (p > 0.05). The SIO provides rapid and reliable access to administer life-saving medications during cardiac arrest.
Elenes, Egleide Y; Hunter, Shawn A
2014-08-20
Allograft safety is contingent on effective sterilization. However, current sterilization methods have been associated with decreased biomechanical strength and higher failure rates of soft-tissue allografts. In this study, electron beam (e-beam) sterilization was explored as an alternative sterilization method to preserve biomechanical integrity. We hypothesized that e-beam sterilization would not significantly alter the biomechanical properties of tendon allograft compared with aseptic, nonsterilized controls and gamma-irradiated grafts. Separate sets of forty fresh-frozen tibialis tendon allografts (four from each of ten donors) and forty bisected bone-patellar tendon-bone (BTB) allografts (four from each of ten donors) were randomly assigned to four study groups. One group received a 17.1 to 21.0-kGy gamma radiation dose; two other groups were sterilized with an e-beam at either a high (17.1 to 21.0-kGy) or low (9.2 to 12.2-kGy) dose. A fourth group served as nonsterilized controls. Each graft was cyclically loaded to 200 N of tension for 2000 cycles at a frequency of 2 Hz, allowed to relax for five minutes, and then tested in tension until failure at a 100%/sec strain rate. One-way analysis of variance testing was used to identify significant differences. Tibialis tendons sterilized with both e-beam treatments and with gamma irradiation exhibited values for cyclic tendon elongation, maximum load, maximum displacement, stiffness, maximum stress, maximum strain, and elastic modulus that were not significantly different from those of nonsterilized controls. BTB allografts sterilized with the high e-beam dose and with gamma irradiation were not significantly different in cyclic tendon elongation, maximum load, maximum displacement, stiffness, maximum stress, maximum strain, and elastic modulus from nonsterilized controls. BTB allografts sterilized with the e-beam at the lower dose were significantly less stiff than nonsterilized controls (p = 0.014) but did not
Anterior augmentation plating of aseptic humeral shaft nonunions after intramedullary nailing.
Gessmann, Jan; Königshausen, Matthias; Coulibaly, Marlon Osman; Schildhauer, Thomas Armin; Seybold, Dominik
2016-05-01
Humeral shaft nonunion after intramedullary nailing is a rare but serious complication. Treatment options include implant removal, open plating, exchange nailing and external fixation. The objective of this retrospective study was to determine whether augmentation plating without nail removal is feasible for treating a humeral shaft nonunion. Between 2002 and 2014, 37 patients (mean age 51, range 20-84 years) with aseptic humeral shaft nonunions prior to intramedullary nailing were treated with augmentation plating. The initial fractures had been fixed with retrograde nails (10 cases) or anterograde nails (27 cases). There were 34 atrophic nonunions and 3 hypertrophic nonunions. Nonunion treatment of all patients consisted of local debridement through an anterior approach to the humerus and anterior placement of the augmentation plates. Supplemental bone grafting was performed in all atrophic nonunion cases. All patients were followed until union was radiologically confirmed. Union was achieved in 36 patients (97 %) after a mean of 6 months (range 3-24 months). There was one case of iatrogenic median nerve palsy that showed complete spontaneous recovery 6 weeks postoperatively. One patient sustained a peri-implant stress fracture that was treated successfully by exchanging the augmentation plate to bridge the nonunion and the fracture. No infections or wound healing complications developed. At a mean follow-up of 14 months, all patients showed free shoulder and elbow motion and no restrictions in daily or working life. The results indicate that augmentation plating using an anterior approach is a safe and reliable option for humeral shaft nonunions after failed nailing, and the treatment has no substantial complications. Because the healing rates are similar to the standard technique of nail removal and fixation by compression or locking plates, we consider this technique to be an alternative choice for treatment.
Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru
2015-01-01
We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.
Arruda, Celina; Vaz, Celidéia A C; Calich, Vera L G
2007-05-01
The murine model of paracoccidioidomycosis, the most important South American endemic mycosis, mimics the human disease: resistance is associated with preserved cellular immunity while T-cell anergy is related with susceptibility. In the present study we asked whether a previous s.c. infection which induces strong cellular immunity would protect mice against a lethal pulmonary challenge. It was found that susceptible but not resistant mice developed immunoprotection and aseptic cure of infection. Immunoprotection led to reversal of DTH anergy, increased levels of antibodies and pulmonary IL-12, IL-2 and IL-4 indicating a balanced type 1/type 2 response. On the contrary, no marked differences in A/Sn infection and immunity were observed. Depletion experiments showed that immunoprotection required the cooperative action of CD4(+) and CD8(+) T cells in association with IFN-gamma and IL-12. Altogether, these observations demonstrated that susceptible hosts can develop sterilizing immunity and defined the main immunological requirements to control secondary paracoccidioidomycosis.
Seol, Jung Eun; Park, In Ho; Kim, Do Hyeong; Park, So Hee; Kang, Jeong Nan; Kim, Hyojin; Seo, Jong Keun
2016-01-01
Alopecic and aseptic nodule of the scalp (AANS) is a rare disease entity first reported in 1992 as pseudocyst of the scalp (PCS). Controversy exists regarding the histopathology and etiology of reported cases. We performed this study to analyze the clinical and histopathologic features of AANS/PCS in Korean patients. A retrospective review of medical records from 2008 to 2013 at Inje University Busan Paik Hospital was performed. Eleven patients were enrolled. All patients were male, and their mean age was 21.6 years. Most patients had a solitary nodule (10/11) located predominantly on the vertex. The mean nodule size was 20 mm. Inflammatory cell infiltration in the deep dermis was a histologic feature of AANS/PCS. Eight patients showed granulomatous infiltration. All patients were treated with short-term antibiotics and intralesional steroid injection. Our results suggest that dermatologists should consider AANS when diagnosing an alopecic nodule on the scalp. © 2015 S. Karger AG, Basel.
Deli, Chariklia K; Fatouros, Ioannis G; Paschalis, Vassilis; Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis; Jamurtas, Athanasios Z
2017-01-01
Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults ( n = 14) and children ( n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation ( p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Clinicaltrials.gov Identifier: NCT02374619.
Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait.
Dalwai, Ajmal; Ahmad, Suhail; Al-Nakib, Widad
2010-09-16
The etiologic agents of aseptic meningitis (AM) often include human enteroviruses. The role of enteroviruses causing AM in young children was investigated during a 3-year period in Kuwait. Enteroviral RNA was detected in cerebrospinal fluid (CSF) by reverse transcription-PCR and specific genotypes of enteroviruses were identified by direct DNA sequencing of VP4-VP2 region. Enteroviral RNA was detected in 92 of 387 (24%) suspected AM cases and the results were confirmed by hybridization of amplicons with an internal, enterovirus-specific probe. The CSF samples from 75 of 281 (27%) children < 2 years old but only from 3 of 38 (8%) 4-12 year-old children were positive for enteroviral RNA (p = 0.011). Majority of infections in children < 2 years old (49 of 75, 65%) were due to three echoviruses; echovirus type 9 (E9), E11 and E30. Only three other enteroviruses, namely coxsackievirus type B4, coxsackievirus type B5 and enterovirus 71 were detected among AM cases in Kuwait. Our data show that three types of echoviruses (E9, E11 and E30) are associated with the majority of AM cases in Kuwait. To the best of our knowledge, this is the first report to characterize different enterovirus genotypes associated with AM in the Arabian Gulf region.
Krämer, Irene; Federici, Matteo; Kaiser, Vanessa; Thiesen, Judith
2016-04-01
The purpose of this study was to evaluate the contamination rate of media-fill products either prepared automated with a robotic system (APOTECAchemo™) or prepared manually at cytotoxic workbenches in the same cleanroom environment and by experienced operators. Media fills were completed by microbiological environmental control in the critical zones and used to validate the cleaning and disinfection procedures of the robotic system. The aseptic preparation of patient individual ready-to-use injection solutions was simulated by using double concentrated tryptic soy broth as growth medium, water for injection and plastic syringes as primary packaging materials. Media fills were either prepared automated (500 units) in the robot or manually (500 units) in cytotoxic workbenches in the same cleanroom over a period of 18 working days. The test solutions were incubated at room temperature (22℃) over 4 weeks. Products were visually inspected for turbidity after a 2-week and 4-week period. Following incubation, growth promotion tests were performed with Staphylococcus epidermidis. During the media-fill procedures, passive air monitoring was performed with settle plates and surface monitoring with contact plates on predefined locations as well as fingerprints. The plates got incubated for 5-7 days at room temperature, followed by 2-3 days at 30-35℃ and the colony forming units (cfu) counted after both periods. The robot was cleaned and disinfected according to the established standard operating procedure on two working days prior to the media-fill session, while on six other working days only six critical components were sanitized at the end of the media-fill sessions. Every day UV irradiation was operated for 4 h after finishing work. None of the 1000 media-fill products prepared in the two different settings showed turbidity after the incubation period thereby indicating no contamination with microorganisms. All products remained uniform, clear, and light
Blouin, Dawn; Gegel, Brian T; Johnson, Don; Garcia-Blanco, Jose C
2016-01-01
To determine if there were significant differences among humerus intraosseous (HIO), sternal intraosseous (SIO), and intravenous (IV) administration of 500 mL Hextend in hemodynamics or administration time in a hypovolemic swine model. Vivarium. Yorkshire swine; sample size was based on a large effect size of 0.5, an α of 0.05, and a power of 80 percent Swine were randomly assigned to one of four groups: HIO (n = 9), SIO (n = 9), IV (n = 9), and control (n = 9). Swine were exsanguinated 30 percent of their blood volume. Hextend (500 mL) was administered by either the HIO, SIO, or IV route; the control group received none. Time of administration of Hextend; systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP), heart rate (HR), cardiac output (CO), and stroke volume (SV) data were collected every 2 minutes and compared by group over 8 minutes. A repeated analysis of variance found that there were no significant differences in SBP, DBP, MAP, HR, CO, and SV among HIO, SIO, and IV groups over 8 minutes (p > 0.05). An analyses of variance determined that there was no significant difference between groups relative to time of administration (p = 0.521). When IV access is difficult, both HIO and SIO are effective techniques for rapid vascular access and the administration of Hextend for patients in hypovolemic shock.
Quennedey, André; Peppuy, Alexis; Courrent, Annie; Robert, Alain; Everaerts, Claude; Bordereau, Christian
2004-12-01
In female alates of Macrotermes annandalei, two types of abdominal glands are involved in the secretion of sex pheromone. Tergal glands are found at the anterior margin of tergites 6-10 and posterior sternal glands (PSGs) are located at the anterior margin of sternites 6-7. The cytological features of both types of glands are quite similar. The fine structural organization of PSGs is studied more precisely and described for the first time. The glandular cuticle is pitted with narrow apertures corresponding to the openings of numerous subcuticular pouches. Several Class 3 glandular units open in each pouch. One canal cell and one secretory cell make an individual glandular unit. The canal cell is enlarged apically and is connected with the other canal cells to form a common pouch. Based on the structural features found in these glands, we propose a common secretory process for PSGs and tergal glands. During the physiological maturation of alates inside the nest, secretory vesicles amass in the cytoplasm of secretory cells, while large intercellular spaces collapse the cuticular pouches. At the time of dispersal flight, pouches are filled with the content of secretory vesicles while intercellular spaces are sharply reduced. After calling behavior, no secretion remains in the glands and pouches collapse again, while secretory cells are drastically reduced in size. The structure and the secretory processes of PSGs and tergal glands are compared to those of abdominal sexual glands known in termites.
Caimmi, Philippe P; Sabbatini, Maurizio; Kapetanakis, Emmanouil I; Cantone, Silvia; Ferraz, Marcus V; Cannas, Mario; Tesler, Ugo F
2017-06-01
Mechanical complications of median sternotomy may cause significant morbidity and mortality in cardiac surgical patients. This study was aimed at assessing the role of Posthorax support vest (Epple, Inc., Vienna, Austria) in the prevention of sternal complications and the improvement of anatomical healing in patients at high risk for mechanical sternal dehiscence after cardiac surgery by mean of median sternotomy. A prospective, randomized, study was performed and 310 patients with predisposing factors for sternal dehiscence after sternotomy for cardiac surgery were included. The patients were divided into two groups: patients who received the Posthorax support vest after surgery, and patients who did not. Primary variables assessed included the incidence of mechanical sternal complications, the quality of sternal healing, the rate of re-operation, the duration of hospitalization, rate and duration of hospital, re-admission for sternal complications. Secondary variables assessed were the post-operative pain, the number of requests for supplemental analgesia and the quality of life measured by means of the EQ-5D format. Patients using vest demonstrated a lower incidence of mechanical sternal complications, a better anatomical sternum healing, lower hospital stay, no re-operations for sternal dehiscence before discharge and lower re-admissions for mechanical sternal complication. In addition, patients using a vest reported a better quality of life with better freedom from limitations in mobility, self-care, and pain. Our findings demonstrate that the use of the Posthorax vest reduces post-sternotomy mechanical complications and improves the healing of the sternotomy, the clinical course, and the post-operative quality of life.
Mertes, P M; Voiriot, P; Dopff, C; Scholl, H; Clavey, M; Villemot, J P; Canton, P; Dureux, J B
1990-01-01
The penetration of ciprofloxacin into heart tissue (valve and myocardium), mediastinal fat, and sternal bone marrow was the object of a prospective nonrandomized study involving 36 patients undergoing mitral and/or aortic valve replacement. Patients were divided into two groups of 18. Group 1 patients were administered a single 400-mg intravenous dose of ciprofloxacin over a 1-h period. Group 2 patients received a 750-mg dose of ciprofloxacin orally every 12 h over the 48-h period preceding surgery. In this group, the last dose of ciprofloxacin consisted of an intravenous infusion of 400 mg. Concentrations of ciprofloxacin in plasma and tissue were assayed by high-performance liquid chromatography. Peak and trough levels in plasma were, respectively, 6.19 +/- 1.73 and 0.54 +/- 0.25 micrograms/ml in group 1 patients and 11.59 +/- 3.95 and 0.89 +/- 0.57 micrograms/ml in group 2 patients. Levels of ciprofloxacin in plasma remained significantly higher in group 2 than in group 1 until 12 h postinfusion (P less than 0.05). Concentrations of ciprofloxacin in heart valves and myocardia rose rapidly by 1 h postinfusion and remained greater than the MICs for usually susceptible pathogens for at least 5 h. Peak concentrations in myocardia were achieved by hour 1 and were 31.6 +/- 25.0 micrograms/g for group 1 and 21.8 +/- 13.0 micrograms/g for group 2. Peak concentrations in heart valves, achieved between hours 1 and 3, were 5.8 +/- 3.2 and 8.3 +/- 3.1 micrograms/g for groups 1 and 2, respectively. In both groups, peak concentrations in mediastinal fat were lower and achieved later. These were 3.1 +/- 3.8 micrograms/g in group 1 and 2.0 +/- 1.8 micrograms/gram in group 2 and were achieved between hours 3 and 5 and hours 1 and 3, respectively. In conclusion, the good diffusion of ciprofloxacin into heart tissue warrants its use for the treatment of bacterial endocarditis. On the other hand, low and delayed concentrations in mediastinal fat could limit its value as an
Burgert, James M; Martinez, Andre; O'Sullivan, Mara; Blouin, Dawn; Long, Audrey; Johnson, Arthur D
2018-01-01
The pharmacokinetics of IO administered lipid soluble amiodarone during ventricular fibrillation (VF) with ongoing CPR are unknown. This study measured mean plasma concentration over 5 minutes, maximum plasma concentration (Cmax), and time to maximum concentration (Tmax) of amiodarone administered by the sternal IO (SIO), tibial IO (TIO), and IV routes in a swine model of VF with ongoing CPR. Twenty-one Yorkshire-cross swine were randomly assigned to three groups: SIO, TIO, and IV. Ventricular fibrillation was induced under general anesthesia. After 4 minutes in VF, 300 mg amiodarone was administered as indicated by group assignment. Serial blood specimens collected at 30, 60, 90, 120, 150, 180, 240, and 300 seconds were analyzed using high performance liquid chromatography with tandem mass spectrometry. The mean plasma concentration of IV amiodarone over 5 minutes was significantly higher than the TIO group at 60 seconds (P = 0.02) and 90 seconds (P = 0.017) post-injection. No significant differences in Cmax between the groups were found (P <0.05). The Tmax of amiodarone was significantly shorter in the SIO (99 secs) and IV (86 secs) groups compared to the TIO group (215 secs); P = 0.002 and P = 0.002, respectively. The SIO and IV routes of amiodarone administration were comparable. The TIO group took nearly three times longer to reach Tmax than the SIO and IV groups, likely indicating depot of lipid-soluble amiodarone in adipose-rich tibial yellow bone marrow. The SIO route was more effective than the TIO route for amiodarone delivery in a swine model of VF with ongoing CPR. Further investigations are necessary to determine if the kinetic differences found between the SIO and TIO routes in this study affect survival of VF in humans.
Hafez, Pezhman; Jose, Shinsmon; Chowdhury, Shiplu R; Ng, Min Hwei; Ruszymah, B H I; Abdul Rahman Mohd, Ramzisham
2016-01-01
The alarming rate of increase in myocardial infarction and marginal success in efforts to regenerate the damaged myocardium through conventional treatments creates an exceptional avenue for cell-based therapy. Adult bone marrow mesenchymal stem cells (MSCs) can be differentiated into cardiomyocytes, by treatment with 5-azacytidine, thus, have been anticipated as a therapeutic tool for myocardial infarction treatment. In this study, we investigated the ability of basic fibroblastic growth factor (bFGF) and hydrocortisone as a combined treatment to stimulate the differentiation of MSCs into cardiomyocytes. MSCs were isolated from sternal marrow of patients undergoing heart surgery (CABG). The isolated cells were initially monitored for the growth pattern, followed by characterization using ISCT recommendations. Cells were then differentiated using a combination of bFGF and hydrocortisone and evaluated for the expression of characteristic cardiac markers such as CTnI, CTnC, and Cnx43 at protein level using immunocytochemistry and flow cytometry, and CTnC and CTnT at mRNA level. The expression levels and pattern of the cardiac markers upon analysis with ICC and qRT-PCR were similar to that of 5-azacytidine induced cells and cultured primary human cardiomyocytes. However, flow cytometric evaluation revealed that induction with bFGF and hydrocortisone drives MSC differentiation to cardiomyocytes with a marginally higher efficiency. These results indicate that combination treatment of bFGF and hydrocortisone can be used as an alternative induction method for cardiomyogenic differentiation of MSCs for future clinical applications. © 2015 International Federation for Cell Biology.
Chemical regulation of polyethism during foraging in the neotropical termiteNasutitermes costalis.
Traniello, J F; Busher, C
1985-03-01
The soldiers ofNasutitermes costalis communicate information about the presence and location of food by laying chemical trails of sternal gland secretion. These trails first recruit additional soldiers, and as the number of soldiers contacting food and returning to the nest increases, trail pheromone concentration increases, and workers are recruited. This polyethic pattern of recruitment does not appear to depend on qualitative (caste-specific) properties of soldier and worker sternal gland secretions, but rather on quantitative differences in pheromone production between castes. Large third-instar workers have significantly greater sternal gland volumes than soldiers, and glands of approximately equivalent size have approximately equivalent recruitment effects. The recruitment and orientation effects of artificial trails prepared from worker sternal glands can be mimicked by increasing the concentration of soldier sternal gland pheromone.
Binod, Bijukachhe; Nagmani, Singh; Bigyan, Bhandari; Rakesh, John; Prashant, Adhikari
2016-08-01
Tibial nonunion is the most common nonunion encountered by the orthopedic surgeon. Repeated surgeries, cost, increased duration of hospital stay, disability, pain all contribute to the increased morbidity. Many methods have been used to treat nonunion of tibia with variable results and none of them are 100 % successful. Our objective was to determine the effectiveness of modification of Judet's decortication technique and buttress plating, without bone graft, in the treatment of aseptic, atrophic tibial nonunion. Also, to find the correlation between time of achieving union and time since injury to decortication. Ours is a retrospective study conducted at a Level I trauma center. A total of 35 cases of atrophic tibial nonunion, irrespective of the cause, was treated by modifying Judet's osteoperiosteal decortication and plating during the time period January 2006 to July 2013. Demographic data, range of motion, time of achieving union and clinico-radiological evaluation for union of fracture were included as main outcome measurements. Union was achieved in all cases with a mean duration of 8.34 months. Pain and stiffness of joints were not reported in any case on long-term follow-up and the patients had satisfactory range of motion. Implant removal was done in three cases after fracture union. Treatment of atrophic tibial nonunion is challenging and management of each nonunion has to be customized based on the biological and mechanical characteristics of the nonunion. Plating with osteoperiosteal decortication is an effective and simple technique, which in our hands has shown to result in 100 % union rates without the need of additional bone healing augmentation procedures like bone grafting. Level II.
Haydary, J; Susa, D; Dudáš, J
2013-05-01
Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. Copyright © 2013 Elsevier Ltd. All rights reserved.
Optimizing Prevention of Healthcare-Acquired Infections After Cardiac Surgery (HAI)_2
2017-10-24
Cardiovascular Disease; Healthcare Associated Infectious Disease; Sternal Superficial Wound Infection; Deep Sternal Infection; Mediastinitis; Thoracotomy; Conduit Harvest or Cannulation Site; Sepsis; Pneumonia
Platelet-rich plasma for long bone healing
Lenza, Mário; Ferraz, Silvia de Barros; Viola, Dan Carai Maia; dos Santos, Oscar Fernando Pavão; Cendoroglo, Miguel; Ferretti, Mario
2013-01-01
ABSTRACT Objective: To evaluate effectiveness of the use of platelet-rich plasma as coadjuvant for union of long bones. Methods: The search strategy included the Cochrane Library (via Central) and MEDLINE (via PubMed). There were no limits as to language or publication media. The latest search strategy was conducted in December 2011. It included randomized clinical trials that evaluated the use of platelet-rich plasma as coadjuvant medication to accelerate union of long bones (acute fractures, pseudoarthrosis and bone defects). The outcomes of interest for this review include bone regeneration, adverse events, costs, pain, and quality of life. The authors selected eligible studies, evaluated the methodological quality, and extracted the data. It was not possible to perform quantitative analysis of the grouped studies (meta-analyses). Results: Two randomized prospective clinical trials were included, with a total of 148 participants. One of them compared recombinant human morphogenic bone protein-7 versus platelet-rich plasma for the treatment of pseudoarthrosis; the other evaluated the effects of three coadjuvant treatments for union of valgising tibial osteotomies (platelet-rich plasma, platelet-rich plasma plus bone marrow stromal cells, and no coadjuvant treatment). Both had low statistical power and moderate to high risk of bias. Conclusion: There was no conclusive evidence that sustained the use of platelet-rich plasma as a coadjuvant to aid bone regeneration of fractures, pseudoarthrosis, or bone defects. PMID:23579757
Lu, Jing; Guo, Xue; Zhang, Yong; Li, Hui; Liu, Leng; Zeng, Hanri; Fang, Ling; Mo, Yanling; Yoshida, Hiromu; Yi, Lina; Liu, Tao; Rutherford, Shannon; Xu, Wenbo; Ke, Changwen
2015-01-01
An aseptic meningitis outbreak occurred in Luoding City of Guangdong, China, in 2012, and echovirus type 30 (ECHO30) was identified as the major causative pathogen. Environmental surveillance indicated that ECHO30 was detected in the sewage of a neighboring city, Guangzhou, from 2010 to 2012 and also in Luoding City sewage samples (6/43, 14%) collected after the outbreak. In order to track the potential origin of the outbreak viral strains, we sequenced the VP1 genes of 29 viral strains from clinical patients and environmental samples. Sequence alignments and phylogenetic analyses based on VP1 gene sequences revealed that virus strains isolated from the sewage of Guangzhou and Luoding cities matched well the clinical strains from the outbreak, with high nucleotide sequence similarity (98.5% to 100%) and similar cluster distribution. Five ECHO30 clinical strains were clustered with the Guangdong environmental strains but diverged from strains from other regions, suggesting that this subcluster of viruses most likely originated from the circulating virus in Guangdong rather than having been more recently imported from other regions. These findings underscore the importance of long-term, continuous environmental surveillance and genetic analysis to monitor circulating enteroviruses. PMID:25616804
Johnson, Jason N.; Jaggers, James; Li, Shuang; O’Brien, Sean M.; Li, Jennifer S.; Jacobs, Jeffrey P.; Jacobs, Marshall L.; Welke, Karl F.; Peterson, Eric D.; Pasquali, Sara K.
2009-01-01
Objectives There is debate whether primary or delayed sternal closure (DSC) is the best strategy following Stage 1 palliation (S1P) for hypoplastic left heart syndrome (HLHS). We describe center variation in DSC following S1P and associated outcomes. Methods Society of Thoracic Surgeons Congenital Database participants performing S1P for HLHS from 2000–2007 were included. We examined center variation in DSC, and compared in-hospital mortality, prolonged length of stay (LOS >6wks), and postoperative infection in centers with low (≤25% of cases), middle (26%–74% of cases), and high (≥75% of cases) DSC utilization, adjusting for patient and center factors. Results There were 1283 patients (45 centers) included. Median age and weight at surgery were 6d (IQR4-9d) and 3.2 kg (IQR2.8–3.5kg); 59% were male. DSC was used in 74% (range 3–100% of cases/center). In centers with high (n=23) and middle (n=17) vs. low (n=5) DSC utilization, there was a greater proportion of patients with prolonged LOS and infection, and a trend toward increased in-hospital mortality in unadjusted analysis. In multivariable analysis, there was no difference in mortality. Centers with high and middle DSC utilization had prolonged LOS [OR (95%CI): 2.83(1.46–5.47) p=0.002 and 2.23(1.17–4.26) p=0.02] and more infection [2.34(1.20–4.57) p=0.01 and 2.37(1.36–4.16) p=0.003]. Conclusions Utilization of DSC following S1P varies widely. These observational data suggest more frequent use of DSC is associated with longer LOS and higher postoperative infection rates. Further evaluation of the risks and benefits of DSC in the management of these complex infants is necessary. PMID:20167337
Anatomic Variability of the Upper Mediastinal Lymph Node Level VII.
Hartl, Dana M; Breuskin, Ingrid; Mirghani, Haïtham; Berdelou, Amandine; Déandréis, Désirée; Pottier, Edwige; Borget, Isabelle; Schlumberger, Martin; Leboulleux, Sophie
2016-08-01
Lymph node level VII, between the sternal notch and the innominate artery, is a frequent site of lymph node metastases in thyroid cancer. The objective of this study was to determine the cranial-caudal dimensions of level VII in patients undergoing central neck dissection for thyroid cancer and its accessibility through a neck incision only. Consecutive patients undergoing central neck dissection for thyroid cancer, with no previous neck dissection, mediastinal or thoracic surgery. The innominate artery was identified and the distance between the sternal notch and the upper border of the artery was measured to the nearest .5 mm. The sizes of level VII were compared with respect to age, sex, height, body mass index, type of neck dissection (therapeutic or prophylactic), and the incidence of previous thyroidectomy. One-hundred-one consecutive patients (65 women, 36 men, mean age 44 years (range 15-87) underwent prophylactic (n = 55) or therapeutic (n = 46) bilateral central compartment neck dissection. Level VII was accessible via the horizontal neck incision in all cases. Sizes of level VII ranged from 6 cm above the sternal notch to 35 mm below the sternal notch, with a mean distance of 3.5 mm below the sternal notch. The innominate artery was at the level of the sternal notch in 29 patients, and cranial to the sternal notch in 20 cases. No statistical relationship with age, sex, therapeutic/prophylactic neck dissection, previous surgery, body mass index or height was found. The maximal distance below the sternal notch was 35 mm. Level VII did not exist in 49 % of patients, and was less than 25 mm caudal to the sternal notch in 95 % of cases. Distinguishing level VII from level VI in thyroid cancer surgery may not be pertinent, due to the ease of access via a classic horizontal neck incision and the small sizes of level VII in the majority of patients.
Cunha, Burke A; Hage, Jean E; Nouri, Yelda
2012-01-01
Fever of unknown origin (FUO) has been defined as a fever of ≥101°F that persists for 3 weeks or more. It is not readily diagnosed after 1 week of intensive in-hospital testing or after intensive outpatient or inpatient testing. Fevers of unknown origin may be caused by infectious diseases, malignancies, collagen vascular diseases, or a variety of miscellaneous disorders. The relative distribution of causes of FUOs is partly age-related. In the elderly, the preponderance of FUOs is attributable to neoplastic and infectious etiologies, whereas in children, collagen vascular diseases, neoplasms, and viral infectious disease predominate. The diagnostic approach to FUOs depends on a careful analysis of the history, physical findings, and laboratory tests. Most patients with FUOs exhibit localizing findings that should direct the diagnostic workup and limit diagnostic possibilities. The most perplexing causes of FUOs involve those without specific diagnostic tests, e.g., juvenile rheumatoid arthritis (JRA) or adult Still's disease. In a young adult with FUO, if all of the cardinal symptoms are present, JRA may present either a straightforward or an elusive diagnosis, if key findings are absent or if the diagnosis goes unsuspected. We present a 19-year-old man with a recurrent FUO. His illness began 3 years before admission and has recurred twice since. In the past, he did not manifest arthralgias, arthritis, or a truncal rash. On admission, he presented with an FUO with hepatosplenomegaly, aseptic meningitis, and pericarditis. An extensive diagnostic workup ruled out lymphoma and leukemia. Moreover, a further extensive workup eliminated infectious causes of FUO appropriate to his clinical presentation, ie, tuberculosis, histoplasmosis, brucellosis, Q fever, typhoid fever, Epstein-Barr virus, infectious mononucleosis, cytomegalovirus, human herpes virus (HHV)-6, babesiosis, ehrlichiosis, viral hepatitis, and Whipple's disease. The diagnosis of JRA was based on the
Meyer, Luisa A.; Johnson, Michael G.; Cullen, Diane M.; Vivanco, Juan F.; Blank, Robert D.; Ploeg, Heidi-Lynn; Smith, Everett L.
2016-01-01
Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (−2000 με, 120 cycles daily, “jump” waveform) and big ET1 (25 ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23 days. The bone cores’ response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher’s LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the “no load + big ET1” (CE, 13±12.2%, p=0.56), “load + no big ET1” (LC, 17±3.9%, p=0.14) and “load + big ET1” (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8 days post-osteotomy in all groups and the treatment groups remained elevated compared
Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L
2016-04-01
Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15
Perrotti, Andrea; Gatti, Giuseppe; Dorigo, Enrica; Sinagra, Gianfranco; Pappalardo, Aniello; Chocron, Sidney
The Gatti score is a weighted scoring system based on risk factors for deep sternal wound infection (DSWI) that was created in an Italian center to predict DSWI risk after bilateral internal thoracic artery (BITA) grafting. No external evaluation based on validation samples derived from other surgical centers has been performed. The aim of this study is to perform this validation. During 2015, BITA grafts were used as skeletonized conduits in all 255 consecutive patients with multi-vessel coronary disease who underwent isolated coronary bypass surgery at the Department of Thoracic and Cardio-Vascular Surgery, University Hospital Jean Minjoz, Besançon, France. Baseline characteristics, operative data, and immediate outcomes of every patient were collected prospectively. A DSWI risk score was assigned to each patient pre-operatively. The discrimination power of both models, pre-operative and combined, of the Gatti score was assessed with the calculation of the area under the receiver operating characteristic curve. Fourteen (5.5%) patients had DSWI. Major differences both as the baseline characteristics of patients and surgical techniques were found between this series and the original series from which the Gatti score was derived. The area under the receiver operating characteristic curve was 0.78 (95% confidence interval: 0.64-0.92) for the pre-operative model and 0.84 (95% confidence interval: 0.69-0.98) for the combined model. The Gatti score has proven to be effective even in a cohort of French patients despite major differences from the original Italian series. Multi-center validation studies must be performed before introducing the score into clinical practice.
Kjelgaard-Hansen, Mads; Strom, Henriette; Mikkelsen, Lars F; Eriksen, Thomas; Jensen, Asger L; Luntang-Jensen, Michael
2013-09-01
C-reactive protein (CRP) is an established serum marker for the presence of systemic inflammation in dogs. Results from previous experimental and clinical studies suggest that CRP concentrations also quantitatively reflect the degree and progress of an inflammatory process, suggesting its use for inflammation monitoring. The objective was to investigate whether the canine CRP response in serum correlates with the amount of trauma and the consequent inflammatory response after 3 standard aseptic soft-tissue surgical procedures in 3 groups of dogs. A total of 24 client-owned intact female dogs of various breeds were enrolled in a clinical study with random allocation into 2 surgical groups, for either conventional, open-approach ovariohysterectomy (OVH; n = 14) or laparoscopic assisted OVH (n = 10). In addition, a group of 8 male Beagles from a laboratory animal facility underwent vasectomy, serving as the third and mildest surgical trauma group. Serum CRP was measured pre- and at 4, 8, 12, 23, and 27 hours postsurgery. Cumulative concentration over time and point concentrations of CRP were correlated with the surgical trauma impact level. There was a significant surgery trauma-related difference in cumulative CRP concentrations among the 3 groups, and also in the 12 hours postsurgery concentration. The CRP response varied according to the degree of surgical trauma on 3 standardized levels, thus supporting the use of canine serum concentrations of CRP as an inflammatory activity indicator and monitoring marker. © 2013 American Society for Veterinary Clinical Pathology.
Rigid Plate Fixation Versus Wire Cerclage for Sternotomy After Cardiac Surgery: A Meta-Analysis.
Tam, Derrick Y; Nedadur, Rashmi; Yu, Monica; Yanagawa, Bobby; Fremes, Stephen E; Friedrich, Jan O
2018-03-22
Traditionally, wire cerclage has been used to reapproximate the sternum after sternotomy. Recent evidence suggests that rigid plate fixation for sternal closure may reduce the risk of sternal complications. The Medline and Embase databases were searched from inception to February 2017 for studies that compared rigid plate fixation with wire cerclage for cardiac surgery patients undergoing sternotomy. Random effects meta-analysis compared rates of sternal complications (primary outcome, defined as deep or superficial sternal wound infection, or sternal instability), early mortality, and length of stay (secondary outcomes). Three randomized controlled trials (n = 427) and five unadjusted observational studies (n = 1,025) met inclusion criteria. There was no significant difference in sternal complications with rigid plate fixation at a median of 6 months' follow-up (incidence rate ratio 0.51, 95% confidence interval [CI]: 0.20 to 1.29, p = 0.15) overall, but a decrease when including only patients at high risk for sternal complications (incidence rate ratio 0.23, 95% CI: 0.06 to 0.89, p = 0.03; two observational studies). Perioperative mortality was reduced favoring rigid plate fixation (relative risk 0.40, 95% CI: 0.28 to 0.97, p = 0.04; four observational studies and one randomized controlled trial). Length of stay was similar overall (mean difference -0.77 days, 95% CI: -1.65 to +0.12, p = 0.09), but significantly reduced with rigid plate fixation in the observational studies (mean difference -1.34 days, 95% CI: -2.05 to -0.63, p = 0.0002). This meta-analysis, driven by the results of unmatched observational studies, suggests that rigid plate fixation may lead to reduced sternal complications in patients at high risk for such events, improved perioperative survival, and decreased hospital length of stay. More randomized controlled trials are required to confirm the potential benefits of rigid plate fixation for primary sternotomy closure. Copyright
Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong
2013-01-01
Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars–IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p<0.05) in IM and SD cultivars. The differences in sensory characteristics between the FCR and ACR were larger than the equivalent differences between the FCR and HCR. Overall consumer acceptance ratings for FCR in overall aspect, appearance, aroma, and texture were not significantly different compared to those for HCR (p>0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112
Ateşoğlu, Sibel; Deniz, Mustafa; Uslu, Ayşe İmge
2018-01-18
Sternum is one of the skeleton parts which have frequently congenital anomalies and variations are commonly used by researchers in determining sex. We evaluated the morphological characteristics and sex-related changes of the sternum in adult individuals using multidetector CT in our study. 200 adults (103 female and 97 male) aged between 18-87 years were evaluated. Utilizing the morphological characteristics of the sternum based on the multi-slice images; length, width and the thickness of Manubrium, length, width and the thickness of Corpus Sterni, total length of Sternum, Sternal angle, Sternal index, length of the xiphoid process, the thickness of xiphoid process, the number of indents of xiphoid process were measured and a total of 20 parameters were evaluated by adding age, height and weight to these variables. The mean length of the manubrium, the length of corpus sterni, the length of total sternum, sternal index, sternal angle were found in females 46.7±5.1,86.6±9.7, 133.1±1.1, 54.47±10.0 and 163.75±5.79; in males 51.2±6, 102.4±13.3, 154.1±13.1, 50.11±10.02 and 162.21±6.17, respectively. We found that Hyrtl's law and Sternal index did not provide adequate accuracy for sex determination in our patients. It has been detected that the length of the Manubrium alone is not helpful for individual samples. Total length of the sternum was found to be more reliable than the length of the Manubrium and the length of corpus Sterni. We determined Sternal cleft and Sternal foramen as 0.5% and 3.5%, respectively. We suggest that the Morphometric standards cannot be universally applied and can demonstrate individual differences. The standard rules must be implemented for every population.
Marasco, Silvana F; Fuller, Louise; Zimmet, Adam; McGiffin, David; Seitz, Michael; Ch'ng, Stephanie; Gangahanumaiah, Shivanand; Bailey, Michael
2018-04-16
Midline sternotomy remains the most common access incision for cardiac operations. Traditionally, the sternum is closed with stainless steel wires. Wires are well known to stretch and break, however, leading to pain, nonunion, and potential deep sternal wound infection. We hypothesized that biocompatible plastic cable ties would achieve a more rigid sternal fixation, reducing postoperative pain and analgesia requirements. A prospective, randomized study compared the ZIPFIX (De Puy Synthes, West Chester, Pa) sternal closure system (n = 58) with standard stainless steel wires (n = 60). Primary outcomes were pain and analgesia requirements in the early postoperative period. Secondary outcome was sternal movement, as assessed by ultrasound at the postoperative follow-up visit. Groups were well matched in demographic and operative variables. There were no significant differences between groups in postoperative pain, analgesia, or early ventilatory requirements. Patients in the ZIPFIX group had significantly more movement in the sternum and manubrium on ultrasound at 4 weeks. ZIPFIX sternal cable ties provide reliable closure but no demonstrable benefit in this study in pain or analgesic requirements relative to standard wire closure after median sternotomy. Crown Copyright © 2018. Published by Elsevier Inc. All rights reserved.
Hall, Wendy C E; Jolly, Donald T; Hrazdil, Jiri; Galbraith, John C; Greacen, Maria; Clanachan, Alexander S
2003-01-01
To evaluate the ability of the EmulSiv filter (EF) to remove extrinsic microbial contaminants from propofol. Aliquots of Staphylococcus aureus (S. aureus), Candida albicans (C. albicans), Klebsiella pneumoniae (K. pneumoniae), Moraxella osloensis (M. osloensis), Enterobacter agglomerans (E. agglomerans), Escherichia coli (E. coli), Serratia marcescens (S. marcescens), Moraxella catarrhalis (M. catarrhalis), Haemophilus influenzae (H. influenzae) and Campylobacter jejuni (C. jejuni) were inoculated into vials containing 20 mL of sterile propofol. The unfiltered inoculated propofol solutions served as controls. Ten millilitres and 20 mL samples of the inoculated propofol were filtered through the EF. All solutions were then subplated onto three culture plates using a precision 1 micro L calibrated platinum loop and incubated. The number of colony forming units (CFU) were counted. Data were analyzed using a one-sample t test, and a P value of less than 0.05 was selected as the level of statistical significance. The EF was able to completely remove CFU of S. aureus, C. albicans, K. pneumoniae, M. osloensis, E. agglomerans, E. coli, S. marcescens, and M. catarrhalis (P < 0.05). A small number of H. influenzae CFU were able to evade filtration in both the 10 mL and 20 mL samples. C. jejuni CFU were able to evade filtration in only the 10 mL sample. The EF removes the majority of microbial contaminates from propofol with the exception of H. influenzae and C. jejuni. Although the EF is capable of removing most of the microbial contamination produced by H. influenzae and C. jejuni, a few CFU are capable of evading filtration. Consequently, even the use of a filter capable of removing microbial contaminants is not a substitute for meticulous aseptic technique and prompt administration when propofol is used.
Matiasek, Johannes; Kienzl, Philip; Otti, Gerlinde R; Turk, Bela R; Djedovic, Gabriel; Rieger, Ulrich M
2018-02-01
Blepharoplasty is the third most common plastic surgical procedure in the USA. Due to the emergence of multiresistant bacteria, optimising the antiseptic procedure is crucial. Choice of antiseptics plays an important role as they may cause skin irritation and colouring of disinfected areas. In this study, the use of the aqueous antiseptic octenisept ® (octenidine) was evaluated in the outcome of blepharoplasties: incidence of wound dehiscence; haematoma; and infection in correlation with gender, medication, smoking habits and time of year. This retrospective surveillance study included 352 patients (median age 58·3 years). Skin disinfection was performed thrice prior to blepharoplasty. Sutures were removed on day 6. None of the patients suffered from wound infection. The total rate of wound dehiscence was 6·3%, with a higher ratio among male patients. Smokers and patients on anticoagulant medication showed a significantly higher incidence of wound dehiscence. Throughout the year, rates of wound dehiscence were highest in summer. Aseptic surgical preparation for blepharoplasty via full-face scrub with octenisept ® without oral antibiotic prophylaxis is well tolerated, with no report of wound infection, which may improve antibiotic stewardship as well as patient comfort. Elective upper eyelid blepharoplasty may ideally be performed in winter. © 2017 Medicalhelplines.com Inc and John Wiley & Sons Ltd.
Franzen-Rohl, Elisabeth; Larsson, Kenny; Skoog, Eva; Tiveljung-Lindell, Annika; Grillner, Lena; Aurelius, Elisabeth; Glimåker, Martin
2008-01-01
Acute aseptic meningitis (AAM) affects 10-20/100,000 inhabitants per years in Sweden. Up to the beginning of the 1980s the diagnoses were made by virus isolation and/or determination of viral antibodies in serum. The development of PCR for detection of viruses in CSF samples has increased the sensitivity and diagnostic efficiency considerably. We investigated the aetiology of AAM and the diagnostic efficiency in an adult population in Stockholm, using a limited first-line combination of microbiological assays. CSF and serum samples, consecutively collected in 419 patients with clinical symptoms of AAM in northern Stockholm during 1999-2004, were included. PCR assays for herpes simplex virus (HSV) DNA and enterovirus (EV) RNA in the CSF as well as ELISA for IgM in serum to tick-borne encephalitis virus (TBEV) were performed routinely. A viral diagnosis was obtained in 255 of the 419 cases (62%) with these routinely performed assays. Clinical findings in combination with additional diagnostic tests resulted in an overall aetiological yield of 72%. EV was the major causative agent (27%) followed by TBEV (21%) and HSV-2 (19%). We conclude that consistent use of CSF-PCR for EV and HSV and TBEV serology established a diagnosis in the majority of AAM patients.
Si, Damin; Rajmokan, Mohana; Lakhan, Prabha; Marquess, John; Coulter, Christopher; Paterson, David
2014-06-10
Surgical site infections following coronary artery bypass graft (CABG) procedures pose substantial burden on patients and healthcare systems. This study aims to describe the incidence of surgical site infections and causative pathogens following CABG surgery over the period 2003-2012, and to identify risk factors for complex sternal site infections. Routine computerised surveillance data were collected from three public hospitals in Queensland, Australia in which CABG surgery was performed between 2003 and 2012. Surgical site infection rates were calculated by types of infection (superficial/complex) and incision sites (sternal/harvest sites). Patient and procedural characteristics were evaluated as risk factors for complex sternal site infections using a logistic regression model. There were 1,702 surgical site infections (518 at sternal sites and 1,184 at harvest sites) following 14,546 CABG procedures performed. Among 732 pathogens isolated, Methicillin-sensitive Staphylococcus aureus accounted for 28.3% of the isolates, Pseudomonas aeruginosa 18.3%, methicillin-resistant Staphylococcus aureus 14.6%, and Enterobacter species 6.7%. Proportions of Gram-negative bacteria elevated from 37.8% in 2003 to 61.8% in 2009, followed by a reduction to 42.4% in 2012. Crude rates of complex sternal site infections increased over the reporting period, ranging from 0.7% in 2004 to 2.6% in 2011. Two factors associated with increased risk of complex sternal site infections were identified: patients with an ASA (American Society of Anaesthesiologists) score of 4 or 5 (reference score of 3, OR 1.83, 95% CI 1.36-2.47) and absence of documentation of antibiotic prophylaxis (OR 2.03, 95% CI 1.12-3.69). Compared with previous studies, our data indicate the importance of Gram-negative organisms as causative agents for surgical site infections following CABG surgery. An increase in complex sternal site infection rates can be partially explained by the increasing proportion of patients
Perut, Francesca; Dallari, Dante; Rani, Nicola; Baldini, Nicola; Granchi, Donatella
Regenerative strategies based on the use of platelet concentrates as an autologous source of growth factors (GF) has been proposed to promote the healing of long bone nonunions. However, the relatively high failure rate stimulates interest in growing knowledge and developing solutions to obtain the best results from the regenerative approach. In this study we evaluated whether a cell-based assay system could be able to recognize patients who will benefit or not from the use of autologous platelet preparations. The autologous serum was used in culture medium to promote the osteogenic differentiation of normal bone-marrow stromal cells (BMSC). Blood samples were collected from 16 patients affected by aseptic long bone nonunion who were candidates to the treatment with autologous platelet-rich fibrin. The osteoinductive effect was detected by measuring the BMSC proliferation, the mineralization activity, and the expression of bone-related genes. Serum level of basic fibroblast growth factor (bFGF) was considered as a representative marker of the delivery of osteogenic GFs from platelets. Laboratory results were related to the characteristics of the disease before the treatment and to the outcome at 12 months. Serum samples from "good responders" showed significantly higher levels of bFGF and were able to induce a significantly higher proliferation of BMSC, while no significant differences were observed in terms of osteoblast differentiation. BMSC-based assay could be a useful tool to recognize patients who have a low probability to benefit from the use of autologous platelet concentrate to promote the healing of long bone nonunion.
Treatment of Standardized Fractures by Extracorporeal Shockwave Therapy (ESWT)
2001-10-25
prostate carcinoma and melanomas [4,7,18,19]. Having an analgesic effect, shock waves, are also used in treatment of tendinosis calcarea, tennis ... elbow and heel spurs [6,11,15]. Another application area for ESWT is pseudoarthrosis [9,12,13]. In bone tissue, ESWT imitates a fresh fracture
[Hygienic handling in cardiac surgery].
Shimasaki, T; Masaoka, T; Hirooka, S; Abe, H; Watanabe, T; Washio, M
1993-04-01
Some points regarding the hygienic handling in cardiac surgery are mentioned. The sternal infection or mediastinitis is still one of the most important complications after cardiac operation especially when ITA is used for CABG. After we paid much attention to these points, the postoperative sternal infection has decreased obviously.
O'Sullivan, Mara; Martinez, Andre; Long, Audrey; Johnson, Michelle; Blouin, Dawn; Johnson, Arthur D; Burgert, James M
2016-01-01
Compare vasopressin, amiodarone, and epinephrine administration by sternal intraosseous (SIO), tibial intraosseous (TIO), and intravenous (IV) routes in a swine model of cardiac arrest. Prospective, randomized, between subjects, experimental design. Laboratory. Male Yorkshire-cross swine (N = 35), seven per group. Swine were randomized to SIO, TIO, IV, cardiopulmonary resuscitation (CPR) with defibrillation, or CPR-only groups. Ventricular fibrillation (VF) was induced under general anesthesia. Mechanical CPR began 2 minutes postarrest. Vasopressin (40 U) was administered to the SIO, TIO, and IV groups 4 minutes postarrest. Defibrillation was performed and amiodarone (300 mg) was administered 6 minutes postarrest. Defibrillation was repeated, and epinephrine (1 mg) was administered 10 minutes postarrest. Defibrillation was repeated every 2 minutes and epinephrine repeated every 4 minutes until return of spontaneous circulation (ROSC) or 26 postarrest minutes elapsed. Rate of ROSC, time to ROSC, and odds of ROSC. There were no significant differences in rate of ROSC between the SIO and TIO (p = 0.22) or IV groups (p = 1.0). Time to ROSC was five times less in the SIO group than the TIO group (p = 0.003) but not compared to IV (p = 0.125). Time to ROSC in the IV group was significantly less than the TIO group (p = 0.04). Odds of ROSC for the SIO group were five times higher compared to the TIO group but same as IV. Odds of ROSC in the IV group were higher than the TIO group. There was a statistically significant delay in the time to ROSC and a clinically significant difference in odds of ROSC when resuscitative drugs, including lipophilic amiodarone, were administered by the TIO route compared to the SIO and IV routes in a swine model of sudden cardiac arrest. Further investigations are warranted to isolate the mechanism behind these findings.
Ziegler, Andreas
2008-01-01
Before moulting, terrestrial isopods resorb calcium carbonate (CaCO(3)) from the posterior cuticle and store it in sternal deposits. These consist mainly of amorphous calcium carbonate (ACC) spherules that develop within the ecdysial space between the anterior sternal epithelium and the old cuticle. Ions that occur in the moulting fluid, including those required for mineral deposition, are transported from the hemolymph into the ecdysial space by the anterior sternal epithelial cells. The cationic composition of the moulting fluid probably affects mineral deposition and may provide information on the ion-transport activity of the sternal epithelial cells. This study presents the concentrations of inorganic cations within the moulting fluid of the anterior sternites during the late premoult and intramoult stages. The most abundant cation is Na(+) followed by Mg(2+), Ca(2+) and K(+). The concentrations of these ions do not change significantly between the stages whereas the mean pH changed from 8.2 to 6.9 units between mineral deposition in late premoult, and resorption in intramoult, respectively. Measurements of the transepithelial potential show that there is little driving force for passive movements of calcium across the anterior sternal epithelium. The results suggest a possible role of magnesium ions in ACC formation, and a contribution of pH changes to CaCO(3) precipitation and dissolution.
Darwish, Ragaa T; Abdel-Aziz, Manal H; El Nekiedy, Abdel-Aziz M; Sobh, Zahraa K
2017-11-01
In forensic sciences to determine one's sex is quite important during the identity defining stage. The reliability of sex determination depends on the completeness of the remains and the degree of sexual dimorphism inherent in the population. Computed Tomography is the imaging modality of choice for two- and three-dimensional documentation and analysis of many autopsy findings. The aim of the present work was to assess the reliability of Three-dimensional Multislice Computed Tomography (3D MSCT) to determine sexual dimorphism from certain chest measurements; sternum and fourth rib using the 3D MSCT and to develop equations for sex determination from these bones among adult Egyptians sample. The present study was performed on 60 adult Egyptians. Their age ranged from 21 up to 74 years and they were equally divided between both sexes. Sixty virtual chests (reconstructed Multislice Computed Tomography 3D images) were examined for detection of Sternal measurements; Manubrium length (ML), Sternal body length (BL), Manubrium width (MW), Sternal body widths(BWa&BWb), Sternal area (SA) [(ML + BL) × (MW + BWa + BWb)/3]and Fourth rib width (FRW). All the studied measurements were significantly higher in males than in females. Multiple regression analysis was used to and three significant regression equations were developed for predicting sex using the different studied chest measurements; the sternal measurements, the sternal area and the widths of the right and left fourth ribs with their accuracies 96.67%.95.0%.72.68% respectively. Sterunm and fourth rib width revealed significant metric sex differences with the use of Multislice Computed Tomography 3D images thus provide a great advantage in the analysis of skeletal remains and badly decomposed bodies. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Nougairede, Antoine; Bessaud, Mael; Thiberville, Simon-Djamel; Piorkowski, Geraldine; Ninove, Laetitia; Zandotti, Christine; Charrel, Remi N; Guilhem, Noel; de Lamballerie, Xavier
2014-09-01
Human enteroviruses (HEVs) are major cause of aseptic meningitis. A new outbreak of E-30 occurred between April and September 2013 in Marseille, South-East France. Better understand what happen locally when an E-30 outbreak occurs. Laboratory data (identification and characterization of circulating E-30 strains by partial/complete genome sequencing) were analyzed together with clinical data from emergency ward of the public hospital of Marseille. Compared with data from previous years, we observed an excess of HEV infections between April and September 2013. A total of 202 patients were tested positive of which 79% (160/202) had a cerebrospinal fluid tested positive. Because we performed genotyping using clinical specimens, we obtained representative molecular data related to patients tested positive and found a majority (105/119) of echoviruses 30 (E-30). Phylogenetic analysis revealed that E-30 circulating in Europe since 2000 belong to a unique lineage and showed at the intra-genogroup level the temporal circulation of E-30. Molecular data also indicated that majority of E-30 detected (92%) were almost identical. Compared with data from previous years, this outbreak was finally associated with an excess of patients admitted to an emergency ward for meningitis but also for non-specific viral illness. Our data provide new insights into microevolution of E-30: almost all E-30 emerged from local circulation of one parental virus. Moreover, our findings showed that HEV outbreaks cause an excess of emergency ward consultations but probably also an excess of consultations to general practitioners who receive majority of the non-specific viral illness. Copyright © 2014 Elsevier B.V. All rights reserved.
Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang
2015-01-01
Abstract Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel–titanium (Ni–Ti) memory alloy arthrodesis concentrator in the treatment of this disease. A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni–Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale. Patients were followed up for a mean of 12 months (range, 6–24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred. STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni–Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results. PMID:26496298
Adams, Jenny; Pullum, Gwen; Stafford, Pamala; Hanners, Nava; Hartman, Julie; Strauss, Danielle; Hubbard, Matt; Lawrence, Anne; Anderson, Valerie; McCullough, Tiffany
2008-01-01
Physician advice and restrictions to patients following a cardiac event can, in some instances, lead patients to be fearful regarding their activities even to the point of inactivity. The purpose of this study was to test whether lawn mowing, one of the activities most strongly discouraged after coronary artery bypass surgery, could be safely performed in a supervised setting. Subjects participated in a 6-session simulated lawn-mowing protocol, calibrated to match the push and pull forces of using an outdoor nonpropelled lawn mower. Plain chest radiographs were taken before and after the protocol period. During each session, subjects' sternums were carefully palpated and electrocardiograms, heart rates, and blood pressures were monitored. None of the 13 subjects experienced adverse arrhythmia events or detrimental heart rate, blood pressure, or sternal palpation findings that led to study discontinuation. The radiographs taken after protocol completion showed stable sternal wires with no evidence of sternal dehiscence. Simulated lawn mowing did not negatively affect the sternal incision, electrocardiogram findings, blood pressure, or heart rate in this small sample.
Hong, Jiyoung; Kang, Bunghak; Yeo, Sanggu; Jee, Youngmee; Park, Jae-Hak
2017-12-31
Group B coxsackieviruses (CVBs) are a group of common human pathogens producing various clinical symptoms. Although the virology of CVB is well known, there is limited information on viral pathogenesis and the relationship between clinical symptoms and viral phenotype, particularly for CVB type 2 (CVB2). In 2004 in Korea, two CVB2 strains were isolated: CB2/04/279 from stool of an acute myocarditis patient with heart failure and CB2/04/243 from an aseptic meningitis patient. In this study, a high degree of homology was observed between the CB2/04/279 and CB2/04/243 full genome sequences. The two Korean CVB2 isolates had 93.1% homology compared to 82.1%-82.5% nucleotide sequence identity with the cardiovirulence-associated reference CVB strain Ohio-1 (CVB/O). CVB2-induced pathogenesis was analyzed, focusing on virus-induced pathology of various tissues in 4-week-old BALB/c inbred male mice. Myocarditis developed and extensive pancreatic inflammation was observed in all mice infected with CB2/04/279 or CVB/O, but not in animals infected with CB2/04/243. This is the first report of the full-genomic sequence and pathogenesis of the CVB2 strain isolated from an acute myocarditis patient in Korea.
Naganobu, Kiyokazu; Hagio, Mitsuyoshi
2007-01-01
To assess the accuracy of the 'hanging drop method' for identifying the extradural space in anaesthetized dogs positioned in sternal or lateral recumbency. Prospective randomized-experimental study. Seventeen clinically healthy adult dogs, 10 females and seven males weighing 8.4-26.2 kg. Dogs were positioned in either sternal (n = 8) or lateral (n = 9) recumbency under general anaesthesia. A 20 SWG spinal needle pre-filled with 0.9% saline was advanced through the skin into the lumbosacral extradural space and the response of the saline drop recorded, i.e. whether it: 1) was aspirated from the hub into the needle; 2) remained within the hub, or 3) moved synchronously with i) spontaneous respiration, ii) heart beat or iii) manual lung inflation. The position of the needle tip was ultimately determined by positive contrast radiography. One dog positioned in lateral recumbency was excluded from the study because bleeding occurred from the needle hub. Saline was aspirated into the needle in seven of eight dogs held in sternal recumbency but in none of the dogs positioned in lateral recumbency. Accurate needle tip placement in the extradural space was confirmed by positive contrast radiography in all dogs. The 'hanging drop' method, when performed with a spinal needle, appears to be a useful technique for identifying the location of the extradural space in anaesthetized medium-sized dogs positioned in sternal, but not in lateral recumbency. The technique may yield 'false negative' results when performed in dogs positioned in sternal recumbency.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doenmez, Halil, E-mail: hdonmez68@yahoo.com; Mavili, Ertugrul, E-mail: ertmavili@yahoo.com; Ikizceli, Tuerkan
Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.
Cherry, M Gemma; Brown, Jeremy M; Neal, Timothy; Ben Shaw, Nigel
2010-01-01
Up to 6000 patients per year in England acquire a central venous catheter (CVC)-related bloodstream infection (Shapey et al. 2008 ). Implementation of Department of Health guidelines through educational interventions has resulted in significant and sustained reductions in CVC-related blood stream infections (Pronovost et al. 2002), and cost (Hu et al. 2004 ). This review aimed to determine the features of structured educational interventions that impact on competence in aseptic insertion technique and maintenance of CV catheters by healthcare workers. We looked at changes in infection control behaviour of healthcare workers, and considered changes in service delivery and the clinical welfare of patients involved, provided they were related directly to the delivery method of the educational intervention. A total of 9968 articles were reviewed, of which 47 articles met the inclusion criteria. Findings suggest implications for practice: First, educational interventions appear to have the most prolonged and profound effect when used in conjunction with audit, feedback, and availability of new clinical supplies consistent with the content of the education provided. Second, educational interventions will have a greater impact if baseline compliance to best practice is low. Third, repeated sessions, fed into daily practice, using practical participation appear to have a small, additional effect on practice change when compared to education alone. Active involvement from healthcare staff, in conjunction with the provision of formal responsibilities and motivation for change, may change healthcare worker practice.
Nipple placement in simple mastectomy with free nipple grafting for severe gynecomastia.
Murphy, T P; Ehrlichman, R J; Seckel, B R
1994-11-01
Severe gynecomastia with excessive skin is difficult to treat by only periareolar excision or suction-assisted lipectomy or both. In these patients, total mastectomy and free nipple grafting may be the best option. Placement of the nipple, however, has been arbitrary. With use of 20 "aesthetically perfect" men as models, standard nipple distances were identified. The average sternal notch-to-nipple measurement was 21 cm. In addition, two consistent ratios were identified. The nipple plane was located 0.33 times the distance from the sternal notch to the pubis, and the internipple distance was 0.23 times the chest circumference. With use of preoperatively obtained measurements of the sternal notch to pubis and chest circumference, accurate nipple placement can be accomplished.
Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe
2012-01-01
Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337
Pahwa, Parika; Lunsford, Sarah; Livesley, Nigel
2018-03-01
Quality improvement (QI) involves the following 4 steps: (1) forming a team to work on a specific aim, (2) analyzing the reasons for current underperformance, (3) developing changes that could improve care and testing these changes using plan-do-study-act cycles (PDSA), and (4) implementing successful interventions to sustain improvements. Teamwork and group discussion are key for effective QI, but convening in-person meetings with all staff can be challenging due to workload and shift changes. Mobile technologies can support communication within a team when face-to-face meetings are not possible. WhatsApp, a mobile messaging platform, was implemented as a communication tool by a neonatal intensive care unit (NICU) team in an Indian tertiary hospital seeking to reduce nosocomial infections in newborns. This exploratory qualitative study aimed to examine experiences with WhatsApp as a communication tool among improvement team members and an external coach to improve adherence to aseptic protocols. Ten QI team members and the external coach were interviewed on communication processes and approaches and thematically analyzed. The WhatsApp transcript for the implementation period was also included in the analysis. WhatsApp was effective for disseminating information, including guidance on QI and clinical practice, and data on performance indicators. It was not effective as a platform for group discussion to generate change ideas or analyze the performance indicator data. The decision of who to include in the WhatsApp group and how members engaged in the group may have reinforced existing hierarchies. Using WhatsApp created a work environment in which members were accessible all the time, breaking down barriers between personal and professional time. The continual influx of messages was distracting to some respondents, and how respondents managed these messages (eg, using the silent function) may have influenced their perceptions of WhatsApp. The coach used WhatsApp to
Livesley, Nigel
2018-01-01
Background Quality improvement (QI) involves the following 4 steps: (1) forming a team to work on a specific aim, (2) analyzing the reasons for current underperformance, (3) developing changes that could improve care and testing these changes using plan-do-study-act cycles (PDSA), and (4) implementing successful interventions to sustain improvements. Teamwork and group discussion are key for effective QI, but convening in-person meetings with all staff can be challenging due to workload and shift changes. Mobile technologies can support communication within a team when face-to-face meetings are not possible. WhatsApp, a mobile messaging platform, was implemented as a communication tool by a neonatal intensive care unit (NICU) team in an Indian tertiary hospital seeking to reduce nosocomial infections in newborns. Objective This exploratory qualitative study aimed to examine experiences with WhatsApp as a communication tool among improvement team members and an external coach to improve adherence to aseptic protocols. Methods Ten QI team members and the external coach were interviewed on communication processes and approaches and thematically analyzed. The WhatsApp transcript for the implementation period was also included in the analysis. Results WhatsApp was effective for disseminating information, including guidance on QI and clinical practice, and data on performance indicators. It was not effective as a platform for group discussion to generate change ideas or analyze the performance indicator data. The decision of who to include in the WhatsApp group and how members engaged in the group may have reinforced existing hierarchies. Using WhatsApp created a work environment in which members were accessible all the time, breaking down barriers between personal and professional time. The continual influx of messages was distracting to some respondents, and how respondents managed these messages (eg, using the silent function) may have influenced their perceptions of
Landgraeber, Stefan; Samelko, Lauryn; McAllister, Kyron; Putz, Sebastian; Jacobs, Joshua.J.; Hallab, Nadim James
2018-01-01
Background: The rate of revision for some designs of total hip replacements due to idiopathic aseptic loosening has been reported as higher for women. However, whether this is environmental or inherently sex-related is not clear. Objective: Can particle induced osteolysis be sex dependent? And if so, is this dependent on the type of implant debris (e.g. metal vs polymer)? The objective of this study was to test for material dependent inflammatory osteolysis that may be linked to sex using CoCrMo and implant grade conventional polyethylene (UHMWPE), using an in vivo murine calvaria model. Methods: Healthy 12 week old female and male C57BL/6J mice were treated with UHMWPE (1.0um ECD) or CoCrMo particles (0.9um ECD) or received sham surgery. Bone resorption was assessed by micro-computed tomography, histology and histomorphometry on day 12 post challenge. Results: Female mice that received CoCrMo particles showed significantly more inflammatory osteolysis and bone destruction compared to the females who received UHMWPE implant debris. Moreover, females challenged with CoCrMo particles exhibited 120% more inflammatory bone loss compared to males (p<0.01) challenged with CoCrMo implant debris (but this was not the case for UHMWPE particles). Conclusion: We demonstrated sex-specific differences in the amount of osteolysis resulting from CoCrMo particle challenge. This suggests osteo-immune responses to metal debris are preferentially higher in female compared to male mice, and supports the contention that there may be inherent sex related susceptibility to some types of implant debris. PMID:29785221
Malka, Shachar; Hawkins, Michelle G; Jones, James H; Pascoe, Peter J; Kass, Philip H; Wisner, Erik R
2009-09-01
To determine the effects of body position on lung and air-sac volumes in anesthetized and spontaneously breathing red-tailed hawks (Buteo jamaicensis). 6 adult red-tailed hawks (sex unknown). A crossover study design was used for quantitative estimation of lung and air-sac volumes in anesthetized hawks in 3 body positions: dorsal, right lateral, and sternal recumbency. Lung volume, lung density, and air-sac volume were calculated from helical computed tomographic (CT) images by use of software designed for volumetric analysis of CT data. Effects of body position were compared by use of repeated-measures ANOVA and a paired Student t test. Results for all pairs of body positions were significantly different from each other. Mean +/- SD lung density was lowest when hawks were in sternal recumbency (-677 +/- 28 CT units), followed by right lateral (-647 +/- 23 CT units) and dorsal (-630 +/- 19 CT units) recumbency. Mean lung volume was largest in sternal recumbency (28.6 +/- 1.5 mL), followed by right lateral (27.6 +/- 1.7 mL) and dorsal (27.0 +/- 1.5 mL) recumbency. Mean partial air-sac volume was largest in sternal recumbency (27.0 +/- 19.3 mL), followed by right lateral (21.9 +/- 16.1 mL) and dorsal (19.3 +/- 16.9 mL) recumbency. In anesthetized red-tailed hawks, positioning in sternal recumbency resulted in the greatest lung and air-sac volumes and lowest lung density, compared with positioning in right lateral and dorsal recumbency. Additional studies are necessary to determine the physiologic effects of body position on the avian respiratory system.
Blood Far Forward - A Whole Blood Research and Training Program for Austere Environments
2013-01-01
crisis situation should be avoided.39 The training program thus includes blood transfusion through the sternal intraosseous route. To date, 158 blood...collections have been performed by soldiers and medics, and more than 100 retransfusions have been performed intravenously and 58 intraosseously in...healthy volunteers. The transfusion time through the sternal intraosseous route of 1 unit of whole blood (by gravity only) varies between 8 minutes 30
Treatment of olecranon bursitis: a systematic review.
Sayegh, Eli T; Strauch, Robert J
2014-11-01
The optimal management of olecranon bursitis is ill-defined. The purposes of this review were to systematically evaluate clinical outcomes for aseptic versus septic bursitis, compare surgical versus nonsurgical management, and examine the roles of corticosteroid injection and aspiration in aseptic bursitis. The English-language literature was searched using PubMed, Cumulative Index to Nursing and Allied Health Literature, Physiotherapy Evidence Database, Allied and Complementary Medicine, and Cochrane Central Register of Controlled Trials. Analyses were performed for clinical resolution and complications after treatment of aseptic and/or septic olecranon bursitis. Twenty-nine studies containing 1278 patients were included. Compared with septic bursitis, aseptic bursitis was associated with a significantly higher overall complication rate (p = 0.0108). Surgical management was less likely to clinically resolve septic or aseptic bursitis (p = 0.0476), and demonstrated higher rates of overall complications (p = 0.0117), persistent drainage (p = 0.0194), and bursal infection (p = 0.0060) than nonsurgical management. Corticosteroid injection for aseptic bursitis was associated with increased overall complications (p = 0.0458) and skin atrophy (p = 0.0261). Aspiration did not increase the risk of bursal infection for aseptic bursitis. Based primarily on level IV evidence, nonsurgical management of olecranon bursitis is significantly more effective and safer than surgical management. The clinical course of aseptic bursitis appears to be more complicated than that of septic bursitis. Corticosteroid injection is associated with significant risks without improving the outcome of aseptic bursitis. Therapeutic IV.
Reilly, Danielle; Kamineni, Srinath
2016-01-01
Bursitis is a common medical condition, and of all the bursae in the body, the olecranon bursa is one of the most frequently affected. Bursitis at this location can be acute or chronic in timing and septic or aseptic. Distinguishing between septic and aseptic bursitis can be difficult, and the current literature is not clear on the optimum length or route of antibiotic treatment for septic cases. The current literature was reviewed to clarify these points. The reported data for olecranon bursitis were compiled from the current literature. The most common physical examination findings were tenderness (88% septic, 36% aseptic), erythema/cellulitis (83% septic, 27% aseptic), warmth (84% septic, 56% aseptic), report of trauma or evidence of a skin lesion (50% septic, 25% aseptic), and fever (38% septic, 0% aseptic). General laboratory data ranges were also summarized. Distinguishing between septic and aseptic olecranon bursitis can be difficult because the physical and laboratory data overlap. Evidence for the optimum length and route of antibiotic treatment for septic cases also differs. In this review we have presented the current data of offending bacteria, frequency of key physical examination findings, ranges of reported laboratory data, and treatment practices so that clinicians might have a better guide for treatment. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.
Stekol'nikov, A A
2001-01-01
Numbers of scutal, coxal and sternal setae were counted in 1393 specimens of 5 Hirsutiella species. All observed chaetotactic anomalies were classified into 3 groups: 1) "rare" anomalies, such as absence of one AL, AM, coxal or sternal setae, presence of additional AL, AM, coxal or anterior sternal setae; 2) presence of 1-2 post-posterolateral soutal setae (PPL); 3) presence of additional 1-3 posterior sternal setae. "Rare" anomalies were found in 2.8% of the specimens examined. They were observed usually in northern or alpine populations. Obviously, it is an effect of more frequent ontogenetic failures in rigorous climate conditions being out of optimum for trombiculids. The quota of the individuals with PPL in a set of H. steineri samples varied from 16 to 74%, while in the other samples of this species the presence of the single (and not more) PPL were found very seldom, as well as in the other species examined. In the similar way, the additional posterior sternal setae were found with the frequency up to 100% in the some samples of H. steineri, H. hexasternalis and H. alpina, but in other ones they were present only in few specimens. Since in a series of cases the ratio of the number of specimens with PPL to the number of specimens without PPL, as well as the ratio of the number of specimens with fSt = 2.4 to the number of specimens with fSt = 2.2 is almost equal to 2, one can suppose that the variance of this characters has a genetic basis. All samples having a high frequency of the PPL appearance or the appearance of additional posterior sternal setae were collected in the alpine zone. It is an evident example of the ecogeographical rules, which were reported previously by the author for the quantitative characters in species of the genera Neotrombicula (Stekolnikov, 1996, 1998, 1999) and Hirsutiella (Stekolnikov, 2001). It is possible that the PPL appearance is caused by the higher humidity of the climate, and the appearance of additional posterior sternal
Liang, Xiang; Tang, Ganghua; Wang, Hongliang; Hu, Kongzhen; Tang, Xiaolan; Nie, Dahong; Sun, Ting; Huang, Tingting
2014-08-01
The aim of this study is to evaluate uptake of 2-(18)F-fluoroethyl-bis(zinc(II)-dipicolylamine) ((18)F-FEN-DPAZn2) as a promising cell death imaging agent, a choline analog (18)F-fluoroethylcholine ((18)F-FECH), (18)F-fluoride as a bone imaging agent, and a glucose analog 2-(18)F-fluoro-2-deoxy-d-glucose ((18)F-FDG) in the combined S180 fibrosarcoma and turpentine-induced inflammation mice models. The results showed that (18)F-FDG had the highest tumor-to-blood uptake ratio and tumor-to-muscle ratio, and high inflammation-to-blood ratio and inflammation-to-muscle ratio. (18)F -FECH showed moderate tumor-to-blood ratio and tumor-to-muscle ratio, and low inflammation-to-blood ratio and inflammation-to-muscle ratio. However, accumulation of (18)F FEN-DPAZn2 in tumor was similar to that in normal muscle. Also, (18)F-FEN-DPAZn2 and (18)F-fluoride exhibited the best selectivity to inflammation. (18)F-FECH positron emission tomography (PET) imaging demonstrates some advantages over (18)F-FDG PET for the differentiation of tumor from inflammation. (18)F FEN-DPAZn2 and (18)F-fluoride can be used for PET imaging of aseptic inflammation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bhowmik, Biplab; Bandyopadhyay, P K
2017-03-01
During the course of a biodiversity survey of the endoparasitic aseptate gregarines in the Malda district of West Bengal, India, seminal vesicles of the earthworm, Eutyphoeus kherai , Julka 1978 were found to be infested with a new species, Monocystis julkae sp.nov., of the genus, Monocystis Stein (Arch Anat Phys Med 181-223, 1848). The trophozoite is elongated but slightly constricted posteriorly. A tail like protrusion appears in the posterior end. Anterior end is rather wider than the posterior one. The whole body size of the trophozoite measures 102.2-184.0 (126.7 ± 19.9) µm × 40.9-81.8 (58.2 ± 10.0) µm. Size of the nucleus ranges from 10.2 to 16.3 (11.9 ± 1.9) µm × 8.1-12.2 (8.8 ± 1.2) µm. The gametocysts are ovoidal containing two unequal gametocytes. Diameter of it measures 61.3-98.1 (75.8 ± 8.6) µm. Oocysts are navicular and measures 6.9-10.0 (8.7 ± 0.9) µm × 3.0-4.6 (4.3 ± 0.4) µm.
Hanson, Summer E; Meaike, Jesse D; Selber, Jesse C; Liu, Jun; Li, Liang; Hassid, Victor J; Baumann, Donald P; Butler, Charles E; Garvey, Patrick B
2018-05-01
Although multiple acellular dermal matrix sources exist, it is unclear how its processing impacts complication rates. The authors compared complications between two preparations of human cadaveric acellular dermal matrix (freeze dried and ready-to-use) in immediate tissue expander breast reconstruction to analyze the effect of processing on complications. The authors retrospectively reviewed all alloplastic breast reconstructions with freeze-dried or ready-to-use human acellular dermal matrices between 2006 and 2016. The primary outcome measure was surgical-site occurrence defined as seroma, skin dehiscence, surgical-site infection, or reconstruction failure. The two groups were compared before and after propensity score matching. The authors included 988 reconstructions (freeze-dried, 53.8 percent; ready-to-use, 46.2 percent). Analysis of 384 propensity score-matched pairs demonstrated a slightly higher rate of surgical-site occurrence (21.4 percent versus 16.7 percent; p = 0.10) and surgical-site infection (9.6 percent versus 7.8 percent; p = 0.13) in the freeze-dried group than in the ready-to-use group, but the difference was not significant. However, failure was significantly higher for the freeze-dried versus ready-to-use group (7.8 percent versus 4.4 percent; p = 0.050). This is the largest study comparing the outcomes of alloplastic breast reconstruction using human acellular dermal matrix materials prepared by different methods. The authors demonstrated higher early complications with aseptic, freeze-dried matrix than with sterile ready-to-use matrix; reconstructive failure was the only outcome to achieve statistical significance. The authors conclude that acellular dermal matrix preparation has an independent impact on patient outcomes in their comparison of one company's product. Therapeutic, III.
Miller, Michael J; Walsh, Michael R; Shrake, Jerry L; Dukes, Randall E; Hill, Daniel B
2009-01-01
This paper describes the use of the BioVigilant IMD-A, a real-time and continuous monitoring technology based on optical spectroscopy, to simultaneously and instantaneously detect, size, and enumerate both viable and nonviable particles in a variety of filling and transfer isolator environments during an aseptic fill, transfer of sterilized components, and filling interventions. Continuous monitoring of three separate isolators for more than 16 h and representing more than 28 m3 of air per isolator (under static conditions) yielded a mean viable particle count of zero (0) per cubic meter. Although the mean count per cubic meter was zero, the detection of very low levels of single viable particles was randomly observed in each of these sampling runs. No viable particles were detected during the manual transfer of sterilized components from transfer isolators into a filling isolator, and similar results were observed during an aseptic fill, a filling needle change-out procedure, and during disassembly, movement, and reassembly of a vibrating stopper bowl. During the continuous monitoring of a sample transfer port and a simulated mousehole, no viable particles were detected; however, when the sampling probe was inserted beyond the isolator-room interface, the IMD-A instantaneously detected and enumerated both viable and nonviable particles originating from the surrounding room. Data from glove pinhole studies showed no viable particles being observed, although significant viable particles were immediately detected when the gloves were removed and a bare hand was allowed to introduce microorganisms into the isolator. The IMD-A technology offers the industry an unprecedented advantage over growth-based bioaerosol samplers for monitoring the state of microbiological control in pharmaceutical manufacturing environments, and represents significant progress toward the acceptance of microbiology process analytical technology solutions for the industry.
... R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ... R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ...
Trail-following pheromones in basal termites, with special reference to Mastotermes darwiniensis.
Sillam-Dussès, David; Sémon, Etienne; Lacey, Michael J; Robert, Alain; Lenz, Michael; Bordereau, Christian
2007-10-01
In the framework of an evolutionary study, trail pheromones have been studied in the most basal extant termite, Mastotermes darwiniensis (Mastotermitidae), and two other basal termites, the Termopsidae Porotermes adamsoni (Porotermitinae) and Stolotermes victoriensis (Stolotermitinae). Although workers of M. darwiniensis do not walk in single file while exploring a new environment under experimental conditions and are unable to follow artificial trails in 'open field' experiments, they do secrete a trail-following pheromone from their sternal glands. This unique behavior might reflect a primitive function of communication of the sternal gland. The major component of the pheromone appears to be the same in the three basal species: the norsesquiterpene alcohol (E)-2,6,10-trimethyl-5,9-undecadien-1-ol. This represents a new chemical category of trail-following pheromones for termites. The quantity of pheromone was estimated as 20 pg/individual in M. darwiniensis, 700 pg/individual in P. adamsoni, and 4 pg/individual in S. victoriensis. The activity threshold was 1 ng/cm in M. darwiniensis and 10 pg/cm in P. adamsoni. In M. darwiniensis, the trail pheromone was secreted by sternal gland 4 and to a lesser degree by sternal gland 3, sternal gland 5 being almost inactive. This study highlighted phylogenetic relationships between the Mastotermitidae and two subfamilies of the Termopsidae, the Porotermitinae and the Stolotermitinae. Furthermore, it indicated a heterogeneity within the Termopsidae, with Porotermitinae and Stolotermitinae on one hand, and Termopsinae on the other. Finally, Mastotermitidae and Termopsidae, with C14 trail pheromones, are clearly separated from the Kalotermitidae, Rhinotermitidae, and Termitidae that secrete C12 or C20 trail pheromones.
Manubrial stress fractures diagnosed on MRI: report of two cases and review of the literature.
Baker, Jonathan C; Demertzis, Jennifer L
2016-06-01
In contrast to widely-reported sternal insufficiency fractures, stress fractures of the sternum from overuse are extremely rare. Of the 5 cases of sternal stress fracture published in the English-language medical literature, 3 were in the sternal body and only 2 were in the manubrium. We describe two cases of manubrial stress fracture related to golf and weightlifting, and present the first report of the MR findings of this injury. In each of these cases, the onset of pain was atraumatic, insidious, and associated with increased frequency of athletic activity. Imaging was obtained because of clinical diagnostic uncertainty. On MRI, each patient had a sagittally oriented stress fracture of the lateral manubrium adjacent to the first rib synchondrosis. Both patients had resolution of pain after a period of rest, with subsequent successful return to their respective activities. One patient had a follow-up MRI, which showed resolution of the manubrial marrow edema and fracture line. Based on the sternal anatomy and MR findings, we hypothesize that this rare injury might be caused by repetitive torque of the muscle forces on the first costal cartilage and manubrium, and propose that MRI might be an effective means of diagnosing manubrial stress fracture.
Lopez, J; Sachithanandan, A; Leow, M
2016-06-01
Hypersensitivity to stainless steel sternal sutures are an uncommon occurrence. We present a case of such a patient who developed chronic tissue overgranulation over a sternotomy wound eight weeks post-operatively. Primary suspicion was infection, a more common complication however radiological and laboratory investigation showed otherwise. Conservative management provided limited ephemeral success. After ensuring adequate sternal bone healing, the sutures and granulation tissue were eventually surgically removed without complication and the reoperated wound healed well.
Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N.; Romio, Silvana A.; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L.F.
2017-01-01
New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders´Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the
Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal
2015-01-01
Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.
Kharadov, A V
2002-01-01
Aberrations (quantitative chaetotactic deviations, i.e. decreasing or increasing of setae numbers and variations in arrangement of setae) and anomalies (qualitative chaetotactic deviations, for example, partial reduction of scutum, shortening of a seta more than 1.5-2 times, merging of setae) were recorded for 13 taxonomically important morphological structures in the chigger mite species Neotrombicula sympatrica Stekolnikov, 2001. 3308 specimens were studied as a total. 17.2% of them had various morphological deviations. The most common types of aberrations were observed in the number and positions of genualae I (94 specimens), AM seta (79 spec.) and sternal setae (77 spec.). The aberrations of sternal and coxal setae were usually interrelated: the sternal seta was "transferred" from the sternal area onto the coxa, or the other way round take place. The specimens having aberrations of sternal setae were twice as numerous as the specimens with aberrations of coxal setae (77 against 35). The specimens with aberrations of dorsal setae and mastitarsala were very rare (2 spec. each). Among anomalies, the presence of nude galeal seta (91 spec.) and scutal anomalies (66 spec.) were prevalent. The most frequently one form of deviation only was observed in one specimen of N. sympatrica. Nevertheless, the specimens simultaneously having several aberrations or anomalies were also found. 17 types of such combinations were observed, that counts 20.6% of all specimens with deviations. Symmetric deviations, namely the presence of two nude galeal setae (31 spec.), presence of 2 genualae on both legs I (4 spec.), presence of 2 AM (2 spec.) and symmetric reduction of scutal angles (1 spec.), sometimes cause troubles in diagnostics. The quarter of variance in N. sympatrica and in the species N. monticola Schluger et Davydov, 1967 formerly studied by the author turned out as almost identical. The specimens with deviations counted 14.5% of all studied specimens in the latter species
Ji, Ye; Xu, Gong Ping; Zhang, Zhi Peng; Xia, Jing Jun; Yan, Jing Long; Pan, Shang Ha
2010-03-01
Autogenous bone grafts are widely used in the repair of bone defects. Growth factors such as bone morphogenetic protein 2 (BMP-2) can induce bone regeneration and enhance bone growth. The combination of an autogenous bone graft and BMP-2 may provide a better osteogenic effect than either treatment alone, but BMP-2 is easily inactivated in body fluid. The objective of this study was to develop a technique that can better preserve the in vivo activity of BMP-2 incorporated in bone grafts. In this study, we first prepared BMP-2/poly(lactic-co-glycolic acid) (PLGA) delayed-release microspheres, and then combined collagen, the delayed-release microspheres, and rat autologous bone particulates to form four groups of composite grafts with different combinations: collagen in group A; collagen combined with bone particulates in group B; collagen combined with BMP-2/PLGA delayed-release microspheres in group C; and collagen combined with both bone particulates and BMP-2/PLGA delayed-release microspheres in group D. The four groups of composite grafts were implanted into the gluteus maximus pockets in rats. The ectopic osteogenesis and ALP level in group D (experimental group) were compared with those in groups A, B, and C (control groups) to study whether it had higher osteogenic capability. Results showed that the composite graft design increased the utility of BMP-2 and reduced the required dose of BMP-2 and volume of autologous bone. The selection of bone particulate diameter had an impact on the osteogenetic potential of bone grafts. Collagen prevented the occurrence of aseptic inflammation and improved the osteoinductivity of BMP-2. These results showed that this composite graft design is effective and feasible for use in bone repair.
Urbanowicz, T; Straburzyńska-Migaj, E; Buczkowski, P; Grajek, S; Jemielity, M
2015-01-01
Surgical wound infections are more frequent in patients undergoing heart transplantation than in other heart surgery patients. There is a wide spread of sternal wound infection incidence in transplant patients ranging from 4% to 40%. It is first study describing local gentamicin sponge application during heart transplantation procedure. We enrolled 75 patients in a retrospective, single-center study, including 25 patients who underwent orthotopic heart transplantation (heart transplant group) and 50 in the cardiac surgery group. They were in mean age of 49 ± 12 years and 51 ± 13 years in heart transplantation and cardiac surgery group, respectively. A gentamicin sponge was inserted intraoperatively between sternal borders before chest closure in all heart transplantation patients. There was 1 early death (4%) on postoperative day 7 owing to Clostridium difficile infection in the heart transplant group. There was 1 death (2%) in the cardiac surgery group owing to multiorgan failure secondary to perioperative heart ischemia. There was neither bacterial sternal wound infection nor sternal instability in the heart transplant group. None of the patients who had gentamicin sponge applied had wound healing problems. Two patients (4%) had a deep sternal wound infection in the cardiac surgery group, who had no sponge application; 1 (2%) was treated by surgical debridement and active drainage and 1 (2%) by vacuum therapy. There were 11 patients (44%) discharged on insulin therapy in the heart transplant group and 21 (21%) in the cardiac surgery group. Mean overall postoperative hospital stay was 35 ± 19 days in the heart transplant group and 10 ± 4 days in the cardiac surgery group. Gentamicin sponge is an effective local infection prophylaxis in heart transplant patients. Copyright © 2015 Elsevier Inc. All rights reserved.
Sievert, Lynnette L.; Reza, Angela; Mills, Phoebe; Morrison, Lynn; Rahberg, Nichole; Goodloe, Amber; Sutherland, Michael; Brown, Daniel E.
2010-01-01
Objective To test for a diurnal pattern in hot flashes in a multi-ethnic population living in a hot, humid environment. To examine rates of concordance between objective and subjective measures of hot flashes using ambulatory and laboratory measures. Methods Study participants aged 45–55 were recruited from the general population of Hilo, Hawaii. Women wore a Biolog hot flash monitor, kept a diary for 24-hours, and also participated in 3-hour laboratory measures (n=199). Diurnal patterns were assessed using polynomial regression. For each woman, objectively recorded hot flashes that matched subjective experience were treated as true positive readings. Subjective hot flashes were considered the standard for computing false positive and false negative readings. True positive, false positive, and false negative readings were compared across ethnic groups by chi-square analyses. Results Frequencies of sternal, nuchal and subjective hot flashes peaked at 15:00 ± 1 hour with no difference by ethnicity. Laboratory results supported the pattern seen in ambulatory monitoring. Sternal and nuchal monitoring showed the same frequency of true positive measures, but non-sternal electrodes picked up more false positive readings. Laboratory monitoring showed very low frequencies of false negatives. There were no ethnic differences in the frequency of true positive or false positive measures. Women of European descent were more likely to report hot flashes that were not objectively demonstrated (false negative measures). Conclusions The diurnal pattern and peak in hot flash occurrence in the hot humid environment of Hilo was similar to results from more temperate environments. Lack of variation in sternal vs. non-sternal measures, and in true positive measures across ethnicities suggests no appreciable effect of population variation in sweating patterns. PMID:20220538
Evidence for crustacean cardioactive peptide-like innervation of the gut in Locusta migratoria.
Donini, Andrew; Ngo, Caroline; Lange, Angela B
2002-11-01
Hindguts from female Vth instar larvae, young adults (1-2 days) and old adults (>10 days) are equally sensitive to the crustacean cardioactive peptide (CCAP), with changes in contraction occurring at a threshold concentration of 10(-9)M and maximal responses observed at concentrations ranging between 10(-7) and 5x10(-6)M. An immunohistochemical examination of the gut of Locusta migratoria with an antiserum raised against CCAP revealed an extensive network of CCAP-like immunoreactive processes on the hindgut and posterior midgut via the 11th sternal nerve arising from the terminal abdominal ganglion. Anterograde filling of the 11th sternal nerve with neurobiotin revealed extensive processes and terminals on the hindgut. Retrograde filling of the branch of the 11th sternal nerve which innervates the hindgut with neurobiotin revealed two bilaterally paired cells in the terminal abdominal ganglion which co-localized with CCAP-like immunoreactivity. Results suggest that a CCAP-like substance acts as a neurotransmitter/neuromodulator at the locust hindgut.
D'Agostino, A; Toffanetti, G; Scala, R; Trevisiol, L; Ferrari, F
2004-04-01
Still today, there is no classification of non-unions in maxillofacial traumatology. There is a broad spectrum of definitions that simultaneously describe the pathological conditions and functional implications determined by the anatomical location of the fractures and the time factor. In this article the authors describe a literature review about bone non-union classification. Weber, in 1973, introduced the term "pseudo-arthrosis" to describe an altered process of bone healing characterised by the presence of fibrous tissue interposed between the fracture segments, that was lined with cartilaginous tissue and joined by a capsule; Spiessl, in 1988, used the term "non-union" to define any alteration of the bone healing process after a time period of more than 6 months from the initial traumatic event; Rosen, in 1990, proposed a new classification of the modes of altered bone healing in fractures, distinguishing 5 categories: delayed consolidation, non-union, non-union vascular, non union avascular, pseudoarthrosis. The authors also talk about "poor bone positioning". This factor describes the incorrect anatomical position of the bone fragments despite perfectly normal healing according to Gruss. In this article they also discuss about the treatment of non-unions and the treatment of occlusal alterations caused by poor post-traumatic bone positioning.
Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N; Romio, Silvana A; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L F
2018-01-08
New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders'Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the
K, Kandhari V; M, Desai M; S, Bava S; N, Wade R
2015-01-01
Chances of avascular necrosis of acetabulum are rare as it enjoys a rich blood supply. But cases of post - traumatic avascular necrosis of acetabulum following fracture of posterior column have been well documented. Importance of identifying and suspecting the avascular necrosis of acetabulum is essential in cases of failed fixation of fracture acetabulum, previously operated using extensile approach to acetabulum; either extended anterior ilio - femoral or tri - radiate approach. Such patients usually present with repeated deep bone infection or with early failure of fixation with aseptic loosening and migration of its components. We present a similar case. 40 years female presented with inadequately managed transverse fracture of left acetabulum done by anterior extended ilio-inguinal approach. The fixation failed. She presented 6 months later with painful hip. Cemented total hip replacement was performed with reconstruction of acetabulum by posterior column plating. Six months postoperatively patient presented with dislodgement of cup, pelvic discontinuity and sinus in the thigh. Two stage revision surgery was planned. First implant, removal; debridement and antibiotic spacer surgery was performed. At second stage of revision total hip replacement, patient had Paprosky grade IIIb defect in acetabulum. Spacer was removed through the posterior approach. Anterior approach was taken for anterior plating. Intra-operatively external iliac pulsations were found to be absent so procedure was abandoned after expert opinion. Postoperatively digital subtraction angiography demonstrated a chronic block in the external iliac artery and corona mortis was the only patent vascular channel providing vascular to the left lower limb. Thus, peripheral limb was stealing blood supply from the acetabulum to maintain perfusion. Patient was ultimately left with pelvic discontinuity, excision arthroplasty and pseudoarthrosis of the left hip. Avascular necrosis of acetabulum is a rare
Topical negative pressure for the treatment of neonatal post-sternotomy wound dehiscence.
Hardwicke, J; Richards, H; Jagadeesan, J; Jones, T; Lester, R
2012-01-01
The use of topical negative pressure (TNP) dressings for sternal wound dehiscence or mediastinitis in the neonatal population is rare. The majority of case reports have focused on wound healing as an endpoint and have not discussed the physiological advantage that TNP dressings may impart with regard to sternal stabilisation, improved respiratory function and early weaning from mechanical ventilation. We present a case of the use of TNP in neonatal post-sternotomy wound dehiscence and mediastinitis, from a UK perspective, with an emphasis on wound healing and physiological optimisation. As well as an improvement in sternal wound healing due to the local effects of the TNP system, serial arterial blood gas analysis revealed a significant improvement in systemic physiological parameters, including a reduction in pCO(2) in the period (days 20-31) after application of TNP (p<0.0001) compared to the period before where simple occlusive dressings were applied. Hydrogen ion concentration also significantly reduced in this period (p=0.0058). The use of the TNP system in association with systemic antibiotics successfully treated the mediastinitis. A sealed, controlled wound environment also allowed ease of nursing and an expedited return to care by the parents. We would recommend the consideration of TNP dressings in similar cases of neonatal and paediatric sternal wound dehiscence. Not only do we observe the local effects of improved wound healing, the systemic effects of improved lung function are also valuable in the early management of such complex cases.
Mechanism of trail following by the arboreal termite Nasutitermes corniger (Isoptera: Termitidae).
Gazai, Vinícius; Bailez, Omar; Viana-Bailez, Ana Maria
2014-01-01
In this study, we investigated the mechanisms used by the arboreal termite Nasutitermes corniger (Motschulsky, 1855) to follow trails from the nest to sources of food. A plate containing one of seven trail types was used to connect an artificial nest of N. corniger with an artificial foraging arena. The trail types were: termite trail; paraffined termite trail; trail made of paraffin; rectal fluid extract trail; sternal gland extract trail; feces extract trail; and solvent trail (control). In each test, the time was recorded from the start of the test until the occurrence of trail following, at which point the number of termites that followed the trail for least 5 cm in the first 3 min of observation was recorded. The delay for termites initiating trail following along the termite trail was lower (0.55 ± 0.16 min) than in the trails of sternal gland extract (1.05 ± 0.08 min) and trails of termite feces extract (1.57 ± 0.21 min) (F(2), (48) = 22.59, P < 0.001). The number of termites that followed the termite trail was greater (207.3 ± 17.3) than the number that followed the trail of termite feces extract (102.5 ± 9.4) or sternal gland extract (36, 9 ± 1.6) (F(2), (48) = 174.34, P < 0.001). Therefore, feces on the trail may play an important role alongside sternal gland pheromones in increasing the persistence of the trail.
Aortic valve replacement in a patient with severe nickel allergy.
Lusini, Mario; Barbato, Raffaele; Spadaccio, Cristiano; Chello, Massimo
2011-11-01
Nickel allergy can raise clinical problems in patients undergoing cardiac surgery who require sternal closure with stainless steel wire. We describe the case of a 51-year-old woman with severe nickel allergy who underwent aortic valve replacement with a nickel-free ON-X prosthesis and sternal closure by Fiberwire # 2 suture without complications. Considering its biocompatibility and its mechanical characteristics including optimal strength and knot resistance, this suture might be a viable alternative in patients in which the use of stainless steel wire is contraindicated. © 2011 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, C.
This profile covers aseptic boxes and paper milk cartons because they are collected together in recycling programs, but statistics are given separately for each product. Aseptic boxes, more commonly known as drink boxes, are used for fruit juices and milk. Aseptic processing involves a high-temperature/short-time treatment in which liquid products are heated quickly to a temperature at which sterilization occurs. The product is then cooled and placed in a sterile container. By weight, aseptic boxes are 70% paper (used for stiffness and strength), 24% polyethylene (used in four different layers to seal the package liquid-tight), and 6% aluminum foil (usedmore » as a barrier against air and light). By weight, milk cartons are 80% paper and 20% polyethylene.« less
Echovirus 15 and autumn meningitis outbreak among children, Patras, Greece, 2005.
Frantzidou, Filanthi; Dumaidi, Kamal; Spiliopoulou, Adamantia; Antoniadis, Antonis; Papa, Anna
2007-09-01
Enteroviruses are the most common cause of aseptic meningitis, presenting in epidemic or endemic form. To determine the causative agent of an aseptic meningitis outbreak in autumn, 2005 in Patras, Greece. Cerebrospinal fluid (CSF) samples taken during May 2005-February 2006 from children admitted to the Children Hospital of Patras with signs of aseptic meningitis were tested for the presence of enteroviral RNA. Typing was performed by nucleotide analysis. Enteroviruses were detected in 11 (57.9%) of 19 tested CSF samples. In a 12-day period (27 October-7 November 2005) five aseptic meningitis cases were observed. Echovirus 15 was detected in all five cases, and differed from the prototype strain by 27.6%. Enteroviruses before and after this cluster of cases were of different serotypes (Echovirus 9, Echovirus 6). All patients with Echovirus 15 infection were male with a mean age of 7.7 years (2 months-13 years), all recovered successfully. This is the first report of a cluster of aseptic meningitis cases caused by Echovirus 15. The causative agent was a new variant of Echovirus 15.
Kramer, A; Roth, B; Müller, G; Rudolph, P; Klöcker, N
2004-01-01
The main target of the combination of octenidine with phenoxyethanol (Octenisept) is the antisepsis of acute wounds, whereas polyhexanide combined with polyethylene glycol in Ringer solution (Lavasept) is the agent of choice for antisepsis of chronic wounds and burns. Because comparative data for both agents on the effects on wound healing are lacking, we investigated the influence of preparations based on polyhexanide and octenidine versus placebo (Ringer solution) in experimental superficial aseptic skin wounds (n = 108) of 20 mm diameter, using a double-blind, randomised, stratified, controlled, parallel-group design in piglets. Computerised planimetry and histopathological methods were used for the assessment of wound healing. Histologically, no significant differences could be verified at any time between the 3 groups. However, in the early phase (day 9 after wounding), the octenidine-based product retarded wound contraction to a significantly greater extent than placebo and polyhexanide, whereas in the later phase (days 18 and 28), polyhexanide promoted contraction significantly more than did placebo and octenidine. The consequence is complete wound closure after 22.9 days using polyhexanide, in comparison to the placebo after 24.1 days (p < 0.05) and octenidine after 28.3 days (no statistical difference to placebo). This may be explained by the better tolerance of polyhexanide in vitro, which was demonstrated with dose and time dependence in cytotoxicity tests on human amnion cells. Copyright 2004 S. Karger AG, Basel
Increased incidence of patella baja after total knee arthroplasty revision for infection.
Chen, Antonia F; Tetreault, Matthew W; Levicoff, Eric A; Fedorka, Catherine J; Rothenberg, Adam C; Klatt, Brian A
2014-12-01
The incidence of patella baja in total knee arthroplasty (TKA) revisions for aseptic and septic causes is not well defined. We retrospectively reviewed 101 mobile-bearing TKA revisions performed between 2003 and 2009. Aseptic (n=67) and septic (n=34) revisions were compared for patella baja. A nonarticulating spacer was used as the initial treatment for infected cases. The Insall-Salvati ratio was radiographically measured before surgery (preexplant for septic revisions) and at latest follow-up (postreplant for septic revisions). Mean (SD) Insall-Salvati ratio did not differ between groups before surgery, 1.00 (0.25) for aseptic and 0.96 (0.22) for septic, but differed significantly after surgery, 0.99 (0.23) for aseptic and 0.77 (0.24) for septic. After correcting for preoperative patellar height, there was a statistically significant postoperative difference between aseptic cases, 1.09 (0.19), and septic cases, 0.82 (0.21). There was also a significant difference in mean (SD) postoperative range of motion (ROM) between aseptic cases, 108.0° (20.7°), and septic cases, 92.2° (34.6°), and decreased ROM between cases with patella baja, 95.1° (31.6°) and cases without patella baja, 106.8° (23.6°). TKA revisions done for septic causes using a nonarticulating spacer resulted in a higher incidence of patella baja and decreased ROM.
Park, Youngsoo; Choi, Kyoung Wook; Chung, Kyu-Jin; Kim, Tae Gon; Kim, Yong-Ha
2016-01-01
Background The use of acellular dermal matrix (ADM) in implant-based immediate breast reconstruction has been increasing. The current ADMs available for breast reconstruction are offered as aseptic or sterile. No published studies have compared aseptic and sterile ADM in implant-based immediate breast reconstruction. The authors performed a retrospective study to evaluate the outcomes of aseptic versus sterile ADM in implant-based immediate breast reconstruction. Methods Implant-based immediate breast reconstructions with ADM conducted between April 2013 and January 2016 were included. The patients were divided into 2 groups: the aseptic ADM (AlloDerm) group and the sterile ADM (MegaDerm) group. Archived records were reviewed for demographic data and postoperative complication types and frequencies. The complications included were infection, flap necrosis, capsular contracture, seroma, hematoma, and explantation for any cause. Results Twenty patients were reconstructed with aseptic ADM, and 68 patients with sterile ADM. Rates of infection (15.0% vs. 10.3%), flap necrosis (5.0% vs. 7.4%), capsular contracture (20.0% vs. 14.7%), seroma (10.0% vs. 14.7%), hematoma (0% vs. 1.5%), and explantation (10.0% vs. 8.8%) were not significantly different in the 2 groups. Conclusions Sterile ADM did not provide better results regarding infectious complications than aseptic ADM in implant-based immediate breast reconstruction. PMID:27896182
Computed tomographic findings of pulmonary atelectasis in healthy anesthetized Beagles.
le Roux, Christelle; Cassel, Nicolette; Fosgate, Geoffrey T; Zwingenberger, Allison L; Kirberger, Robert M
2016-10-01
OBJECTIVE To characterize the extent and location of atelectasis in healthy anesthetized dogs positioned in lateral recumbency and to determine whether repositioning dogs in sternal recumbency would resolve atelectasis. ANIMALS 6 healthy adult Beagles. PROCEDURES Each dog was anesthetized and underwent a CT examination twice with a 2-week interval between examinations. Once anesthetized, each dog was positioned in sternal recumbency, and a breath-hold helical transverse thoracic CT scan was acquired. The dog was then positioned in lateral recumbency for 30 minutes, and images were obtained at 5 preselected sites at 3, 8, 13, 20, and 30 minutes after repositioning (phase 1). Then, the dog was repositioned in sternal recumbency, and CT images were obtained at the 5 preselected sites at 5, 10, and 20 minutes after repositioning (phase 2). The protocol for the second examination was the same as the first except the dog was positioned in the opposite lateral recumbency during phase 1. The attenuation and cross-sectional area of the lung lobes at the preselected sites were measured and compared over time. RESULTS Lateral recumbency did not cause atelectasis in any of the dogs. Patchy areas of abnormally increased attenuation were infrequently detected in the left cranial lung lobe when dogs were positioned in left lateral recumbency, and those areas failed to resolve when dogs were positioned in sternal recumbency. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that the extent of lung attenuation changes was minimal in healthy anesthetized Beagles positioned in lateral recumbency and should not preclude CT examination.
Surgical correction of pectus arcuatum
Ershova, Ksenia; Adamyan, Ruben
2016-01-01
Background Pectus arcuatum is a rear congenital chest wall deformity and methods of surgical correction are debatable. Methods Surgical correction of pectus arcuatum always includes one or more horizontal sternal osteotomies, resection of deformed rib cartilages and finally anterior chest wall stabilization. The study is approved by the institutional ethical committee and has obtained the informed consent from every patient. Results In this video we show our modification of pectus arcuatum correction with only partial sternal osteotomy and further stabilization by vertical parallel titanium plates. Conclusions Reported method is a feasible option for surgical correction of pectus arcuatum. PMID:29078483
Ichimori, H; Yuhki, T; Mori, H; Matsubara, F; Sumida, M
1992-01-01
1. Effect of oral administration of live or formalin-treated Escherichia coli (E. coli) K-12 to the fifth instar, days 1 and 3 larvae of the silkworm, Bombyx mori, on induction of antibacterial activity in the haemolymph was investigated using the silkworms reared on an artificial diet under completely aseptic conditions. 2. When live E. coli was administered to the male day 1 larvae, low but significant antibacterial activity of 3.8 mm was detectable in the haemolymph of one individual at 48 hr after immunization. The proportion of the larvae to express antibacterial activity increased thereafter and at 120 hr after immunization, all three individuals showed antibacterial activity. In day 3 male larvae, activity was detectable at 48 and 72 hr after immunization. 3. When formalin-treated E. coli was orally administered to days 1 and 3 male larvae, no activity was detectable at any time post-immunization. 4. In the second experiment, when day 1 larvae, females and males were orally immunized with live E. coli, only females showed antibacterial activity in the haemolymph, beginning from 24 hr after immunization and up to 96 hr. 5. Removal of an antibiotic, chloramphenicol, from ingredients of an artificial diet was required for induction of antibacterial activity with oral administration of live E. coli. 6. When live E. coli that grows at pH 9.0 was selected and used for oral immunization, antibacterial activity was induced both in females and males at 72 hr after immunization and the activity was observed at 96 hr. 7. These results suggest that establishment of oral immunization with live E. coli in the silkworm larvae requires multiplication of E. coli in the midgut lumen and possibly its colonization on the luminal surface.
Choi, Rihwa; Kim, Gyeong-Moon; Jo, Ik Joon; Sim, Min Seob; Song, Keun Jeong; Kim, Byoung Joon; Na, Duk L; Huh, Hee Jae; Kim, Jong-Won; Ki, Chang-Seok; Lee, Nam Yong
2014-06-01
Since there are limited data on the incidence and clinical findings of central nervous system (CNS) infection by three α-herpesviruses including human herpes simplex virus 1 (HSV-1), HSV-2 and varicella-zoster virus (VZV) in Korea, a retrospective analysis of clinical data and polymerase chain reaction (PCR) results was performed in patients who presented with suspicion of acute viral meningitis and/or encephalitis at the emergency department of a tertiary referral hospital in Seoul, Korea. During the 3-year study period, a total of 224 cerebrospinal fluid (CSF) samples from 224 patients were examined. Among the 224 patients, 135 (60.3%) patients were identified as having aseptic meningitis (n = 70, 51.9%), encephalitis (n = 41, 30.4%) or meningoencephalitis (n = 24, 17.8%) at discharge. Twenty-four (17.8%) patients were identified as having VZV meningitis (n = 16, 11.9%), VZV meningoencephalitis (n = 2, 1.5%), HSV-2 meningitis (n = 4, 3.0%), or HSV-1 encephalitis (n = 2, 1.5%). Of the 24 patients infected with the three herpesviruses, immunocompromised patients accounted for 33.3% (n = 8). Skin rashes were observed in half (n = 9) of the patients with VZV, and none with HSV-1 or HSV-2. One patient with VZV meningitis and four patients with brain parenchymal involvement had neurologic sequelae. In conclusion, three herpesviruses are important causative agents of CNS infectious disease with significant morbidity in adults, regardless of the immunologic status. Therefore, CSF should be examined for HSV-1, HSV-2, and VZV using sensitive diagnostic methods in all cases of adult patients with clinical manifestations of CNS disease in order to identify the correct etiology and to determine appropriate therapy. © 2014 Wiley Periodicals, Inc.
Sex estimation from measurements of the first rib in a contemporary Polish population.
Kubicka, Anna Maria; Piontek, Janusz
2016-01-01
The aim of this study was to evaluate the accuracy of sex assessment using measurements of the first rib from computed tomography (CT) to develop a discriminant formula. Four discriminant formulae were derived based on CT imaging of the right first rib of 85 female and 91 male Polish patients of known age and sex. In direct discriminant analysis, the first equation consisted of all first rib variables; the second included measurements of the rib body; the third comprised only two measurements of the sternal end of the first rib. The stepwise method selected the four best variables from all measurements. The discriminant function equation was then tested on a cross-validated group consisting of 23 females and 24 males. The direct discriminant analysis showed that sex assessment was possible in 81.5% of cases in the first group and in 91.5% in the cross-validated group when all variables for the first rib were included. The average accuracy for the original group for rib body and sternal end was 80.9 and 67.9%, respectively. The percentages of correctly assigned individuals for the functions based on the rib body and sternal end in the cross-validated group were 76.6 and 85.0%, respectively. Higher average accuracies were obtained for stepwise discriminant analysis: 83.1% for the original group and 91.2% for the cross-validated group. The exterior edge, anterior-posterior of the sternal end, and depth of the arc were the most reliable parameters. Our results suggest that the first rib is dimorphic and that the described method can be used for sex assessment.
Surgical debridement, vacuum therapy and pectoralis plasty in poststernotomy mediastinitis.
Ennker, I C; Pietrowski, D; Vöhringer, L; Kojcici, B; Albert, A; Vogt, P M; Ennker, J
2009-11-01
In cardiac surgery poststernotomy mediastinitis continues to be a serious cause of morbidity and mortality. We report our experience with vacuum-assisted closure (VAC) therapy followed by reconstruction with M. pectoralis muscle flaps as treatment for deep sternal wound infections. Our group performed a retrospective analysis of 3630 consecutive cardiac surgical patients using median sternotomy from 11/2004 to 11/2007. After removing sternal wires, necrotic debris and potentially infective material, restabilisation of the sternum was performed and VAC therapy was employed. Wound closure and subsequent reconstruction were performed using a bilateral pectoralis muscle plasty. Of the analysed patients 16 female and 29 male patients suffered from deep sternal wound infections and were treated with VAC. The most common risk factors were diabetes mellitus odds ratio (OR 3.5), chronic obstructive pulmonary disease (COPD) (OR 2.9), use of bilateral mammarian artery (OR 2.0) and obesity (1.8). The median age of patients with deep sternal infections was similar to control patients. Staphylococcus epidermis was the most common pathogen (37.8%) followed by Enterococcus faecilis (22.2%) and Staphylococcus aureus (17.8). In 22.2% no pathogen could be detected. The 30 day mortality was 0%, the in-hospital mortality was 15.6%. The results of our studies demonstrate that vacuum therapy in conjunction with early and aggressive debridement is an effective strategy for treating poststernotomy mediastinitis. We consider pectoralis major muscle flap reconstruction as a safe technique and regard it as the primary choice for wound closure in poststernotomy mediastinitis. (c) 2009 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
A new posterior iliac puncture/aspiration needle.
Islam, Anwarul
2016-03-25
The needles that are currently used for obtaining bone marrow aspirate samples from the posterior ilium are typically those of 1930s vintage (eg, Klima, Salah or similar needles), which were specifically designed for sternal aspiration. These needles are not designed to obtain bone marrow aspirate samples from the posterior ilium and as a result they are unsatisfactory particularly if the patient is large or obese. A new posterior iliac puncture/aspiration needle has therefore been designed, which is particularly suited for bone marrow aspiration from the posterior ilium. The needle was tested on five cadavers and on five patients. The design and construction of the needle was found to be satisfactory and a marked improvement over the conventional sternal puncture needles particularly when large or obese patients were concerned. The new posterior iliac bone marrow aspiration needle has advantages that overcome the limitations of using a conventional sternal puncture needle to obtain marrow aspirates from the posterior ilium. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Li, Gang; Wu, Ping; Xu, Yao; Yu, Yan; Sun, Li; Zhu, Liang; Ye, Duyun
2009-06-02
Aseptic loosening (AL) is the main problem of total joints replacement (TJR) by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs) are endogenous eicosanoids synthesized locally from arachidonate acid (AA) at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB) cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4) on polymethylmethacrylate (PMMA) induced inflammation, pro-inflammatory cytokines including TNF-alpha, IL-1beta, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO) blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0-100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked with 15-LO siRNA, the PMMA induced pro
Li, Gang; Wu, Ping; Xu, Yao; Yu, Yan; Sun, Li; Zhu, Liang; Ye, Duyun
2009-01-01
Background Aseptic loosening (AL) is the main problem of total joints replacement (TJR) by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs) are endogenous eicosanoids synthesized locally from arachidonate acid (AA) at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Methods Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB) cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4) on polymethylmethacrylate (PMMA) induced inflammation, pro-inflammatory cytokines including TNF-α, IL-1β, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO) blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. Results 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0–100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked with 15-LO siRNA, the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lieb, K.
Since aseptic packages, or drink boxes, were introduced in the US in the early 1980s, they have been praised for their convenience and berated for their lack of recyclability. As a result, aseptic packaging collection has been linked with that of milk cartons to increase the volume. The intervening years since the introduction of aseptic packaging have seen the drink box industry aggressively trying to create a recycling market for the boxes. Communities and schools have initiated programs, and recycling firms have allocated resources to see whether recycling aseptic packaging can work. Drink boxes are now recycled in 2.3 millionmore » homes in 15 states, and in 1,655 schools in 17 states. They are typically collected in school and curbside programs with other polyethylene coated (laminated) paperboard products such a milk cartons, and then baled and shipped to five major paper companies for recycling at eight facilities.« less
Pressure load on specific body areas of gestating sows lying on rubber mats with different softness.
Schubbert, A; Hartung, E; Schrader, L
2014-08-01
Rubber mats offer a possibility to increase lying comfort for sows with positive effects on sow lying behavior and health. However, until now, no information has been reported about the relationship between the softness of rubber mats and the pressure load on certain body areas of sows. We used a total of 68 (40 multiparous, 28 primiparous) German Landrace × German Landrace sows with a BW within the range of 90 to 330 kg (divided in 3 weight classes) to measure peak force and distribution of pressure during lying in the sternal and half recumbent position. Measures were done in an experimental pen that was equipped with a pressure sensor map system (5400 NTL; Tekscan Inc., Boston, MA). Three rubber mats differing in softness (penetration depth: hard mat, 4.0 mm [HM]; soft mat, 14.6 mm [SM]; very soft mat, 43.0 mm [VSM]) were tested and compared to concrete floor (CF) as a reference. Pressure load was analyzed in the sternal position for the sternum, belly, and ham body regions and also in the half recumbent position for the shoulder. For each lying position we determined the body region with the highest pressure load and analyzed the peak force (PF) and the contact area (CA) using a mixed model ANOVA (MIXED procedure of SAS Enterprise, version 4.3., SAS Inst. Inc., Cary, NC) with floor type, weight class of sows, and their interaction as fixed factors. Overall, the highest values for PF in the sternal position were found on the sternum (median: 1.62 N/cm(2)) and in the half recumbent position on the shoulder (median: 2.72 N/cm(2)). In the sternal position PF on the sternum was lower on VSM compared to CF (P = 0.001). In the half-recumbent position PF on the shoulder was lower on VSM compared to CF (P = 0.013) and compared to HM (P = 0.011). The weight of the sows affected PF on the sternum in the sternal position, with lower values in weight class 1 compared to weight class 2 (P = 0.001) and weight class 3 (P = 0.002). Contact area under the sternum was larger on
Paltoglou, George; Schoina, Maria; Valsamakis, George; Salakos, Nicolaos; Avloniti, Alexandra; Chatzinikolaou, Athanasios; Margeli, Alexandra; Skevaki, Chrysanthi; Papagianni, Maria; Kanaka-Gantenbein, Christina; Papassotiriou, Ioannis; Chrousos, George P; Fatouros, Ioannis G; Mastorakos, George
2017-03-01
and catalase. In all subjects, leptin and adiponectin predict negatively and positively anti-oxidation, respectively, while high sensitivity IL-6 predicts positively and negatively pro- and anti-oxidation, respectively. High-sensitivity C-reactive protein is increased and negatively associated with anti-oxidation in pre-pubertal obese boys, suggesting that childhood obesity is associated with aseptic inflammation and oxidative stress.
Delanois, Ronald E; Gwam, Chukwuweike U; Mohamed, Nequesha; Khlopas, Anton; Chughtai, Morad; Malkani, Arthur L; Mont, Michael A
2017-09-01
We are reporting on the minimum 5-year outcomes of patients who underwent revision total hip arthroplasty (THA) using a specific highly-porous titanium shell. We assessed (1) aseptic and all-cause survivorship; (2) functional outcomes; (3) complications; and (4) radiographic outcomes. Two hospital databases were evaluated for patients who underwent revision THA due to component instability or aseptic loosening using a cementless highly-porous titanium shell between September 2006 and December 2011. This yielded 35 patients who had a mean age of 61 years (range 14-88 years). Patients had a mean follow-up of 6 years (minimum 5 years). All-cause and aseptic survivorship of the shell was calculated. Functional outcomes were assessed using the Harris Hip Score. We determined the incidence of postoperative complications and performed radiographic evaluation of pelvic radiographs from regular office visits. The aseptic survivorship of the acetabular component was 97% (95% confidence interval; 8.1-9.5). The all-cause survivorship of the acetabular component was 91% (95% confidence interval; 7.3-8.1). One patient had an aseptic failure and 2 patients had septic failures. The mean postoperative Harris Hip Score was 76 points (range, 61-91 points). Excluding the aseptic and septic failures, there was no osteolysis or progressive radiolucencies present on radiographic evaluation at final follow-up. At a minimum of 5-year follow-up, the highly-porous titanium acetabular revision shell has excellent survivorship and functional outcomes. Although long-term follow-up is needed to further monitor these implants, the results are promising and demonstrate that this prosthesis may be an excellent option for patients undergoing revision THA. Copyright © 2017 Elsevier Inc. All rights reserved.
Microscopical and functional aspects of calcium-transport and deposition in terrestrial isopods.
Ziegler, Andreas; Fabritius, Helge; Hagedorn, Monica
2005-01-01
Terrestrial isopods (Crustacea) are excellent model organisms to study epithelial calcium-transport and the regulation of biomineralization processes. They molt frequently and resorb cuticular CaCO(3) before the molt to prevent excessive loss of Ca(2+) ions when the old cuticle is shed. The resorbed mineral is stored in CaCO(3) deposits within the ecdysial gap of the first four anterior sternites. After the molt, the deposits are quickly resorbed to mineralise the posterior part of the new cuticle. The deposits contain numerous small spherules composed of an organic matrix and amorphous CaCO(3), which has a high solubility and, therefore, facilitates quick mobilization of Ca(2+) and HCO(3)(-) ions. During the formation and resorption of the deposits large amounts of Ca(2+), HCO(3)(-) and H(+) are transported across the anterior sternal epithelial cells. Within the last years, various light and electron microscopical techniques have been used to characterize the CaCO(3) deposits and the cellular mechanisms involved in biomineralization. The work on the CaCO(3) deposits includes studies on the ultrastructure of the deposits, the sequence of events during deposit formation and dissolution, and the mineral composition of the sternal deposits. The differentiation of the anterior sternal epithelial cells and the mechanisms of epithelial ion transport required for the mineralization and demineralisation of the deposits was studied using various analytical light and electron microscopical techniques including polarized light microscopy, immunocytochemistry, electron microprobe analysis, electron energy loss spectroscopy and electron spectroscopic imaging. Comparative analysis of deposit morphology and the differentiation of the sternal epithelia provide information on the evolution of CaCO(3) deposit formation in relation to the degree of adaptation to terrestrial environments.
Clips versus suture technique: is there a difference?
Chughtai, T; Chen, L Q; Salasidis, G; Nguyen, D; Tchervenkov, C; Morin, J F
2000-11-01
Coronary artery bypass grafting (CABG) is one of the most common procedures performed today, and wound complications are a major source of morbidity and cost. To determine whether there is any difference in wound outcome (including cost in a Canadian context) between a subcuticular suture technique and skin stapling technique for closure of sternal and leg incisions in CABG patients. One hundred and sixty-two patients undergoing CABG were prospectively, randomly placed to have their sternal and leg incisions closed with either a subcuticular suture technique or with a skin clip. Data were obtained through chart review, in-hospital assessments and follow-up visits. Nonblinded assessments were made regarding wound leakage, inflammation, infection, necrosis, swelling, dehiscence and cosmesis. Each of the parameters was graded on a scale from 1 to 4. The cost was evaluated in Canadian dollars. There were trends toward increased rates of in-hospital sternal (P=0.09) and leg (P=0.17) incision inflammation when the wounds were closed with skin clips. There was a significantly greater (P=0.05) rate of sternal wound infection with clips, as well as a tendency (P=0.15) toward a greater rate of mediastinitis at follow-up assessment. Cosmetic outcome was similar for both groups. The cost incurred was significantly greater when skin clips were used for closure. There was a greater than threefold difference, which translates to a greater than $10,000 difference over one year. Closure with a subcuticular technique achieves better outcomes than the use of skin clips. When factoring in the increased cost incurred by using clips, as well as other intangible factors such as surgical skill acquisition, subcuticular suture closure appears to be a favourable method of wound closure in CABG patients compared with the use of skin stapling techniques.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davis, J.C.; Reiss, R.J.; Rica, A.F.
There is disclosed an aseptic flexible walled container having a rigid fitment member cooperative with an aseptic filling apparatus and including a neck, outer flanges surrounding the neck, a frangible membrane and an outer end rim receptive of an hermetically sealed lid. The neck is formed with an internal chamferred seating shoulder for fluid-tight engagement with a fill tube. One outer flange cooperates with clamping jaws of the aseptic filling apparatus for detachably sealing the fitment to a sterilizing chamber and placing it in position for insertion of the filling tube which ruptures the membrane and permits the aseptic introductionmore » of product to the container's interior. The other outer flange is secured to an opening in a wall of the flexible container. The joined fitment and container are presterilized prior to filling. Selected materials for the multi-ply container walls and the fitment permit the container to withstand gamma ray and other sterilization treatment, heat and pressure while maintaining required strength. After the container is aseptically filled, such as with flowable food product, the fill tube is withdrawn and a lid is hermetically sealed onto the rim of the fitment. A heat shield adjacent a container wall surrounds the fitment to protect the container from excessive heat generated by the associated filling apparatus during filling.« less
Iliac crest tap; Sternal tap; Leukemia - bone marrow aspiration; Aplastic anemia - bone marrow aspiration; Myelodysplastic syndrome - bone marrow aspiration; Thrombocytopenia - bone marrow aspiration; Myelofibrosis - bone marrow aspiration
Calvert, George T; Cummings, Judd E; Bowles, Austin J; Jones, Kevin B; Wurtz, L Daniel; Randall, R Lor
2014-03-01
Aseptic failure of massive endoprostheses used in the reconstruction of major skeletal defects remains a major clinical problem. Fixation using compressive osseointegration was developed as an alternative to cemented and traditional press-fit fixation in an effort to decrease aseptic failure rates. The purpose of this study was to answer the following questions: (1) What is the survivorship of this technique at minimum 2-year followup? (2) Were patient demographic variables (age, sex) or anatomic location associated with implant failure? (3) Were there any prosthesis-related variables (eg, spindle size) associated with failure? (4) Was there a discernible learning curve associated with the use of the new device as defined by a difference in failure rate early in the series versus later on? The first 50 cases using compressive osseointegration fixation from two tertiary referral centers were retrospectively studied. Rates of component removal for any reason and for aseptic failure were calculated. Demographic, surgical, and oncologic factors were analyzed using regression analysis to assess for association with implant failure. Minimum followup was 2 years with a mean of 66 months. Median age at the time of surgery was 14.5 years. A total of 15 (30%) implants were removed for any reason. Of these revisions, seven (14%) were the result of aseptic failure. Five of the seven aseptic failures occurred at less than 1 year (average, 8.3 months), and none occurred beyond 17 months. With the limited numbers available, no demographic, surgical, or prosthesis-related factors correlated with failure. Most aseptic failures of compressive osseointegration occurred early. Longer followup is needed to determine if this technique is superior to other forms of fixation.
[Possibilities of follow-up imaging after implantation of a carbon fiber-reinforced hip prosthesis].
Krüger, T; Alter, C; Reichel, H; Birke, A; Hein, W; Spielmann, R P
1998-03-01
There are many problems in the radiological diagnosis of aseptic loosening in total hip arthroplasty. Computed tomography (CT) and magnetic resonance tomography (MRT) are not usable for metallic implants (stainless steel, cobalt alloy, titanium alloy). From April 1993 to December 1993 15 CFRP non-cemented hip prostheses have been implanted. In a prospective clinical study plane radiographs, CT and MRT have been analysed. Three stems were revised (1 femoral fracture, 1 severe thigh pain, 1 aseptic loosening). CFRP are not visible in plane radiographs. There was a complete (two-third of the cases) or nearly complete (one-third of the cases) small sclerotic interface between the prosthesis and the bone, these were apparent in CT and MRT in stable implant cases and did not have any clinical correlations. The small sclerotic interface is quite different in comparison to so called "Reactive Lines". In one case of aseptic loosening there was an interposition of soft tissue between prosthesis and bone in MRT and CT. CFRP inaugurates new diagnostic possibilities in aseptic loosening of hip prosthesis and in tumour surgery too.
Delgado, Denise Aparecida; de Souza Sant'ana, Anderson; de Massaguer, Pilar Rodriguez
2012-07-01
This study aimed at enumerating molds (heat-labile and heat-resistant) on the surface of paperboard material to be filled with tomato pulps through an aseptic system and at determining the most heat- and hydrogen peroxide-resistant strains. A total of 118 samples of laminated paperboard before filling were collected, being 68 before and 50 after the hydrogen peroxide bath. Seven molds, including heat-resistant strains (Penicillium variotii and Talaromyces flavus) with counts ranging between 0.71 and 1.02 CFU/cm(2) were isolated. P. variotii was more resistant to hydrogen peroxide than T. flavus and was inactivated after heating at 85 °C/15 min. When exposed to 35 % hydrogen peroxide at 25 °C, T. flavus (F5E2) and N. fischeri (control) were less resistant than P. variotti (F1A1). P. citrinum (F7E2) was shown to be as resistant as P. variotti. The D values (the time to cause one logarithmic cycle reduction in a microbial population at a determined temperature) for spores of P. variotii (F1A1) and N. fischeri (control) with 4 months of age at 85 and 90 °C were 3.9 and 4.5 min, respectively. Although the contamination of packages was low, the presence of heat- and chemical-resistant molds may be of concern for package sterility and product stability during shelf-life. To our knowledge, this is the first report that focuses on the isolation of molds, including heat-resistant ones, contaminating paperboard packaging material and on estimating their resistance to the chemical and physical processes used for packaging sterilization.
Is there a role for robotic totally endoscopic coronary artery bypass in patients with a colostomy?
Gibber, Marc; Lehr, Eric J; Kon, Zachary N; Wehman, P Brody; Griffith, Bartley P; Bonatti, Johannes
2014-01-01
Preoperative colostomy presents a significant risk of sternal wound complications, mediastinitis, and ostomy injury in patients requiring coronary artery bypass grafting. Less invasive procedures in coronary surgery have a potential to reduce the risk of sternal wound healing problems. Robotic totally endoscopic coronary artery bypass grafting in patients with a colostomy has not been reported. We describe a case of completely endoscopic coronary surgery using the da Vinci Si system in a patient with a transverse colostomy. Single left internal mammary artery grafting to the left anterior coronary artery was performed successfully on the beating heart. We regard this technique as the least invasive method of surgical coronary revascularization with a potential to reduce the risk of surgical site infection and mediastinitis in patients with a colostomy.
2009-01-01
Deep sternal infections, also known as poststernotomy mediastinitis, are a rare but often fatal complication in cardiac surgery. They are a cause of increased morbidity and mortality and have a significant socioeconomic aspect concerning the health system. Negative pressure wound therapy (NPWT) followed by muscular pectoralis plasty is a quite new technique for the treatment of mediastinitis after sternotomy. Although it could be demonstrated that this technique is at least as safe and reliable as other techniques for the therapy of deep sternal infections, complications are not absent. We report about our experiences and complications using this therapy in a set of 54 patients out of 3668 patients undergoing cardiac surgery in our institution between January 2005 and April 2007. PMID:19138422
Ennker, Ina C; Malkoc, Anita; Pietrowski, Detlef; Vogt, Peter M; Ennker, Juergen; Albert, Alexander
2009-01-12
Deep sternal infections, also known as poststernotomy mediastinitis, are a rare but often fatal complication in cardiac surgery. They are a cause of increased morbidity and mortality and have a significant socioeconomic aspect concerning the health system. Negative pressure wound therapy (NPWT) followed by muscular pectoralis plasty is a quite new technique for the treatment of mediastinitis after sternotomy. Although it could be demonstrated that this technique is at least as safe and reliable as other techniques for the therapy of deep sternal infections, complications are not absent. We report about our experiences and complications using this therapy in a set of 54 patients out of 3668 patients undergoing cardiac surgery in our institution between January 2005 and April 2007.
Sinha, Priyank; Lee, Ming-Te; Panbehchi, Sasan; Saxena, Ankur; Pal, Debasish
2017-01-01
This case report describes a patient who presented with myelopathy secondary to a large retro-odontoid post traumatic cicatrix. The objective of this study was to discuss the clinical presentation, pathogenesis, imaging, and surgical management of pseudoarthrosis tissue mass associated with odontoid nonunion. Atlantoaxial subluxation (AAS) has been widely reported in patients with rheumatoid arthritis. AAS leads to repeated cycles of partial tear and repair of ligaments around the altantoaxial complex, resulting in the formation of periodontoid mass (pseudotumor). It is thought that formation of retro-odontoid post traumatic mass (cicatrix), in certain cases of odontoid fracture, is because of similar pathology. This is a retrospective review of case note. Here, the patient underwent posterior decompression through a C1-C2 laminectomy and occipitocervical (C0-C4) fusion with instrumentation, which resulted in dramatic improvement in his symptoms and spontaneous regression of retro-odontoid post traumatic cicatrix. We have described an interesting and a rare case of a large pseudoarthrosis tissue mass associated with odontoid nonunion, which regressed following stand-alone posterior instrumentation. To the best of our knowledge, only a handful of such cases of spontaneous regression of retro-odontoid post traumatic cicatrix following occipitocervical fixation have been described in literature, and our case adds to the growing list of such cases and may help in understanding the natural history of the disease process one day. Although rare, post traumatic cicatrix should be considered as a differential diagnosis of enhancing retro-odontoid mass, especially if there is any history of cervical spine trauma.
A biomechanical comparison of three sternotomy closure techniques.
Cohen, David J; Griffin, Lanny V
2002-02-01
A biomechanical study of three sternotomy closure techniques (figure-of-eight stainless-steel wires, Pectofix Dynamic Sternal Fixation [DSF] stainless-steel plates, and figure-of-eight stainless-steel cables) was conducted to compare strength and stiffness variables in three clinically relevant loading modes (anterior-posterior shear, longitudinal shear, and lateral distraction). All tests were conducted on polyurethane foam sternal models that simulate the properties of cancellous bone. Each model was divided longitudinally and reconstructed using one of the sternotomy closure repair techniques. Tests were performed using a materials testing system that applies a continuously increasing amount of force in one direction to the model until it catastrophically breaks. A total of six trials of each fixation type in each of three test groups were prepared and tested, for a total of 54 tests. Strength and stiffness variables as well as a post-yield analysis of failure were evaluated. Sternums repaired using the DSF plate system are a more rigid construct than sternums repaired using the stainless-steel wires or cables in the distraction and transverse shear modes and they are not significantly different from sternums repaired with wires or cables in the longitudinal shear mode. The DSF plate system offers a 25% improvement in resistance to failure (yield) compared to wires when a transverse shear force is applied to the model. The cable system had a higher resistance to failure than the wires in all modes although the differences were not statistically significant. Additionally, the DSF plate system provides substantial reduction of the implant's cutting into the sternal model under loading as evidenced by the post-yield displacement when compared with either cables or wires for the distraction and longitudinal shear modes. For the transverse shear mode, the cables or wires would completely fail at the load for which cutting begins for the DSF. Both the DSF plate system
Exploratory Development of an Ultrafast-Curing Wound Dressing
1988-11-30
removed at will. 0 Control water vapor and oxygen exchange, thus maintaining a moist environment for rapid healing. * Gradually deliver broad-spectrum...removal without precipitating another bjeeding episode, (c) promotion of normal wound healing under moist , aseptic environment, and (d) prevention of...conditions, the field dressing is capable of maintaining the wound moist , but aseptic. And, as explained in the following paragraphs, it is ncm
van der Voort, Paul; Pijls, Bart G; Nieuwenhuijse, Marc J; Jasper, Jorrit; Fiocco, Marta; Plevier, Josepha W M; Middeldorp, Saskia; Valstar, Edward R; Nelissen, Rob G H H
2015-01-01
Few studies have addressed the association between early migration of femoral stems and late aseptic revision in total hip arthroplasty. We performed a meta-regression analysis on 2 parallel systematic reviews and meta-analyses to determine the association between early migration and late aseptic revision of femoral stems. Of the 2 reviews, one covered early migration data obtained from radiostereometric analysis (RSA) studies and the other covered long-term aseptic revision rates obtained from survival studies with endpoint revision for aseptic loosening. Stems were stratified according to the design concept: cemented shape-closed, cemented force-closed, and uncemented. A weighted regression model was used to assess the association between early migration and late aseptic revision, and to correct for confounders. Thresholds for acceptable and unacceptable migration were determined in accordance with the national joint registries (≤ 5% revision at 10 years) and the NICE criteria (≤ 10% revision at 10 years). 24 studies (731 stems) were included in the RSA review and 56 studies (20,599 stems) were included in the survival analysis review. Combining both reviews for the 3 design concepts showed that for every 0.1-mm increase in 2-year subsidence, as measured with RSA, there was a 4% increase in revision rate for the shape-closed stem designs. This association remained after correction for age, sex, diagnosis, hospital type, continent, and study quality. The threshold for acceptable migration of shape-closed designs was defined at 0.15 mm; stems subsiding less than 0.15 mm in 2 years had revision rates of less than 5% at 10 years, while stems exceeding 0.15 mm subsidence had revision rates of more than 5%. There was a clinically relevant association between early subsidence of shape-closed femoral stems and late revision for aseptic loosening. This association can be used to assess the safety of shape-closed stem designs. The published research is not sufficient
PHACES syndrome associated with carcinoid endobronchial tumor.
Mama, Nadia; H'mida, Dorra; Lahmar, Imen; Yacoubi, Mohamed Tahar; Tlili-Graiess, Kalthoum
2014-05-01
PHACES syndrome consists of the constellation of manifestations including posterior fossa anomalies of the brain (most commonly Dandy-Walker malformations), hemangiomas of the face and scalp, arterial abnormalities, cardiac defects, eye anomalies and sternal defects. We present a case with a possible PHACES syndrome including sternal cleft and supraumbilical raphé, precordial skin tag, persistent left superior vena cava and subtle narrowing of the aorta with an endobronchial carcinoid tumor. All these anomalies were discovered on chest multi-detector CT. This is a unique case of PHACES syndrome associated with carcinoid tumor. Review of the literature revealed 3 cases of PHACES syndrome with glial tumor. The authors tried to find the relationship between PHACES syndrome and carcinoid tumors or gliomas, which all derive from the neural crest cells.
Hubbard, Aaron; Reodl, Thomas; Hui, Ada; Knueppel, Stephanie; Eppler, Kirk; Lehnert, Siegfried; Maa, Yuh-Fun
2018-03-15
A monoclonal antibody drug product (DP) manufacturing process was transferred to a different production site, where aseptic filling took place within an isolator that was sanitized using vapor phase hydrogen peroxide (VPHP). A quality-by-design approach was applied for study design to understand the impact of VPHP uptake in the isolator on DP quality. A combination of small-scale and manufacturing-scale studies was performed to evaluate the sensitivity of the monoclonal antibody to hydrogen peroxide (H2O2) as well as VPHP uptake mechanisms during the filling process. The acceptable H2O2 level was determined to be 100 ng/mL for the antibody in the H2O2 spiking study; protein oxidation was observed above this threshold. The most prominent sources of VPHP uptake were identified to be via the silicone tubing assembly (associated with the peristaltic pumps) and open, filled vials. Silicone tubing, an effective depot to H2O2, could absorb VPHP during different stages of the filling process and discharge H2O2 into the DP solution during filling interruptions. A small-scale isolator model, established to simulate manufacturing-scale conditions, was a useful tool in understanding H2O2 uptake in relation to tubing dimensions and VPHP concentration in the isolator air (or atmosphere). Although the tubing assembly had absorbed a substantial amount of VPHP during the decontamination phase, the majority of H2O2 could be removed during tubing cleaning and sterilization in the subsequent isolator aeration phase, demonstrating that H2O2 in the DP solution is taken up primarily via atmospheric VPHP residues in the isolator during filling. Picarro sensor monitoring suggested that the validated VPHP aeration process generates reproducible residual VPHP profiles in isolator air, thus allowing small-scale studies to provide more relevant recommendations on tubing size and interruption time limits for commercial manufacturing. The recommended process parameters were demonstrated to be
Dysbaric Osteonecrosis in Divers. 1. A Survey of 611 Selected U. S. Navy Divers
1976-02-24
ed., Academic Press, New York, 1971, pp 251- 262. 10 7. Asahi, S. H. Ohiwa, and I. Nashimoto, " Avascular Bone Necrosis in Japanese Diving...bone necrosis has been confirmed. 4>5 The confirmation of aseptic bone necrosis in Caisson workers prompted several studies of divers to determine...de- scribe the radiological observations of bone density and structure variations which appear to be aseptic bone necrosis occurring in
Cundell, A M; Bean, R; Massimore, L; Maier, C
1998-01-01
To determine the relationship between the sampling time of the environmental monitoring, i.e., viable counts, in aseptic filling areas and the microbial count and frequency of alerts for air, surface and personnel microbial monitoring, statistical analyses were conducted on 1) the frequency of alerts versus the time of day for routine environmental sampling conducted in calendar year 1994, and 2) environmental monitoring data collected at 30-minute intervals during routine aseptic filling operations over two separate days in four different clean rooms with multiple shifts and equipment set-ups at a parenteral manufacturing facility. Statistical analyses showed, except for one floor location that had significantly higher number of counts but no alert or action level samplings in the first two hours of operation, there was no relationship between the number of counts and the time of sampling. Further studies over a 30-day period at the floor location showed no relationship between time of sampling and microbial counts. The conclusion reached in the study was that there is no worst case time for environmental monitoring at that facility and that sampling any time during the aseptic filling operation will give a satisfactory measure of the microbial cleanliness in the clean room during the set-up and aseptic filling operation.
Clinical experience of repair of pectus excavatum and carinatum deformities.
Oncel, Murat; Tezcan, Bekir; Akyol, Kazim Gurol; Dereli, Yüksel; Sunam, Güven Sadi
2013-09-01
We present the results of surgical correction of pectus excavatum (PE) and pectus carinatum (PC) deformities in adults, and also report a new method of sternal support used in surgery for PE deformities. We present the results of 77 patients between the ages of 10 and 29 years (mean 17) with PE (n = 46) or PC (n = 31) deformities undergoing corrective surgery from 2004 to 2011, using the Ravitch repair method. Symptoms of the patients included chest pain (15%) and tachycardia (8%). Three patients underwent repair of recurrent surgical conditions. All of the patients with dyspnoea with exercise experienced marked improvement at five months post operation. Complications included pneumothorax in 5.1% (n = 4), haemothorax in 2.6% (n = 2), chest discomfort in 57% (n = 44), pleural effusion in 2.6% (n = 2), and sternal hypertrophic scar in 27% (n = 21) of patients. Mean hospitalisation was eight days. Pain was mild and intravenous analgesics were used for a mean of four days. There were no deaths. Results after surgical correction were very good or excellent in 62 patients (80%) at a mean follow up of three years. Three patients had recurrent PE and were repaired with the Nuss procedure. In three patients who underwent the Ravitch procedure, a stainless steel bar was used for sternal support instead of Kirschner wire. Pectus deformities may be repaired with no mortality, low morbidity, very good cosmetic results and improvement in cardiological and respiratory symptoms.
Does incineration turn infectious waste aseptic?
Kanemitsu, K; Inden, K; Kunishima, H; Ueno, K; Hatta, M; Gunji, Y; Watanabe, I; Kaku, M
2005-08-01
Incineration of infectious waste is considered to be biologically safe. We performed basic experiments to confirm that bacillus spores are killed by incineration in a muffle furnace. Biological samples containing 10(6) spores of Bacillus stearothermophilus were placed in stainless steel Petri dishes and then into hot furnaces. The furnace temperature and duration of incineration were 300 degrees C for 15 min, 300 degrees C for 30 min, 500 degrees C for 15 min, 500 degrees C for 30 min and 1100 degrees C for 3 min. We confirmed that all spores of B. stearothermophilus were killed at each of these settings. The effect of incineration seems to be equivalent to that of sterilization, based on the satisfactory sterilization assurance level of 10(-6).
Nambiar, Mithun; Yang, Yi; Liew, Susan; Turner, Peter L; Torode, Ian P
2016-10-01
Single or dual-rod instrumentation can be used for the anterior fixation of the spine in adolescent idiopathic scoliosis (AIS). We aim to compare the complications, radiographic and functional outcomes of patients with AIS who have undergone single and dual-rod instrumentation. This is a multi-centre study involving the Royal Children's, Royal Melbourne and Epworth hospitals. Three primary surgeons were involved to ensure homogeneity of surgical technique and implants. Patients with AIS and thoracolumbar curves (Lenke 5 and 6) undergoing anterior instrumentation from 1st January 2000 to 30th June 2013 were included. Radiographic data were collected from X-rays. The functional outcome was measured through the Scoliosis Research Society questionnaire (SRS-30). The study included 58 patients (38 single-rod and 20 dual-rod patients). Thirty-nine patients were classified with Lenke 5 curves, while 19 patients had Lenke 6 curves. Structural interbody supports were used in 95 % of cases. In the preoperative to postoperative period, patients with single rods had an improvement of 75 and 51 % for primary and secondary curves, respectively, while patients with dual rods had an improvement of 70 and 38 % for primary and secondary curves, respectively. There were no cases of pseudoarthrosis or metalware failure in either group. Two patients (one single-rod and one dual-rod patient) required further unplanned posterior fusion. 91 % of patients were satisfied with the results of their back management. Pseudoarthrosis and metalware failure are rare complications of anterior instrumentation. Our study found no significant difference in functional or radiographic outcome between single and dual-rod instrumentation. Level III.
Fithian, Donald C
2018-05-01
Bipartite patella is an uncommon but potentially troublesome problem for young athletes. Numerous uncontrolled retrospective studies have reported good results after various treatments. What is needed are studies that will guide workup and support treatment decisions based on the condition of the cartilage surfaces of the fragment, presence of pseudoarthrosis, and size and location of the fragment. To support decisions, we need prospective comparative studies, either randomized or, at least, prospective cohort studies that identify patients at the time of presentation, document key decision points, and follow patients to successful resolution of symptoms. Copyright © 2018 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
A reappraisal of adult thoracic surface anatomy.
Mirjalili, S Ali; Hale, Samuel J M; Buckenham, Tim; Wilson, Ben; Stringer, Mark D
2012-10-01
Accurate surface anatomy is essential for safe clinical practice. Numerous inconsistencies in clinically important surface markings exist between and within anatomical reference texts. The aim of this study was to investigate key thoracic surface anatomical landmarks in vivo using computed tomographic (CT) imaging. High-resolution thoracic CT scans from 153 supine adults (mean age 63, range 19-89 years; 53% female) taken at end tidal inspiration were analyzed by dual consensus reporting to determine the surface anatomy of the sternal angle, central veins, heart, lungs, and diaphragm. Patients with kyphosis/scoliosis, distorting space-occupying lesions, or visceromegaly were excluded. The position of the cardiac apex, formation of the brachiocephalic veins, and vertebral levels of the sternal angle, xiphisternal joint, and aortic hiatus were consistent with commonly accepted surface markings although there was a wide range of normal variation. In contrast, common surface markings were markedly inaccurate for the following: the position of the tracheal bifurcation, aortic arch, and azygos vein termination (below the plane of the sternal angle at T5-T6 vertebral level in most individuals); the superior vena cava/right atrial junction (most often behind the fourth costal cartilage); the lower border of the lung (adjacent to T12 vertebra posteriorly); and the level at which the inferior vena cava and esophagus traverse the diaphragm (T11 in most). Surface anatomy must be reappraised using modern imaging in vivo if it is to be evidence based and fit for purpose. The effects of gender, age, posture, respiration, build, and ethnicity also deserve greater emphasis. Copyright © 2012 Wiley Periodicals, Inc.
Tickle, Peter G.; Lean, Samantha C.; Rose, Kayleigh A. R.; Wadugodapitiya, Avanti P.; Codd, Jonathan R.
2013-01-01
Summary The application of artificial loads to mammals and birds has been used to provide insight into the mechanics and energetic cost of terrestrial locomotion. However, only two species of bird have previously been used in loading experiments, the cursorial guinea fowl (Numida meleagris) and the locomotor-generalist barnacle goose (Branta leucopsis). Here, using respirometry and treadmill locomotion, we investigate the energetic cost of carrying trunk loads in a diving bird, the tufted duck (Aythya fuligula). Attachment of back loads equivalent to 10% and 20% of body mass increased the metabolic rate during locomotion (7.94% and 15.92%, respectively) while sternal loads of 5% and 10% had a greater proportional effect than the back loads (metabolic rate increased by 7.19% and 13.99%, respectively). No effect on locomotor kinematics was detected during any load carrying experiments. These results concur with previous reports of load carrying economy in birds, in that there is a less than proportional relationship between increasing load and metabolic rate (found previously in guinea fowl), while application of sternal loads causes an approximate doubling of metabolic rate compared to back loads (reported in an earlier study of barnacle geese). The increase in cost when carrying sternal loads may result from having to move this extra mass dorso-ventrally during respiration. Disparity in load carrying economy between species may arise from anatomical and physiological adaptations to different forms of locomotion, such as the varying uncinate process morphology and hindlimb tendon development in goose, guinea fowl and duck. PMID:24244861
Estimation of optimal nasotracheal tube depth in adult patients.
Ji, Sung-Mi
2017-12-01
The aim of this study was to estimate the optimal depth of nasotracheal tube placement. We enrolled 110 patients scheduled to undergo oral and maxillofacial surgery, requiring nasotracheal intubation. After intubation, the depth of tube insertion was measured. The neck circumference and distances from nares to tragus, tragus to angle of the mandible, and angle of the mandible to sternal notch were measured. To estimate optimal tube depth, correlation and regression analyses were performed using clinical and anthropometric parameters. The mean tube depth was 28.9 ± 1.3 cm in men (n = 62), and 26.6 ± 1.5 cm in women (n = 48). Tube depth significantly correlated with height (r = 0.735, P < 0.001). Distances from nares to tragus, tragus to angle of the mandible, and angle of the mandible to sternal notch correlated with depth of the endotracheal tube (r = 0.363, r = 0.362, and r = 0.546, P < 0.05). The tube depth also correlated with the sum of these distances (r = 0.646, P < 0.001). We devised the following formula for estimating tube depth: 19.856 + 0.267 × sum of the three distances (R 2 = 0.432, P < 0.001). The optimal tube depth for nasotracheally intubated adult patients correlated with height and sum of the distances from nares to tragus, tragus to angle of the mandible, and angle of the mandible to sternal notch. The proposed equation would be a useful guide to determine optimal nasotracheal tube placement.
Sex-pairing pheromone of Ancistrotermes dimorphus (Isoptera: Macrotermitinae).
Wen, Ping; Mo, Jianchu; Lu, Chunwen; Tan, Ken; Šobotník, Jan; Sillam-Dussès, David
2015-12-01
Ancistrotermes dimorphus is a common Macrotermitinae representative, facultative inquiline by its life-style, occurring in South-East China. Sex pheromone is used for couple formation and maintenance, and it is produced by and released from the female sternal gland and is highly attractive to males. Based on our combined behavioral, chemical and electrophysiological analyses, we identified (3Z,6Z)-dodeca-3,6-dien-1-ol as the female sex pheromone of A. dimorphus as it evoked the tandem behavior at short distance, and the active quantities ranged from 0.01ng to 10ng. Interestingly, GC-MS analyses of SPME extracts showed another compound specific to the female sternal gland, (3Z)-dodec-3-en-1-ol, which showed a clear GC-EAD response. However, this compound has no behavioral function in natural concentrations (0.1ng), while higher amounts (1ng) inhibit the attraction achieved by (3Z,6Z)-dodeca-3,6-dien-1-ol. The function of (3Z)-dodec-3-en-1-ol is not fully understood, but might be linked to recognition from sympatric species using the same major compound, enhancing the long-distance attraction, or informing about presence of other colonies using the compound as a trail-following pheromone. The sternal gland secretion of Ancistrotermes females contains additional candidate compounds, namely (3E,6Z)-dodeca-3,6-dien-1-ol and (6Z)-dodec-6-en-1-ol, which are not perceived by males' antennae in biologically relevant amounts. Copyright © 2015 Elsevier Ltd. All rights reserved.
Long-term trend of bone development in the contemporary teenagers of Chinese Han nationality.
Wang, Ya-Hui; Ying, Chong-Liang; Wan, Lei; Zhu, Guang-You
2012-08-01
To further improve the accuracy of bone age identification using the time of secondary ossification center appearance and epiphyseal fusion of 7 joints to estimate the age of living individuals. DR films were taken from 7 parts including sternal end of clavical and the left side of shoulder, elbow, carpal, hip, knee and ankle joints of 1 709 individuals who came from eastern China, central China and southern China, whose ages were between 11.0 and 20.0 years. From those 7 joints 24 osteal loci were selected as bone age indexes, which could better reflect age growth of teenagers. The characteristics of secondary ossification center appearance and epiphyseal fusion were observed, and the mean and age range of secondary ossification center appearance and epiphyseal fusion were calculated. The fusion time of the 24 epiphyses were advanced at different degrees, the most obvious epiphyses the sternal end of clavicle, scapular acromial end, distal end of the radius, distal end of the ulna, iliac crest, ischial tuberosity, the upper and lower end of tibia and fibula. The appearance time of sternal end of clavicle, scapular acromial end, iliac crest and ischial tuberosity epiphyses were all found to be after the age of 12, and the female's age, approximately 1 year ahead of schedule in comparison with the male's. The relevant forensic information and data for bone age identification should be updated every 10-15 years so as to provide accurate and objective evidence for court testimony, conviction and sentencing.
Packaging's Contribution for the Effectiveness of the Space Station's Food Service Operation
NASA Technical Reports Server (NTRS)
Rausch, B. A.
1985-01-01
Storage limitations will have a major effect on space station food service. For example: foods with low bulk density such as ice cream, bread, cake, standard type potato chips and other low density snacks, flaked cereals, etc., will exacerbate the problem of space limitations; package containers are inherently volume consuming and refuse creating; and the useful observation that the optimum package is no package at all leads to the tentative conclusion that the least amount of packaging per unit of food, consistent with storage, aesthetics, preservation, cleanliness, cost and disposal criteria, is the most practical food package for the space station. A series of trade offs may have to be made to arrive at the most appropriate package design for a particular type of food taking all the criteria into account. Some of these trade offs are: single serve vs. bulk; conventional oven vs. microwave oven; nonmetallic aseptically vs. non-aseptically packaged foods; and comparison of aseptic vs. nonaseptic food packages. The advantages and disadvantages are discussed.
Design Considerations of a Compounded Sterile Preparations Course
Petraglia, Christine; Mattison, Melissa J.
2016-01-01
Objective. To design a comprehensive learning and assessment environment for the practical application of compounded sterile preparations using a constructivist approach. Design. Compounded Sterile Preparations Laboratory is a required 1-credit course that builds upon the themes of training aseptic technique typically used in health system settings and threads application of concepts from other courses in the curriculum. Students used critical-thinking skills to devise appropriate strategies to compound sterile preparations. Assessment. Aseptic technique skills were assessed with objective, structured, checklist-based rubrics. Most students successfully completed practical assessments using appropriate technique (mean assessment grade=83.2%). Almost all students passed the practical media fill (98%) and gloved fingertip sampling (86%) tests on the first attempt; all passed on the second attempt. Conclusion. Employing a constructivist scaffold approach to teaching proper hygiene and aseptic technique prepared students to pass media fill and gloved fingertip tests and to perform well on practical compounding assessments. PMID:26941438
Wearable Oximetry for Harsh Environments
characterize the types and significance of motion artifacts that will need to be mitigated. The forehead was confirmed to be an excellent site with...respect to signal quality, but signal corruption from changes in contact pressure will need to be mitigated. The sternal locations are initially assessed
van Wingerden, Jan J; Ubbink, Dirk T; van der Horst, Chantal M A M; de Mol, Bas A J M
2014-11-23
Early recognition and, where possible, avoidance of risk factors that contribute to the development of poststernotomy mediastinitis (PSM) form the basis for successful prevention. Once the presence of PSM is diagnosed, the known risk factors have been shown to have limited influence on management decisions. Evidence-based knowledge on treatment decisions, which include the extent and type of surgical intervention (other than debridement), timing and others is available but has not yet been incorporated into a classification on management decisions regarding PSM. Ours is a first attempt at developing a classification system for management of PSM, taking the various evidence-based reconstructive options into consideration. The classification is simple to introduce (there are four Types) and relies on the careful establishment of two variables (sternal stability and sternal bone viability and stock) prior to deciding on the best available reconstructive option. It should allow better insight into why treatment decisions fail or have to be altered and will allow better comparison of treatment outcomes between various institutions.
Chailler, Myrianne; Ellis, Jacqueline; Stolarik, Anne; Woodend, Kirsten
2010-01-01
Coughing has been identified as the most painful experience post cardiac surgery. Participants (n = 32), in a randomized crossover trial, applied a frozen gel pack to their sternal incision dressing before performing deep breathing and coughing (DB & C) exercises. Pain scores from 0 to 10 at rest were compared with pain scores post DB & C with and without the gel pack. Participants were also asked to describe their sensations with the frozen gel pack, as well as their preferences for gel pack application. The repeated measures analysis of variance revealed a significant reduction in pain scores between pre- and post-application of the gel pack (F = 28.69, p < .001). There were 22 (69%) participants who preferred the application of the gel pack compared with no gel pack. All 32 (100%) participants would reapply the gel pack in the future. This study demonstrates that cold therapy can be used to manage sternal incisional pain when DB & C.
Tuberculous osteomyelitis/arthritis of the first costo-clavicular joint and sternum
Patel, Prasan; Gray, Robin R
2014-01-01
A young Somali immigrant presents with a two-year history of a large, firm, painful right anterolateral chest wall sternal mass. The patient denied any history of trauma or infection at the site and did not have a fever, erythematous lesion at the site, clubbing, or lymphadenopathy. A lateral chest radiograph demonstrated a low density mass isolated to the subcutaneous soft tissue overlying the sternum, ribs and clavicle. Computed tomography (CT) with contrast demonstrated a cystic lesion in the right anterolateral chest wall deep to the pectoralis muscle. Enhanced CT of the chest demonstrated sclerosis and destruction of the rib and costochondral joint and manubrio-sternal joint narrowing. Ultrasound-guided biopsy and aspiration returned 500 cc of purulent, cloudy yellow, foul-smelling fluid. Acid-fact bacilli stain and the nucleic acid amplification test identified and confirmed Mycobacterium tuberculosis. A diagnosis of tuberculous osteomyelitis/septic arthritis was made and antibiotic coverage for tuberculosis was initiated. PMID:25550999
Tuberculous osteomyelitis/arthritis of the first costo-clavicular joint and sternum.
Patel, Prasan; Gray, Robin R
2014-12-28
A young Somali immigrant presents with a two-year history of a large, firm, painful right anterolateral chest wall sternal mass. The patient denied any history of trauma or infection at the site and did not have a fever, erythematous lesion at the site, clubbing, or lymphadenopathy. A lateral chest radiograph demonstrated a low density mass isolated to the subcutaneous soft tissue overlying the sternum, ribs and clavicle. Computed tomography (CT) with contrast demonstrated a cystic lesion in the right anterolateral chest wall deep to the pectoralis muscle. Enhanced CT of the chest demonstrated sclerosis and destruction of the rib and costochondral joint and manubrio-sternal joint narrowing. Ultrasound-guided biopsy and aspiration returned 500 cc of purulent, cloudy yellow, foul-smelling fluid. Acid-fact bacilli stain and the nucleic acid amplification test identified and confirmed Mycobacterium tuberculosis. A diagnosis of tuberculous osteomyelitis/septic arthritis was made and antibiotic coverage for tuberculosis was initiated.
Hall, P; Traniello, J F
1985-11-01
The monocyclic 14-membered ring diterpene, cembrene-A, previously identified as a nasutitermitine trail pheromone, was tested for its effectiveness as a trail pheromone inNasutitermes costalis. Artificial trails prepared from serial dilutions of racemic cembrene-A over a concentration range of 10(-1)-10(-6) mg/ml were ineffective in recruiting termites. Serial dilutions of racemic cembrene-A ranging in concentration from 10(-1) to 10(-5) mg/ml produced an orientation effect. Chiral cembrene-A produced recruitment in soldiers at 10(-1) and 10(-3) mg/ml and was less ineffective in recruiting workers. Soldiers always showed a lower and more variable recruitment response to chiral cembrene-A than to sternal gland extracts. The behavioral response to both chiral and racemic cembrene-A was different in quantity and quality from that observed for sternal gland extract. Based on the results of these behavioral tests, cembrene-A appears to be a generalized nasute orientation pheromone which may show recruitment properties at unnaturally high concentrations.
Prevention of neonatal late-onset sepsis: a randomised controlled trial.
Alcock, Gary; Liley, Helen G; Cooke, Lucy; Gray, Peter H
2017-04-04
Late-onset sepsis (LOS), defined as sepsis occurring after 48 h of age causes substantial mortality and morbidity in very low birth weight infants. Risk factors for LOS include immaturity, intravascular catheters, mechanical ventilation, and prolonged parenteral nutrition (PN). Little attention has been paid to studying the effects of PN administration methods. The aim of the study was to compare a bundle of measures for PN line management incorporating a strict aseptic technique with standard line management on LOS in very low birth weight infants. Infants <1500 g birth weight who required PN were randomised to either a bundle of a strict aseptic technique for line management together with single use intravascular catheter for PN or a standard technique. The primary outcome was the incidence of LOS in the first 28 days of life. Secondary outcomes were mortality, neonatal morbidities and developmental outcome at 12 months of age. There were 126 infants in the aseptic technique group and 123 in the standard technique group. Forty (31.8%) infants in the aseptic technique group and 36 (29.3%) in the standard technique group had an episode of sepsis (p = 0.77). This corresponds to incidences of 15.8 and 14.2 episodes of sepsis per 1000 patient days respectively. Subgroup analyses for infants <1000 g also revealed no difference in the rate of sepsis between the intervention and control groups. (p = 0.43). There were no significant differences in secondary outcomes and development between the groups. A bundle of measures including strict aseptic technique for parenteral nutrition line management did not result in a reduction in LOS when compared to a standard technique. There is no evidence to recommend this as routine practice. Interdisciplinary Maternal Perinatal Australasian Collaborative Trials (IMPACT) Network, TRN registration number: PT0363. Date: 06/03/2001; Australian New Zealand Clinical Trials Registry (ANZCTR), TRN registration number: ACTRN
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merkova, M.A.; Mordvinova, N.P.; Golland, E.B.
1960-01-01
A case of complete cure of myasthenia gravis by xirradiation (6400 r) of the thymus is described. Radiation ulcer appeared in the sternal area of the skin 8 years after the x-ray therapy and was cured by excision of the injured skin with subsequent plastic operation. (auth)
Setchell, Joanna M; Vaglio, Stefano; Moggi-Cecchi, Jacopo; Boscaro, Francesca; Calamai, Luca; Knapp, Leslie A
2010-03-01
Primates are traditionally considered to be microsmatic, with decreased reliance on olfactory senses in comparison to other sensory modalities such as vision. This is particularly the case for Old World monkeys and apes (catarrhines). However, various lines of evidence suggest that chemical communication may be important in these species, including the presence of a sternal scent-gland in the mandrill. We investigated the volatile components of mandrill odor using gas chromatography-mass spectrometry. We identified a total of 97 volatile components in 88 swabs of the sternal gland secretion and 95 samples of sternal gland hair saturated with scent-gland secretion collected from 27 males and 18 females. We compared odor profiles with features of the signaler using principle components and discriminant function analyses and found that volatile profiles convey both variable (age, dominance rank in males) and fixed (sex, possibly individual identity) information about the signaler. The combination of an odor profile that signals sex, age, and rank with increased motivation to scent-mark and increased production of secretion in high-ranking males leads to a potent signal of the presence of a dominant, adult male with high testosterone levels. This may be particularly relevant in the dense Central African rain forest which mandrills inhabit. By contrast, we were unable to differentiate between either female cycle stage or female rank based on odor profiles, which accords with behavioral studies suggesting that odor signals are not as important in female mandrills as they are in males. The similarity of our findings to those for other mammals and in primates that are more distantly related to humans suggests a broader role for odor in primate communication than is currently recognized.
Clinical characteristics and outcomes of the meningitides in systemic lupus erythematosus.
Baizabal-Carvallo, José Fidel; Delgadillo-Márquez, German; Estañol, Bruno; García-Ramos, Guillermo
2009-01-01
The meningitides are rare but well-identified complications in patients with systemic lupus erythematosus (SLE). To determine the clinical characteristics, risk factors, prevalence and outcomes of the meningitides (septic and aseptic) in patients with SLE. From January 1988 to December 2006, we identified patients with SLE and septic or aseptic meningitis. We identified 25 episodes of meningitis in 23 patients with SLE, from a total of 1,411 SLE patients (1.63%); in 15 out of 25 episodes, a microorganism was identified. Mycobacterium tuberculosis, Listeria monocytogenes and Criptococcus neoformans represented the main microorganisms. In 10 episodes, aseptic meningitis was diagnosed. Lymphopenia, steroid use, chronic damage and systemic activity of SLE were frequent in both kinds of meningitis. Although the clinical presentation did not differ significantly, patients with septic meningitis had more residual neurological deficits (p = 0.04). Meningitis was observed in about 1.6% of the patients with SLE; in 40% of the cases, no microorganism could be isolated. A residual neurological deficit was more common in patients with septic meningitis. Copyright (c) 2008 S. Karger AG, Basel.
Vanhegan, I S; Malik, A K; Jayakumar, P; Ul Islam, S; Haddad, F S
2012-05-01
Revision arthroplasty of the hip is expensive owing to the increased cost of pre-operative investigations, surgical implants and instrumentation, protracted hospital stay and drugs. We compared the costs of performing this surgery for aseptic loosening, dislocation, deep infection and peri-prosthetic fracture. Clinical, demographic and economic data were obtained for 305 consecutive revision total hip replacements in 286 patients performed at a tertiary referral centre between 1999 and 2008. The mean total costs for revision surgery in aseptic cases (n = 194) were £11 897 (sd 4629), for septic revision (n = 76) £21 937 (sd 10 965), for peri-prosthetic fracture (n = 24) £18 185 (sd 9124), and for dislocation (n = 11) £10 893 (sd 5476). Surgery for deep infection and peri-prosthetic fracture was associated with longer operating times, increased blood loss and an increase in complications compared to revisions for aseptic loosening. Total inpatient stay was also significantly longer on average (p < 0.001). Financial costs vary significantly by indication, which is not reflected in current National Health Service tariffs.
Can patients determine the level of their dysphagia?
Ashraf, Hafiz Hamad; Palmer, Joanne; Dalton, Harry Richard; Waters, Carolyn; Luff, Thomas; Strugnell, Madeline; Murray, Iain Alexander
2017-01-01
AIM To determine if patients can localise dysphagia level determined endoscopically or radiologically and association of gender, age, level and pathology. METHODS Retrospective review of consecutive patients presenting to dysphagia hotline between March 2004 and March 2015 was carried out. Demographics, clinical history and investigation findings were recorded including patient perception of obstruction level (pharyngeal, mid sternal or low sternal) was documented and the actual level of obstruction found on endoscopic or radiological examination (if any) was noted. All patients with evidence of obstruction including oesophageal carcinoma, peptic stricture, Schatzki ring, oesophageal pouch and cricopharyngeal hypertrophy were included in the study who had given a perceived level of dysphagia. The upper GI endoscopy reports (barium study where upper GI endoscopy was not performed) were reviewed to confirm the distance of obstructing lesion from central incisors. A previously described anatomical classification of oesophagus was used to define the level of obstruction to be upper, middle or lower oesophagus and this was compared with patient perceived level. RESULTS Three thousand six hundred and sixty-eight patients were included, 42.0% of who were female, mean age 70.7 ± 12.8 years old. Of those with obstructing lesions, 726 gave a perceived level of dysphagia: 37.2% had oesophageal cancer, 36.0% peptic stricture, 13.1% pharyngeal pouches, 10.3% Schatzki rings and 3.3% achalasia. Twenty-seven point five percent of patients reported pharyngeal level (upper) dysphagia, 36.9% mid sternal dysphagia and 25.9% lower sternal dysphagia (9.5% reported multiple levels). The level of obstructing lesion seen on diagnostic testing was upper (17.2%), mid (19.4%) or lower (62.9%) or combined (0.3%). When patients localised their level of dysphagia to a single level, the kappa statistic was 0.245 (P < 0.001), indicating fair agreement. 48% of patients reporting a single level of
Can patients determine the level of their dysphagia?
Ashraf, Hafiz Hamad; Palmer, Joanne; Dalton, Harry Richard; Waters, Carolyn; Luff, Thomas; Strugnell, Madeline; Murray, Iain Alexander
2017-02-14
To determine if patients can localise dysphagia level determined endoscopically or radiologically and association of gender, age, level and pathology. Retrospective review of consecutive patients presenting to dysphagia hotline between March 2004 and March 2015 was carried out. Demographics, clinical history and investigation findings were recorded including patient perception of obstruction level (pharyngeal, mid sternal or low sternal) was documented and the actual level of obstruction found on endoscopic or radiological examination (if any) was noted. All patients with evidence of obstruction including oesophageal carcinoma, peptic stricture, Schatzki ring, oesophageal pouch and cricopharyngeal hypertrophy were included in the study who had given a perceived level of dysphagia. The upper GI endoscopy reports (barium study where upper GI endoscopy was not performed) were reviewed to confirm the distance of obstructing lesion from central incisors. A previously described anatomical classification of oesophagus was used to define the level of obstruction to be upper, middle or lower oesophagus and this was compared with patient perceived level. Three thousand six hundred and sixty-eight patients were included, 42.0% of who were female, mean age 70.7 ± 12.8 years old. Of those with obstructing lesions, 726 gave a perceived level of dysphagia: 37.2% had oesophageal cancer, 36.0% peptic stricture, 13.1% pharyngeal pouches, 10.3% Schatzki rings and 3.3% achalasia. Twenty-seven point five percent of patients reported pharyngeal level (upper) dysphagia, 36.9% mid sternal dysphagia and 25.9% lower sternal dysphagia (9.5% reported multiple levels). The level of obstructing lesion seen on diagnostic testing was upper (17.2%), mid (19.4%) or lower (62.9%) or combined (0.3%). When patients localised their level of dysphagia to a single level, the kappa statistic was 0.245 ( P < 0.001), indicating fair agreement. 48% of patients reporting a single level of dysphagia were
Atypical hypocalcemia in 2 dairy cows, after having been fed discarded vegetable cooking oil.
Gunn, Allan J; Abuelo, Angel
2017-12-01
Two mid-lactation dairy cows were presented sternally recumbent 4 days after the herd had been fed discarded vegetable cooking oil ad libitum. In both affected animals hypocalcemia was confirmed by clinical chemistry and response to treatment. This atypical presentation of hypocalcemia associated with feeding discarded cooking oil is previously unreported.
Sukur, Erhan; Akman, Yunus Emre; Ozturkmen, Yusuf; Kucukdurmaz, Fatih
2016-01-01
Background: Inflammatory responses to wear debris cause osteolysis that leads to aseptic prosthesis loosening and hip arthroplasty failure. Although osteolysis is usually associated with aseptic loosening, it is rarely seen around stable implants. Aseptic implant loosening is a simple radiologic phenomenon, but a complex immunological process. Particulate debris produced by implants most commonly causes osteolysis, and this is called particle-associated periprosthetic osteolysis (PPO). Objective: The objective of this review is to outline the features of particle-associated periprosthetic osteolysis to allow the physician to recognise this condition and commence early treatment, thereby optimizing patient outcome. Methods: A thorough literature search was performed using available databases, including Pubmed, to cover important research published covering particle-associated PPO. Results: Although osteolysis causes bone resorption, clinical, animal, and in vitro studies of particle bioreactivity suggest that particle-associated PPO represents the culmination of several biological reactions of many cell types, rather than being caused solely by the osteoclasts. The biological activity is highly dependent on the characteristics and quantity of the wear particles. Conclusion: Despite advances in total hip arthroplasty (THA), particle-associated PPO and aseptic loosening continue to be major factors that affect prosthetic joint longevity. Biomarkers could be exploited as easy and objective diagnostic and prognostic targets that would enable testing for osteolysis after THA. Further research is needed to identify new biomarkers in PPO. A comprehensive understanding of the underlying biological mechanisms is crucial for developing new therapeutic interventions to reverse or suppress biological responses to wear particles. PMID:27499822
Atypical hypocalcemia in 2 dairy cows, after having been fed discarded vegetable cooking oil
Gunn, Allan J.; Abuelo, Angel
2017-01-01
Two mid-lactation dairy cows were presented sternally recumbent 4 days after the herd had been fed discarded vegetable cooking oil ad libitum. In both affected animals hypocalcemia was confirmed by clinical chemistry and response to treatment. This atypical presentation of hypocalcemia associated with feeding discarded cooking oil is previously unreported. PMID:29203941
Electromyographic Permutation Entropy Quantifies Diaphragmatic Denervation and Reinnervation
Kretschmer, Alexander; Lehmeyer, Veronika; Kellermann, Kristine; Schaller, Stephan J.; Blobner, Manfred; Kochs, Eberhard F.; Fink, Heidrun
2014-01-01
Spontaneous reinnervation after diaphragmatic paralysis due to trauma, surgery, tumors and spinal cord injuries is frequently observed. A possible explanation could be collateral reinnervation, since the diaphragm is commonly double-innervated by the (accessory) phrenic nerve. Permutation entropy (PeEn), a complexity measure for time series, may reflect a functional state of neuromuscular transmission by quantifying the complexity of interactions across neural and muscular networks. In an established rat model, electromyographic signals of the diaphragm after phrenicotomy were analyzed using PeEn quantifying denervation and reinnervation. Thirty-three anesthetized rats were unilaterally phrenicotomized. After 1, 3, 9, 27 and 81 days, diaphragmatic electromyographic PeEn was analyzed in vivo from sternal, mid-costal and crural areas of both hemidiaphragms. After euthanasia of the animals, both hemidiaphragms were dissected for fiber type evaluation. The electromyographic incidence of an accessory phrenic nerve was 76%. At day 1 after phrenicotomy, PeEn (normalized values) was significantly diminished in the sternal (median: 0.69; interquartile range: 0.66–0.75) and mid-costal area (0.68; 0.66–0.72) compared to the non-denervated side (0.84; 0.78–0.90) at threshold p<0.05. In the crural area, innervated by the accessory phrenic nerve, PeEn remained unchanged (0.79; 0.72–0.86). During reinnervation over 81 days, PeEn normalized in the mid-costal area (0.84; 0.77–0.86), whereas it remained reduced in the sternal area (0.77; 0.70–0.81). Fiber type grouping, a histological sign for reinnervation, was found in the mid-costal area in 20% after 27 days and in 80% after 81 days. Collateral reinnervation can restore diaphragm activity after phrenicotomy. Electromyographic PeEn represents a new, distinctive assessment characterizing intramuscular function following denervation and reinnervation. PMID:25532023
Reiser, M; Scherag, A; Forstner, C; Brunkhorst, F M; Harbarth, S; Doenst, T; Pletz, M W; Hagel, S
2017-02-01
To evaluate the effect of pre-operative octenidine (OCT) decolonization on surgical site infection (SSI) rates. Before-and-after cohort study. Patients undergoing an elective isolated coronary artery bypass graft (CABG) procedure: control group (1 st January to 31 st December 2013), N=475; intervention group (1 st January to 31 st December 2014), N=428. The intervention consisted of nasal application of OCT ointment three times daily, beginning on the day before surgery, and showering the night before and on the day of surgery with OCT soap. A median sternotomy was performed in 805 (89.1%) patients and a minimally invasive direct coronary artery bypass procedure was performed in 98 (10.9%) patients. Overall, there was no difference in SSI rates between the control and intervention groups (15.4% vs 13.3%, P=0.39). The rate of harvest site SSIs was significantly lower in patients in the intervention group (2.5% vs 0.5%, P=0.01). Patients who had undergone a median sternotomy in the intervention group had a significantly lower rate of organ/space sternal SSIs (1.9% vs 0.3%, P=0.04). However, there was a trend towards an increased rate of deep incisional sternal SSIs (1.2% vs 2.9%, P=0.08). Multi-variate analysis did not identify a significant protective effect of the intervention (odds ratio 0.79, 95% confidence interval 0.53-1.15, P=0.27). Pre-operative decolonization with OCT did not reduce overall SSI rates in patients undergoing an elective isolated CABG procedure, but significantly decreased harvest site and organ/space sternal SSIs. Randomized controlled trials, including controlled patient adherence to the intervention, are required to confirm these observations and to determine the clinical utility of OCT in pre-operative decolonization. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Pheromones and exocrine glands in Isoptera.
Costa-Leonardo, Ana Maria; Haifig, Ives
2010-01-01
Termites are eusocial insects that have a peculiar and intriguing system of communication using pheromones. The termite pheromones are composed of a blend of chemical substances and they coordinate different social interactions or activities, including foraging, building, mating, defense, and nestmate recognition. Some of these sociochemicals are volatile, spreading in the air, and others are contact pheromones, which are transmitted by trophallaxis and grooming. Among the termite semiochemicals, the most known are alarm, trail, sex pheromones, and hydrocarbons responsible for the recognition of nestmates. The sources of the pheromones are exocrine glands located all over the termite body. The principal exocrine structures considered pheromone-producing glands in Isoptera are the frontal, mandibular, salivary or labial, sternal, and tergal glands. The frontal gland is the source of alarm pheromone and defensive chemicals, but the mandibular secretions have been little studied and their function is not well established in Isoptera. The secretion of salivary glands involves numerous chemical compounds, some of them without pheromonal function. The worker saliva contains a phagostimulating pheromone and probably a building pheromone, while the salivary reservoir of some soldiers contains defensive chemicals. The sternal gland is the only source of trail-following pheromone, whereas sex pheromones are secreted by two glandular sources, the sternal and tergal glands. To date, the termite semiochemicals have indicated that few molecules are involved in their chemical communication, that is, the same compound may be secreted by different glands, different castes and species, and for different functions, depending on the concentration. In addition to the pheromonal parsimony, recent studies also indicate the occurrence of a synergic effect among the compounds involved in the chemical communication of Isoptera. Copyright © 2010 Elsevier Inc. All rights reserved.
Sievert, Lynnette L; Reza, Angela; Mills, Phoebe; Morrison, Lynn; Rahberg, Nichole; Goodloe, Amber; Sutherland, Michael; Brown, Daniel E
2010-01-01
The aims of this study were to test for a diurnal pattern in hot flashes in a multiethnic population living in a hot, humid environment and to examine the rates of concordance between objective and subjective measures of hot flashes using ambulatory and laboratory measures. Study participants aged 45 to 55 years were recruited from the general population of Hilo, HI. Women wore a Biolog hot flash monitor (UFI, Morro Bay, CA), kept a diary for 24 hours, and also participated in 3-hour laboratory measures (n = 199). Diurnal patterns were assessed using polynomial regression. For each woman, objectively recorded hot flashes that matched subjective experience were treated as true-positive readings. Subjective hot flashes were considered the standard for computing false-positive and false-negative readings. True-positive, false-positive, and false-negative readings were compared across ethnic groups by chi analyses. Frequencies of sternal, nuchal, and subjective hot flashes peaked at 1500 +/- 1 hours with no difference by ethnicity. Laboratory results supported the pattern seen in ambulatory monitoring. Sternal and nuchal monitoring showed the same frequency of true-positive measures, but nonsternal electrodes picked up more false-positive readings. Laboratory monitoring showed very low frequencies of false negatives. There were no ethnic differences in the frequency of true-positive or false-positive measures. Women of European descent were more likely to report hot flashes that were not objectively demonstrated (false-negative measures). The diurnal pattern and peak in hot flash occurrence in the hot humid environment of Hilo were similar to results from more temperate environments. Lack of variation in sternal versus nonsternal measures and in true-positive measures across ethnicities suggests no appreciable effect of population variation in sweating patterns.
Deo, Salil V; Altarabsheh, Salah E; Shah, Ishan K; Cho, Yang Hyun; McGraw, Michael; Sarayyepoglu, Basar; Medalion, Benjamin; Markowitz, Alan H; Park, Soon J
2015-04-01
Bilateral internal thoracic artery grafting appears to be the preferred method to achieve durable long-term coronary artery revascularization. However, data reporting the benefit of this technique in the elderly is very conflicting. We performed a systematic review of available literature (till November 2014) using multiple databases to identify studies comparing clinical events in patients undergoing coronary artery bypass grafting using either a single or double internal thoracic artery in the elderly. While early mortality was the primary end-point of inclusion, other adverse events compared were sternal wound infection (deep and superficial), stroke and peri-operative myocardial infarction. Individual and pooled odd's ratios were calculated using the Mantel-Haenzel method (random effect model); sensitivity analysis was performed. Results are presented using 95% confidence intervals. Nine retrospective studies (4479 BITA, 7733 LITA patients) fulfilled search criteria. Deep sternal wound infection was significantly higher after BITA harvest [OR 1.86 (1.3-2.5); I(2) = 0%; p < 0.01]. Early mortality (BITA 3.6% vs SITA 3.1%; p = 0.86), stroke [OR 0.7(0.4-1.1); p = 0.1], and peri-operative myocardial infarction (BITA 4.3% vs SITA 2.3%; p = 0.1) were comparable in both cohorts. Long-term survival favored the BITA cohort in two propensity matched studies. The incidence of deep sternal wound infection may be significantly higher after the harvest of both internal thoracic arteries in the elderly. While other post-operative adverse events are comparable, data regarding the long-term survival advantage in this cohort is conflicting. Hence, the use of both internal thoracic arteries in this age group needs to be invidualized. Copyright © 2015 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.
Sharma, Chandra Madhur; Kumar, Shrawan; Meghwani, Manoj K; Agrawal, Ravi P
2014-01-01
Poland's syndrome is a rare congenital condition, characterized by the absence of the sternal or breastbone portion of the pectoralis major muscle, which may be associated with the absence of nearby musculoskeletal structures. We hereby report an 8-year-old boy with typical features of Poland syndrome, the first documented case from Uttar Pradesh, India.
Acute venous thrombosis as complication and clue to diagnose a SAPHO syndrome case. A case report.
Rosero, A; Ruano, R; Martin, M; Hidalgo, C; Garcia-Talavera, J
2013-01-01
This report concerns a male adult admitted for sternal and left arm pain, who was diagnosed and treated for acute deep venous thrombosis in the left subclavian and axillary veins. X-ray and a hybrid single photon emission tomography and computed tomography (SPECT-CT) scintigraphy scan revealed high intensity uptake in both sternoclavicular joints, which corresponded to hyperostosis, thereby suggesting a SAPHO syndrome. Upon reviewing the patient's medical history, we found dermatological pustulosis disease and an intermittent sternal chest pain untreated since 10 years ago. In the biochemical study we found erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) elevation, hyperglobulinemia, and mild anaemia. Initial treatment included nonsteroidal anti-inflammatory drugs (NSAIDs) with low response, which then changed to methotrexate, sulfasalazine, and prednisone. The patient's pain was controlled almost completely in 10 months. A control bone scan revealed a marked decrease in intensity of bone deposits according to clinical response. To our knowledge, there are only a few cases of SAPHO and thrombosis and none are followed up with a bone SPECT-CT scan.
Lewis, Priya; Jewell, James; Mattison, Gennaya; Gupta, Subhas; Kim, Hahns
2015-05-01
The use of human acellular dermal matrices (ADM) has become routinely used in implant-based breast surgery. Notwithstanding the many benefits for tissue support, the morbidity associated with its use includes seroma and infection, among other potential complications. Some patients experience a specific complication called red breast syndrome (RBS), which has been linked to ADM use, but its exact etiology remains elusive. In our institution, AlloDerm aseptic regenerative tissue matrix was recently replaced with a ready-to-use sterile version that undergoes terminal sterilization, eliminating the need for rehydration. We want to determine if this change in processing affected complications, including RBS. We conducted a retrospective chart review analyzing patients from January 1, 2011, to June 1, 2013, who underwent breast surgery with human ADM. Patients with aseptic AlloDerm were compared to patients with sterile AlloDerm. Data were analyzed using the Fisher exact test. A total of 167 reconstructed breasts from 105 patients met inclusion criteria: 56% (n=93) with aseptic ADM, 44% (n=74) with sterile ADM. When comparing the two, patients had a decrease in overall necrosis, infection, seroma, and RBS with sterile ADM. However, the rates did not reach statistical significance. For example, the incidence of RBS decreased from 7.5% to 2.7% (P=0.301) and seroma decreased from 8.6% to 2.7% (P=0.188). The infection rate proved to be equivocal at 11.8% with aseptic ADM to 10.8% with sterile ADM (P=1.000). The only statistically significant change was a decrease in the total complication rate from 41.9% to 27.0% (P=0.046). The absolute risk reduction for total complications was 14.9% with a number-needed-to-treat of 7. According to our study, sterile AlloDerm has a clinically decreased incidence of complications compared to aseptic AlloDerm. Whereas RBS decreased, it was interesting to see that it was not eliminated altogether. This suggests that the etiology may be
Why Do Medial Unicompartmental Knee Arthroplasties Fail Today?
van der List, Jelle P; Zuiderbaan, Hendrik A; Pearle, Andrew D
2016-05-01
Failure rates are higher in medial unicompartmental knee arthroplasty (UKA) than total knee arthroplasty. To improve these failure rates, it is important to understand why medial UKA fail. Because individual studies lack power to show failure modes, a systematic review was performed to assess medial UKA failure modes. Furthermore, we compared cohort studies with registry-based studies, early with midterm and late failures and fixed-bearing with mobile-bearing implants. Databases of PubMed, EMBASE, and Cochrane and annual registries were searched for medial UKA failures. Studies were included when they reported >25 failures or when they reported early (<5 years), midterm (5-10 years), or late failures (>10 years). Thirty-seven cohort studies (4 level II studies and 33 level III studies) and 2 registry-based studies were included. A total of 3967 overall failures, 388 time-dependent failures, and 1305 implant design failures were identified. Aseptic loosening (36%) and osteoarthritis (OA) progression (20%) were the most common failure modes. Aseptic loosening (26%) was most common early failure mode, whereas OA progression was more commonly seen in midterm and late failures (38% and 40%, respectively). Polyethylene wear (12%) and instability (12%) were more common in fixed-bearing implants, whereas pain (14%) and bearing dislocation (11%) were more common in mobile-bearing implants. This level III systematic review identified aseptic loosening and OA progression as the major failure modes. Aseptic loosening was the main failure mode in early years and mobile-bearing implants, whereas OA progression caused most failures in late years and fixed-bearing implants. Copyright © 2016 Elsevier Inc. All rights reserved.
OSTEOLYSIS AROUND TOTAL KNEE ARTHOPLASTY: A REVIEW OF PATHOGENETIC MECHANISMS
Gallo, Jiri; Goodman, Stuart B.; Konttinen, Yrjö T.; Wimmer, Markus A.; Holinka, Martin
2014-01-01
Aseptic loosening and other wear-related complications are one of the most frequent late reasons for revision of total knee arthroplasty (TKA). Periprosthetic osteolysis (PPOL) predates aseptic loosening in many cases indicating the clinical significance of this pathogenic mechanism. A variety of implant-, surgery-, and host-related factors have been delineated to explain the development of PPOL. These factors influence the development of PPOL due to changes in mechanical stresses within the vicinity of the prosthetic device, excessive wear of the polyethylene liner, and joint fluid pressure and flow acting on the peri-implant bone. The process of aseptic loosening is initially governed by factors such as implant/limb alignment, device fixation quality, and muscle coordination/strength. Later large numbers of wear particles detached from TKAs trigger and perpetuate particle disease, as highlighted by progressive growth of inflammatory/granulomatous tissue around the joint cavity. An increased accumulation of osteoclasts at the bone-implant interface, an impairment of osteoblast function, mechanical stresses, and an increased production of joint fluid contribute to bone resorption and subsequent loosening of the implant. In addition, hypersensitivity and adverse reactions to metal debris may contribute to aseptic TKA failure but should be determined more precisely. Patient activity level appears to be the most important factor when the long-term development of PPOL is considered. Surgical technique, implant design, and material factors are the most important preventative factors because they influence both the generation of wear debris and excessive mechanical stresses. New generations of bearing surfaces and designs for TKA should carefully address these important issues in extensive preclinical studies. Currently, there is little evidence that PPOL can be prevented with pharmacological interventions. PMID:23669623
Scintigraphy of infected total hip arthroplasty (THA): A canine model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merkel, K.D.; Brown, M.L.; Fitzgerald, R.H.
1984-01-01
Differentiating low-grade sepsis from aseptic loosening of an orthopedic prosthesis is difficult. This study was designed to compare the ability of Tc-99m-HMDP, Ga-67, and In-111 leukocytes (WC) to differentiate low-grade sepsis from aseptic THA component loosening in a canine model. A canine THA was implanted in 14 dogs. Six dogs were given infected femoral components by injecting 10/sup 5/ colony-forming units of Staphylococcus aureus into the femoral canal 6y0 to 90 seconds prior to cementing. Four dogs had an aseptic loose femoral component, and four dogs had an aseptic tight femoral component (control). At six months all dogs were evaluatedmore » with X-ray, lab scintigraphy, and tissue quantitation of each tracer. Diagnosis was confirmed by histology and quantitative microbiology. White blood cell counts and differentials were normal in all dogs, and in only one out of six infected dogs was the sedimentation rate abnormal. X-rays were interpreted as possible infection in five dogs and probable infection in only one dog. In-111 WBC scans were more accurate than sequential Tc-Ga scans (sensitivity 94% vs 61%, specificity 86% vs 71% accuracy 90% vs 67%). Quantitative counting of gamma camera data and tissue samples demonstrated significantly (P < .01) higher accumulation of In-111 WBC about the infected than the loose or control component. No significant difference was demonstrated between the loose and septic components with TC-HMDP or Ga. These results correlate well and confirm our clinical data that In-111 WBC scanning is accurate and useful in the workup of the painful orthopedic prosthesis.« less
Heim, Cortney E; Vidlak, Debbie; Odvody, Jessica; Hartman, Curtis W; Garvin, Kevin L; Kielian, Tammy
2017-11-15
Prosthetic joint infection (PJI) is a devastating complication of joint arthroplasty surgery typified by biofilm formation. Currently, mechanisms whereby biofilms persist and evade immune-mediated clearance in immune competent patients remain largely ill-defined. Therefore, the current study characterized leukocyte infiltrates and inflammatory mediator expression in tissues from patients with PJI compared to aseptic loosening. CD33 + HLA-DR - CD66b + CD14 -/low granulocytic myeloid-derived suppressor cells (G-MDSCs) were the predominant leukocyte population at sites of human PJI compared to aseptic tissues. MDSCs inhibit T cell proliferation, which coincided with reduced T cells in PJIs compared to aseptic tissues. IL-10, IL-6, and CXCL1 were significantly elevated in PJI tissues and have been implicated in MDSC inhibitory activity, expansion, and recruitment, respectively, which may account for their preferential increase in PJIs. This bias towards G-MDSC accumulation during human PJI could account for the chronicity of these infections by preventing the pro-inflammatory, antimicrobial actions of immune effector cells. Animal models of PJI have revealed a critical role for MDSCs and IL-10 in promoting infection persistence; however, whether this population is prevalent during human PJI and across distinct bacterial pathogens remains unknown. This study has identified that granulocytic-MDSC infiltrates are unique to human PJIs caused by distinct bacteria, which are not associated with aseptic loosening of prosthetic joints. Better defining the immune status of human PJIs could lead to novel immune-mediated approaches to facilitate PJI clearance in combination with conventional antibiotics. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Survivorship analysis of failure pattern after revision total hip arthroplasty.
Retpen, J B; Varmarken, J E; Jensen, J S
1989-12-01
Failure, defined as established indication for or performed re-revision of one or both components, was analyzed using survivorship methods in 306 revision total hip arthroplasties. The longevity of revision total hip arthroplasties was inferior to that of previously reported primary total hip arthroplasties. The overall survival curve was two-phased, with a late failure period associated with aseptic loosening of one or both components and an early failure period associated with causes of failure other than loosening. Separate survival curves for aseptic loosening of femoral and acetabular components showed late and almost simultaneous decline, but with a tendency toward a higher rate of failure for the femoral component. No differences in survival could be found between the Stanmore, Lubinus standard, and Lubinus long-stemmed femoral components. A short interval between the index operation and the revision and intraoperative and postoperative complications were risk factors for early failure. Young age was a risk factor for aseptic loosening of the femoral component. Intraoperative fracture of the femoral shaft was not a risk factor for secondary loosening. No difference in survival was found between primary cemented total arthroplasty and primary noncemented hemiarthroplasty.
Cerebrospinal fluid lactate level as a diagnostic biomarker for bacterial meningitis in children
2014-01-01
Background Cerebrospinal fluid (CSF) lactate is a potential biomarker for bacterial meningitis in children. To this end, we performed a single-center retrospective cohort study of children from Sao Paulo, Brazil, with CSF pleocytosis to evaluate the ability of CSF lactate to distinguish between children with bacterial and aseptic meningitis. We determined the optimum cutoff point for CSF lactate using receiver-operator curve (ROC) analysis. Findings We identified 451 children of whom 40 (9%) had bacterial meningitis. Children with bacterial meningitis had a higher median CSF lactate level [9.6 mmol/l, interquartile range (IQR) 3.2-38.5 mmol/l bacterial meningitis vs. 2.0 mmol/l, IQR 1.2-2.8 mmol/l aseptic meningitis]. A CSF lactate cutoff point of 3.0 mmol/l had a sensitivity of 95% [95% confidence interval (CI) 83-99%), specificity of 94% (95% CI 90-96%) and negative predictive value of 99.3% (95% CI 97.7-99.9%) for bacterial meningitis. Conclusions In combination with a validated meningitis clinical prediction rule, the CSF lactate level can be used to distinguish between bacterial and aseptic meningitis in children with CSF pleocytosis. PMID:24576334
Cerebrospinal fluid lactate level as a diagnostic biomarker for bacterial meningitis in children.
Mekitarian Filho, Eduardo; Horita, Sérgio Massaru; Gilio, Alfredo Elias; Nigrovic, Lise E
2014-02-27
Cerebrospinal fluid (CSF) lactate is a potential biomarker for bacterial meningitis in children. To this end, we performed a single-center retrospective cohort study of children from Sao Paulo, Brazil, with CSF pleocytosis to evaluate the ability of CSF lactate to distinguish between children with bacterial and aseptic meningitis. We determined the optimum cutoff point for CSF lactate using receiver-operator curve (ROC) analysis. We identified 451 children of whom 40 (9%) had bacterial meningitis. Children with bacterial meningitis had a higher median CSF lactate level [9.6 mmol/l, interquartile range (IQR) 3.2-38.5 mmol/l bacterial meningitis vs. 2.0 mmol/l, IQR 1.2-2.8 mmol/l aseptic meningitis]. A CSF lactate cutoff point of 3.0 mmol/l had a sensitivity of 95% [95% confidence interval (CI) 83-99%), specificity of 94% (95% CI 90-96%) and negative predictive value of 99.3% (95% CI 97.7-99.9%) for bacterial meningitis. In combination with a validated meningitis clinical prediction rule, the CSF lactate level can be used to distinguish between bacterial and aseptic meningitis in children with CSF pleocytosis.
Central Nervous System Infections in Denmark
2018-02-04
Central Nervous System Infections; Bacterial Meningitis; Viral Meningitis; Aseptic Meningitis; Encephalitis; Brain Abscess; Neuroborreliosis; Neurosyphilis; Lyme Disease; Tertiary Syphilis; Cerebral Abscess; Meningitis
Sharma, Chandra Madhur; Kumar, Shrawan; Meghwani, Manoj K.; Agrawal, Ravi P.
2014-01-01
Poland's syndrome is a rare congenital condition, characterized by the absence of the sternal or breastbone portion of the pectoralis major muscle, which may be associated with the absence of nearby musculoskeletal structures. We hereby report an 8-year-old boy with typical features of Poland syndrome, the first documented case from Uttar Pradesh, India. PMID:24959021
Stephenson, Jacob T; Du Bois, Jeffrey
2008-10-01
The treatment of pectus carinatum (PC) has classically been operative, though compressive orthotic braces have been used with good success in recent years. The purpose of this article is to evaluate the use of radiologic measurements in a successful bracing protocol. Sixty-three patients with PC have been evaluated for an 8-year span. The average age is 13.3 +/- 2.5. Follow-up is from 4 to 60 months, with a median of 24 months. Seventeen patients with mild defects elected observation alone. The remaining 46 patients began the bracing protocol. Baseline chest computed tomography (CT) was obtained, and custom-fitted orthotic braces were constructed for each patient. Radiographic markers were evaluated to include the Haller index, angle of sternal rotation, and asymmetry index. Patient surveys and chart review were used to identify compliance and success rates. Pretreatment CTs were retrospectively reviewed by bracing outcomes and radiographic measurements were compared. Ten patients received posttreatment CTs after successful bracing. Of 63 patients with PC, 17 patients (27%) with mild defects elected observation alone. The remaining 46 patients began the bracing protocol as described above. Of these, 10 are excluded from analysis, with 6 patients currently in the early treatment phase and 4 who have been lost to follow-up. Of the remaining 36 patients, 8 failed bracing because of noncompliance. Of the 28, 24 patients who completed treatment report either good or excellent results after bracing. Eight patients have required surgical intervention, 4 as a result of noncompliance and 4 who were compliant but failed bracing. In patients who were compliant, significant differences were seen on initial CT between those with successful outcomes and those who required surgical repair. Haller index (2.85 vs 2.05; P < .05), angle of sternal rotation (27.3 vs 14.8; P < .05), and asymmetry index (1.23 vs 1.06; P < .01) were all higher in the group who failed bracing. In those
Basu, Saumyajit; Rathinavelu, Sreeramalingam
2017-04-01
Prospective cohort study. To study clinicoradiological parameters of zero-profile cage screw used for anterior cervical discectomy and fusion (ACDF). Radiological parameters of various implants used for ACDF are available, but those for zero-profile cage are sparse. Patients with unilateral intractable brachialgia due to single-level cervical disc prolapse between April 1, 2011 and March 31, 2014 were included. Clinical assessment included arm and neck pain using visual analogue score (VAS) and neck disability index (NDI) scores. Radiological assessment included motion segment height, adjacent disc height (upper and lower), segmental and cervical lordosis, implant subsidence, and pseudoarthrosis. Follow-ups were scheduled at 1, 3, 6, 12, and 24 months. Thirty-four patients (26 males, 8 females) aged 30-50 years (mean, 42.2) showed excellent clinical improvement based on VAS scores (7.4-0 for arm and 2.0-0.6 for neck pains). Postoperative disc height improved by 11.33% ( p <0.001), but at 2 years, the score deteriorated by 7.03% ( p <0.001). Difference in the adjacent segment disc height at 2 years was 0.08% ( p =0.8) in upper and 0.16% ( p <0.001) in lower disc spaces. Average segmental lordosis achieved was 5.59° ( p <0.001) from a preoperative kyphosis of 0.88°; at 2 years, an average loss of 7.05° ( p <0.001) occurred, resulting in an average segmental kyphosis of 1.38°. Cervical lordosis improved from 11.59° to 14.88° ( p =0.164), and at 2 years, it progressively improved to 22.59° ( p <0.001). Three patients showed bone formation and two mild protrusion of the implant at 2 years without pseudoarthrosis/implant failure. The zero-profile cage screw device provides good fusion and cervical lordosis but is incapable of maintaining the segmental lordosis achieved up to a 2-year follow-up. We also recommend caution when using it in patients with small vertebrae.
Chemoiwa, R K; Mukthar, V K; Maranga, A K; Kulei, S J
2014-10-01
To analyse the infection prevention practices in handling of injections by nurses in Rift Valley Provincial Hospital in Kenya. A cross-sectional observational study. Rift Valley Provincial hospital which is a level five health facility situated in Nakuru County, Kenya. A sample of 386 injection procedures attributed to the nurses in Rift Valley Provincial Hospital was considered for this study. The study established that among all the injections administered in this study, 43.7% (386) adhered to aseptic techniques. Over seventy five percent (76.9%, n = 386) of the observed injections procedures did not involve the hand-washing, 53.4% (n = 206) did not involve swabbing of a vial rubber cap with alcohol swabs and 95.1%(n = 263) involved using of multidose drug in more than one designated patient. Over ninety five percent (95.6%, n = 364) of the observed procedures involved use of sterile the syringe bit of the devices only while the rest used either clean or contaminated syringes. Around forty percent (42.2%, n = 316) of the injections preparation was done elsewhere (not at the patient bedside) before administration. Slightly over thirty five percent (36.6%, n = 386) of the injections were administered immediately upon reconstitution(at the right time). The study also established the use of aseptic techniques to reconstitute and administer was significantly related to the number of nurses to patients ratio per shift (X2(1) = 3.5: p = 0.04). The findings of this study indicate that patient safety in public hospital is still relatively low. The adherence to basic infection prevention procedures/aseptic techniques in handling of injections by health workers is still a concern. The adherence to aseptic techniques in handling injections is significantly associated with the nurses to patients ratios. Therefore, it is imperative to improve nurse to patient ratio in public health facilities in Kenya.
Liu, Zhuo-Hao; Tu, Po-Hsun; Chen, Nan-Yu; Yip, Ping K; Bowes, Amy L; Lee, Cheng-Chi; Chan, She-Hung; Kung, Chua-Chi; Wang, Alvin Yi-Chou; Wu, Chieh-Tsai; Lee, Shih-Tseng
2015-11-01
The objective of the present study was to determine whether selective inflammatory cytokine concentrations within cerebrospinal fluid are useful markers for the differential diagnosis of aseptic and bacterial meningitis within neurosurgical patients. Prospective, open-label, observational, cohort study. Neurosurgical ICU, Chang Gung Memorial Hospital. Thirty-two consecutive neurosurgical patients who had postoperative fever following external ventricular drain insertion for the treatment of brain injury underwent serial cerebrospinal fluid cytokine analysis pre and post fever to determine the value of such markers in ascertaining the differential diagnosis of meningitis. Cerebrospinal fluid samples were collected on the day of fever onset, as well as on day 2 and 4 pre and post fever development. Tumor necrosis factor-α, interleukin-1β, interleukin-6, interleukin-8, transforming growth factor-β, and procalcitonin were subsequently analyzed using enzyme-linked immunosorbent assay analysis techniques. Inflammatory marker levels were compared among febrile aseptic, bacterial, and nonmeningitis patients to determine cerebrospinal fluid inflammatory changes over time. Significant increases in cerebrospinal fluid tumor necrosis factor -α, interleukin-1β, interleukin-6, and interleukin-8 levels were observed within patients with bacterial meningitis at fever onset, which was not evident in aseptic or nonmeningitis patients. Furthermore, significant increases in cerebrospinal fluid tumor necrosis factor-α, interleukin-1β, interleukin-6, and interleukin-8 levels were detected as early as 4 days prior to fever onset within patients with bacterial meningitis when compared with both aseptic and nonmeningitis groups. Interestingly, procalcitonin was only significantly increased in patients with bacterial meningitis on the fourth day post fever. The present study suggests that raised cerebrospinal fluid tumor necrosis factor -α, interleukin-1β, and interleukin-8 in a
[Proximal tibial valgus osteotomy semi-invasive technique. A report on 66 cases].
González Maza, Carlos; Moscoso López, Luis; Magaña García, Ignacio; Mejía Vargas, Gildardo; López Segundo, José Román
2007-01-01
The purpose of the present study is to report sixty six high tibial lateral osteotomies (HTO) make on patients with osteoarthrosis of the medial compartment, using modified semi invasive technique. With this technique the incision is 5-6 mm, fibular head is not resect, biceps femoris tendon is not cut, no internal fixation is place; the median follow-up was 6.4 years. The status of the patient at the final follow-up was analyzed using Knee Society Score (KSS), and Visual Analogue Scale (VAS). An average of 85 points was achieved after HTO compared to 55 points preoperative and 83 points after HTO compared to 51 points preoperative, was obtained at the evaluation with KSS. The only complication was superficial infections (4%). Serious complications did not appear. There was not pseudoarthrosis.
Anterior pseudoarthrectomy for symptomatic Bertolotti's syndrome.
Malham, Gregory M; Limb, Rebecca J; Claydon, Matthew H; Brazenor, Graeme A
2013-12-01
Painful L5/S1 pseudoarthrosis has been previously managed with posterior excision and/or lumbar fusion. To our knowledge, the anterior approach for L5/S1 pseudoarthrectomy in the treatment of Bertolotti's syndrome has not been described. We present two patients with severe symptomatic L5/S1 pseudoarthroses that were successfully excised via an anterior retroperitoneal approach with 2 year clinical and radiological follow-up. The literature regarding surgical treatments for Bertolotti's syndrome is reviewed. The technique for an anterior retroperitoneal approach is described. This approach has been safe and effective in providing long term symptomatic relief to our two patients. Further studies comparing the outcomes of anterior versus posterior pseudoarthrectomy will guide the management of this condition. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ao, Haiyong; Zong, Jiajia; Nie, Yanjiao; Wan, Yizao; Zheng, Xiebin
2018-03-01
Aseptic loosening of implant is one of the main causes of Ti-based implant failure. In our previous work, a novel stable collagen/hyaluronic acid (Col/HA) multilayer modified titanium coatings (TCs) was developed by layer-by-layer (LBL) covalent immobilization technique, which showed enhanced biological properties compared with TCs that were physically absorbed with Col/HA multilayer in vitro . In this study, a rabbit model with femur condyle defect was employed to compare the osteointegration performance of them. Results indicated that Col/HA multilayer with favourable stability could better facilitate osteogenesis around implants and bone-implant contact. The Col/HA multilayer covalent-immobilized TC may reduce aseptic loosening of implant.
Sterility Testing of Prototype Plastic Aseptic Docking Tubes
1982-09-01
Bacillus stearothermophilus CL21. AmerRACT (Coat~e- aeids uIf 8" niev teIi by block n"Unbee) Fifty-nine pairs of sterile docking tabs, manufactured...of Bacillus stearothermophilus , _J sealed, and flushed with sterile culture medium. Twenty five percent of the LA_.. seals failed because of...were similarly attached to sterile tubes of Becton Dickenson supplemented peptone broth. A 25 ul aliquot of Bacillus stearothermophilus spores (Ix]O
DiResta, Gene R; Brown, Holly; Aiken, Sean; Doty, Steven; Schneider, Robert; Wright, Timothy; Healey, John H
2006-01-01
A device is presented that positions ultrahigh molecular weight polyethylene (UHMWPE) debris against periprosthetic bone surfaces. This can facilitate the study of aseptic loosening associated with cemented joint prostheses by speeding the appearance of this debris within the periprosthetic space. The device, composed of a 100 microm thick bioabsorbable membrane impregnated with 1.4 x 10(9) sub-micron particles of UHMWPE debris, is positioned on the endosteum of the bone prior to the insertion of the cemented orthopedic implant. An in vitro pullout study and an in vivo canine pilot study were performed to investigate its potential to accelerate "time to aseptic loosening" of cemented prosthetic joints. Pullout studies characterized the influence of the membrane on initial implant fixation. The tensile stresses (mean+/-std.dev.) required to withdraw a prosthesis cemented into canine femurs with and without the membrane were 1.15+/-0.3 and 1.54+/-0.01 MPa, respectively; these findings were not significantly different (p > 0.4). The in vivo pilot study, involving five dogs, was performed to evaluate the efficacy of the debris to accelerate loosening in a canine cemented hip arthroplasty. Aseptic loosening and lameness occurred within 12 months, quicker than the 30 months reported in a retrospective clinical review of canine hip arthroplasty.
Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie
2015-11-20
In a previous study, a modular process risk model, from the raw material reception to the final product storage, was built to estimate the risk of a UHT-aseptic line of not complying with commercial sterility (Pujol et al., 2015). This present study was focused on demonstrating how the model (updated version with uncertainty and variability separated and 2(nd) order Monte Carlo procedure run) could be used to assess quantitatively the influence of management options. This assessment was done in three steps: pinpoint which process step had the highest influence on the risk, identify which management option(s) could be the most effective to control and/or reduce the risk, and finally evaluate quantitatively the influence of changing process setting(s) on the risk. For Bacillus cereus, it was identified that during post-process storage in an aseptic tank, there was potentially an air re-contamination due to filter efficiency loss (efficiency loss due to successive in-place sterilizations after cleaning operations), followed by B. cereus growth. Two options were then evaluated: i) reducing by one fifth of the number of filter sterilizations before renewing the filters, ii) designing new UHT-aseptic lines without an aseptic tank, i.e. without a storage period after the thermal process and before filling. Considering the uncertainty in the model, it was not possible to confirm whether these options had a significant influence on the risk associated with B. cereus. On the other hand, for Geobacillus stearothermophilus, combinations of heat-treatment time and temperature enabling the control or reduction in risk by a factor of ca. 100 were determined; for ease of operational implementation, they were presented graphically in the form of iso-risk curves. For instance, it was established that a heat treatment of 138°C for 31s (instead of 138°C for 25s) enabled a reduction in risk to 18×10(-8) (95% CI=[10; 34]×10(-8)), instead of 578×10(-8) (95% CI=[429; 754]×10
Epidemics of viral meningitis caused by echovirus 6 and 30 in Korea in 2008.
Kim, Hye-Jin; Kang, Byounghak; Hwang, Seoyeon; Hong, Jiyoung; Kim, Kisang; Cheon, Doo-Sung
2012-02-15
Enteroviruses (EVs) are the leading cause of aseptic meningitis, which is the most frequent central nervous system infection worldwide. We aimed to characterize the EVs involved in an aseptic meningitis outbreak in Korea in 2008. In Korea, Echovirus type 30 (E30) and E6 have been associated with outbreaks and frequent meningitis. During 2008, through nationwide surveillance, we collected specimens from 758 patients with aseptic meningitis-related clinical manifestations. The detection of EVs from specimens was subjected to a diagnostic real-time RT-PCR in the 5' NCR. A semi-nested polymerase chain reaction (PCR) to amplify sequences from the VP1 region and sequence comparison with reference strains registered in Genbank was performed for the genotype determination. Most patients (98%) in this outbreak were children < 15 years of age. The temporal distribution of the E6 and E30 epidemics showed an obvious seasonal pattern during the short period from June to July. A large majority of the EV-positive patients experienced fever, headache, vomiting, and neck stiffness. Some patients also showed cold symptoms, sore throat, altered mental status, and seizures. We did not observe a higher fatality rate in children with E6 or E30 infection. Most of the patients recovered uneventfully. In most cases, the cerebrospinal fluid (CSF) profile was studied, and generally showed a higher than normal white blood cell count (≥ 5/mm(3)). We detected EVs from 513 patients (67.68%) and identified the EV genotype in 287 patients. E30 (n = 155, 50.4%) and E6 (n = 95, 33.1%) were the predominant genotypes. E9, E1, E7, E16, coxsackievirus A3, 4, 6, coxsackievirus B1, 3, and 10 were also identified. According to phylogenetic analysis, E30 belonged to subgroup 4b, and E6, to the C4 subgroup. Conclusively, aseptic meningitis was the most common manifestation in children with either echovirus 30 or 6 infection. Identification of E6 and E30 as the prominent EVs in the 2008 outbreak in South
Epidemics of viral meningitis caused by echovirus 6 and 30 in Korea in 2008
2012-01-01
Background Enteroviruses (EVs) are the leading cause of aseptic meningitis, which is the most frequent central nervous system infection worldwide. We aimed to characterize the EVs involved in an aseptic meningitis outbreak in Korea in 2008. In Korea, Echovirus type 30 (E30) and E6 have been associated with outbreaks and frequent meningitis. Methods During 2008, through nationwide surveillance, we collected specimens from 758 patients with aseptic meningitis-related clinical manifestations. The detection of EVs from specimens was subjected to a diagnostic real-time RT-PCR in the 5' NCR. A semi-nested polymerase chain reaction (PCR) to amplify sequences from the VP1 region and sequence comparison with reference strains registered in Genbank was performed for the genotype determination. Results Most patients (98%) in this outbreak were children < 15 years of age. The temporal distribution of the E6 and E30 epidemics showed an obvious seasonal pattern during the short period from June to July. A large majority of the EV-positive patients experienced fever, headache, vomiting, and neck stiffness. Some patients also showed cold symptoms, sore throat, altered mental status, and seizures. We did not observe a higher fatality rate in children with E6 or E30 infection. Most of the patients recovered uneventfully. In most cases, the cerebrospinal fluid (CSF) profile was studied, and generally showed a higher than normal white blood cell count (≥ 5/mm3). We detected EVs from 513 patients (67.68%) and identified the EV genotype in 287 patients. E30 (n = 155, 50.4%) and E6 (n = 95, 33.1%) were the predominant genotypes. E9, E1, E7, E16, coxsackievirus A3, 4, 6, coxsackievirus B1, 3, and 10 were also identified. According to phylogenetic analysis, E30 belonged to subgroup 4b, and E6, to the C4 subgroup. Conclusions Conclusively, aseptic meningitis was the most common manifestation in children with either echovirus 30 or 6 infection. Identification of E6 and E30 as the prominent
Vittori, Miloš; Kostanjšek, Rok; Žnidaršič, Nada; Štrus, Jasna
2012-01-01
Abstract Terrestrial isopods are a suitable group for the study of cuticle synthesis and calcium dynamics because they molt frequently and have evolved means to store calcium during molt. Little data is currently available on molting in Synocheta and subterranean isopods. We studied the molting dynamics in the subterranean trichoniscid Titanethes albus under laboratory conditions and performed a microscopic investigation of sternal CaCO3 deposits and the tergal epithelium during molt in this species. In accordance with its lower metabolic rate, molting in the laboratory is roughly 2–3 times less frequent in Titanethes albus than would be expected for an epigean isopod under similar conditions. Animals assumed characteristic postures following the molt of each body half and did not consume the posterior exuviae after posterior molt. The structure of sternal calcium deposits and the ultrastructural characteristics of the epidermis during cuticle formation in Titanethes albus are similar to those described in representatives of Ligiidae. During the deposition of the exocuticle, the apical plasma membrane of epidermal cells forms finger-like extensions and numerous invaginations. In the ecdysial space of individuals in late premolt we observed cellular extensions surrounded by bundles of tubules. PMID:22536097
Congenital cardiac disease in dogs.
McCaw, D; Aronson, E
1984-07-01
Pulmonic stenosis is caused by a malformed pulmonic valve, stricture of the right ventricular outflow tract or stricture of the pulmonary artery. English Bulldogs, Beagles, Samoyeds, Fox Terriers and Chihuahuas are predisposed. Clinical signs in severely affected dogs include exercise intolerance, stunting, dyspnea, syncope and ascites. Auscultation reveals a high-frequency, crescendo-decrescendo murmur during systole, loudest over the left side of the thorax, near the sternal cardiac border. An ECG may reveal a right-axis deviation of greater than 120 degrees, S waves in leads I, II and III, deep S waves in CV6LL, CV6LU and V10, Q waves deeper than 0.5 mv in leads II, III and AVF, and positive T waves in lead V10. Plain film LAT thoracic radiographs reveal an elevated carina, increased sternal contact of the heart, loss of the cranial cardiac waist and a widened cardiac silhouette, with normal pulmonary vasculature. A DV projection reveals an inverted "D" shape of the right ventricle and a pulmonary artery bulge. A nonselective angiocardiogram reveals poststenotic dilation of the main pulmonary artery. Treatment involves surgical correction of the stenosis.
21 CFR 211.113 - Control of microbiological contamination.
Code of Federal Regulations, 2011 CFR
2011-04-01
... shall include validation of all aseptic and sterilization processes. [43 FR 45077, Sept. 29, 1978, as... Process Controls § 211.113 Control of microbiological contamination. (a) Appropriate written procedures...
21 CFR 211.113 - Control of microbiological contamination.
Code of Federal Regulations, 2012 CFR
2012-04-01
... shall include validation of all aseptic and sterilization processes. [43 FR 45077, Sept. 29, 1978, as... Process Controls § 211.113 Control of microbiological contamination. (a) Appropriate written procedures...
21 CFR 211.113 - Control of microbiological contamination.
Code of Federal Regulations, 2014 CFR
2014-04-01
... shall include validation of all aseptic and sterilization processes. [43 FR 45077, Sept. 29, 1978, as... Process Controls § 211.113 Control of microbiological contamination. (a) Appropriate written procedures...
21 CFR 211.113 - Control of microbiological contamination.
Code of Federal Regulations, 2013 CFR
2013-04-01
... shall include validation of all aseptic and sterilization processes. [43 FR 45077, Sept. 29, 1978, as... Process Controls § 211.113 Control of microbiological contamination. (a) Appropriate written procedures...
Hong, Jennifer; Zaman, Rifat; Coy, Shannon; Pastel, David; Simmons, Nathan; Ball, Perry; Mirza, Sohail; Abdu, William; Pearson, Adam; Lollis, S Scott
2018-06-01
Although the primary goal of treatment of type II odontoid fracture is bony union, some advocate continued nonsurgical management of minimally symptomatic older patients who have fibrous union or minimal fracture motion. The risk of this strategy is unknown. We reviewed our long-term outcomes after dens nonunion to define the natural history of Type II odontoid fractures in elderly patients managed nonoperatively. A retrospective chart review of 50 consecutive adults aged 65 or older with Type II odontoid fracture initially managed nonsurgically from 1998 to 2012 at a single tertiary care institution was conducted. Particular attention was paid to patients who had orthosis removal despite absent bony fusion. Patients were contacted prospectively by telephone and followed until death, surgical intervention, or last known contact. Fifty patients initially were managed nonsurgically; of these, 21 (42.0%) proceeded to bony fusion, 3 (6%) underwent delayed surgery for persistent instability, and 26 (52%) had orthosis removal despite the lack of solid arthrodesis on imaging. The last group had a median follow-up of 25 months (range 4-158 months), with 20 of 26 (76.9%) followed until death. Of these patients, 1 patient developed progressive quadriplegia and dysphagia 11 months after initial injury. Compared with patients with spontaneous union, patients with nonunion had shorter life expectancy, despite no significant differences between the groups with respect to age, sex, injury mechanism, radiographic variables, or follow-up duration. Orthosis removal despite fracture nonunion may be reasonable in elderly patients with Type II dens fractures. Copyright © 2018 Elsevier Inc. All rights reserved.
Shen, Francis H; Samartzis, Dino
2007-07-01
A case report. To report the successful nonoperative management of a patient with progressive ankylosing spondylitis who sustained a three-column flexion-distraction injury of the upper thoracic spine with an intact sternal-rib complex, thereby emphasizing the existence and clinical relevance of the fourth-column concept in such patients. Three-column injuries of the cervical and lumbar spine are typically unstable and require surgical stabilization. Patients with ankylosing spondylitis are at an increase risk to sustain three-column injuries of the spine due to their progressive inflammatory disease, a state that renders the spine brittle and alters its biomechanical function. A fourth-column model of the thoracic spine has been proposed and incorporates the sternal-rib complex; however, such a model has rarely been addressed in the literature and its role regarding three-column upper thoracic spine injury with an intact sternal-rib complex in patients with ankylosing spondylitis is unknown. METHODS.: A 68-year-old white man with ankylosing spondylitis and Pickwickian body habitus sustained a three-column flexion-distraction injury at T5 following a ground-level fall. The patient complained of midthoracic back pain; however, he was neurologically intact and ambulated without aids. Because of the patient's numerous active medical issues that substantially increased his perioperative risks combined with symptomatic improvement of his pain, the patient refused surgical stabilization. In addition, because of the patient's body habitus and pulmonary issues, external brace immobilization was not tolerated. At 17 months of follow-up, the patient remained neurologically intact, ambulated well, his midthoracic back pain had subsided, and no progressive kyphosis was noted. This case confirms the existence and clinical relevance of the fourth column of the thoracic spine and its role in providing added spinal stability in the patient with ankylosing spondylitis. As such, it
Buhr, R J; Cason, J A; Rowland, G N
1997-11-01
Stunning and slaughter trials were conducted to evaluate the influence of stunning method (electrical 50 V alternating current, CO2 gas: 0 to 40% for 90 s or 40 to 60% for 30 s) on feather retention force (FRF) in commercial broilers. Feathers from the pectoral, sternal, and femoral feather tracts were sampled with a force gauge before stunning (ante-mortem) and contralaterally either after stunning (peri-mortem from 0.5 to 4 min) or after stunning and bleeding (post-mortem from 2 to 6 min). Prior to stunning, ante-mortem FRF values varied among assigned stunning methods only for the pectoral (7%) feather tract. After stunning, peri-mortem FRF values were higher only for the sternal tract (11% for 40 to 60% CO2 for 30 s); whereas after stunning and bleeding, post-mortem FRF values were lower than ante- or peri-mortem only for the sternal tract (10% lower for 40 to 60% CO2 for 30 s). Peri- and post-mortem FRF values did not differ among stunning methods for the pectoral and femoral feather tracts. Small changes in FRF values occurred from ante-mortem to peri-mortem (-1 to +12%), and from ante-mortem to post-mortem (-2 to +8%) across stunning methods. A significant increase was determined for only the pectoral tract (7%) from ante- to peri-mortem across stunning methods. Electrically stunned broilers that were not bled gained weight in excess of the 36 feathers removed (0.16%), apparently due to body surface water pickup during the brine-stunning process, whereas CO2-stunned broilers lost weight due to excretion of cloacal contents (-0.31 to -0.98%). The change in body weight among stunning methods was significant (P < 0.0233). Peri- and post-mortem FRF, in addition to bleed-out body weight loss, were not substantially influenced by electrical or CO2 stunning methods, and, therefore, carcass defeathering efficiency may not differ after scalding.
Krinner, Sebastian; Oppel, Pascal; Grupp, Sina; Schulz-Drost, Melanie; Hennig, Friedrich F.; Langenbach, Andreas
2018-01-01
Background Sternum fractures are mostly located on the sternal corpus, seldom on the manubrium. Fractures of the sternal manubrium are, however, more frequently associated with severe concomitant injuries of thoracic organs, and therefore deserve special attention. In addition, in its function as a capstone in between the anterior chest wall and the shoulder girdle, it is exposed to a multiplicity of forces. Therefore the questions arise what types of fractures are observed in today’s clinical practice, how to classify them and which treatment options are available. This study reports on different types of fractures which involve the manubrium sterni. Methods Between January 2012 and October 2014, data was collected from all severely injured patients (ISS ≥16), which received a CT scan of the thorax in our Level-I-Trauma Center and retrospectively analyzed concerning sternal fractures. Fracture type, collateral injuries, age, and information about the circumstances of the accident were noted. Results Of 890 evaluable patients, 154 (17.3%) had a fracture of the sternum and 23 (2.6%) of the manubrium. Fractures of the manubrium appeared in following types: A-type—transverse fracture (n=11) in 1st intercostal space by direct blunt trauma or flexion of the torso with sagittal instability; B-type—oblique fracture (n=9) by seat belt injury with rotatory instability; C-type—combined, more fragmentary fracture (n=3) by direct blunt trauma with simultaneous flexion of the torso and multi directional instability. Fractures only little dislocation were treated conservatively, and unstable fractures were surgically stabilized (n=10). Conclusions In summary, three main types of fractures could be found. A-type fractures were stabilized with a longitudinal plate osteosynthesis and B-type fractures with transverse positioned plates. To treat complex C-type fractures, plates with a T- or H-form could be a good solution. Level of evidence: Level III retrospective
42 CFR 485.725 - Condition of participation: Infection control.
Code of Federal Regulations, 2010 CFR
2010-10-01
... procedures for effective aseptic techniques. The procedures are reviewed annually and revised if necessary to... handled, stored, processed, and transported in such a manner as to prevent the spread of infection. (e...
Kallala, R F; Vanhegan, I S; Ibrahim, M S; Sarmah, S; Haddad, F S
2015-02-01
Revision total knee arthroplasty (TKA) is a complex procedure which carries both a greater risk for patients and greater cost for the treating hospital than does a primary TKA. As well as the increased cost of peri-operative investigations, blood transfusions, surgical instrumentation, implants and operating time, there is a well-documented increased length of stay which accounts for most of the actual costs associated with surgery. We compared revision surgery for infection with revision for other causes (pain, instability, aseptic loosening and fracture). Complete clinical, demographic and economic data were obtained for 168 consecutive revision TKAs performed at a tertiary referral centre between 2005 and 2012. Revision surgery for infection was associated with a mean length of stay more than double that of aseptic cases (21.5 vs 9.5 days, p < 0.0001). The mean cost of a revision for infection was more than three times that of an aseptic revision (£30 011 (sd 4514) vs £9655 (sd 599.7), p < 0.0001). Current NHS tariffs do not fully reimburse the increased costs of providing a revision knee surgery service. Moreover, especially as greater costs are incurred for infected cases. These losses may adversely affect the provision of revision surgery in the NHS. ©2015 The British Editorial Society of Bone & Joint Surgery.
High bacterial contamination rate of electrocautery tips during total hip and knee arthroplasty.
Abdelaziz, Hussein; Zahar, Akos; Lausmann, Christian; Gehrke, Thorsten; Fickenscher, Helmut; Suero, Eduardo M; Gebauer, Matthias; Citak, Mustafa
2018-04-01
The aim of the study was to quantify the bacterial contamination rate of electrocautery tips during primary total joint replacement (TJR), as well as during aseptic and septic revision TJR. A total of 150 electrocautery tips were collected between April and July 2017. TJR surgeries were divided into three groups: (1) primary, (2) aseptic and (3) septic revisions. In each group, a total of 50 electrocautery tips were collected. A monopolar electrocautery with a reusable stainless-steel blade tip was used in all cases. The rate of bacterial contamination was determined for all groups. Correlation of exposure time and type of surgery was analyzed. The overall bacterial contamination rate was 14.7% (95% CI 9.4 to 21.4%). The highest contamination rate occurred in the septic revision group (30.0%; 95% CI 17.9 to 44.6%), followed by the primary cases group (10.0%; 95% CI 3.3 to 21.8%) and the aseptic revision group (4.0%; 95% CI 0.5 to 13.7%). Exposure time did not affect the bacterial contamination rate. In 12 out of 15 (80%) contaminations identified in the septic group, we found the same causative microorganism of the prosthetic joint infection on the electrocautery tip. The bacterial contamination of the electrocautery tips is relatively high, especially during septic hip revision arthroplasty. Electrocautery tips should be changed after debridement of infected tissue.
Kim, Wanlim; Yoon, Pil Whan; Kwak, Hong Suk; Yoo, Jeong Joon; Kim, Hee Joong; Yoon, Kang Sup
2017-07-01
The high failure rate of cemented femoral components in the 1970s facilitated the improvement of the cementing technique and surface finishes such as polymethylmethacrylate (PMMA)-precoated stems, reporting a survival rate of >95% at 10 years from some studies. However, controversy persists regarding whether precoated femoral stems are associated with a longer revision-free prosthesis survival. The purpose of this study was to evaluate the clinical and radiological outcomes of PMMA-precoated femoral stems, and analyze factors associated with implant survival. We retrospectively reviewed 73 primary hybrid total hip arthroplasties performed using PMMA-precoated femoral stems. The mean age of the patients was 61 years. During the mean follow-up period of 13 years, 18 hips (24.7%) underwent aseptic loosening, and all of the loosened stems were subjected to revision surgery 8.8 years (range 4.6-15.5 years) from the index surgery. Younger age and poor cementing were significantly associated with aseptic loosening (P = 0.013 and P < 0.001, respectively). However, the aseptic loosening rate was also high at 13.1% even with a good cementing technique. In conclusion, the PMMA-precoated stem failed to show expected advantages and needs to be replaced with other surface finish stem designs. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1300-1306, 2017. © 2016 Wiley Periodicals, Inc.
Wolfaardt, Marianne; Büchner, Ané; Myburgh, Marcelle; Avenant, Theunis; du Plessis, Nicolette M; Taylor, Maureen B
2014-11-01
Human enteroviruses (HEVs) are the most common viral pathogen associated with paediatric aseptic meningitis. From October 2010 to February 2011 a cluster of HEV-associated meningitis cases was identified in paediatric patients who had presented at two large tertiary hospitals in Pretoria in the Tshwane Metropolitan Area, Gauteng, South Africa (SA). The aim of this study was to review the clinical features and to characterise the HEV strains associated with this cluster of meningitis cases. In this retrospective study HEVs, detected by real time reverse transcription-polymerase chain reaction in acute phase cerebrospinal fluid specimens from 30 patients with aseptic meningitis, were characterised and the clinical presentations of these patients were described. Fever (83%), headache (70%) and vomiting (67%) were the most prominent symptoms with signs of meningeal irritation recorded in 67% of the patients. There was a neutrophil predominance in the cerebrospinal fluid of 57% of the patients with pleocytosis. Based on partial nucleotide sequence analysis of the HEV viral protein 1 gene, echovirus (E) serotype 4 (E-4) was identified in 80% (24/30) of specimens with E-9 (3/30) and coxsackie virus B5 (1/30) detected less frequently. In this cluster of aseptic meningitis cases E-4 was the predominant strain with E-9, and to a lesser extent other HEVs, identified less frequently. Copyright © 2014 Elsevier B.V. All rights reserved.
21 CFR 522.2424 - Sodium thiamylal for injection.
Code of Federal Regulations, 2011 CFR
2011-04-01
... anesthetic in dogs, cats, swine, horses, and cattle. (2) When diluted aseptically to the desired...) Swine: 40 milligrams per 5 pounds of body weight. (iii) Horses: Light anesthesia, 1 gram per 500 pounds...
21 CFR 522.2424 - Sodium thiamylal for injection.
Code of Federal Regulations, 2010 CFR
2010-04-01
... anesthetic in dogs, cats, swine, horses, and cattle. (2) When diluted aseptically to the desired...) Swine: 40 milligrams per 5 pounds of body weight. (iii) Horses: Light anesthesia, 1 gram per 500 pounds...
Acute generalised exanthematous pustulosis.
Criton, S; Sofia, B
2001-01-01
Acute generalised exanthernatous pustulosis (AGEP) is a condition characterised by sudden onset of non-follicular aseptic pustules all over the body. It is distinct from pustular psoriasis with characteristic morphology, histopathology and evolution.
Dellatorre, Gerson; Castro, Caio César Silva de
2012-01-01
The SAPHO syndrome (synovitis, acne, pustulosis, hyperostosis and osteitis) includes a group of findings characterized by bone lesions usually located on the anterior chest wall, often associated with skin lesions. We report the case of a 47 years old patient, with osteochondritis at costoesternal and manubrium-sternal joints, besides of palmar-plantar pustulosis. The diagnosis is predominantly clinical and there are several treatment options described in the literature.
Leelahavanichkul, Asada; Pongpirul, Krit; Thongbor, Nisa; Worasilchai, Navaporn; Petphuak, Kwanta; Thongsawang, Bussakorn; Towannang, Piyaporn; Lorvinitnun, Pichet; Sukhontasing, Kanya; Katavetin, Pisut; Praditpornsilpa, Kearkiat; Eiam-Ong, Somchai; Chindamporn, Ariya; Kanjanabuch, Talerngsak
2016-01-01
♦ Aseptic, sheet-like foreign bodies observed inside Tenckhoff (TK) catheter lumens (referred to as "black particles") are, on gross morphology, hardly distinguishable from fungal colonization because these contaminants adhere tightly to the catheter. Detection of fungal cell wall components using (1→3)-β-d-glucan (BG) and galactomannan index (GMI) might be an alternative method for differentiating the particles. ♦ Foreign particles retrieved from TK catheters in 19 peritoneal dialysis patients were examined microscopically and cultured for fungi and bacteria. Simultaneously, a Fungitell test (Associates of Cape Cod, Falmouth, MA, USA) and a Platelia Aspergillus ELISA assay (Bio-Rad Laboratories, Marnes-La-Coquette, France) were used to test the spent dialysate for BG and GMI respectively. ♦ Of the 19 patients, 9 had aseptic black particles and 10 had fungal particles in their tubing. The fungal particles looked grainy, were tightly bound to the catheter, and appeared more "colorful" than the black particles, which looked sheet-like and could easily be removed by milking the tubing. Compared with effluent from patients having aseptic particles, effluent from patients with fungal particles had significantly higher levels of BG (501 ± 70 pg/mL vs. 46 ± 10 pg/mL) and GMI (10.98 ± 2.17 vs. 0.25 ± 0.05). Most of the fungi that formed colonies inside the catheter lumen were molds not usually found in clinical practice, but likely from water or soil, suggesting environmental contamination. Interestingly, in all 10 patients with fungal colonization, visualization of black particles preceded a peritonitis episode and TK catheter removal by approximately 1-3 weeks; in patients with aseptic particles, a 17-week onset to peritonitis was observed. ♦ In all patients with particle-coated peritoneal dialysis tubing, spent dialysate should be screened for BG and GMI. Manipulation of the TK catheter by squeezing, hard flushing, or even brushing to dislodge black
Lamont, Byron B.; Pérez-Fernández, María
2016-01-01
Background Root clusters are bunches of hairy rootlets produced by >1800 species in nine families. The possible involvement of micro-organisms in root-cluster formation has produced conflicting results over the last 40 years. In addition, any effect of rhizobacteria on overall plant growth of root-cluster-bearing species remains unknown. Aims To evaluate the effect of seven rhizobacteria on total plant size, and relative cluster production, by three species, and relate outcomes to their indole-3-acetic acid (IAA)-producing ability as part explanation of past disparate results. Methods We grew Leucadendron salicifolium (from South Africa), Viminaria juncea (Australia) and Lupinus albus (Europe) in gnotobiotic, hydroponic culture at two nitrogen (N) levels and inoculated them with seven bacterial strains and harvested the plants after 13 weeks. Key Results Following inoculation with all seven bacteria individually, plant growth sometimes greatly exceeded that of the aseptic controls, but, under other conditions, growth was less than the controls. Leucadendron and Lupinus failed to produce root clusters in the –N aseptic controls and Viminaria in the +N controls that was overcome by inoculating them with selected bacteria. Six bacteria were able to induce far more root clusters than those of the aseptic controls, while all bacteria sometimes suppressed cluster production in other treatments. All nine possible combinations of resource (plant size, indirect) and morphogenetic (relative cluster production, direct) effects were represented among the results, especially positive synergism (larger plants with a greater density of clusters). There was no clear relationship with IAA-producing ability of the seven bacteria, but low IAA strains of Pseudomonas putida and Bacillus magetarium were associated with greatest cluster production. Conclusions While root-cluster formation can sometimes be induced by introducing rhizobacteria to aseptic culture, the growth
Suvikas-Peltonen, Eeva; Palmgren, Joni; Häggman, Verner; Celikkayalar, Ercan; Manninen, Raija; Airaksinen, Marja
2017-01-01
On the hospital wards in Finland, nurses generally reconstitute intravenous medicines, such as antibiotics, analgesics, and antiemetics prescribed by doctors. Medicine reconstitution is prone to many errors. Therefore, it is important to identify incorrect practices in the reconstitution of medicine to improve patient safety in hospitals. The aim of this study was to audit the compounding and reconstituting of intravenous medicines on hospital wards in a secondary-care hospital in Finland by using an assessment tool and microbiological testing for identifying issues posing patient safety risks. A hospital pharmacist conducted an external audit by using a validated 65-item assessment tool for safe-medicine compounding practices on 20 wards of the selected hospital. Also, three different microbiological samples were collected to assure the aseptics. Practices were evaluated using a four-point rating scale of "never performed," "rarely performed," "often performed," and "always performed," and were based on observation and interviews with nurses or ward pharmacists. In addition, glove-, settle plate-, and media fill-tests were collected. Associations between microbial sample results and audit-tool results were discussed. Altogether, only six out of the 65 items were fully implemented in all wards; these were related to logistic practices and quality assurance. More than half of the wards used incorrect practices ("rarely performed" or "never performed") for five items. Most of these obviated practices related to aseptic practices. All media-fill tests were clean but the number of colony forming units in glove samples and settle- plate samples varied from 0 to >100. More contamination was found in wards where environmental conditions were inadequate or the use of gloves was incorrect. Compounding practices were [mostly] quite well adapted, but the aseptic practices needed improvement. Attention should have been directed particularly to good aseptic techniques and
The sternalis muscle in the Bulgarian population: classification of sternales
JELEV, L.; GEORGIEV, G.; SURCHEV, L.
2001-01-01
The sternalis muscle (musculus sternalis) is the name usually given to this common anatomical variant, but the terms ‘episternalis’, ‘presternalis’, ‘sternalis brutorum’, ‘rectus thoracis’, ‘rectus sterni’, ‘superficial rectus abdominis’ and ‘japonicus’ have also been used in the literature (for reviews see Le Double, 1879; Calori, 1888; Pichler, 1911; Blees, 1968). According to Turner (1867), Cabrolius was the first, in 1604, to describe sternalis. Nevertheless this muscle is often unknown even in clinical practice (Bailey & Tzarnas, 1999; Vandeweyer, 1999). Thus far, investigations on the incidence of sternalis have been made both in large populations such as the American (Barlow, 1935) and small populations, for example in Taiwan (Shen et al. 1992; Jeng & Su, 1998). In Europe, all studies on the frequency of this muscle have been made amongst subpopulations in Western (e.g. Cunningham, 1888; Le Double, 1890, 1897) and Northern Europe (Gruber, 1860) although the reported frequencies have been quite different. There is a lack of information about sternalis in Eastern European populations. We therefore present data from a study on the incidence of sternalis muscle in Bulgaria. PMID:11554516
Kikuchi-Fujimoto disease: an unusual association with acute renal failure.
Silva, Amanda Feliciano da; Focaccia, Roberto; Oliveira, Allan Constantino de; Sementilli, Angelo; Reis, Gelvana Flávio Barreto
2010-01-01
Kikuchi-Fujimoto disease, also known as histiocytic necrotizing lymphadenitis of unknown etiopathogenesis, is a self-limited disease which frequently appears as feverish lymphadenomegaly, thus creating the need for differential diagnosis with lymphoma, systemic lupus erythematosus (SLE), infectious mononucleosis, cat-scratch disease, and toxoplasmosis with lymphonodal impairment. However, there are cases in which it may evolve with complications such as aseptic meningitis, cerebellar ataxia, and aseptic myocarditis. We are presenting a case of a 24-year-old man who had an initial picture of arthralgia, evening fever and adenomegaly. Kikuchi disease was diagnosed through lymph node biopsy with immunohistochemistry and evolves with severe systemic manifestations, such as pericarditis with cardiac tamponade, pneumonitis, hepatitis, and acute kidney failure - the latter has not been reported in literature yet. There was significant improvement of the clinical picture with prednisone.
[Use and versatility of titanium for the reconstruction of the thoracic wall].
Córcoles Padilla, Juan Manuel; Bolufer Nadal, Sergio; Kurowski, Krzysztof; Gálvez Muñoz, Carlos; Rodriguez Paniagua, José Manuel
2014-02-01
Chest wall deformities/defects and chest wall resections, as well as complex rib fractures require reconstruction with various prosthetic materials to ensure the basic functions of the chest wall. Titanium provides many features that make it an ideal material for this surgery. The aim is to present our initial results with this material in several diseases. From 2008 to 2012, 14 patients were operated on and titanium was used for reconstruction of the chest wall. A total of 7 patients had chest wall tumors, 2 with sternal resection, 4 patients with chest wall deformities/defects and 3 patients with severe rib injury due to traffic accident. The reconstruction was successful in all cases, with early extubation without detecting problems in the functionality of the chest wall at a respiratory level. Patients with chest wall tumors including sternal resections were extubated in the operating room as well as the chest wall deformities. Chest trauma cases were extubated within 24h from internal rib fixation. There were no complications related to the material used and the method of implementation. Titanium is an ideal material for reconstruction of the chest wall in several clinical situations allowing for great versatility and adaptability in different chest wall reconstructions. Copyright © 2013 AEC. Published by Elsevier Espana. All rights reserved.
Martín Arias, Luis H; García Ortega, Pilar; Sáinz Gil, María; Navarro García, Ester; Treceño Lobato, Carlos; Delgado Armas, Virginia
2017-12-01
A 55-year-old woman developed an atraumatic sternum fracture during treatment with alendronate for osteoporosis. The woman received alendronate 70 mg in combination with cholecalciferol 5600 IU once weekly, as well as nonsteroidal anti-inflammatory drugs. After 4 years of treatment, following a dorsal flexion with no direct thoracic trauma, the patient suffered a fracture of the sternum, with an X-ray revealing sternal body fracture. This fracture was seen to be transverse, noncomminuted and without displacement. Magnetic resonance imaging was carried out to rule out the presence of either a pathological fracture or a fracture resulting from osteoporotic fragility, and showed a triple sternal fracture involving the body, as well as the upper and lower manubrium of the sternum. This fracture presented the features of an atypical femur fracture, except for the location. The alendronate and cholecalciferol combination was discontinued and denosumab was prescribed. After the withdrawal of alendronate, the patient showed clinical improvement, with a decrease in pain, and is currently having routine checkups. The causality algorithm of the Spanish Pharmacovigilance System shows a score of 5, indicating a possible relationship between the patient's sternum fracture and her use of the suspect drug (Naranjo scale 6 = probable).
Sex pheromone and trail pheromone of the sand termite Psammotermes hybostoma.
Sillam-Dussès, David; Hanus, Robert; Abd El-Latif, Ashraf Oukasha; Jiroš, Pavel; Krasulová, Jana; Kalinová, Blanka; Valterová, Irena; Sobotník, Jan
2011-02-01
Within the complex network of chemical signals used by termites, trail pheromones and sex pheromones are among the best known. Numerous recent papers map the chemical identity and glandular origin of these pheromones in nearly all major isopteran taxa. In this study, we aimed to describe the sex pheromone and the trail pheromone of a poorly known sand termite, Psammotermes hybostoma. We identified (3Z,6Z,8E)-dodeca-3,6,8-trien-1-ol (dodecatrienol) as the sex pheromone released by tergal and sternal glands of female imagos and, at the same time, as the trail pheromone secreted from the sternal gland of workers. We conclude that chemical communication in Psammotermes does not differ from that of most other Rhinotermitidae, such as Reticulitermes, despite the presence of a diterpene as a major component of the trail pheromone of Prorhinotermes to which Psammotermes is presumed to be phylogenetically close. Our findings underline once again the conservative nature of chemical communication in termites, with dodecatrienol being a frequent component of pheromonal signals in trail following and sex attraction and, at the same time, a tight evolutionary relationship between the trail following of working castes and the sex attraction of imagos.
Harjula, A; Järvinen, A; Mattila, S; Porkka, L
1985-01-01
Single photon emission computerized tomography (SPECT) was performed thrice in ten patients undergoing open-heart surgery--preoperatively and 2 and 12 weeks postoperatively. The operations were done for ischemic heart disease (5), aortic valvular stenosis (2), aortic valvular insufficiency (1), leaking mitral prosthetic valve (1) and combined aortic and mitral valvular stenosis and insufficiency (1). The healing process in the longitudinally divided sternum was evaluated from the SPECT study. Four conventional static images in two dimensions were registered in anteroposterior, posteroanterior and left and right lateral projections. A tomographic study was done. Quantitative analyses were performed. The ratio of the sternal counts to the counts from a thoracic vertebra was calculated for use as a reference. The activity ratios showed a similar pattern in six cases, with initial increases and at 12 weeks slight decrease compared with the preoperative values. In two cases the activity was still increasing after 12 postoperative weeks. One patient, with sternotomy also one year previously, showed only slightly increased activity. The activity at the areas of the sternal wires was increased in six cases. The study thus revealed differing patterns of isotope uptake, although recovery was uneventful in all patients. The differences may reflect the possibility that the operative course and the preoperative clinical status can influence the healing mechanisms.
Recovery from desflurane anesthesia in horses with and without post-anesthetic xylazine.
Aarnes, Turi K; Bednarski, Richard M; Bertone, Alicia L; Hubbell, John A E; Lerche, Phillip
2014-04-01
The objective of this study was to compare recovery from desflurane anesthesia in horses with or without post-anesthetic xylazine. Six adult horses were anesthetized on 2 occasions, 14 d apart using a prospective, randomized crossover design. Horses were sedated with xylazine, induced to lateral recumbency with ketamine and diazepam, and anesthesia was maintained with desflurane. One of 2 treatments was administered intravenously at the end of anesthesia: xylazine [0.2 mg/kg body weight (BW)] or an equivalent volume of saline. Recovery parameters were recorded and assessed by 2 blinded observers. A Wilcoxon signed-rank test was used to analyze recovery data. Heart rate, arterial blood pressures, and arterial blood gas data were analyzed using 2-way analysis of variance (ANOVA) for repeated measures. Values of P < 0.05 were considered significant. Duration of anesthesia was not different between groups. Administration of xylazine at the end of desflurane anesthesia was associated with significantly longer times to first movement, endotracheal tube removal, first attempt to achieve sternal recumbency, sternal recumbency, first attempt to stand, and standing. Number of attempts to stand and quality of recovery scores were not different between groups. Administering xylazine after desflurane anesthesia resulted in longer recovery times. Recovery scores were not significantly different between groups.
Recovery from desflurane anesthesia in horses with and without post-anesthetic xylazine
Aarnes, Turi K.; Bednarski, Richard M.; Bertone, Alicia L.; Hubbell, John A.E.; Lerche, Phillip
2014-01-01
The objective of this study was to compare recovery from desflurane anesthesia in horses with or without post-anesthetic xylazine. Six adult horses were anesthetized on 2 occasions, 14 d apart using a prospective, randomized crossover design. Horses were sedated with xylazine, induced to lateral recumbency with ketamine and diazepam, and anesthesia was maintained with desflurane. One of 2 treatments was administered intravenously at the end of anesthesia: xylazine [0.2 mg/kg body weight (BW)] or an equivalent volume of saline. Recovery parameters were recorded and assessed by 2 blinded observers. A Wilcoxon signed-rank test was used to analyze recovery data. Heart rate, arterial blood pressures, and arterial blood gas data were analyzed using 2-way analysis of variance (ANOVA) for repeated measures. Values of P < 0.05 were considered significant. Duration of anesthesia was not different between groups. Administration of xylazine at the end of desflurane anesthesia was associated with significantly longer times to first movement, endotracheal tube removal, first attempt to achieve sternal recumbency, sternal recumbency, first attempt to stand, and standing. Number of attempts to stand and quality of recovery scores were not different between groups. Administering xylazine after desflurane anesthesia resulted in longer recovery times. Recovery scores were not significantly different between groups. PMID:24688171
Operative fixation of chest wall fractures: an underused procedure?
Richardson, J David; Franklin, Glen A; Heffley, Susan; Seligson, David
2007-06-01
Chest wall fractures, including injuries to the ribs and sternum, usually heal spontaneously without specific treatment. However, a small subset of patients have fractures that produce overlying bone fragments that may produce severe pain, respiratory compromise, and, if untreated mechanically, result in nonunion. We performed open reduction and internal fixation on seven patients with multiple rib fractures-five in the initial hospitalization and two delayed--as well as 35 sternal fractures (19 immediate fixation and 16 delayed). Operative fixation was accomplished using titanium plates and screws in both groups of patients. All patients with rib fractures did well; there were no major complications or infections, and no plates required removal. Clinical results were excellent. There was one death in the sternal fracture group in a patient who was ventilator-dependent preoperatively and extubated himself in the early postoperative period. Otherwise, the results were excellent, with no complications occurring in this group. Three patients had their plates removed after boney union was achieved. No evidence of infection or nonunion occurred. The excellent results achieved in the subset of patients with severe chest wall deformities treated initially at our institution and those referred from outside suggest that operative fixation is a useful modality that is likely underused.
... humerus). Knees. Shoulders. Ankles. It is also called: Avascular necrosis. Aseptic necrosis. Ischemic necrosis. Who gets it? Anyone ... Fast Facts Oral Health and Bone Disease Osteonecrosis (Avascular Necrosis), Questions and Answers about Last Reviewed: 10/30/ ...
ASEPTIC INFLAMMATION IN THE LUNGS IN ACUTE RADIATION SICKNESS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ivanov, A.E.
1963-09-01
Inflammation in the lungs of irradiated rabbits at the site of turpentine injection has much in common with the inflammatory changes arising in other tissues and organs during local irradiation or acute radiation sickness. The fact that the inflammatory changes under different conditions of irradiation are similar in type regardless of the character of the inflammatory agent suggests that the phenomenon has a common mechanism. The absence of polymorphonuclear (eosinophtlic) leukocytes from inflammatory foci in irradiated rabbits is due not only to the developing leukopenia, but also to a disturbance of the leukocyte emigration process into the inflammatory focus. Inmore » irradiated rabbits in cortrast to the controls, the normal arrangement of the fibrous structures is preserved in the necrotic lung tissue at the site of turpentine injection. In animals with severe acute radiation sickness induced by external irradiation in sublethal doses, the ability of the organism to respond to introduction of an inflammatory agent by an increase in the number of leukocytes in the blood and by a rise of the body temperature is to some extent preserved. (auth)« less
Synoviocyte-packaged Chlamydia trachomatis induces a chronic aseptic arthritis.
Inman, R D; Chiu, B
1998-01-01
The basic mechanisms underlying reactive arthritis and specifically the joint injury that follows intra-articular Chlamydia trachomatis infection have not been defined. The present study addresses this question through the development of an experimental model. Stable cell lines were generated from synoviocytes harvested from the knee joints of Lewis rats. The synoviocytes were cocultivated with C. trachomatis to allow invasion by the microbe and were then transferred by intra-articular injection into the knee joints of Lewis rats. The ensuing arthritis could be subdivided into an early phase (= 14 d) and a late phase. The early phase was characterized by intense, primarily neutrophilic, synovitis; accelerated cartilage injury; dissemination of Chlamydia to liver and spleen; and viable Chlamydia in the joints. The late phase was marked by mixed mononuclear lymphocyte infiltration in the joint; dysplastic cartilage injury and repair; absence of viable organisms; and development of a distinctive humoral response. Western blot analysis comparing reactive arthritis patients to the experimental model indicates that candidate arthritogenic chlamydial antigens are comparable between the two. This model demonstrates that an intense synovitis can be induced by this intracellular pathogen, and that chronic inflammation can persist well beyond the culture-positive phase. Furthermore, these data show that the synoviocyte is a suitable host cell for C. trachomatis and can function as a reservoir of microbial antigens sufficient to perpetuate joint injury. PMID:9819362
2009-01-01
that chronic disease resulting from C. burnetii infection may be the first time Q fever is diagnosed in some patients. Although endocarditis is the most...Microbiol 2006;6:2. [13] Fenollar F, Fournier PE, Raoult D. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis ...automated DNA preparation. BMC Microbiol 2008;8:77. [33] Ghassemi M, Agger WA, Vanscoy RE, Howe GB. Chronic sternal wound infection and endocarditis with
2007-04-01
man with a single episode of vague sub- sternal chest pain was referred for evaluation of possible coronary artery disease. His medical history was...significant for hypertension and type-II diabetes mellitus. The patient had no prior history of thoracic trauma or surgery. During an exercise...Figure 1A; oblique, Figure 1B), the left circumflex artery was identified by its black central lumen and noted to arise normally from the left main
1985-07-01
cervical spine; *an axisymmetric finite element analysis of a lumbar vertebral body with comparisons to other models and sJEecific attention to the...AXISYMMETRIC FINITE ELEMENT ANALYSIS OF A LUMBAR VERTEBRAL BODY 37 Model 40 Stress Nomenclature 42 Comparison of Models C and S 47 Comparison with Earlier...left and right sides. Each side of the diaphragm arises as one sternal slip, six costal slips and one lumbar slip. Accordingly, the origin of the
Spool-like stent for the open sternum after cardiac operations.
Satoh, H; Sakai, K; Koyama, M; Matsuda, H
1997-02-01
Severe edematous heart after a cardiac operation is impossible to treat if there is compression of the heart due to the sternum. In these patients delayed sternal closure may be a useful procedure until the heart decreases in size. We devised a spool-like stent for the open sternum to maintain the optimal cardiac space for the severely edematous heart and to fix the chest wall to allow for management while the sternum is open.
Ahmed, Ruhi; Baseman, Harold; Ferreira, Jorge; Genova, Thomas; Harclerode, William; Hartman, Jeffery; Kim, Samuel; Londeree, Nanette; Long, Michael; Miele, William; Ramjit, Timothy; Raschiatore, Marlene; Tomonto, Charles
2008-01-01
In July 2006 the Parenteral Drug Association's Risk Management Task Force for Aseptic Processes, conducted an electronic survey of PDA members to determine current industry practices regarding implementation of Quality Risk Management in their organizations. This electronic survey was open and publicly available via the PDA website and targeted professionals in our industry who are involved in initiating, implementing, or reviewing risk management programs or decisions in their organizations. One hundred twenty-nine members participated and their demographics are presented in the sidebar "Correspondents Profile". Among the major findings are: *The "Aseptic Processing/Filling" operation is the functional area identified as having the greatest need for risk assessment and quality risk management. *The most widely used methodology in industry to identify risk is Failure Mode and Effects Analysis (FMEA). This tool was most widely applied in assessing change control and for adverse event, complaint, or failure investigations. *Despite the fact that personnel training was identified as the strategy most used for controlling/minimizing risk, the largest contributors to sterility failure in operations are still "Personnel". *Most companies still rely on "Manufacturing Controls" to mitigate risk and deemed the utilization of Process Analytical Technology (PAT) least important in this aspect. *A majority of correspondents verified that they did not periodically assess their risk management programs. *A majority of the correspondents desired to see case studies or examples of risk analysis implementation (as applicable to aseptic processing) in future PDA technical reports on risk management.
Effects of Prosthesis Stem Tapers on Stress Distribution of Cemented Hip Arthroplasty
NASA Astrophysics Data System (ADS)
Abdullah, Abdul Halim; Nor, Mohd Asri Mohd; Saman, Alias Mohd; Tamin, Mohd Nasir; Kadir, Mohammed Rafiq Abdul
2010-10-01
Aseptic loosening effects are critical issues in encouraging long term stability of cemented hip arthroplasty. Stress shielding is believed to be an important factor that contributes to the aseptic loosening problems. The numerous changes in the prosthesis stem design are intended to minimize the stress shielding and aseptic loosening problems and to improve the long term performance of the implants. In this study, the stress distribution in cemented hip arthroplasty is established using finite element method. The taper of the prosthesis is designed to be 3° at anterior/posterior, 3° at medial/lateral and 10° from wide lateral to narrow medial. Major muscle loads and contact forces are simulated for walking (toe-off phase) and stair climbing load cases. Effects of prosthesis stem tapers on the resulting stress distribution are investigated. Results show that compressive stress dominates in the medial plane while tensile stress in the lateral plane of the femur. The corresponding stress levels of intact femur for walking and stair-climbing load cases are 22 and 29 MPa, respectively. The magnitude of Tresca stress for the THA femur in stair-climbing load case remains higher in the region of 85 MPa while the walking load case induces around 40 MPa. The stress range in the straight and single taper stem prosthesis is lower than 260 MPa, while localized Tresca stress is in the order of the yield strength of Ti-6Al-4V alloy for double and triple taper stem design.
Measurement of Interleukin-6 in Cerebrospinal Fluid for the Diagnosis of Bacterial Meningitis.
Dano, Ibrahim Dan; Sadou, Hassimi; Issaka, Bassira; Oukem-Boyer, Odile Ouwe Missi
It is assessed whether the measurement of interleukin-6 in the cerebrospinal fluid can serve as a biomarker for the diagnosis of bacterial meningitis. Cerebrospinal fluid was obtained from 152 patients aged 0-15 years suspected of having meningitis. These patients were classified into the following groups: Bacterial meningitis (n = 85), aseptic meningitis (n = 35) and non-meningitis/control (n = 32) based on leukocyte count and bacterial identification by culture and molecular biology. Interleukin-6 concentrations in cerebrospinal fluid were measured by enzyme-linked immunosorbent assay. This study found a significant difference of the mean cerebrospinal fluid interleukin-6 level (p≤0.01) between patients with bacterial meningitis (3,538.69±2,560.78 pg mL -1) and patients with aseptic meningitis (332.51±470.69 pg mL -1) or those of the control group (205.83±79.39 pg mL -1). There was also a significant difference of the mean cerebrospinal fluid interleukin-6 level between patients with aseptic meningitis and those of the control group. Interleukin-6 had the highest area under the ROC curve: 0.94 (95% confidence interval: 0.901-0.979) compared to that of cerebrospinal fluid glucose and total protein. At a cut-off value of 1,065.96 pg mL -1, interleukin-6 had a sensitivity of 76.2% and specificity of 100%. Interleukin-6 is a potential biomarker for the differential diagnosis of meningitis.
Phan, Kevin; Maharaj, Monish; Assem, Yusuf; Mobbs, Ralph J
2016-09-01
Lumbar interbody fusion represents an effective surgical intervention for patients with lumbar degenerative diseases, spondylolisthesis, disc herniation, pseudoarthrosis and spinal deformities. Traditionally, conventional open anterior lumbar interbody fusion and posterior/transforaminal lumbar interbody fusion techniques have been employed with excellent results, but each with their own advantages and caveats. Most recently, the antero-oblique trajectory has been introduced, providing yet another corridor to access the lumbar spine. Termed the oblique lumbar interbody fusion, this approach accesses the spine between the anterior vessels and psoas muscles, avoiding both sets of structures to allow efficient clearance of the disc space and application of a large interbody device to afford distraction for foraminal decompression and endplate preparation for rapid and thorough fusion. This review aims to summarize the early clinical results and complications of this new technique and discusses potential future directions of research. Copyright © 2016 Elsevier Ltd. All rights reserved.
Early follow-up of a custom non-fluted diaphyseal press-fit tumour prosthesis.
O'Donnell, Patrick W; Griffin, Anthony M; Eward, William C; Sternheim, Amir; Wunder, Jay S; Ferguson, Peter C
2014-01-01
The objective of this study was to evaluate the early results of a custom non-fluted diaphyseal press-fit stem for use with the global modular replacement system (GMRS) tumour prosthesis and the early complications associated with this implant. A total of 53 patients (54 implants) were identified from a prospective database where a custom non-fluted diaphyseal press-fit stem was used as part of the reconstruction of the limb. All patients had a minimum of 22 months of follow-up. The rates of stem revision for any reason were calculated. The median follow-up was 36 months (range 22-85 months). Aseptic loosening was not observed in any patient. At early term follow-up, an uncemented non-fluted stem used with the GMRS tumour endoprosthesis provides a stable bone-prosthesis interface with no evidence of aseptic loosening.
Survival of primary condylar-constrained total knee arthroplasty at a minimum of 7 years.
Maynard, Lance M; Sauber, Timothy J; Kostopoulos, Vasileios K; Lavigne, Gregory S; Sewecke, Jeffrey J; Sotereanos, Nicholas G
2014-06-01
The purpose of the present study is to retrospectively analyze clinical and radiographic outcomes in primary constrained condylar knee arthroplasty at a minimum follow-up of 7 years. Given the concern for early aseptic loosening in constrained implants, we focused on this outcome. Our cohort consists of 127 constrained condylar knees. The mean age of patients in the study was 68.3 years, with a mean follow-up of 110.7 months. The diagnosis was primary osteoarthritis in 92%. There were four periprosthetic distal femur fractures, with a rate of revision of 0.8%. No implants were revised for aseptic loosening. Kaplan-Meier survivorship analysis with removal of any component as the end point revealed that the 10-year rate of survival of the primary CCK was 97.6% (95% CI, 94%-100%). Copyright © 2014. Published by Elsevier Inc.
The radiation enhancement of the sterility assurance levels of sterile fluids — A case study
NASA Astrophysics Data System (ADS)
Plessis, T. A. Du.; Rosekilly, I. C.
1995-02-01
A study was undertaken to determine the effect of low-dose gamma irradiation on aseptically admixed total parenteral nutrition (TPN) solutions to which large inocula of three test bacterial species, recognised as common contaminants of these products, were added. Attainable SALs of TPN solutions containing test bacteria were subsequently calculated. Results showed that a minimum absorbed radiation dose as low as 1.5 kGy improved the SAL of aseptically prepared TPN solutions from a SAL of 10 -3 to a value of less than 10 -8 for the microorganisms investigated. No measurable changes in amino acid, electrolyte, glucose and lipid components of the solutions were detected up to a dose of 8.3 kGy. Practical experience applying this radiation treatment of TPNs rendered excellent results leading to the routine application of the process in South Africa.
Avascular necrosis; Bone infarction; Ischemic bone necrosis; AVN; Aseptic necrosis ... Osteonecrosis occurs when part of the bone does not get blood and dies. After a while, the bone can collapse. If osteonecrosis is not treated, the joint deteriorates, leading ...
Oral Steroids (Steroid Pills and Syrups)
... compressions, especially of the backbone and the hip Loss of blood supply to bones (aseptic necrosis) may cause severe bone pain and may require surgical correction Bones To prevent osteoporosis (loss of calcium in the bones), it is important ...
A Course in... Biochemical Engineering.
ERIC Educational Resources Information Center
Ng, Terry K-L.; And Others
1988-01-01
Describes a chemical engineering course for senior undergraduates and first year graduate students in biochemical engineering. Discusses five experiments used in the course: aseptic techniques, dissolved oxygen measurement, oxygen uptake by yeast, continuous sterilization, and cultivation of microorganisms. (MVL)
Practical Tips for the Safe Handling of Micro-organisms in Schools
ERIC Educational Resources Information Center
Holt, G.
1974-01-01
Outlines safe laboratory procedures for the handling of micro-organisms including aseptic technique, manipulation of cultures, and treatment of contaminated equipment. Identifies the principal hazard as the microbial aerosol, explains its possible effects, and describes the appropriate precautions. (GS)
Liebsch, Christian; Graf, Nicolas; Wilke, Hans-Joachim
2017-05-01
The influence of the anterior rib cage on the stability of the human thoracic spine is not completely known. One of the most common surgical interventions on the anterior rib cage is the longitudinal median sternotomy and its fixation by wire cerclage. Therefore, the purpose of this in vitro study was to examine, if wire cerclage can restore the stability of the human thoracic spine after longitudinal median sternotomy. Six fresh frozen human thoracic spine specimens (C7-L1, 56 years in average, range 50-65), including the intact rib cage without intercostal muscles, were tested in a spinal loading simulator and monitored with an optical motion tracking system. While applying 2 Nm pure moment in flexion/extension (FE), lateral bending (LB), and axial rotation (AR), the range of motion (ROM) and neutral zone (NZ) of the functional spinal units of the thoracic spine (T1-T12) were studied (1) in intact condition, (2) after longitudinal median sternotomy, and (3) after sternal closure using wire cerclage. The longitudinal median sternotomy caused a significant increase of the thoracic spine ROM relative to the intact condition (FE: 12° ± 5°, LB: 18° ± 5°, AR: 25° ± 10°) in FE (+12 %) and AR (+22 %). As a result, the sagittal cut faces of the sternum slipped apart visibly. Wire cerclage fixation resulted in a significant decrease of the ROM in AR (-12 %) relative to condition after sternotomy. ROM increased relative to the intact condition, in AR even significantly (+8 %). The NZ showed a proportional behavior compared to the ROM in all loading planes, but it was distinctly higher in FE (72 %) and in LB (82 %) compared to the ROM than in AR (12 %). In this in vitro study, the longitudinal median sternotomy resulted in a destabilization of the thoracic spine and relative motion of the sternal cut faces, which could be rectified by fixation with wire cerclage. However, the stability of the intact condition could not be reached. Nevertheless, a
Dunham, C Michael; Hileman, Barbara M; Ransom, Kenneth J; Malik, Rema J
2015-01-01
We hypothesized that lung injury and rib cage fracture quantification would be associated with adverse outcomes. Consecutive admissions to a trauma center with Injury Severity Score ≥ 9, age 18-75, and blunt trauma. CT scans were reviewed to score rib and sternal fractures and lung infiltrates. Sternum and each anterior, lateral, and posterior rib fracture was scored 1 = non-displaced and 2 = displaced. Rib cage fracture score (RCFS) = total rib fracture score + sternal fracture score + thoracic spine Abbreviated Injury Score (AIS). Four lung regions (right upper/middle, right lower, left upper, and left lower lobes) were each scored for % of infiltrate: 0% = 0; ≤ 20% = 1, ≤ 50% = 2, > 50% = 3; total of 4 scores = lung infiltrate score (LIS). Of 599 patients, 193 (32%) had 854 rib fractures. Rib fracture patients had more abdominal injuries (p < 0.001), hemo/pneumothorax (p < 0.001), lung infiltrates (p < 0.001), thoracic spine injuries (p = 0.001), sternal fractures (p = 0.0028) and death or need for mechanical ventilation ≥ 3 days (Death/Vdays ≥ 3) (p < 0.001). Death/Vdays ≥ 3 was independently associated with RCFS (p < 0.001), LIS (p < 0.001), head AIS (p < 0.001) and abdominal AIS (p < 0.001). Of the 193 rib fracture patients, Glasgow Coma Score 3-12 or head AIS ≥ 2 occurred in 43%. A lung infiltrate or hemo/pneumothorax occurred in 55%. Thoracic spine injury occurred in 23%. RCFS was 6.3 ± 4.4 and Death/Vdays ≥ 3 occurred in 31%. Death/Vdays ≥ 3 rates correlated with RCFS values: 19% for 1-3; 24% for 4-6; 42% for 7-12 and 65% for ≥ 13 (p < 0.001). Death/Vdays ≥ 3 was independently associated with RCFS (p = 0.02), LIS (p = 0.001), head AIS (p < 0.001) and abdominal AIS (p < 0.001). Death/Vdays ≥ 3 association was better for RCFS (p = 0.005) than rib fracture score (p = 0.08) or number of fractured ribs (p = 0.80). Rib fracture patients have increased risk for truncal injuries and adverse outcomes. Adverse outcomes are independently
Effects of mating behaviour and the ovarian follicular state of female alpacas on conception.
Vaughan, J L; Macmillan, K L; Anderson, G A; D'Occhio, M J
2003-01-01
To determine relationships between mating behaviour, ovarian follicular state and successful conception in receptive female alpacas. Seventy pen matings were observed at a commercial alpaca stud in south-western Victoria. The behaviours observed included time taken to assume sternal recumbency, mating duration, and evidence of nonreceptive behaviour such as spitting, kicking and vocalisation. Ovarian follicular state was determined by ultrasonography, which was complemented by measuring plasma concentrations of oestradiol and progesterone. Pregnancies were confirmed by transabdominal ultrasonography between days 45 and 80 after mating. There were no significant differences between receptive females that conceived and those that failed to conceive in the time taken to adopt the copulation position of sternal recumbency, mating duration, or maximum follicle diameter. There was no significant relationship between time taken to assume sternal recumbency (log10) and maximum follicle diameter or plasma oestradiol (log10). However, there was a significant quadratic relationship between plasma oestradiol concentration (log10) and follicle diameter, and the probability of pregnancy increased as the plasma concentration of oestradiol (log10) at the time of mating increased. Females were sexually receptive most of the time in the absence of a corpus luteum, and regardless of size of the largest follicle or plasma concentration of oestradiol. Breed (Huacaya vs Suri), site of the dominant follicle (left or right ovary), lactation state, number of matings by the male (1 or 2), or interval between parturition and mating, did not affect pregnancy outcome. Follicles with a diameter less than 7 mm were able to ovulate in response to mating. This was smaller than previously reported. Thirty-four pregnancies (49% pregnancy rate) resulted in 30 (88%) births with a gestation length of 343 days (SEM +/- 2, range 316-367 days). There were 4 (12%) abortions between days 45 and 80 of
Imageological measurement of the sternoclavicular joint and its clinical application.
Li, Ming; Wang, Bo; Zhang, Qi; Chen, Wei; Li, Zhi-Yong; Qin, Shi-Ji; Zhang, Ying-Ze
2012-01-01
Dislocation of the sternoclavicular joint is rare. However, posterior dislocation compressing important structures in the mediastinum may be fatal. Early diagnosis and prompt therapy of sternoclavicular joint dislocation are important. Computed tomography (CT) is an optimal means to investigate sternoclavicular joint anatomy; however, there are few reports on the imageological anatomical features of the sternoclavicular joint. The study investigated imageological anatomical features, and a new plate was devised according to these data to treat sternoclavicular joint dislocation. Fifty-three healthy Chinese volunteers examined with chest CT were included in the study. The coronal, sagittal, and axial images of the sternoclavicular region were reconstructed. The sternal head diameter in the inferolateral-to-superomedial direction, length of the clavicular notch, and angle between the clavicular notch and sternum were measured on coronal images. The angle between the presternum and trunk was measured on sagittal images. The following dimensions were measured on axial images: anteroposterior dimensions of the sternal head, clavicular notch, and presternum; width of the sternoclavicular joint; distance between bilateral clavicles; and minimal distance from the presternum to the underlying structures in the thoracic cavity. A new plate was designed according to the above data and was used to repair six sternoclavicular joint dislocations. All cases were followed up with a range of 9 to 12 months. The proximal clavicle is higher than the presternum in a horizontal position. On axial images, the anteroposterior dimension of the sternal head was longer than the presternum, and the center region of the presternum was thinner than the edges. The left sternoclavicular joint space was (0.82 ± 0.21) cm, and the right was (0.87 ± 0.22) cm. Among the structures behind the sternum, the left bilateral innominate vein ran nearest to the presternum. The distance from the anterior
Induction of a chronic myocardial infarction in the laboratory animal - experimental model
POP, IONEL CIPRIAN; GRAD, NICOLAE-OVIDIU; PESTEAN, COSMIN; TAULESCU, MARIAN; MIRCEAN, MIRCEA; MIRONIUC, ION-AUREL
2013-01-01
Introduction Ischemic heart disease is a major public health problem in western countries. Appropriate animal experimental models of chronic myocardial infarction is an essential first step in order to investigate and develop new therapeutic interventions. Aim The aim of this study was to find an optimal place for a coronary artery ligation to induce an optimal chronic myocardial infarction and also a new heart approach that will not require oro-tracheal intubation. Material and methods To achieve these goals we used a group of rabbits and after induction of anesthesia and cardiac exposure by rib osteotomy (rib III, IV and V) at the costo-sternal junction level on the right side we performed three different left anterior descending artery (LAD) ligation at different distances (5, 10 and 15 mm) in relation to the apex. Thirty days after the acute myocardial infarction, we correlated laboratory investigations (serology, ECG, cardiac ultrasound) with histopathological findings. Results Heart approach achieved by rib osteotomy (rib III, IV and V) at the costo-sternal junction level on the right side, maintains the integrity of the ribcage, allowing it to take part in respiratory movements and the animal model does not need oro-tracheal intubation. Ligation of LAD at 15 mm from the apex was incompatible with life; ligation of LAD at 5 mm from the apex does not achieved transmural myocardial infarction and ligation of LAD at 10 mm from the apex achieved a transmural myocardial infarction of the left ventricle which also involved the distal part of the interventricular septum. Conclusion Ligation of LAD at 10 mm from the apex achieved a transmural myocardial infarction of the left ventricle, is in an easily accessible area from technical point of view, it is sufficiently expanded to induce hemodynamic effects that can be quantified with paraclinical examination and also it is compatible with the experimental animal life. If the heart is approached by rib III, IV and V
AEROBIC SOIL MICROCOSMS FOR LONG-TERM BIODEGRADATION OF HYDROCARBON VAPORS
The aims of this research project included the development of laboratory protocols for the preparation of aerobic soil microcosms using aseptic field soil samples, and for the gas chromatographic analysis of hydrocarbon vapor biodegradation based on vapor samples obtained from th...
Progress in cryopreservation of dormant winter buds of selected tree species
USDA-ARS?s Scientific Manuscript database
In cryopreservation of germplasm, using dormant winter buds (DB) as source plant materials is economically favorable over tissue culture options (TC). Processing DB does not require aseptic conditions and involved cryopreservation procedures. Although, the DB cryopreservation method has been known f...
Cryopreservation of Salix sp. dormant winter buds
USDA-ARS?s Scientific Manuscript database
In cryopreservation, using dormant winter buds (DB) as source plant materials is economically advantageous over tissue culture options (TC). Processing DB does not require aseptic conditions and elaborate cryopreservation procedures. However, the DB approach is only feasible for cryopreserving a sel...
Overcoming bacterial contamination of fuel ethanol fermentations -- alterntives to antibiotics
USDA-ARS?s Scientific Manuscript database
Fuel ethanol fermentations are not performed under aseptic conditions and microbial contamination reduces yields and can lead to costly "stuck fermentations". Antibiotics are commonly used to combat contaminants, but these may persist in the distillers grains co-product. Among contaminants, it is kn...
Robert, Alain; Peppuy, Alexis; Sémon, Etienne; Boyer, François D; Lacey, Michael J; Bordereau, Christian
2004-01-01
The diunsaturated C12 alcohol (Z,Z)-dodeca-3,6-dien-1-ol (dodecadienol) has been characterized by GC-MS and FTIR as a novel releaser pheromone in termites. This alcohol identified in Ancistrotermes pakistanicus (Termitidae, Macrotermitinae) possesses a double pheromonal function which again illustrates the chemical parsimony of termites compared with other social insects. In workers, dodecadienol elicits trail-following at a very low concentration (activity threshold at 0.1 pg/cm of trail); in male alates it induces trail-following at a low concentration (1-10 pg/cm) and sexual attraction at a higher concentration (about 1 ng). Traces of the monounsaturated C12 alcohol (Z)-dodec-3-en-1-ol (dodecenol), known as a trail pheromone of several Macrotermitinae, were also found in the sternal gland extracts of A. pakistanicus, although only dodecadienol was present at the surface of the sternal gland. Workers of A. pakistanicus are not sensitive to dodecenol, but they are as sensitive to dodecatrienol as to dodecadienol. However, in the study area (Vietnam), A. pakistanicus is living in sympatry only with those Macrotermitinae using dodecenol as a trail pheromone, the foraging populations therefore being well isolated through their respective trail pheromones. The presence of three types of unsaturated C12 alcohols as releaser pheromones in the only Macrotermitinae subfamily is discussed, and a possible biosynthetic pathway from linoleic acid is proposed for dodecadienol.
NASA Technical Reports Server (NTRS)
Stoker, Carol; Dunagan, Stephen; Stevens, Todd; Amils, Ricardo; Gomez-Elvira, Javier; Fernandez, David; Hall, James; Lynch, Kennda; Cannon, Howard; Zavaleta, Jhony
2004-01-01
The MARTE (Mars Astrobiology Research and Technology Experiment) project, an ASTEP field experiment, is exploring for a hypothesized subsurface anaerobic chemoautotrophic biosphere in the region of the Tinto River- or Rio Tinto- in southwestern Spain. It is also demonstrating technology needed to search for a subsurface biosphere on Mars. The project has three primary objectives: (1) search for and characterize subsurface life at Rio Tinto along with the physical and chemical properties and sustaining energy sources of its environment, (2) perform a high fidelity simulation of a robotic Mars drilling mission to search for life, and (3) demonstrate the drilling, sample handling, and instrument technologies relevant to searching for life on Mars. The simulation of the robotic drilling mission is guided by the results of the aseptic drilling campaign to search for life at Rio Tinto. This paper describes results of the first phase of the aseptic drilling campaign.
Uptake of free amino acids by bacteria-free larvae of the sand dollar Dendraster excentricus.
Davis, J P; Stephens, G C
1984-10-01
Larvae of Dendraster excentricus were produced by collecting gametes and carrying out fertilization under aseptic conditions. Since gametes are free of bacteria in the gonad, bacteria-free (axenic) suspensions of larvae result. Net rates of entry of 14 amino acids and the rate of production of ammonia were simultaneously determined by high-performance liquid chromatography. The net rates of uptake of neutral amino acids were an order of magnitude greater than rates for basic and acidic amino acids. Influx of 14C-labeled leucine, arginine, and glutamate accurately reflects the net entry rate of these substrates. Uptake of amino acids by axenic suspensions of larvae was compared with uptake by suspensions prepared without aseptic precautions. There was no significant difference in net uptake of the 14 amino acids or in the pattern of oxidation and assimilation of [14C]leucine during short-term experiments of 4-h duration or less.
Tuckett, Andrea Z.; Zakrzewski, Johannes L.; Li, Duan; van den Brink, Marcel R.M.; Thornton, Raymond H.
2014-01-01
The goal of this study was to evaluate whether using an aseptic free-hand approach for ultrasound-guided injection facilitates injection into the thymic gland in mice. We used this interventional radiology technique in young, aged, and immunodeficient mice and found that the thymus was visible in all cases. The mean injection period was 8 s in young mice and 19 s in aged or immunodeficient mice. Injection accuracy was confirmed by intrathymic location of an injected dye, or by in vivo bioluminescence imaging of injected luciferase-expressing cells. Accurate intrathymic injection was confirmed in 97% of cases. No major complications were observed. We conclude that an aseptic free-hand technique for ultrasound-guided intrathymic injection is safe, accurate, and reduces the time required for intrathymic injections. This method facilitates large-scale experiments, injection of individual thymic lobes, and is clinically relevant. PMID:25701534
Ferreira, C M; Bonifácio, K C; Fröner, I C; Ito, I Y
1999-01-01
The antimicrobial activity of 0.4% papaine gel (FCF-USP), an antibacterial product derived from 3.3% castor oil (IQSC-USP), and 0.5% sodium hypochlorite (FORP-USP) was evaluated in teeth with radiographically visible pulpal necrosis and periapical lesion in vivo. After cavity access, under aseptic conditions, a first harvesting was performed. The 3 irrigating solutions were used for biomechanical preparation. After 72 hours, a second harvesting was performed, also under aseptic conditions. The number of colony forming units (cfu) was counted with a stereomicroscope under reflected light. Castor oil and 0.5% sodium hypochlorite presented similar antimicrobial activities for the reduction of the anaerobe number, S. mutans and streptococci; however, the papaine gel showed lower activity. We conclude that both castor oil and sodium hypochlorite are effective as antimicrobial agents and can be used in the treatment of root canals with pulpal necrosis.
Identity and Behavior of Xylem-Residing Bacteria in Rough Lemon Roots of Florida Citrus Trees †
Gardner, John M.; Feldman, Albert W.; Zablotowicz, Robert M.
1982-01-01
An aseptic vacuum extraction technique was used to obtain xylem fluid from the roots of rough lemon (Citrus jambhiri Lush.) rootstock of Florida citrus trees. Bacteria were consistently isolated from vascular fluid of both healthy and young tree decline-affected trees. Thirteen genera of bacteria were found, the most frequently occurring genera being Pseudomonas (40%), Enterobacter (18%), Bacillus, Corynebacterium, and other gram-positive bacteria (16%), and Serratia (6%). Xylem bacterial counts fluctuated seasonally. Bacterial populations ranged from 0.1 to 22 per mm3 of root tissue (about 102 to 2 × 104 bacteria per g of xylem) when bacterial counts were made on vascular fluid, but these numbers were 10- to 1,000-fold greater when aseptically homogenized xylem tissue was examined similarly. Some of the resident bacteria (4%) are potentially phytopathogenic. It is proposed that xylem bacteria have an important role in the physiology of citrus. PMID:16346030
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdullah, Abdul Halim; Nor, Mohd Asri Mohd; Saman, Alias Mohd
Aseptic loosening effects are critical issues in encouraging long term stability of cemented hip arthroplasty. Stress shielding is believed to be an important factor that contributes to the aseptic loosening problems. The numerous changes in the prosthesis stem design are intended to minimize the stress shielding and aseptic loosening problems and to improve the long term performance of the implants. In this study, the stress distribution in cemented hip arthroplasty is established using finite element method. The taper of the prosthesis is designed to be 3 deg. at anterior/posterior, 3 deg. at medial/lateral and 10 deg. from wide lateral tomore » narrow medial. Major muscle loads and contact forces are simulated for walking (toe-off phase) and stair climbing load cases. Effects of prosthesis stem tapers on the resulting stress distribution are investigated. Results show that compressive stress dominates in the medial plane while tensile stress in the lateral plane of the femur. The corresponding stress levels of intact femur for walking and stair-climbing load cases are 22 and 29 MPa, respectively. The magnitude of Tresca stress for the THA femur in stair-climbing load case remains higher in the region of 85 MPa while the walking load case induces around 40 MPa. The stress range in the straight and single taper stem prosthesis is lower than 260 MPa, while localized Tresca stress is in the order of the yield strength of Ti-6Al-4V alloy for double and triple taper stem design.« less
Pleocytosis is not fully responsible for low CSF glucose in meningitis.
Baud, Maxime O; Vitt, Jeffrey R; Robbins, Nathaniel M; Wabl, Rafael; Wilson, Michael R; Chow, Felicia C; Gelfand, Jeffrey M; Josephson, S Andrew; Miller, Steve
2018-01-01
The mechanism of hypoglycorrhachia-low CSF glucose-in meningitis remains unknown. We sought to evaluate the relative contribution of CSF inflammation vs microorganisms (bacteria and fungi) in lowering CSF glucose levels. We retrospectively categorized CSF profiles into microbial and aseptic meningitis and analyzed CSF leukocyte count, glucose, and protein concentrations. We assessed the relationship between these markers using multivariate and stratified linear regression analysis for initial and repeated CSF sampling. We also calculated the receiver operating characteristics of CSF glucose and CSF-to-serum glucose ratios to presumptively diagnose microbial meningitis. We found that increasing levels of CSF inflammation were associated with decreased CSF glucose levels in the microbial but not aseptic category. Moreover, elevated CSF protein levels correlated more strongly than the leukocyte count with low CSF glucose levels on initial ( R 2 = 36%, p < 0.001) and repeated CSF sampling ( R 2 = 46%, p < 0.001). Hypoglycorrhachia (<40 mg/dL) was observed in 50.1% of microbial cases, but only 9.6% of aseptic cases, most of which were neurosarcoidosis. Absolute CSF glucose and CSF-to-serum glucose ratios had similar low sensitivity and moderate-to-high specificity in diagnosing microbial meningitis at thresholds commonly used. The main driver of hypoglycorrhachia appears to be a combination of microbial meningitis with moderate to high degrees of CSF inflammation and proteins, suggesting that the presence of microorganisms capable of catabolizing glucose is a determinant of hypoglycorrhachia in meningitis. A major notable exception is neurosarcoidosis. Low CSF glucose and CSF-to-serum glucose ratios are useful markers for the diagnosis of microbial meningitis.
Breast cancer in Poland syndrome.
Havlik, R J; Sian, K U; Wagner, J D; Binford, R; Broadie, T A
1999-07-01
A 33-year-old African-American woman with a severe manifestation of Poland syndrome developed breast cancer in the ipsilateral breast. She had a severely hypoplastic upper extremity, including symbrachydactyly, and a hypoplastic forearm and upper arm. In addition, she lacked the sternal origin of the pectoralis muscle. She had a very small nipple-areola complex and no axillary hair. This is the first case report of breast cancer developing in the ipsilateral breast of a patient with Poland syndrome.
Boyar, V; Handa, D; Clemens, K; Shimborske, D
2014-02-01
Preterm, critically ill neonates represent a challenge in wound healing. Many factors predispose infants to skin injuries, including decreased epidermal-dermal cohesion, deficient stratum corneum, relatively alkaline pH of skin surface, impaired nutrition and presence of multiple devices on the skin. We present a case series describing the use of medical-grade honey-Leptospermum honey (Medihoney), for successful treatment of slowly healing neonatal wounds, specifically stage 3 pressure ulcer, dehiscent and infected sternal wound, and full-thickness wound from an extravasation injury.
Use of vascularised free fibula in limb reconstruction (for non-malignant defects).
Hameed, Shahid; Ehtesham-ul-haq, Rana Hassan Javaid; Ahmed, Rao Saood; Majid, Abdul; Waqas, Muhammad; Aslam, Ayesha; Yusuf, Omamah; Butt, Ahsin Masood; Ali, Ghazanfar
2013-12-01
The case series was conducted at the Department of Plastic Surgery, Combined Military Hospital, Rawalpindi, from June 2009 to May 2011, and comprised 19 patients in whom free fibula flap was performed for upper and lower limb reconstruction, using SPSS 16. Results showed that flap survival was 100%. One (5.2%) flap was re-explored for venous congestion and was salvaged. One (5.2%) patient of congenital pseudoarthrosis of tibia had a fracture of the fibula and was treated with external fixation. Average follow up was 8 months. Mean union time and full weight-bearing was 6.5 +/- 1.34 months (range 3-8 months) and 9 months, respectively. No recurrence of pseudoathrosis was observed until the last follow up, with only a 1.5 cm length discrepancy in one patient. The results proved that a microvascular free fibular flap heals rapidly, causes early functional recovery and it can be raised as an osteocutaneous flap.
21 CFR 514.8 - Supplements and other changes to an approved application.
Code of Federal Regulations, 2013 CFR
2013-04-01
... method(s) or an addition, deletion, or substitution of steps in an aseptic processing operation; (D... solely affecting a natural product, a recombinant DNA-derived protein/polypeptide, or a complex or...) or references to previously approved documentation; (H) For a natural product, a recombinant DNA...
21 CFR 514.8 - Supplements and other changes to an approved application.
Code of Federal Regulations, 2014 CFR
2014-04-01
... method(s) or an addition, deletion, or substitution of steps in an aseptic processing operation; (D... solely affecting a natural product, a recombinant DNA-derived protein/polypeptide, or a complex or...) or references to previously approved documentation; (H) For a natural product, a recombinant DNA...
21 CFR 514.8 - Supplements and other changes to an approved application.
Code of Federal Regulations, 2012 CFR
2012-04-01
... method(s) or an addition, deletion, or substitution of steps in an aseptic processing operation; (D... solely affecting a natural product, a recombinant DNA-derived protein/polypeptide, or a complex or...) or references to previously approved documentation; (H) For a natural product, a recombinant DNA...
Cloning: plants – micropropagation/tissue culture
USDA-ARS?s Scientific Manuscript database
Clonal micropropagation is the multiplication of the buds and shoots that occur in leaf axils on a defined nutrient medium in an aseptic in vitro environment. The resulting shoots are either subdivided for continued multiplication or rooted and acclimatized to the greenhouse or field. Micropropagati...
Evidence supporting vertical transmission of Salmonella in dairy cattle
USDA-ARS?s Scientific Manuscript database
We set out to investigate whether Salmonella enterica could be recovered from various tissues of viable neonatal calves immediately following parturition. Eleven samples were aseptically collected from each of 20 calves and consisted of both left and right subiliac and prescapular lymph nodes (LN),...
Surgical Education: Attitudes toward Animal Use in Teaching Surgery at Louisiana State University.
ERIC Educational Resources Information Center
Hedlund, Cheryl S.; Hosgood, Giselle; Naugler, Sasha
2002-01-01
Surveyed students and faculty at Louisiana State University about the use of animals for teaching surgery. Found that they favored the practice, finding it helpful for learning aseptic technique and suturing skills but less so for learning tissue handling, dissection, hemostasis, or anesthesia. (EV)
First epidemic of echovirus 16 meningitis in Cuba.
Sarmiento, L; Mas, P; Goyenechea, A; Palomera, R; Morier, L; Capó, V; Quintana, I; Santin, M
2001-01-01
From April to September 2000, an epidemic of aseptic meningitis spread throughout Cuba, with 16,943 reported cases. Virologic studies identified echovirus 16 as the cause of this epidemic. This is the first reported isolate of echovirus 16 from patients with viral meningitis in Cuba.
USDA-ARS?s Scientific Manuscript database
Fuel ethanol fermentations are not performed under aseptic conditions and microbial contamination reduces yields and can lead to costly “stuck fermentations.” Antibiotics are commonly used to combat contaminants, but these may persist in the distillers grains co-product. Among contaminants, it is kn...
40 CFR 63.3561 - What definitions apply to this subpart?
Code of Federal Regulations, 2010 CFR
2010-07-01
... pressurized aerosol product is packaged. Aseptic coating means any coating that must withstand high... application with hand-held nonrefillable aerosol containers, touch-up markers, or marking pens is not a... equipment that may be required to meet the data acquisition and availability requirements of this subpart...
Medical Laboratory Technician--Microbiology (AFSC 90470).
ERIC Educational Resources Information Center
Thompson, Joselyn H.
This four-volume student text is designed for use by Air Force personnel enrolled in a self-study extension course for medical laboratory technicians. Covered in the individual volumes are laboratory procedures in clinical bacteriology (the history of bacteriology; aseptic techniques and sterilization procedures; bacterial morphology and…
Gravity, chromosomes, and organized development in aseptically cultured plant cells
NASA Technical Reports Server (NTRS)
Krikorian, Abraham D.
1993-01-01
The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.
[The daily life of patients at the Hôtel-Dieu in Lyon in the nineteenth century].
Bel, Jean-Christophe; Feireisen, Marie; Fessy, Michel-Henri; Broussolle, Christiane; Neidhardt, Jean-Pierre Hano; Ferrandis, Jean-Jacques
2015-01-01
In 1802 the Hôtel-Dieu in Lyons was incorporated in the so-called Hospices Civils de Lyon. This allowed the expansion and renovation of buildings, as well as the improvement of the conditions of hygiene and comfort of the patients. This hospital was devoted only to the most severely ill or injured adults. 1100 patients were treated by seven doctors, a main surgeon and his deputy, residents and sisters. Broadly speaking the evolution of surgery can be divided into two periods: that of before anesthesia and septic surgery and that of antiseptic and aseptic surgery. We have to mention Gensoul and the resection of the maxillary before anesthesia, Bonnet and Ollier who were devoted to osteo-articular surgery (Ollier's disease), Poncet who built the first aseptic theater, Jaboulay and the resident Carrel who were transplantation's pioneers, Bouveret (paroxysmal tachycardia and Bouveret syndrome), Destot who did the first medical use of X-rays in 1895.
Poor short term outcome with a metal-on-metal total hip arthroplasty.
Levy, Yadin D; Ezzet, Kace A
2013-08-01
Metal-on-metal (MoM) bearings for total hip arthroplasty (THA) have come under scrutiny with reports of high failure rates. Clinical outcome studies with several commercially available MoM THA bearings remain unreported. We evaluated 78 consecutive MoM THAs from a single manufacturer in 68 patients. Sixty-six received cobalt-chrome (CoCr) monoblock and 12 received modular titanium acetabular cups with internal CoCr liners. Femoral components were titanium with modular necks. At average 2.1 years postoperatively, 12 THAs (15.4%) demonstrated aseptic failure (10 revisions, 2 revision recommended). All revised hips demonstrated capsular necrosis with positive histology reaction for aseptic lymphocytic vasculitis-associated lesions/adverse local tissue reactions. Prosthetic instability following revision surgery was relatively common. Female gender was a strong risk factor for failure, though smaller cups were not. Both monoblock and modular components fared poorly. Corrosion was frequently observed around the proximal and distal end of the modular femoral necks. Copyright © 2013 Elsevier Inc. All rights reserved.
Tension pneumocephalus mimicking septic shock: a case report.
Miranda, Caroline; Mahta, Ali; Wheeler, Lee Adam; Tsiouris, A John; Kamel, Hooman
2018-02-01
Tension pneumocephalus can lead to rapid neurologic deterioration. We report for the first time its association with aseptic systemic inflammatory response syndrome mimicking septic shock and the efficacy of prompt neurosurgical intervention and critical care support in treating this condition. A 64-year-old man underwent 2-stage olfactory groove meningioma resection. The patient developed altered mental status and gait instability on postoperative day 6. Imaging showed significant pneumocephalus. The patient subsequently developed worsening mental status, respiratory failure, and profound shock requiring multiple vasopressors. Bedside needle decompression, identification and repair of the cranial fossa defect, and critical care support led to improved mental status and reversal of shock and multiorgan dysfunction. Thorough evaluation revealed no evidence of an underlying infection. In this case, tension pneumocephalus incited an aseptic systemic inflammatory response syndrome mimicking septic shock. Prompt neurosurgical correction of pneumocephalus and critical care support not only improved neurologic status, but also reversed shock. Such a complication indicates the importance of close monitoring of patients with progressive pneumocephalus.
Tuckett, Andrea Z; Zakrzewski, Johannes L; Li, Duan; van den Brink, Marcel R M; Thornton, Raymond H
2015-04-01
The goal of this study was to evaluate whether use of an aseptic free-hand approach to ultrasound-guided injection facilitates injection into the thymic gland in mice. We used this interventional radiology technique in young, aged and immunodeficient mice and found that the thymus was visible in all cases. The mean injection period was 8 seconds in young mice and 19 seconds in aged or immunodeficient mice. Injection accuracy was confirmed by intrathymic location of an injected dye or by in vivo bioluminescence imaging of injected luciferase-expressing cells. Accurate intrathymic injection was confirmed in 97% of cases. No major complications were observed. We conclude that an aseptic freehand technique for ultrasound-guided intrathymic injection is safe and accurate and reduces the time required for intrathymic injections. This method facilitates large-scale experiments and injection of individual thymic lobes and is clinically relevant. Copyright © 2015 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.