Science.gov

Sample records for aseptic sternal pseudoarthrosis

  1. ASEPTIC

    NASA Image and Video Library

    2013-07-31

    ISS036-E-026661 (31 July 2013) --- In the International Space Station?s Rassvet Mini-Research Module (MRM1), Russian cosmonaut Fyodor Yurchikhin, Expedition 36 flight engineer, works with the Aseptic experiment, which involves collecting air and surface samples in the Russian segment of the station for analysis.

  2. Sternal exploration or closure

    MedlinePlus

    ... Chronic pain Decreased lung function Increased risk of death More infections Need to repeat or revise the procedure Alternative Names VAC - vacuum-assisted closure - sternal wound; Sternal dehiscence; Sternal infection References ...

  3. Aseptic technique.

    PubMed

    Bykowski, Tomasz; Stevenson, Brian

    2008-11-01

    This chapter describes common laboratory procedures that can reduce the risk of culture contaminations (sepsis), collectively referred as "aseptic technique." Two major strategies of aseptic work are described: using a Bunsen burner and a laminar flow hood. Both methods are presented in the form of general protocols applicable to a variety of laboratory tasks such as pipetting and dispensing aliquots, preparing growth media, and inoculating, passaging, and spreading microorganisms on petri dishes.

  4. Sternal Talon, a novel repair for sternal dehiscence.

    PubMed

    Subramaniam, Thavakumar; Keita, Luther; Veerasingam, Dave

    2015-06-01

    Sternal dehiscence is a recognised complication after median sternotomy, occurring in 0.5-5% of cases with or without infection. A 72-year-old man presenting with collapse and ventricular tachycardia was investigated for a possible acute cardiac event 2 years after coronary artery bypass grafting for ischemic heart disease. Work-up chest X-ray showed displacement of all sternal wires, and computed tomography (CT) performed to investigate further showed sternal dehiscence with right ventricle wall herniation through the defect and sternal wire breakdown. A decision was made after discussion with the patient to repair the defect using 3 Sternal Talon devices and 2 sternal wires. The patient made an uncomplicated recovery, and the outpatient clinic review after discharge home showed satisfactory and stable sternal union. We report a case of non-infected sternal dehiscence managed successfully with the Sternal Talon without long-term complications.

  5. Tuberculous sternal osteomyelitis.

    PubMed

    Cataño, Juan Carlos; Galeano, Daniela; Botero, Juan Camilo

    2014-10-01

    A 32-year-old female patient with systemic lupus erythematosus presented with 1 month of nocturnal subjective fevers, night sweats, poor appetite, malaise, 8-kg weight loss, and a 6-cm painful sternal mass. She had normal vital signs with a physical examination notable only for the presence of a fluctuating sternal mass. A computed tomographic scan of the thorax showed a 67 × 32 × 27-mm sternal mass associated with severe sternal osteomyelitis (Fig. 1); then a surgical drainage was performed, and abundant caseous material was removed, leaving a penrose drain (Fig. 2). Histologic examination of the bone tissue revealed extensive necrosis and granulomas with multinucleated giant cells. The bone, secretion, and soft tissue were negative for acid-fast bacillae on Ziehl-Neelsen stain; but culture grew Mycobacterioum tuberculosis, and she was started on 4 first-line antituberculosis medications, showing rapid symptomatic improvement, and was discharged 4 weeks after admission (Fig. 3).

  6. Congenital sternal cleft.

    PubMed

    Biswas, G; Khandelwal, N K; Venkatramu, N K; Chari, P S

    2001-04-01

    A cleft of the sternum is a rare congenital anomaly. We present a case of a sternal cleft in a 7-year-old boy. A split iliac bone graft covered with the sternocostal portion of a pectoralis major flap was used to reconstruct the defect. Copyright 2001 The British Association of Plastic Surgeons.

  7. Sternal cables are not superior to traditional sternal wiring for preventing deep sternal wound infection

    PubMed Central

    Dunne, Ben; Murphy, Mark; Skiba, Rohen; Wang, Xiao; Ho, Kwok; Larbalestier, Robert; Merry, Christopher

    2016-01-01

    OBJECTIVES Deep sternal wound infection is a devastating complication of cardiac surgery. In the current era of increasing patient comorbidity, newer techniques must be evaluated in attempts to reduce the rates of deep sternal wound infection. METHODS A randomized controlled trial comparing sternal closure with traditional sternal wires in figure-8 formation with the Pioneer cabling system® from Medigroup after adult cardiac surgery was performed. RESULTS A total of 273 patients were enrolled with 137 and 135 patients randomized to sternal wires and cables group, respectively. Baseline characteristics between the two groups were well balanced. Deep sternal wound infection occurred in 0.7% of patients in the wires group and 3.7% of patients in the cables group (absolute risk difference = −3.0%, 95% confidence interval: −7.7 to 0.9%; P = 0.12). Patients in the cables group were extubated slightly earlier than those in the sternal wires group postoperatively (9.7 vs 12.8 h; P = 0.03). There was, however, no significant difference in hospital and follow-up pain scores or analgesia requirements. CONCLUSIONS The Pioneer sternal cabling system appears to facilitate early extubation after adult cardiac surgery, but it does not reduce the rate of deep sternal infection Australian New Zealand Clinical Trials Registry: ANZCTR—ACTRN12615000973516. PMID:26912576

  8. New technique for sternal osteosynthesis.

    PubMed

    Roux, D; Fournial, G; Glock, Y; Nottin, R

    1995-10-01

    In our department, we have developed a new method for sternal osteosynthesis. This technique uses steel threads and a sternal retractor. The removable valves are removed and placed with a two-pulley device, which allows good osteosynthesis without assistance or effort.

  9. Sternal wound infections.

    PubMed

    Mauermann, William J; Sampathkumar, Priya; Thompson, Rodney L

    2008-09-01

    Deep sternal wound infections (DSWI) continue to be a relatively uncommon event occurring in about 1%-2% of all patients undergoing cardiac surgery. However, the sheer number of cardiac surgery patients and the relatively high mortality associated with DSWIs makes them of clinical relevance. This review will describe the current incidence of DSWIs and their associated morbidity and mortality as well as risk factors for the development of this complication. The microbiology of DSWIs will be reviewed and strategies to prevent these complications will be discussed with a focus on interventions that may be undertaken by the clinical anesthesiologist.

  10. Pathogenicity of Aseptic Bursaphelenchus xylophilus

    PubMed Central

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity. PMID:22662271

  11. Salmonella typhi sternal wound infection.

    PubMed

    Sfeir, Maroun; Youssef, Pierre; Mokhbat, Jacques E

    2013-12-01

    Samonella typhi usually causes gastrointestinal infections. Few reports in the literature described skin and soft tissue infections related to Salmonella species, especially in immunocompetent patients. Our case exhibited sternal abscess growing Salmonella typhi.

  12. Lamotrigine and aseptic meningitis.

    PubMed

    Simms, Kelley M; Kortepeter, Cindy; Avigan, Mark

    2012-03-20

    The purpose of this case series is to characterize a recently identified association of the antiepileptic drug (AED) lamotrigine with aseptic meningitis based on cases reported to the Food and Drug Administration (FDA)'s Adverse Event Reporting System (AERS) database. We performed a data mining analysis of 9 AEDs from the FDA's AERS database. We applied the multi-item gamma Poisson shrinker (MGPS) algorithm to the entire AERS database through November 2, 2009, to generate empirical Bayes geometric mean (EBGM) values with corresponding confidence intervals for 9 AEDs and the adverse event code "meningitis aseptic." The AERS database was also searched for postmarketing reports of aseptic meningitis associated with lamotrigine and a detailed review of each case was performed. Forty AERS cases were identified in this review. Findings from the AERS reports revealed CSF profiles with features of both bacterial as well as viral meningitis. Fifteen cases documented a positive rechallenge; the median time to onset of symptoms upon rechallenge was only 60 minutes. Data mining analysis of several anticonvulsants resulted in disproportionate reporting solely for lamotrigine. There appears to be an association between lamotrigine use and aseptic meningitis. It is notable that nearly 40% of cases in this case series reported a positive rechallenge. Lamotrigine-associated aseptic meningitis should be considered in the differential diagnosis of culture-negative meningitis. This case series highlights the need for continued pharmacovigilance and the importance of systematic monitoring of patients treated with antiepileptic medications.

  13. MDCT evaluation of sternal variations: Pictorial essay

    PubMed Central

    Duraikannu, Chary; Noronha, Olma V; Sundarrajan, Pushparajan

    2016-01-01

    Sternal variations and anomalies have been identified in the past during autopsy or cadaveric studies. Recently, an increasing number of minor sternal variations have been reported with the advent of multidetector computed tomography (CT). Although there are many sternal variations that occur with varying appearance and prevalence, most of them are not recognized or are underreported during routine imaging of thorax. Identification of sternal variations is important to differentiate from pathological conditions and to prevent fatal complications prior to sternal interventions like marrow aspiration or acupuncture. This article aims to describe the minor and asymptomatic sternal variations by multidetector CT and their clinical significance. PMID:27413263

  14. Overview and Management of Sternal Wound Infection

    PubMed Central

    Singh, Kimberly; Anderson, Erica; Harper, J. Garrett

    2011-01-01

    Sternal wound infection is a life-threatening complication after cardiac surgery associated with high morbidity and mortality. Past treatment options have included closed suction and continuous irrigation. Current paradigms in the management of sternal wound infection include surgical debridement, vacuum-assisted closure therapy, flap coverage, and sternal plating. We provide a general overview of sternal wound infection and treatment options for the plastic surgeon. PMID:22294940

  15. Aseptic meningitis associated with rofecoxib.

    PubMed

    Bonnel, Renan A; Villalba, Maria L; Karwoski, Claudia B; Beitz, Julie

    2002-03-25

    Rofecoxib is a nonsteroidal anti-inflammatory drug that is reported to act by selectively inhibiting cyclooxygenase-2. A review and analysis of reports sent to the Spontaneous Reporting System of the Food and Drug Administration, Rockville, Md, suggest that aseptic meningitis is associated with rofecoxib use. To our knowledge, there have been no published reports of aseptic meningitis occurring in association with rofecoxib use to date. We report 5 serious cases of aseptic meningitis associated with rofecoxib use.

  16. Nitinol Thermoreactive Clips for Secondary Sternal Closure in Cases of Noninfective Sternal Dehiscence

    PubMed Central

    Gucu, Arif; Toktas, Faruk; Eris, Cuneyt; Ata, Yusuf; Turk, Tamer

    2012-01-01

    Postoperative sternal dehiscence is a potentially catastrophic sequela to median sternotomy that can cause not only chest-wall discomfort and pulmonary dysfunction but infection, both superficial and mediastinal. Nitinol thermoreactive clips use a novel material in the treatment of sternal dehiscence. We sought to determine whether the use of these clips is an effective remedy for noninfective sternal dehiscence. From January 2008 through December 2011, we retrospectively studied the data on 10 patients whose sternums had been closed with nitinol thermoreactive clips after the development of noninfective sternal dehiscence. Diagnosis was made on the bases of clinical criteria, chest radiography, and microbiological investigation. There was no control group. No procedure-related sequelae occurred. There was no recurrent sternal instability and dehiscence, sternal-related hemorrhage, superficial wound infection, or mediastinal infection. We believe that the use of nitinol thermoreactive clips is a safe, easy, and efficient method of secondary sternal closure for noninfective sternal dehiscence. PMID:22949767

  17. Nitinol thermoreactive clips for secondary sternal closure in cases of noninfective sternal dehiscence.

    PubMed

    Gucu, Arif; Toktas, Faruk; Eris, Cuneyt; Ata, Yusuf; Turk, Tamer

    2012-01-01

    Postoperative sternal dehiscence is a potentially catastrophic sequela to median sternotomy that can cause not only chest-wall discomfort and pulmonary dysfunction but infection, both superficial and mediastinal. Nitinol thermoreactive clips use a novel material in the treatment of sternal dehiscence. We sought to determine whether the use of these clips is an effective remedy for noninfective sternal dehiscence. From January 2008 through December 2011, we retrospectively studied the data on 10 patients whose sternums had been closed with nitinol thermoreactive clips after the development of noninfective sternal dehiscence. Diagnosis was made on the bases of clinical criteria, chest radiography, and microbiological investigation. There was no control group. No procedure-related sequelae occurred. There was no recurrent sternal instability and dehiscence, sternal-related hemorrhage, superficial wound infection, or mediastinal infection. We believe that the use of nitinol thermoreactive clips is a safe, easy, and efficient method of secondary sternal closure for noninfective sternal dehiscence.

  18. Sternal wrapping for the prevention of sternal morbidity in elderly osteoporotic patients undergoing median sternotomy.

    PubMed

    Kirbas, Ahmet; Celik, Sezai; Gurer, Onur; Yildiz, Yahya; Isik, Omer

    2011-01-01

    Osteoporosis, a major risk factor for sternum-related morbidity after median sternotomy, is quite prevalent among the elderly. In this prospective study, we investigated the potential of sternal protection by use of the "sternal wrapping method" in elderly osteoporotic patients who were undergoing median sternotomy.For this study, we chose 100 elderly osteoporotic patients who were scheduled to undergo median sternotomy. During surgery, we wrapped the sternal edges with polyvinyl chloride tubing in 50 patients (group 1) and omitted the sternal wrapping in the remaining 50 patients (group 2). We then compared the groups with regard to postoperative pain, bleeding, early and late sternum-related morbidity, sternal fractures, and duration of hospitalization.Sternal wrapping was associated with fewer sternal fractures, less chest pain, and shorter hospital stays. Overall sternal morbidity was significantly less common among patients with sternal wrapping (4% vs. 20%, P = 0.03); however, the difference in individual rates for early and late dehiscence or deep sternal infection did not reach statistical significance.Sternal wrapping using polyvinyl chloride tubes provides mechanical protection and, apparently, less postoperative chest pain and shorter hospitalizations. Probably, it reduces sternum-related complications, particularly in high-risk patients. Its benefits, however, should be confirmed in larger studies.

  19. Bilateral congenital pseudoarthrosis of the clavicles in a newborn

    PubMed Central

    Kalagiri, Ram R.; Hemingway, Martha; Beeram, Madhava R.

    2016-01-01

    Bilateral congenital pseudoarthrosis of the clavicles is extremely rare. We report a case of this entity presenting in the neonatal period. We highlight the importance of the differential diagnosis when clavicular fracture shows no evidence of healing or occurs bilaterally. PMID:27695169

  20. Handling difficult materials: Aseptic packaging

    SciTech Connect

    Lieb, K.

    1994-03-01

    Since aseptic packages, or drink boxes, were introduced in the US in the early 1980s, they have been praised for their convenience and berated for their lack of recyclability. As a result, aseptic packaging collection has been linked with that of milk cartons to increase the volume. The intervening years since the introduction of aseptic packaging have seen the drink box industry aggressively trying to create a recycling market for the boxes. Communities and schools have initiated programs, and recycling firms have allocated resources to see whether recycling aseptic packaging can work. Drink boxes are now recycled in 2.3 million homes in 15 states, and in 1,655 schools in 17 states. They are typically collected in school and curbside programs with other polyethylene coated (laminated) paperboard products such a milk cartons, and then baled and shipped to five major paper companies for recycling at eight facilities.

  1. Failure analysis of explanted sternal wires.

    PubMed

    Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che

    2005-05-01

    To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires.

  2. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  3. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here.

  4. Placement of trans-sternal wires according to an ellipsoid pressure vessel model of sternal forces.

    PubMed

    Casha, Aaron R; Manché, Alex; Gauci, Marilyn; Camilleri-Podesta, Marie-Therese; Schembri-Wismayer, Pierre; Sant, Zdenka; Gatt, Ruben; Grima, Joseph N

    2012-03-01

    Dehiscence of median sternotomy wounds remains a clinical problem. Wall forces in thin-walled pressure vessels can be calculated by membrane stress theory. An ellipsoid pressure vessel model of sternal forces is presented together with its application for optimal wire placement in the sternum. Sternal forces were calculated by computational simulation using an ellipsoid chest wall model. Sternal forces were correlated with different sternal thicknesses and radio-density as measured by computerized tomography (CT) scans of the sternum. A comparison of alternative placement of trans-sternal wires located either at the levels of the costal cartilages or the intercostal spaces was made. The ellipsoid pressure vessel model shows that higher levels of stress are operative at increasing chest diameter (P < 0.001). CT scans show that the thickness of the sternal body is on average 3 mm and 30% thicker (P < 0.001) and 53% more radio-dense (P < 0.001) at the costal cartilage levels when compared with adjacent intercostal spaces. This results in a decrease of average sternal stress from 438 kPa at the intercostal space level to 338 kPa at the costal cartilage level (P = 0.003). Biomechanical modelling suggests that placement of trans-sternal wires at the thicker bone and more radio-dense level of the costal cartilages will result in reduced stress.

  5. Placement of trans-sternal wires according to an ellipsoid pressure vessel model of sternal forces

    PubMed Central

    Casha, Aaron R.; Manché, Alex; Gauci, Marilyn; Camilleri-Podesta, Marie-Therese; Schembri-Wismayer, Pierre; Sant, Zdenka; Gatt, Ruben; Grima, Joseph N.

    2012-01-01

    Dehiscence of median sternotomy wounds remains a clinical problem. Wall forces in thin-walled pressure vessels can be calculated by membrane stress theory. An ellipsoid pressure vessel model of sternal forces is presented together with its application for optimal wire placement in the sternum. Sternal forces were calculated by computational simulation using an ellipsoid chest wall model. Sternal forces were correlated with different sternal thicknesses and radio-density as measured by computerized tomography (CT) scans of the sternum. A comparison of alternative placement of trans-sternal wires located either at the levels of the costal cartilages or the intercostal spaces was made. The ellipsoid pressure vessel model shows that higher levels of stress are operative at increasing chest diameter (P < 0.001). CT scans show that the thickness of the sternal body is on average 3 mm and 30% thicker (P < 0.001) and 53% more radio-dense (P < 0.001) at the costal cartilage levels when compared with adjacent intercostal spaces. This results in a decrease of average sternal stress from 438 kPa at the intercostal space level to 338 kPa at the costal cartilage level (P = 0.003). Biomechanical modelling suggests that placement of trans-sternal wires at the thicker bone and more radio-dense level of the costal cartilages will result in reduced stress. PMID:22186126

  6. Repair of Inferior Sternal Cleft Using Bilateral Sternal Bar Turnover Flaps in a Patient with Pentalogy of Cantrell

    PubMed Central

    Yeow, Vincent Kok-Leng

    2014-01-01

    We report a case of sternal reconstruction using bilateral sternal bar turnover flaps in a 4-year-old boy with an inferior sternal cleft, as part of Cantrell's pentad. When the patient was 10 months old, he underwent sternal reconstruction using a resorbable poly-L-lactic-polyglycolic acid plate in the first stage when there was insufficient autogenous tissue to provide a reliable reconstruction. Bilateral sternal bar turnover was performed in the second stage at 4 years of age. This operative technique is described in this report. This novel technique provides a robust, dynamic, and reliable reconstruction for inferior sternal defects. PMID:24511499

  7. Reducing Pediatric Sternal Wound Infections: A Quality Improvement Project.

    PubMed

    Delgado-Corcoran, Claudia; Van Dorn, Charlotte S; Pribble, Charles; Thorell, Emily A; Pavia, Andrew T; Ward, Camille; Smout, Randall; Bratton, Susan L; Burch, Phillip T

    2017-05-01

    To evaluate whether a quality improvement intervention reduces sternal wound infection rates in children after cardiac surgery. This is a pre- and postintervention quality improvement study. A 16-bed cardiac ICU in a university-affiliated pediatric tertiary care children's hospital. All patients undergoing cardiac surgery via median sternotomy from January 2010 to December 2014 are included. The sternal wound infection rates for primary closure and delayed sternal closure are reported per 100 sternotomies. The hospital-acquired infection records were used to identify preintervention cases, while postintervention cases were collected prospectively. Implementation of a sternal wound prevention bundle during the preoperative, intraoperative, and postoperative periods for cardiac surgical cases. During the preintervention period, 32 patients (3.8%) developed sternal wound infection, whereas only 19 (2.1%) developed sternal wound infection during the postintervention period (p = 0.04). The rates of sternal wound infection following primary closure were not significantly different pre- and postintervention (2.4% vs 1.6%; p = 0.35). However, patients with delayed sternal closure had significantly lower postintervention infection rates (10.6% vs 3.9%; p = 0.02). Implementation of a sternal wound prevention bundle during the perioperative period was associated with lower sternal wound infection rates in surgeries with delayed sternal closure.

  8. Pseudoarthrosis rates in anterior cervical discectomy and fusion: a meta-analysis.

    PubMed

    Shriver, Michael F; Lewis, Daniel J; Kshettry, Varun R; Rosenbaum, Benjamin P; Benzel, Edward C; Mroz, Thomas E

    2015-09-01

    Anterior cervical discectomy and fusion (ACDF) is a commonly performed procedure for patients presenting with cervical radiculopathy, myelopathy, or deformity. A systematic literature review and meta-analysis of pseudoarthrosis rates associated with ACDF with plate fixation have not been previously performed. The purpose of this study was to identify all prospective studies reporting pseudoarthrosis rates for ACDF with plate fixation. This study is based on a systematic review and meta-analysis. Studies reporting pseudoarthrosis rates in patients who received one-, two-, or three-level ACDF surgeries were included. Outcomes of interest included reported pseudoarthrosis events after ACDF with plate fixation. We conducted a MEDLINE, SCOPUS, Web of Science, and EMBASE search for studies reporting complications for ACDF with plate fixation. We recorded pseudoarthrosis events from all included studies. A meta-analysis was performed to calculate effect summary mean values, 95% confidence intervals (CIs), Q statistics, and I(2) values. Forest plots were constructed for each analysis group. Of the 7,130 retrieved articles, 17 met the inclusion criteria. The overall pseudoarthrosis rate was 2.6% (95% CI: 1.3-3.9). Use of autograft fusion (0.9%, 95% CI: -0.4 to 2.1) resulted in a reduced pseudoarthrosis rate compared with allograft fusion procedures (4.8%, 95% CI: 1.7-7.9). Studies were separated based on the length of follow-up: 12 to 24 and greater than 24 months. These groups reported rates of 3.1% (95% CI: 1.2-5.0) and 2.3% (95% CI: 0.1-4.4), respectively. Studies performing single-level ACDF yielded a rate of 3.7% (95% CI: 1.6-5.7). Additionally, there was a large difference in the rate of pseudoarthrosis in randomized controlled trials (4.8%, 95% CI: 2.6-7.0) versus prospective cohort studies (0.2%, 95% CI: -0.1 to 0.5), indicating that the extent of follow-up criteria affects the rate of pseudoarthrosis. This review represents a comprehensive estimation of the actual

  9. Congenital osteofibrous dysplasia associated with pseudoarthrosis of the tibia and fibula.

    PubMed

    Teo, Harvey E L; Peh, Wilfred C G; Akhilesh, M; Tan, S B; Ishida, T

    2007-06-01

    The association between congenital pseudoarthrosis and osteofibrous dysplasia of the tibia and fibula is a rare entity that has been recently recognized. We report a male newborn who was found to have swelling and deformity of the left lower leg. Radiographs and magnetic resonance imaging showed an extensive destructive lesion of the tibial shaft, with dysplastic congenital pseudoarthrosis of the lower fibula. Histopathological examination confirmed the diagnosis of congenital pseudoarthrosis of the tibia and fibula with underlying osteofibrous dysplasia involving both bones. Immunohistochemical stains showed cytokeratin positivity.

  10. Analysis of Sternal Fixation Results According to Plate Type in Sternal Fracture

    PubMed Central

    Byun, Chun Sung; Park, Il Hwan; Hwang, Wan Jin; Lee, Yeiwon; Cho, Hyun Min

    2016-01-01

    Background Sternal fractures are relatively rare, and caused mainly by blunt anterior chest wall trauma. In most cases, sternal fractures are treated conservatively. However, if the patient exhibits problematic symptoms such as intractable chest wall pain or bony crepitus due to sternal instability, surgical correction is indicated. But no consensus exists regarding the most appropriate surgical method. We analyzed the results of surgical fixation in cases of sternal fracture in order to identify which surgical method led to the best outcomes. Methods We retrospectively reviewed the medical records of patients with sternal fractures from December 2008 to December 2011, and found 19 patients who underwent open reduction and internal fixation of the sternum with a longitudinal plate (L-group) or a T-shaped plate (T-group). We investigated patients’ characteristics, clinical details regarding each case of chest trauma, the presence of other associated injuries, the type of open reduction and fixation, whether a combined operation was performed, and postoperative complications. Results Of the 19 patients, 10 patients (52.6%) were male, and their average age was 56.8 years (range, 32 to 82 years). Seven patients (36.8%) had isolated sternal fractures, while 12 (63.2%) had other associated injuries. Seven patients (36.8%) were in the L-group and 12 patients (63.2%) were in the T-group. Three patients in the L-group (42.9%) showed a loosening of the fixation. In all patients in the T-group, the fracture exhibited stable alignment. Conclusion Open reduction and internal fixation with a T-shaped plate in sternal fractures is a safer and more efficient treatment method than treatment with a longitudinal plate, especially in patients with a severely displaced sternum or anterior flail chest, than a longitudinal plate. PMID:27733996

  11. Surgical Repair of a Superior Sternal Cleft in an Infant

    PubMed Central

    Klein, Tobias; Kellner, Maximilian; Boemers, Thomas Michael; Mack-Detlefsen, Birte

    2015-01-01

    Sternal cleft is a rare congenital malformation with little more than 100 cases published worldwide. Incomplete sternal clefting in a female newborn is the most frequent form seen. First-line treatment is the surgical defect closure in the neonatal period. Presurgical examination has to focus on common associated malformations, in particular cardiac defects. The surgical repair of sternal cleft itself shows satisfying functional and cosmetic results with low complication rates. We present the case of a 4-month-old male infant with a superior sternal cleft. PMID:26788449

  12. Cabled butterfly closure: a novel technique for sternal closure.

    PubMed

    Jolly, Shashank; Flom, Beau; Dyke, Cornelius

    2012-10-01

    Impaired sternal wound healing remains problematic after median sternotomy and can lead to significant morbidity after cardiac surgical procedures. Although metal plating systems exist for closing the sternum, their use is limited by expense and practicality, and simple wire closure remains the most common technique to close the sternum. We describe a cabling technique for sternal closure that is secure, uses standard sternal wire, and may be used on every patient. We have used the technique routinely in 291 patients with no sternal dehiscence or wound healing problems.

  13. Primary Closure of A Sternal Cleft in A Neonate

    PubMed Central

    Ramdial, Shaal; Pillay, Desigan; Madaree, Anil

    2016-01-01

    A three day old neonate was referred to our department with a problem of a sternal cleft. Sternal clefts are often associated with a myriad of other abnormalities ranging from mild to severe. We present our experience with such a problem, and review the current literature concerning it. PMID:27853697

  14. Embryology, sternal clefts, ectopia cordis, and Cantrell's pentalogy.

    PubMed

    Engum, Scott A

    2008-08-01

    Sternal clefts, ectopia cordis, and Cantrell's pentalogy continue to be very rare congenital anomalies in pediatric surgery. Unfortunately, these conditions present as neonatal emergencies and demand early surgical intervention. This article reviews the embryological development of the chest wall, specific sternal defect anomalies, along with available methods of treatment.

  15. Congenital medium sternal cleft with partial ectopia cordis repair

    PubMed Central

    Sousa, Paulo Rego; Antunes, Sónia; Couto, Alexandra; Santos, Gonçalo Cassiano; Leal, Luis Gagp; Magalhães, Manuel Pedro

    2009-01-01

    Congenital sternal malformation is a rare anomaly often diagnosed as an asymptomatic condition at birth. The authors report a clinical case of a full-term female neonate with congenital sternal cleft and partial ectopia cordis. Successful surgical repair was accomplished at 6 days of age. When surgery is performed shortly after birth, the procedure is easier and better results are achieved. PMID:21918661

  16. Congenital medium sternal cleft with partial ectopia cordis repair.

    PubMed

    Sousa, Paulo Rego; Antunes, Sónia; Couto, Alexandra; Santos, Gonçalo Cassiano; Leal, Luis Gagp; Magalhães, Manuel Pedro

    2009-01-01

    Congenital sternal malformation is a rare anomaly often diagnosed as an asymptomatic condition at birth. The authors report a clinical case of a full-term female neonate with congenital sternal cleft and partial ectopia cordis. Successful surgical repair was accomplished at 6 days of age. When surgery is performed shortly after birth, the procedure is easier and better results are achieved.

  17. Computed Tomographic Evaluation of Presumptively Normal Canine Sternal Lymph Nodes.

    PubMed

    Iwasaki, Ryota; Mori, Takashi; Ito, Yusuke; Kawabe, Mifumi; Murakmi, Mami; Maruo, Kohji

    The sternal lymph nodes receive drainage from a wide variety of structures in the thoraco-abdominal region. Evaluation of these lymph nodes is essential, especially in cancer patients. Computed tomography (CT) can detect sternal lymph nodes more accurately than radiography or ultrasonography, and the criteria of the sternal lymphadenopathy are unknown. The purpose of this retrospective study was to describe the CT characteristics of the sternal lymph nodes in dogs considered unlikely to have lymphadenopathy. The ratio of the short axis dimension of the sternal lymph nodes to the thickness of the second sternebra was also investigated. At least one sternal lymph node was identified in each of the 152 dogs included in the study. The mean long axis and short axis dimensions were 0.700 cm and 0.368 cm, respectively. The mean ratio of the sternal lymph nodes to the second sternebrae was 0.457, and the 95% prediction interval ranged from 0.317 to 0.596 (almost a fixed value independent of body weight). These findings will be useful when evaluating sternal lymphadenopathy using CT.

  18. Amoxicillin-induced acute aseptic meningitis.

    PubMed

    Prieto-González, Sergio; Escoda, Rosa; Coloma, Emmanuel; Grau, Josep M

    2011-03-01

    A 58-year-old man presented to the hospital with fever and headache after amoxicillin intake. Physical examination, laboratory, and a cranial CT scan were unremarkable. Cerebrospinal fluid (CSF) testing revealed lymphocytic pleocytosis. After discontinuation of amoxicillin and symptomatic care, the patient quickly improved. Interestingly, he had had two prior episodes of aseptic meningitis that were probably also related to the administration of amoxicillin. Aseptic meningitis can be caused by multiple non-infectious conditions including drugs, malignancy, and autoimmune diseases. We report a case associated with amoxicillin that meets the criteria of drug-induced aseptic meningitis. Considering the wide utilization of amoxicillin, healthcare providers should be aware of it as a possible cause of drug-induced aseptic meningitis.

  19. The number of wires for sternal closure has a significant influence on sternal complications in high-risk patients

    PubMed Central

    Kamiya, Hiroyuki; Al-maisary, Sameer S.A.; Akhyari, Payam; Ruhparwar, Arjang; Kallenbach, Klaus; Lichtenberg, Artur; Karck, Matthias

    2012-01-01

    OBJECTIVES Sternal dehiscence and mediastinitis are rare but serious complications following cardiac surgery. The aim of this study was to investigate the influence of the number of sternal wires used for chest closure on sternal complications. METHODS From May 2003 to April 2007, 4714 adult patients received cardiac surgery in our institute. X-ray images of all patients were reviewed and the used wires were counted. Patients who received another material or longitudinal wiring technique according to Robicsek for chest closure were excluded from this analysis; thus 4466 patients were included into the final analysis. Figure-of-eight wiring was counted as two wires. RESULTS Sternal complications occurred in 2.4%, and hospital mortality with or without sternal complications were 2.8 and 2.7%, respectively (P = 0.60). Mean numbers of sternal wires were 7.8 in both patient groups with or without sternal complications (P = 0.79). Multivariate analysis revealed diabetes mellitus [odds ratio (OR) 1.54, 95% CI 1.01–2.34, P = 0.04], chronic obstructive pulmonary disease (OR 1.85, 95% CI 1.12–2.79, P = 0.01) and renal insufficiency (OR 1.70, 95% CI 1.11–2.59, P = 0.001) as significant risk factors for sternal complications. In high-risk patients, the use of less than eight wires was significantly associated with postoperative sternal complications. CONCLUSIONS Particularly in high-risk patients, careful haemostasis should be done and eight or more wires should be used to avoid sternal complications. PMID:22771480

  20. Congenital osteofibrous dysplasia of the tibia, associated with pseudoarthrosis of the ipsilateral fibula.

    PubMed

    Zamzam, Mohammed M

    2008-10-01

    We describe an otherwise normal male neonate who presented shortly after birth with rare congenital osteofibrous dysplasia of the right tibia associated with pseudoarthrosis of the ipsilateral fibula. The lesion was curetted, and the defect was packed with a fibular bone graft from the other leg. Histopathological examination was typical for osteofibrous dysplasia. The ipsilateral fibular pseudoarthrosis was observed with no active intervention. Seven years follow-up showed good functional recovery without recurrence of the lesion. The case is a new presentation of congenital osteofibrous dysplasia, and is presented to draw attention to this rare condition that must be considered in the differential diagnosis of congenital lesions of the tibia.

  1. [Early reconstruction of congenital pseudoarthrosis of the tibia with free vascularized fibular grafts].

    PubMed

    Fernández Gómez, E; Castro Torre, M; González-Herranz, P; Delgado Sotorrío, C; Rodríguez Lorenzo, A

    2012-04-01

    Congenital pseudoarthrosis of the tibia (CPT) is an uncommon disease presenting a tibial nonunion since birth and frequently associated to neurofibromatosis type 1. Surgical management by wide excision of the pseudoarthrosis and sustitution of the defect with vascularized bone in an early stage has proven to be the most effective technique in terms of bone consolidation. We present a clinical case of a 22-month-old patient with CPT treated successfully by reconstruction with a free vascularized fibula graft with an excellent functional result.

  2. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  3. Aseptic laboratory techniques: plating methods.

    PubMed

    Sanders, Erin R

    2012-05-11

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak

  4. Major bleeding complicating deep sternal infection after cardiac surgery.

    PubMed

    Yellin, Alon; Refaely, Yael; Paley, Michael; Simansky, David

    2003-03-01

    This study was undertaken to determine the incidence and outcome of major bleeding complicating deep sternal infection after cardiac surgery, to identify predisposing factors and means of prevention, and to clarify management options. This was a retrospective study of 10,863 consecutive patients, of whom 213 (2.18%) acquired deep sternal infection. With 43 additional referrals, the total number of patients with deep sternal infection was 280. Deep sternal infection was managed by a two-stage scheme. Major bleeding was considered to be bleeding that occurred during or after operation for deep sternal infection from the heart, great vessels, or grafts, or bleeding requiring urgent exploration. Fifteen patients (5.36%) had major bleeding. The incidences of deep sternal infection and bleeding were highest among patients undergoing coronary artery bypass grafting. Thirteen patients had underlying diseases (type 2 diabetes in 9 cases). Deep sternal infection was diagnosed a median of 15 days after reoperation. Bleeding originated from the right ventricle in 9 patients. In 4 patients bleeding was iatrogenic during surgery for wire removal (n = 2) or reconstruction (n = 2). In 11 it occurred 15 minutes to 15 days (median 2 days) after wire removal, as a result of shearing forces in 7 cases and of infection only in 4 cases. Three patients died immediately. The other 12 were operated on, 6 with complete cardiopulmonary bypass, 2 with femoral cannulation, and 4 without cardiopulmonary bypass. The immediate mortality was 26.7%; the overall mortality was 53.3%. The median length of hospitalization of surviving patients was 38 days. The probability of development of major bleeding in patients with deep sternal infection was unrelated to the primary operation. The mortality associated with this complication was high. Meticulous technique during wire removal may decrease the risk of major bleeding. The impacts of cardiopulmonary bypass and of the technique and timing of sternal

  5. Brucella melitensis sternal osteomyelitis following median sternotomy.

    PubMed

    Chin, Yoon T; Krishnan, Monica; Burns, Phillipa; Qamruddin, Ahmed; Hasan, Ragheb; Dodgson, Andrew R

    2014-09-01

    Human brucellosis, a zoonotic infection, may present with a range of symptoms but is rarely described as a cause of surgical site infections. We present the first reported case of Brucella melitensis causing sternal osteomyelitis of a midline sternotomy for a coronary artery bypass graft. The operation was performed in a non-endemic country but the patient had travelled to Syria immediately before surgery, where the infection was assumed to have been acquired. The infection resolved following treatment with doxycycline, rifampicin and gentamicin. We review the literature for surgical site infections related to Brucella species and discuss the infection control implications. Human brucellosis has the potential to cause surgical site infections and it should be in the differential diagnosis of any patient with a relevant exposure history presenting with a febrile illness and musculoskeletal findings.

  6. A modified parasternal wire technique for prevention and treatment of sternal dehiscence.

    PubMed

    Sharma, Rajeev; Puri, Deepak; Panigrahi, Bishnu P; Virdi, Inderjeet S

    2004-01-01

    Sternal dehiscence with or without mediastinitis is a devastating complication of median sternotomy. Various techniques of sternotomy closure including 'figure of eight' wire sutures, nylon bands, and custom-made titanium-H plates have been described. We have devised and tested a new method of sternal closure to prevent sternal wound complications in patients at high risk of sternal dehiscence. 1336 patients underwent sternotomy for various cardiac operations from January 1996 to January 2002. Patients were divided into two groups. Group I consisted of 560 patients who did not have any high risk factors for sternal dehiscence and received a standard six wire closure. Group II comprised of patients at high risk of sternal dehiscence and were divided randomly into subgroup II A (n = 390), which included patients who had conventional sternal closure. While in subgroup II B (n = 386) patients had a modified parasternal wire closure according to the finalized protocol. Sternal instability was noticed in 1/560 and none had sternal dehiscence in group I, but 16/390 patients had sternal instability and 3/390 had sternal dehiscence in subgroup II A, whereas only one patient in high risk subgroup II B developed sternal dehiscence with mediastinitis and required a pectoral flap advancement for sternal closure. Use of modified parasternal wire closure in patients with a high risk of sternal dehiscence is a safe, effective, technically easily reproducible, as well as economical, method of preventing and treating sternal dehiscence.

  7. Closing the cleft over a throbbing heart: neonatal sternal cleft

    PubMed Central

    J, Ashok Raja; G, Mathevan; K, Mathiarasan; P, Ramasubramaniam

    2014-01-01

    Sternal cleft is a rare anomaly comprising 0.5% of chest wall malformations. We present a case of a neonate with a ‘V’-shaped upper partial sternal cleft at birth. A hyperpigmented cutaneous nevi was present over the cleft. Primary approximation and closure of the defect was performed at 1 week of life. We discuss the presentation and management, and review the literature. PMID:25100810

  8. Recurrent ibuprofen-induced aseptic meningitis.

    PubMed

    Nguyen, Huy T V; Juurlink, David N

    2004-03-01

    To report a case of recurrent aseptic meningitis temporally associated with the use of ibuprofen. A previously well 51-year-old white man presented with acute confusion and aphasia 7 days after taking a variety of nonprescription medications, including ibuprofen. Imaging of the brain was unremarkable, and lumbar puncture revealed lymphocytic pleocytosis with an elevated protein level. The symptoms improved shortly after admission, and no infectious cause was identified. Two weeks later, the patient was readmitted with similar symptoms beginning immediately after resumption of ibuprofen. His symptoms resolved promptly after ibuprofen was discontinued. Drug-induced aseptic meningitis is an unusual complication of drug therapy. Nonsteroidal antiinflammatory drugs (NSAIDs), particularly ibuprofen, are among the most commonly implicated agents, but rechallenge with the suspected agent is uncommon. Use of an objective causality tool indicated a probable relationship between ibuprofen and development of aseptic meningitis in our patient. Clinicians should consider NSAIDs as potential causes of aseptic meningitis, especially in patients with recurrent illness and no obvious infectious cause. A detailed drug history is invaluable in the assessment of such patients, with particular attention to nonprescription medications such as ibuprofen.

  9. Symptomatic intercostal lung hernia secondary to sternal dehiscence surgery.

    PubMed

    Celik, Sezai; Aydemir, Cüneyt; Gürer, Onur; Işık, Omer

    2013-01-01

    Patient: Male, 60Final Diagnosis: Iatrogenic intercostal lung herniaSymptoms: -Medication: No medicationClinical Procedure: Surgically cerrectedSpecialty: Thoracic surgery. Unusual clinical course. Iatrogenic intercostal lung hernia is a rare thoracic pathology. Injury of intercostal muscles and costocondral separation during median sternotomy and sternal dehiscence surgery are important factors in the development of hernia. We report for the first time a case of a 60-year-old man with acquired lung hernia after sternal dehiscence surgery, presenting as chest pain and exertional dyspnea. A 60-year-old man presented with a 6-week history of progressive exertional dyspnea, particularly following vigorous coughing. Past medical history included slight chronic obstructive pulmonary disease and coronary artery bypass grafting surgery 8 weeks previously, using the left internal mammary artery for the left anterior descending artery via median sternotomy and sternal dehiscence by the Robicsek method. A chest X-ray showed intact sternal and parasternal wires, but the bilateral lung parenchyma appeared normal. A spiral computed tomography scan of the chest found intercostal herniation of the anterior segment of the left upper lobe. The lung hernia was repaired surgically to relieve exertional dyspnea and incarceration, and to improve respiratory function. The postoperative course was uneventful and the patient recovered well. Intercostal lung hernia after median sternotomy and sternal dehiscence surgery is rare, and it has been previously reported on. Preventive techniques include gentle manipulation of the sternal retractor, avoidance of rib fractures, and using a protective method of intercostal arteries and nerves such as Sharma technique. Thoracic surgeons should be aware of this rare complication in sternal dehiscence surgery.

  10. Early acute aseptic iritis after cataract extraction.

    PubMed

    Allen, H F; Grove, A S

    1976-01-01

    Severe iritis which occurs within the first five days after cataract extraction may be categorized as (1) bacterial endophthalmitis, (2) toxic iritis, or (3) aseptic iritis. These entities can sometimes be distinguished because of their clinical features. If bacterial endophthalmitis is suspected, anterior chamber paracentesis should be considered and appropriate antibiotic treatment should be initiated. Acute iritis may result from the introduction of toxic agents into the eye, and may follow the use of products sterilized with ethylene oxide. Early acute aseptic iritis probably occurs more often than has previously been recognized. Response to intensive anti-inflammatory treatment is usually prompt and dramatic. The judicious use of cryoextraction and the careful manipulation of intraocular tissues may minimize the incidence and the severity of postoperative inflammation.

  11. Does the Method of Sternal Repair Influence Long-Term Outcome in Management of Treated Mediastinitis?

    DTIC Science & Technology

    2011-03-15

    of cardiac surgery, reducing early and long-term survival. Current management ofPOM is based on sternal debridement, eradication of infection , and...POM were reviewed (1994-2008). Superficial infections and sternal nonunions were excluded. Management principles included sternal debridement...OF (n = 65), and secondary sternal closure (n = 61). Control of mediastinal infection was augmented with negative pressure therapy (NPT) in 73

  12. Complete sternal cleft associated with right clavicular, manubrial, and thyroid hypoplasia, pectus deformity, and spinal anomalies.

    PubMed

    Golden, Eleza T; Alazraki, Adina; Loewen, Jonathan; Braithwaite, Kiery

    2016-01-01

    Sternal cleft anomalies are rare. Associated anomalies include pentalogy of Cantrell and posterior fossa abnormalities, hemangiomas, arteriopathy, cardiac anomalies, eye abnormalities, and sternal defects syndrome. There is only a single report of complete sternal cleft, pectus excavatum, and right clavicular hypoplasia in an adult. Thyroid hemiagenesis is also very rare. To our knowledge, this is the first case of complete sternal cleft, pectus deformity, and right clavicular hypoplasia in a child and the first case with right thyroid hemiagenesis.

  13. Surgical resection and reconstruction for primary malignant sternal tumor.

    PubMed

    Hirai, Shinji; Nobuto, Hiroaki; Yokota, Kazunori; Matsuura, Yosuke; Uegami, Shinnosuke; Sato, Katsutoshi; Mitsui, Norimasa; Sugita, Takashi; Hamanaka, Yoshiharu

    2009-06-01

    We report a very rare and successful surgery for primary malignant tumor of the sternum. A 73-year-old male, previously healthy, was admitted to our hospital because a chest computed tomography scan detected an abnormal shadow that suggested a sternal tumor destroying part of the sternum body. Aspiration needle biopsy demonstrated a primary sternal chondrosarcoma measuring 3 x 4 cm in diameter. The sternum below the second intercostal space was resected along with a 1-cm width of cartilage below the third rib on each side. Sternal reconstruction was performed with Composix mesh, titanium mesh, and Marlex mesh, using a right pectoralis major muscle flap translation. The patient was extubated just after surgery, and the postoperative course was uneventful. This procedure may be useful for repairing the detect after wide sternotomy.

  14. Pericardial Tamponade: a Rare Complication of Sternal Bone Marrow Biopsy

    PubMed Central

    Santavy, Petr; Troubil, Martin; Lonsky, Vladimir

    2013-01-01

    Injury of the heart with concomitant pericardial tamponade as a result of sternal bone marrow biopsy is rare. An 80-year-old man was admitted with dehydration and non-specified abdominal pain to the regional hospital. Sternal aspiration biopsy was performed because of anemia and thrombocytopenia. Later on, because of the back pain, general weakness and blood pressure drop, an echocardiography examination was indicated. Pericardial fluid collection was found. Anticipated ascending aortic dissection was excluded on computed tomography scan, but pericardial fluid collection was confirmed. Transfer to our cardiac surgical facility ensued. Limited heart tamponade was affirmed on echocardiography and surgery was immediately indicated. Blood effusion was found in upper mediastinal fat tissue and 300 mL of blood were evacuated from opened pericardial space. Stab wound by sternal biopsy needle at the upper part of ascending aorta was repaired by pledgeted suture. Postoperative course was uneventful. PMID:24179668

  15. The significance of stable patients with sternal fractures.

    PubMed

    Buckman, R; Trooskin, S Z; Flancbaum, L; Chandler, J

    1987-03-01

    A retrospective review of patients admitted with sternal fractures without massive trauma to the chest or hypotension was undertaken. Chest pain was present in 59 of 60 patients while external signs of bruising were noted in one-third. The standard anteroposterior (AP) roentgenogram of the chest was diagnostic in all patients. Thirty-four (56.7 per cent) patients had 51 significant noncardiac injuries, an average of 1.5 injuries per patient. Most commonly, these were orthopedic injuries, fractures of the rib and closed head injuries. Sixty-two per cent of the patients with sternal fractures had abnormal electrocardiograms (ECG) at some time, of which 34 per cent had ECG changes consistent with ischemia. The admission ECG was normal in 20 (48 per cent) patients. Three of these patients subsequently had significant ECG changes. Fractures that were comminuted or involved the sternal angle were more likely to be associated with ECG abnormalities than were simple fractures of the sternal body. Only three patients had elevated creatine phosphokinase-myocardial bond fractions. Two dimensional echocardiography and biventricular radionuclide angiocardiography were normal in 11 patients, including five patients with ECG abnormalities. There were no deaths related to the sternal fractures per se or to associated injuries. Sternal fractures result from high energy trauma and should be suspected in patients with chest pain after blunt thoracic trauma. The lateral roentgenogram of the chest is the most useful diagnostic test. There is a high incidence of associated cardiac and noncardiac injuries in these patients mandating close observation with ECG monitoring in the intensive care unit.

  16. Congenital sternal foramen in a stillborn Holstein calf.

    PubMed

    Azizi, Shahrzad; Bakhtiary, Mohsen Khosravi; Goodarzi, Mehdi

    2012-01-01

    Congenital sternal foramen is an anomaly whose occurrence is rare in human but is especially unusual in animals. This defect was formed when fusion of multiple ossification centers was incomplete. It may be associated with other lesions in body organs especially cardiac anomalies. In the present study, we report a very rare case of congenital sternal foramen in a Holstein calf. The oval defect was like a gunshot wound and located at the lower third of the sternum. Apparently, the rest of skeleton system seems normal. The awareness of the anomaly is important for better diagnosis and treatment of diseases.

  17. Congenital sternal foramen in a stillborn Holstein calf

    PubMed Central

    Azizi, Shahrzad; Bakhtiary, Mohsen Khosravi; Goodarzi, Mehdi

    2012-01-01

    Congenital sternal foramen is an anomaly whose occurrence is rare in human but is especially unusual in animals. This defect was formed when fusion of multiple ossification centers was incomplete. It may be associated with other lesions in body organs especially cardiac anomalies. In the present study, we report a very rare case of congenital sternal foramen in a Holstein calf. The oval defect was like a gunshot wound and located at the lower third of the sternum. Apparently, the rest of skeleton system seems normal. The awareness of the anomaly is important for better diagnosis and treatment of diseases. PMID:23569841

  18. Pulmonary agenesis associated with dextrocardia, sternal defects, and ectopic kidney.

    PubMed

    Eroglu, Atilla; Alper, Fatih; Turkyilmaz, Atila; Karaoglanoglu, Nurettin; Okur, Adnan

    2005-12-01

    Pulmonary agenesis is a rare embryological defect, usually unilateral, and is associated with skeletal, cardiovascular, and other anomalies. A 22-month-old girl was admitted to our clinic with recurrent pulmonary infections. A chest X-ray and multidetector computed tomography (MDCT) revealed pulmonary agenesis with dextrocardia, sternal defects, and a right pelvic ectopic kidney. We report on the first known case of right-sided pulmonary agenesis combined with isolated dextrocardia, sternal defects, and an ectopic kidney. The importance of MDCT for the diagnosis of pulmonary agenesis and associated other anomalies is demonstrated.

  19. Extracorporeal shockwaves versus surgery in the treatment of pseudoarthrosis of the carpal scaphoid.

    PubMed

    Notarnicola, A; Moretti, L; Tafuri, S; Gigliotti, S; Russo, S; Musci, L; Moretti, B

    2010-08-01

    The peculiar anatomical characteristics and precarious vascularization of the carpal scaphoid are responsible for a difficult healing of fractures and a fairly frequent subsequent evolution to pseudoarthrosis. Recently, extracorporeal shockwaves therapy (ESWT) has yielded encouraging results in the treatment of pseudoarthrosis of various bone segments. We report a retrospective study comparing the results of application of three sessions of shockwaves therapy (SW) with energy flux density (EFD) impulses of 0.09 (SD = 0.02) mJ/mm(2) ESWT emitted by an electromagnetic generator in 58 patients (group I) affected by pseudoarthrosis of the carpal scaphoid, with the results of surgical treatment consisting of stabilization and bone graft according to the Matti-Russe technique, performed in 60 subjects (controls, group II). There were no statistically significant differences in the mean duration of the pseudoarthrosis (p = 0.46), sex distribution (p = 0.41) and mean age at recruitment (p = 0.95) between the two patient groups. Posttreatment clinical-functional assessment, based on the Mayo Wrist Score, showed a significantly improved score, rising from 28-74.6 in group I already after 2 mo (p < 0.001), with 86.3% of the results judged as satisfactory or excellent; in group II the mean score rose from 27.5-74.2 after 2 mo, with 83.4% of the results judged as satisfactory or excellent (p < 0.001). At the same two-months follow-up (FU), radiographic consolidation was shown in 75.9% of patients in group I and 76.7% in group II. These improvements persisted at the subsequent controls at six and 12 mo in both groups. The Mayo Wrist Score and X-rays did not show statistically significant differences at the various FU visits in the two groups (p > 0.05). On the basis of our data, we can conclude that the results of ESWT are comparable with those of surgical stabilization and bone graft in the treatment of scaphoid pseudoarthrosis. In view of their minimal invasiveness, shockwaves

  20. Posterolateral lumbar fusion: Relationship between computed tomography Hounsfield units and symptomatic pseudoarthrosis.

    PubMed

    Nguyen, Ha Son; Shabani, Saman; Patel, Mohit; Maiman, Dennis

    2015-01-01

    Assessment of bone quality can guide spinal surgery. However, surgeons infrequently evaluate bone quality in a quantitative manner. Recent literature suggests a role for computed tomography (CT) Hounsfield units (HUs) as a marker for bone quality. Limited data exist regarding its utility with respect to posterolateral lumbar fusion (PLF). From fall 2010 to winter 2012, 10 patients underwent revision surgery for symptomatic pseudoarthrosis (defined as intractable pain associated with either radiographic evidence of nonunion or intraoperative evidence of nonunion) after a prior L4-S1 PLF. These patients were age-matched (±5 years) to 10 patients who underwent L4-S1 PLF with no clinical signs of pseudoarthrosis at 1-year follow-up. Available CT imaging (with or without instrumentation) was evaluated from L1 to L5 for the averaged HU. Data were pooled among L1-L3 values and between L4 and L5 values. Within the pseudoarthrosis group, the pooled L1-L3 HU value was similar to the pooled L4-L5 HU value (168.39 ± 22.84 HU vs. 166.98 ± 23.20 HU respectively, P = 0.89). The same pattern was observed for the control group (190.24 ± 37.13 HU vs. 201.89 ± 36.59 HU respectively, P = 0.44). On the other hand, the pooled L1-L3 and L4-L5 HU values were larger for the control group compared to the pseudoarthrosis group, with the pooled L4-L5 HU demonstrating statistical significance, P = 0.01. Currently, CT imaging is typically not obtained prior to lumbar fusion. Results demonstrated that CT HU values were significantly larger for patients who did not exhibit symptomatic pseudoarthrosis at 1-year follow-up compared to those who required revision surgery. As such, CT HU values may serve as a predictor for bony fusion to guide surgical management of patients under consideration for PLF.

  1. Posterolateral lumbar fusion: Relationship between computed tomography Hounsfield units and symptomatic pseudoarthrosis

    PubMed Central

    Nguyen, Ha Son; Shabani, Saman; Patel, Mohit; Maiman, Dennis

    2015-01-01

    Background: Assessment of bone quality can guide spinal surgery. However, surgeons infrequently evaluate bone quality in a quantitative manner. Recent literature suggests a role for computed tomography (CT) Hounsfield units (HUs) as a marker for bone quality. Limited data exist regarding its utility with respect to posterolateral lumbar fusion (PLF). Methods: From fall 2010 to winter 2012, 10 patients underwent revision surgery for symptomatic pseudoarthrosis (defined as intractable pain associated with either radiographic evidence of nonunion or intraoperative evidence of nonunion) after a prior L4–S1 PLF. These patients were age-matched (±5 years) to 10 patients who underwent L4–S1 PLF with no clinical signs of pseudoarthrosis at 1-year follow-up. Available CT imaging (with or without instrumentation) was evaluated from L1 to L5 for the averaged HU. Data were pooled among L1–L3 values and between L4 and L5 values. Results: Within the pseudoarthrosis group, the pooled L1–L3 HU value was similar to the pooled L4–L5 HU value (168.39 ± 22.84 HU vs. 166.98 ± 23.20 HU respectively, P = 0.89). The same pattern was observed for the control group (190.24 ± 37.13 HU vs. 201.89 ± 36.59 HU respectively, P = 0.44). On the other hand, the pooled L1–L3 and L4–L5 HU values were larger for the control group compared to the pseudoarthrosis group, with the pooled L4–L5 HU demonstrating statistical significance, P = 0.01. Conclusion: Currently, CT imaging is typically not obtained prior to lumbar fusion. Results demonstrated that CT HU values were significantly larger for patients who did not exhibit symptomatic pseudoarthrosis at 1-year follow-up compared to those who required revision surgery. As such, CT HU values may serve as a predictor for bony fusion to guide surgical management of patients under consideration for PLF. PMID:26693390

  2. [Particle disease--aseptic loosening of the total hip endoprosthesis].

    PubMed

    Kolundzić, Robert; Orlić, Dubravko

    2008-01-01

    Total hip arthroplasty (THA) improves the ability and quality of life in patients with hip dysfunction due to different causes. Aseptic loosening is the major cause of the late hip endoprosthesis failure. It results from aseptic inflammatory reaction induced by the implant wear debris accumulating at the prosthesis interface, and is mediated by numerous cellular and humoral factors. Due to presence of wear debris we call aseptic loosening of the total hip endoprosthesis as "particle disease". In the most important of factors affecting the risk of aseptic instability include patient's age, sex, body mass index, underlying morbidity (reason for THA), endoprosthetic material and surgeon's skill. However, taken together, all these factors explain only a minor part of variability of this phenomenon. Factors that are decisive for the occurrence of aseptic instability are still largely unknown. The existence of "individual disposition" for development of aseptic instability that is not determined by demographic or biomechanical factors is well recognized.

  3. Sternal fracture due to airbag injury: case report.

    PubMed

    Kapisiz, Nazmiye Selçuk; Ozpolat, Berkant; Kapisiz, Fahri; Yücel, Ertan

    2010-03-01

    Although airbags reduce the overall risk of injury and death from motor vehicle accidents, the airbag may cause injuries during deployment. We present a case of apparently isolated sternal fracture caused by airbag deployment during a motor vehicle crash and we discuss the ultrasonographic diagnosis. We also examine the mechanism of injury caused by the airbag.

  4. Sterile versus non-sterile glove use and aseptic technique.

    PubMed

    Flores, Ashley

    There is evidence indicating that improvements in infection control practice can reduce the incidence of healthcare-associated infection. This article explores the evidence base for glove use and aseptic technique. There is a lack of evidence regarding the influence of sterile versus clean gloves in clinical care. Therefore in practice, clean and aseptic techniques are often used interchangeably. Nurses must learn to select clean or aseptic technique, and therefore clean or sterile gloves, using a risk assessment protocol. Regular audits of aseptic technique and education are needed to improve care.

  5. Control of the aseptic processing environment.

    PubMed

    Frieben, W R

    1983-11-01

    Methods used by industry with applications to hospital pharmacy for maintaining an aseptic environment in production of sterile pharmaceutical products are discussed. A major source of product contamination is airborne microorganisms. The laminar-airflow workbench with a high-efficiency particulate air filter provides an ultraclean environment for preparation of sterile products. However, the workbench does not guarantee sterility of products and is not effective if not properly installed and maintained or if the operator uses poor aseptic technique. The laminar-airflow workbench should be tested for leaks, airflow velocity, and airflow patterns when installed, and the workbench should be checked periodically thereafter. The workbench should be placed in a cleanroom where traffic and air disturbances that might affect the laminar airflow are eliminated. A major source of airborne microbial contamination in cleanrooms is people. Personnel movement through an area and presence of personnel without lint-free, nonshedding protective garments increase the levels of microbial contaminants in an area. The transport of nonsterile products (bottles, boxes, paper products) into a cleanroom should be minimized. The cleanroom itself should be sanitized and should be immaculate. Microbial or particulate monitoring should be conducted in the cleanroom using a quantitative method, and corrective-action limits should be set. Hospital pharmacists should examine industrial sterile-processing techniques and apply them to the preparation of sterile products.

  6. [Treatment of pseudoarthrosis of long bones by surgical stabilization and a transfer of in-vitro cultivated bone marrow interstitial cells].

    PubMed

    Niedźwiedzki, T; Dabrowski, Z; Bonczar, M

    2000-01-01

    The paper presents the results of surgical stabilization of pseudoarthrosis of long bone augmented by a transfer of in vitro cultivated bone marrow interstitium cells in 4 patients. In three cases a Zespol external fixation device was applied without opening the pseudoarthrosis. One patient was treated by open reduction of the bone fragments with the use of frozen spongiose bone grafts. The mean age of the patients was 30.2 years. In two cases the pseudoarthrosis had developed in the tibia, in the remaining two cases it developed in the ulna. The pseudoarthrosis was present for a mean time of 2.5 years. In all cases healing of the pseudoarthrosis was observed after a mean time of 3.7 months.

  7. Deep sternal wound infection after cardiac surgery.

    PubMed

    Kubota, Hiroshi; Miyata, Hiroaki; Motomura, Noboru; Ono, Minoru; Takamoto, Shinichi; Harii, Kiyonori; Oura, Norihiko; Hirabayashi, Shinichi; Kyo, Shunei

    2013-05-20

    Deep sternal wound infection (DSWI) is a serious postoperative complication of cardiac surgery. In this study we investigated the incidence of DSWI and effect of re-exploration for bleeding on DSWI mortality. We reviewed 73,700 cases registered in the Japan Adult Cardiovascular Surgery Database (JACVSD) during the period from 2004 to 2009 and divided them into five groups: 26,597 of isolated coronary artery bypass graft (CABG) cases, 23,136 valvular surgery cases, 17,441 thoracic aortic surgery cases, 4,726 valvular surgery plus CABG cases, and 1,800 thoracic aortic surgery plus CABG cases. We calculated the overall incidence of postoperative DSWI, incidence of postoperative DSWI according to operative procedure, 30-day mortality and operative mortality of postoperative DSWI cases according to operative procedure, 30-day mortality and operative mortality of postoperative DSWI according to whether re-exploration for bleeding, and the intervals between the operation and deaths according to whether re-exploration for bleeding were investigated. Operative mortality is defined as in-hospital or 30-day mortality. Risk factors for DSWI were also examined. The overall incidence of postoperative DSWI was 1.8%. The incidence of postoperative DSWI was 1.8% after isolated CABG, 1.3% after valve surgery, 2.8% after valve surgery plus CABG, 1.9% after thoracic aortic surgery, and 3.4% after thoracic aortic surgery plus CABG. The 30-day and operative mortality in patients with DSWI was higher after more complicated operative procedures. The incidence of re-exploration for bleeding in DSWI cases was 11.1%. The overall 30-day/operative mortality after DSWI with re-exploration for bleeding was 23.0%/48.0%, and it was significantly higher than in the absence of re-exploration for bleeding (8.1%/22.0%). The difference between the intervals between the operation and death according to whether re-exploration for bleeding had been performed was not significant. Age and cardiogenic shock

  8. Congenital pseudoarthrosis of the tibia: healing by lengthening over a rod without compression of the nonunion. A preliminary report.

    PubMed

    Muhammad Abdul Jamil, Muhammad Kamal; Abdul Rashid, Abdul Halim; Ibrahim, Sharaf

    2013-05-01

    This preliminary report is on two patients with congenital pseudoarthrosis of the tibia who had a persistent nonunion following intramedullary rodding and bone grafting. We do not advocate repeated surgery to achieve union. When limb length discrepancy becomes greater than 5 cm, we proceeded with an Ilizarov procedure with the primary aim of equalizing limb length rather than achieving union. Healing of the pseudoarthrosis occurred in both patients after lengthening over the intramedullary rod without compression of the nonunion site. We believe that union occurs because of hyperaemia during the lengthening. This approach minimizes the repeated surgeries that are usually needed and thus ensures a more normal childhood without frequent hospitalizations.

  9. Double-Wire versus Single-Wire Sternal Closure in Obese Patients: a Randomized Prospective Study.

    PubMed

    Loladze, Giorgi; Kuehnel, Ralf Uwe; Claus, Thomas; Hartrumpf, Martin; Kuepper, Frank; Pohl, Manfred; Albes, Johannes Maximilian

    2017-06-01

    Background Sternal instability after coronary artery bypass grafting (CABG) is a serious complication. Obese patients are at high risk for sternal instability after CABG. This study was conducted to assess the positive impact of double-wire sternal closure on sternal instability. Methods A total of 200 obese patients with a body mass index ≥ 30 kg/m(2) undergoing isolated CABG with left internal mammary artery (LIMA) graft were randomly assigned to sternal closure either by eight single wires (n = 100) or by a combination of four double wires and four single wires. Results There was a total of 21 cases with sternal instability: 5 cases (i.e., 5%) in the double-wire group versus 16 cases (16%) in the single-wire group (p = 0.019). Logistic regression analysis showed sternal closure via double wires as an independent protection factor (odds ratio [OR]: 0.276; p = 0.029). Smoking (OR: 5.5; p = 0.006) and postoperative delirium (OR: 3.5; p = 0.033) turned out to be independent risk factors for the development of sternal instability. Conclusion Double-wire sternal closure significantly reduces postoperative sternal instability in obese patients undergoing isolated CABG with LIMA graft. Georg Thieme Verlag KG Stuttgart · New York.

  10. [Study on drawing aseptic gas in diluting drugs].

    PubMed

    Fan, Z C; Yu, F Y; Zou, F S

    1996-07-01

    In this study, the gas was drawn from sealed aseptic bottles, the blue flame of an alcohol lamp, and the air of the same treatment room. And the gas was put into aseptic solutions of 10% glucose separately and dripped. Then the samples were taken for bacteriaculture at appointed time-points. Meanwhile, the gases were drawn and put into aseptic solutions of 10% glucose separately. Then deactived penicillines were diluted with the solutions separately. Finally, the penicillines were mixed with 10% glucose and dripped. The samples were taken for bacteria-culture in the same way. The results showed that there was no colony existed in the gas from the sealed aseptic bottles and the flame of the alcohol lamp. However, colonies existed in the samples from the air of the treatment room. It is suggested that sealed aseptic gas should be drawn and kept for use in diluting drugs.

  11. Consistency of sternal percussion performed manually and with mechanical thumper.

    PubMed

    Bohadana, A B; Kraman, S S

    1992-09-01

    Auscultatory percussion is a technique that is potentially useful to study the acoustic behaviour of the chest. However, finger percussion, as used in this technique, has not been previously assessed for consistency. We calculated the intrasubject variability and short-term reproducibility of this technique in 10 healthy subjects. We examined several indices of the output sound of two series of sternal percussion manoeuvres performed one hour apart by the same examiner. The results were compared to those obtained during sternal percussion performed by a mechanical thumper. Consistency for both finger and thumper percussion varied from 4.8-20.6 (coefficients of variation) for various acoustic indices. For thumper percussion, the average results were not significantly different from those of finger percussion. We conclude that finger percussion of the sternum is sufficiently consistent to be used as a tool to investigate the acoustic behaviour of the chest.

  12. Pectoralis major turnover versus advancement technique for sternal wound reconstruction.

    PubMed

    Zahiri, Hamid R; Lumpkins, Kimberly; Kelishadi, Shahrooz; Stromberg, Jeffrey A; Silverman, Ronald P; Slezak, Sheri; Goldberg, Nelson H; Holton, Luther; Singh, Devinder P

    2013-02-01

    We compared the efficacy of pectoralis turnover versus advancement technique for sternal wound reconstruction. A retrospective chart review was performed, December 1989 to December 2010, to compare postoperative complication rates between pectoralis major turnover versus pectoralis major advancement reconstruction techniques. Complications included hematomas, wound infections, tissue necrosis, dehiscence, and need for reoperation. Pearson χ and logistic regression were used and significance was P < 0.05. Sixty-seven patients received 91 tissue flaps. Eleven patients (16%) required reoperation due to complications, including recurrent wound infection, tissue necrosis, wound dehiscence, mediastinitis, and hematoma formation. Four patients (6%) were treated conservatively for minor complications. Overall, complication rates were significantly higher after pectoralis major advancement reconstruction (32.5% vs. 3.7%, P = 0.004). When feasible, pectoralis major turnover flap offers a superior reconstructive technique for complex sternal wounds, with diminished complications compared with the pectoralis advancement flap.

  13. Primary repair of sternal cleft with a double osteochondroplasty flap

    PubMed Central

    Ballouhey, Quentin; Armendariz, Mateo; Vacquerie, Virginie; Marcheix, Pierre Sylvain; Berenguer, Daniel; Mouliès, Dominique; Fourcade, Laurent

    2013-01-01

    Sternal cleft is a rare congenital malformation affecting the anterior part of the chest wall. Surgical closure is recommended. It should be done early during the neonatal period because of the chest's flexibility. Associated abnormalities may have been previously excluded. Different surgical repairs have been described, but none has been proved to be superior to the others. We present the description of 2 cases managed with an original surgical technique. After dissecting the two sternal bars, they were approximated with several intercostal sutures under close cardiac and respiratory monitoring. A double perichondrium flap technique was then used and resulted in a double perichondrium layer. This technique is suitable for most cases and offers satisfying anatomical restoring and cosmetic results. PMID:23956263

  14. Surgical repair of a congenital sternal cleft in a cat.

    PubMed

    Schwarzkopf, Ilona; Bavegems, Valerie C A; Vandekerckhove, Peter M F P; Melis, Sanne M; Cornillie, Pieter; de Rooster, Hilde

    2014-07-01

    To describe the clinical findings, diagnosis, and treatment of an incomplete cleft of the 5th-8th sternebra and a cranioventral abdominal wall hernia in a 2 month old Ragdoll kitten and to evaluate the short- and long-term outcome. Clinical report. Ragdoll cat (n = 1), 2 months old. Sternal cleft was confirmed by thoracic radiographs. Computed tomography (CT) was used to plan an optimal surgical approach. A ventral median incision was made, starting at the 3rd sternebra and extended into the abdomen. Ostectomy of the proximal part of the 5th left sternebra was performed. Lateral periosteal flaps were created, unfolded, and absorbable monofilament sutures preplaced to facilitate closure and the repair was reinforced by 2 peristernal sutures. A bone graft was applied, and the free margin of the omentum was sutured to the cranial aspect of the wound. No major complications occurred. At 3 weeks, CT scan confirmed approximation of the hemisternebrae and at 10 months, complete fusion of the hemisternebrae had not occurred, but a strong connection of the sternal bars was present. Sternal cleft is a rare congenital abnormality that can be corrected surgically with favorable outcome. © Copyright 2014 by The American College of Veterinary Surgeons.

  15. La tuberculose sternale: à propos de 2 cas

    PubMed Central

    Ouarssani, Aziz; Atoini, Fouad; Ait Lhou, Fatima; Idrissi Rguibi, Mustapha

    2012-01-01

    La tuberculose ostéoarticulaire touche surtout le rachis. L’atteinte sternale est rare, elle représente moins de 1% des ostéomyélites tuberculeuses. L’abcès froid compliqué par une fracture pathologique constitue le mode de révélation le plus fréquent. Le traitement chirurgical assure l’évacuation des abcès et permet le diagnostique histologique et bactériologique. On rapporte deux cas de tuberculose sternale âgés respectivement de 45 ans et de 10ans, colligés au service de pneumologie, l’examen histologique et bactériologique ont permis d’affirmer le diagnostic de tuberculose, et le traitement antibacillaire a permis une évolution favorable .A la lumière de ces observations, les auteurs proposent de faire une mise au point sur l’ostéite sternale tuberculeuse. PMID:22514767

  16. Reconstruction of sternal cleft and aplasia cutis with a Medpor and a rectus abdominis musculocutaneous flap.

    PubMed

    Shen, Weimin; Cui, Jie; Chen, Jianbin; Zou, Jijun; Ji, Yi; Chen, Haini

    2012-01-01

    Superior sternal cleft is a rare congenital malformation that may represent a challenge for plastic surgeons. We describe a 1-day-old neonate. She was noted to have superior sternal cleft associated with aplasia cutis ahead the sternum. Three days after birth, she successfully underwent primary repair using a Medpor and a rectus abdominis musculocutaneous flap. This is a novel concept of successfully constructing the sternal cleft associated with aplasia cutis.

  17. Sternal bands for closure of midline sternotomy leads to better wound healing.

    PubMed

    Bhattacharya, Susmit; Sau, Indrajit; Mohan, Man; Hazari, Kunal; Basu, Rajarshi; Kaul, Ajay

    2007-01-01

    Midline sternotomy is the most common incision for cardiac surgery, but problems of wound healing and sternal instability are still matters of concern. The use of stainless steel wires only was compared with the use of wires plus sternal bands for closure of midline sternotomy wounds in a 2-year period. Of 370 patients in whom only stainless steel wires were used, 14 (3.78%) required re-operation for dehiscence. Only 3 (0.76%) of 395 patients in whom sternal bands were also used, required re-operation for dehiscence. The difference was highly significant. It was concluded that use of sternal bands leads to a more stable union.

  18. Incidental detection of superior sternal cleft on Technetium-99m methylene diphosphonate bone scan

    PubMed Central

    Aland, Nusrat IJ; Pawar, Shwetal Uday; Tilve, Gundu Hari

    2013-01-01

    A sternal cleft is an extremely rare developmental anomaly, which results from failure of fusion of sternal bars which contribute to the formation of the sternum. Most cases are diagnosed in early childhood, where it is associated with serious other midline defects. A sternal cleft is seen as a photopenic area on technetium-99m methylene diphosphonate bone scan and can be confused with other conditions. We report an extremely rare case of isolated upper sternal cleft in a 45-years-old male, found incidentally on Tc-99m MDP bone scan. PMID:24163521

  19. Aseptic meningoencephalitis mimicking transient ischaemic attacks.

    PubMed

    Papavasileiou, V; Milionis, H; Cordier, M; Eskandari, A; Ntaios, G; Michel, P

    2013-04-01

    To highlight meningoencephalitis as a transient ischaemic attack (TIA) mimic and suggest clinical clues for differential diagnosis. This was an observational study of consecutively admitted patients over a 9.75-year period presenting as TIAs at a stroke unit. A total of 790 patients with TIAs and seven with TIA-like symptoms but a final diagnosis of viral meningoencephalitis were recognised. The most frequent presentations of meningoencephalitis patients were acute sensory hemisyndrome (6) and cognitive deficits (5). Signs of meningeal irritation were minor or absent on presentation. Predominantly lymphocytic pleocytosis, hyperproteinorachia and a normal cerebrospinal fluid (CSF)/serum glucose index (in 5 out of 6 documented patients) were present. Meningeal thickening on a brain magnetic resonance imaging (MRI) scan was the only abnormal imaging finding. Six patients received initial vascular treatment; one thrombolysed. Finally, six patients were treated with antivirals and/or antibiotics. Although neither bacterial nor viral agents were identified on extensive testing, viral meningoencephalitis was the best explanation for all clinical and laboratory findings. Aseptic meningoencephalitis should be part of the differential diagnosis in patients presenting as TIA. The threshold for a lumbar puncture in such patients should be set individually and take into account the presence of mild meningeal symptoms, age and other risk factors for vascular disease, the results of brain imaging and the basic diagnostic work-up for a stroke source.

  20. Aseptic practice recommendations for circulating operating theatre nurses.

    PubMed

    Aholaakko, Teija-Kaisa; Metsälä, Eija

    Aseptic practices prevent exposure of a surgical wound to microbes, operating theatre environment and personnel. The circulating nurse assists the operating theatre personnel and supervises aseptic practices preventing surgical site infections. In the absence of analytical tools, few studies exist on intraoperative nursing-related aseptic practices. This study introduces recommendations to assess the role of the circulating nurse in aseptic practices. The authors used international recommendations and research findings to construct a 20-item self-report instrument with a demonstrated reliability across the scale. The authors structured the scale based on three phases: establishment; maintenance; and disestablishment of a sterile operating field. The tool was tested among operating theatre and day surgery nurses, and compared the differences in the mean acceptance rates of aseptic practice recommendations based on background characteristics. College-level nurses and nurses with 15 or more years' work experience accepted the recommendations at higher levels than bachelor-level nurses and nurses with less work experience. Continual assessment of the evidence base and comprehensive evaluation represent important components in further developing the tool. A reasonable number of items covering clinical practice are necessary for assessing the effectiveness and cost-effectiveness of aseptic practices, and a larger response rate is needed to validate the tool in future.

  1. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery.

    PubMed

    Chen, Jenny X; Alkire, Blake C; Lam, Allen C; Curry, William T; Holbrook, Eric H

    2016-10-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics.

  2. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery

    PubMed Central

    Chen, Jenny X.; Alkire, Blake C.; Lam, Allen C.; Curry, William T.; Holbrook, Eric H.

    2016-01-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics. PMID:27722072

  3. Pseudoarthrosis and fracture: interaction between severe vitamin D deficiency and primary hyperparathyroidism.

    PubMed

    Rastogi, Ashu; Bhadada, Sanjay Kumar; Bhansali, Anil

    2013-11-01

    A young woman with severe vitamin D deficiency presented with proximal muscle weakness, fragility fracture and pseudoarthrosis. On evaluation, she was found to have hypercalcaemia, a single parathyroid adenoma and an undetectable 25-hydroxyvitamin D level. She received parenteral cholecalciferol and subsequently underwent curative parathyroidectomy. Postoperatively, she had hungry bone syndrome, which she gradually recovered from with calcium and calcitriol replacement. Notably, her calcium levels were in the lower limit of normal range and associated with elevated alkaline phosphatase levels at postoperative Day 14. Follow-up for the next four years showed that the patient had remarkable symptomatic and radiological improvements. In this report, we discuss the pathophysiological interactions between vitamin D deficiency and associated primary hyperparathyroidism.

  4. Sex estimation from sternal measurements using multidetector computed tomography.

    PubMed

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-12-01

    We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation.

  5. Sex Estimation From Sternal Measurements Using Multidetector Computed Tomography

    PubMed Central

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-01-01

    Abstract We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation. Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30–60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090

  6. Sternal wire-grip: a new device in the surgical armamentarium †

    PubMed Central

    Izzat, Mohammad Bashar

    2012-01-01

    We describe a new wire-grip that enhances the surgeon's grip on sternal wires and facilitates their tightening with minimal risk of slips. This wire-grip should protect against operating room personnel injury during sternal re-approximation. PMID:22207695

  7. Isolation and Characterization of Multipotential Mesenchymal Stromal Cells from Congenital Pseudoarthrosis of the Tibia: Case Report.

    PubMed

    Diaz-Solano, Dylana; Wittig, Olga; Mota, Jose D; Cardier, Jose E

    2015-10-01

    Congenital pseudoarthrosis of the tibia (CPT) is an uncommon disease whose etiology and pathogenesis is unknown. Several evidences suggest that decreased osteogenic capacities, impaired local vascularization, and microenvironment alterations may play a role in the pathogenesis of CPT. Additionally, it is not clear if the pathogenesis of this disease is related to the absence of cells with osteogenic capacity of differentiation. In this work, a two-year-old patient diagnosed with CPT underwent an orthopedic surgery to promote bone union in a pseudoarthrosis lesion. Tissue from CPT lesion was excised, and histological evaluation and tissue culture were performed. Histologic analysis of the soft CPT lesion showed the presence of highly cellular fibrous tissue, vascularization, and abundant extracellular matrix. Fusiform cells of mesenchymal appearance were observed but osteoblasts, osteoclasts, chondrocytes, and adipose cells were not found. There was no evidence of osteogenesis. CPT tissue cultured as explants showed, after one month of culture, evidence of osteogenesis, chondrogenesis, and adipogenesis. Cells isolated from explants of CPT tissue showed a fibroblast-like morphology and expressed the mesenchymal stromal cell (MSC) markers: CD105, CD73, and CD90 (CPT-MSC). Functional analysis showed that CPT-MSC differentiate, in vitro, into osteogenic, chondrogenic, and adipocytic cells. CPT-MSC expressed osteocalcin and agrecan. CPT-MSC produced collagen in the presence of ascorbic acid. MSC from BM of normal individuals were used as control. In summary, our results indicate that CPT tissue contains MSC with osteogenic capacity of differentiation. It is possible that CPT microenvironment may contribute to impair the osteogenic capacity of differentiation of CPT-MSC. © 2015 Wiley Periodicals, Inc.

  8. Sternal force-displacement relationship during cardiopulmonary resuscitation.

    PubMed

    Gruben, K G; Guerci, A D; Halperin, H R; Popel, A S; Tsitlik, J E

    1993-05-01

    A viscoelastic model is presented to describe the dynamic response of the human chest to cyclic loading during manual cardiopulmonary resuscitation (CPR). Sternal force and displacement were measured during 16 clinical resuscitation attempts and during compressions on five CPR training manikins. The model was developed to describe the clinical data and consists of the parallel combination of a spring and dashpot. The human chests' elastic and damping properties were both augmented with increasing displacement. The manikins' elastic properties were stiffer and both elastic and damping properties were less dependent on displacement than the humans'.

  9. Sternal wound reconstruction: 252 consecutive cases. The Lenox Hill experience.

    PubMed

    Schulman, Norman H; Subramanian, Valavanur

    2004-07-01

    The authors report on a personal experience of 252 consecutive secondary sternal wound closures resulting from a series of 11,601 median sternotomies at a single institution performed over a 14-year period. Protocols for treatment are described from the time of initial consultation with the plastic surgeon through the period of postoperative care. The patients and wounds were diverse and complex, with each factor requiring careful analysis before a treatment course was selected. Complete and thorough wound débridement with the elimination of dead space ensured by the placement of healthy tissue and the maintenance of active suction at the operative site were the common elements of success.

  10. Management of Large Sternal Wound Infections With the Superior Epigastric Artery Perforator Flap.

    PubMed

    Eburdery, H; Grolleau, J L; Berthier, C; Bertheuil, N; Chaput, B

    2016-01-01

    The management of sternal wound infections often requires pedicled flaps. In recent years, the emergence of perforator flaps has changed our management of wounds involving tissue loss. For sternal wounds, the superior epigastric artery perforator (SEAP) flap can be used with the propeller procedure with minimal donor site morbidity. In our practice, this flap has replaced the traditional latissimus dorsi and pectoralis major flaps in the treatment of many sternal wounds. We report our experience with 4 patients with large sternal wound infection after cardiothoracic operations. The SEAP flap appears a safe alternative for low-morbidity coverage of sternal infections. Moreover, muscle flaps remain available in case the SEAP flap fails. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  11. The Association between Blunt Cardiac Injury and Isolated Sternal Fracture

    PubMed Central

    McMaster, Jason; Desai, Pathik J.; Desai, Sapan S.; Kuy, SreyRam; Mata, Maggy; Cooper, Jamie

    2014-01-01

    The treatment of isolated sternal fractures (ISF) throughout the world is heterogeneous. This study aimed to identify the incidence, morbidity, and mortality associated with isolated fractures of the sternum and describe current practice for diagnosis and management of ISF and cardiac injury at a level I trauma center in the UK. A retrospective cohort study of adult patients (>16 years) with ISF presenting from 2006 to 2010 was conducted. Eighty-eight patients with ISF were identified. Most patients (88%, 77) were admitted to hospital with 66% (58) of them discharged within 48 hours. Two (2%) patients had an ER EKG with abnormality but both resolved to normal sinus rhythm within 6 hours of follow-up. Serum CEs were drawn from 55 (63%) patients with only 2 (2%) having a rise in serum troponin >0.04; however, in both of these patients troponin quickly normalized. Six (7%) patients underwent echocardiograms without significant findings. In all 88 patients with ISF, no cases of clinically significant cardiac injury were identified. Patients presenting with an isolated sternal fracture with no changes on EKG or chest X-ray do not warrant an admission to hospital and may be discharged from the ER. PMID:24653859

  12. An unconventional indication of the Sauve' - Kapandji procedure in a radial shaft pseudoarthrosis and chronic DRUJ dislocation: a case report.

    PubMed

    Theodorakis, E; Fanelli, M; Ottolenghi, P; Pappalardo, S

    2013-01-01

    We present a 42-years-old male who developed a radial shaft pseudoartrosis and a chronic DRUJ dislocation/instability, following a Galeazzi fracture. He presented to our Office with a severe inability of wrist and forearm motion. A Sauve'-Kapandji procedure was adopted, performing a lateral approach to the ulna and grafting the excised ulnar block to retrieve radial length at the pseudoarthrosis level. Cancellous bone grafts from the iliac crest were also applied and mixed with autologous platelet rich plasma to promote callus formation. The goal was to create an intentional pseudoarthrosis of the distal ulna combined with a DRUJ arthrodesis, in order to resolve instability and regain forearm pronation/supination. We obtained bone healing, an excellent clinical recovery, and the patient returned to all his previous activities six months after surgery. To our knowledge, this is the first reported case of a radial shaft psudoarthrosis treated with the Sauve'-Kapandji technique.

  13. Cervical myelopathy caused by atlas osteochondroma and pseudoarthrosis between the osteochondroma and lamina of the axis: case report.

    PubMed

    Miyakoshi, Naohisa; Hongo, Michio; Kasukawa, Yuji; Shimada, Yoichi

    2010-01-01

    A 58-year-old man presented with a 6-month history of progressive cervical myelopathy. Magnetic resonance imaging and computed tomography of the cervical spine revealed a bone tumor arising from the posterior arch of the atlas and osteophytes at a pseudoarthrosis between the tumor and the lamina of the axis, resulting in marked spinal cord compression. The patient's symptoms resolved after en bloc resection of the tumor and removal of the osteophytes. The histological diagnosis was osteochondroma. The primary cause of myelopathy in the present case was osteochondroma arising from the posterior arch of the atlas, but the osteophyte formations appearing at the pseudoarthrosis between the atlas osteochondroma and the lamina of the axis might also have contributed to the symptoms, which appeared when the patient was in his late 50s.

  14. Molecular identification of bacteria from aseptically loose implants.

    PubMed

    Kobayashi, Naomi; Procop, Gary W; Krebs, Viktor; Kobayashi, Hideo; Bauer, Thomas W

    2008-07-01

    Polymerase chain reaction (PCR) assays have been used to detect bacteria adherent to failed orthopaedic implants, but some PCR assays have had problems with probable false-positive results. We used a combination of a Staphylococcus species-specific PCR and a universal PCR followed by DNA sequencing to identify bacteria on implants retrieved from 52 patients (92 implants) at revision arthroplasty. We addressed two questions in this study: (1) Is this method able to show the existence of bacterial DNA on presumed aseptic loosed implants?; and (2) What proportion of presumed aseptic or culture-negative implants was positive for bacterial DNA by PCR? Fourteen implants (15%) were believed infected, whereas 74 implants (85%) were believed aseptic. Each implant was sonicated and the resulting solution was submitted for dual real-time PCR assay and culture. All implants believed aseptically loose were culture-negative, but nine of the 74 (12%) had bacterial DNA by PCR; two (2.7%) were PCR-positive and also showed histologic findings suggestive of infection. Uniquely developed PCR and bacterial sequencing assays showed bacterial DNA on 12% of implants removed for presumed aseptic loosening. Additional studies are needed to determine the clinical importance of bacterial DNA detected by PCR but not by conventional culture. Level III, diagnostic study.

  15. Complicated sternal dehiscence treated with the strasbourg thoracic osteosyntheses system (STRATOS) and the transposition of greater omentum: a case report.

    PubMed

    Ceresa, Fabrizio; Casablanca, Giuseppe; Patanè, Francesco

    2010-06-28

    Sternal dehiscence is a serious complication after cardiac surgery. Sternal refixation, performed by simple rewiring or techniqual modification of rewiring as described by Robicsek, can fail, overall when the bone quality is poor or the sternum is completely destroyed. The sternal closure systems, consisting of plates, screws or rib clips and titanium bars, have been recently introduced to treat the complicated sternal dehiscence. We describe for the first time the use of the Strasbourg Thoracic Osteosyntheses System (STRATOS) and the greater omentum, to treat a complicated sternal dehiscence, causing chest pain and respiratory failure.

  16. Complete sternal cleft — A rare congenital malformation and its repair in a 3-month-old boy: A case report

    PubMed Central

    Kothari, Paras; Gupta, Abhaya; Patil, Prashant S.; Kekre, Geeta; Kamble, Ravi; Dikshit, Kiran Vishesh

    2016-01-01

    Complete midline sternal cleft is a rare congenital anomaly resulting from failed midline ventral fusion of the sternal bars. Very few cases of complete sternal cleft have been described in literature. We present a case of complete sternal cleft in a 3-month-old child. The patient underwent primary closure of the defect using stainless steel wires. PMID:27046980

  17. Clinical translation of a mesenchymal stromal cell-based therapy developed in a large animal model and two case studies of the treatment of atrophic pseudoarthrosis.

    PubMed

    Prat, Salvi; Gallardo-Villares, Santiago; Vives, Marian; Carreño, Ana; Caminal, Marta; Oliver-Vila, Irene; Chaverri, Daniel; Blanco, Margarita; Codinach, Margarita; Huguet, Pere; Ramírez, José; Pinto, Javier A; Aguirre, Màrius; Coll, Ruth; Garcia-López, Joan; Granell-Escobar, Fernando; Vives, Joaquim

    2016-09-29

    Pseudoarthrosis is a relatively frequent complication of fractures, in which the lack of mechanical stability and biological stimuli results in the failure of bone union, most frequently in humerus and tibia. Treatment of recalcitrant pseudoarthrosis relies on the achievement of satisfactory mechanical stability combined with adequate local biology. Herein we present two cases of atrophic pseudoarthrosis that received a tissue-engineering product (TEP) composed of autologous bone marrow-derived mesenchymal stromal cells (BM-MSC) combined with deantigenized trabecular bone particles from a tissue bank. The feasibility of the treatment and osteogenic potential of the cell-based medicine was first demonstrated in an ovine model of critical size segmental tibial defect. Clinical-grade autologous BM-MSC were produced following a good manufacturing practice-compliant bioprocess. Results were successful in one case, with pseudoarthrosis resolution, and inconclusive in the other one. The first patient presented atrophic pseudoarthrosis of the humeral diaphysis and was treated with osteosynthesis and TEP resulting in satisfactory consolidation at month 6. The second case presented a recalcitrant pseudoarthrosis of the proximal tibia and the Masquelet technique was followed before filling the defect with the TEP. This patient presented a neuropathic pain syndrome unrelated to the treatment that forced the amputation of the extremity 3 months later. In this case, the histological analysis of the tissue formed at the defect site provided evidence of neovascularization but no overt bone remodelling activity. It is concluded that the use of expanded autologous BM-MSC to treat pseudoarthrosis was demonstrated to be feasible and safe, provided that no clinical complications were reported, and early signs of effectiveness were observed. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. [Metal ions: important co-players in aseptic loosening].

    PubMed

    Cadosch, D; Schlett, C L; Gautschi, O P; Frei, H C; Filgueira, L

    2010-08-01

    The aims of this review were to discuss the different mechanisms of biocorrosion of orthopaedic metal implants in the human body, as well as the effects of the released metal ions on bone metabolism and the immune system in regard to their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity. Implant failure due to aseptic loosening is thought to occur in about 10-15% of cases. A review of the literature (using PubMed with the search terms: biocorrosion, metal ions and bone metabolism) was performed. Additionally, we discuss our research results in the field of aseptic loosening. Despite a great effort in developing new implants, metal devices used in orthopaedic and trauma surgery remain prone to biocorrosion by several mechanisms including the direct corrosion by osteoclasts, leading to the production of significant amounts of wear particles and metal ions. In addition to the well documented increased osteolytic activity caused by large (in the nanometer range) wear particles, increasing evidence strongly suggests that the released metal ions contribute to the pathophysiological mechanism of aseptic loosening. Metal ions stimulate both the immune system and bone metabolism through a series of direct and indirect pathways leading to an increased osteolytic activity at the bone-implant interface. To date, revision surgery remains the only option for the treatment of a failed orthopaedic implant caused by aseptic loosening. A better understanding of the complex pathophysiological mechanisms (including the effects caused by the released metal ions) of aseptic loosening may have a significant potential in developing novel implants and therapies in order to reduce the incidence of this complication. Georg Thieme Verlag KG Stuttgart, New York.

  19. Primary repair of sternal cleft in infancy using combined periosteal flap and sliding osteochondroplasty

    PubMed Central

    Muthialu, Nagarajan

    2013-01-01

    Sternal clefts are rare congenital malformations of the chest wall. Immediate correction in neonates or in infancy is beneficial in terms of providing skeletal cover with little or no need for any prosthetic material for reconstruction. In the absence of internal midline defects, one should aim to provide complete correction when the chest wall is still compliant, and cardiorespiratory compromise is expected to be least after correction. We report on 2 children who underwent primary sternal-cleft repair using a periosteal advancement flap along with mobilization of lateral sternal bars after sliding osteotomy of corresponding ribs. PMID:23427313

  20. Bilateral sternales in relation to body of sternum.

    PubMed

    Gupta, Madhur; Harjeet

    2004-06-01

    The sternalis muscle on the manubrium sterni and its communication with sternocleidomastoid has been reported by many workers as unilateral or bilateral in both the sexes. The present report deals with bilateral sternales below the angle of sternum in a male cadaver during routine dissection. The proximal attachment of the muscle was from the manubriosternal joint on either side, right being broader than left and was found to be overlapping the lateral part of sternum and adjoining pectoralis major muscle. The muscle was running downwards and laterally and was attached on the cartilage of 6th and 7th ribs appearing to be continuous with rectus abdominis muscle. The muscle was found to be innervated by branches of the corresponding intercostal nerves of these spaces. The sternalis if present could be used for reconstructive surgical operations on the breast.

  1. Ibuprofen-induced aseptic meningitis in rheumatoid arthritis.

    PubMed

    Horn, A C; Jarrett, S W

    1997-09-01

    To report a case of aseptic meningitis related to ibuprofen ingestion. We discuss the case of a 56-year-old white man with a history of rheumatoid arthritis and hypertension who became confused, nauseated, and began to vomit within 2 hours of the ingestion of ibuprofen. A diagnosis of ibuprofen-induced aseptic meningitis was made based on the patient's physical and laboratory findings, the quick onset and resolution of symptoms, and his medical history. Ibuprofen-induced aseptic meningitis has been most frequently reported in patients with systemic lupus erythematosus. However, there have been reports of this reaction in patients with other underlying disease states. Various nonsteroidal antiinflammatory drugs have been reported to cause this reaction, but ibuprofen is the most common offending agent. A drug-related cause should be considered in any patient who presents with typical meningitis symptoms, such as fever, headache, and stiff neck, that occur within hours of ingesting a drug. Although persons with systemic lupus erythematosus appear to have an increased risk for this type of reaction, the development of signs and symptoms in other patients warrants the consideration of nonsteroidal antiinflammatory drugs as the cause of aseptic meningitis.

  2. Risk factors for total knee arthroplasty aseptic revision.

    PubMed

    Namba, Robert S; Cafri, Guy; Khatod, Monti; Inacio, Maria C S; Brox, Timothy W; Paxton, Elizabeth W

    2013-09-01

    Using a Total Joint Replacement Registry, patient, operative, implant, surgeon, and hospital risk factors associated with aseptic revision after primary total knee arthroplasty (TKA) were evaluated. From 04/2001 to 12/31/2010 64,017 primary TKA cases, followed for a median time of 2.9 years, were registered and included in the analysis. Patients were predominantly female, white, with osteoarthritis, and obese. The crude aseptic revision rate is 1.3% (N=826). The cumulative survival for aseptic revision at 8 years is 97.6% (95% CI 97.3%-97.8%). Adjusted models revealed that age, race, body mass index, diabetic status, bilateral procedures, high-flex implants, and the LCS mobile bearing knee are associated with risk of revision. Gender, general health status, diagnosis, surgeon fellowship training, surgeon volume, hospital volume, fixation, and bearing surface material were not associated with risk of aseptic revision. Recognition of surgical factors associated with TKA failures can help the surgeons with their choices of surgical techniques and implants.

  3. Laparoscopic greater omentum harvesting with split-thickness skin grafting for sternal wound dehiscence.

    PubMed

    Barragan, Barnard A; Halldorsson, Ari O; Wachtel, Mitchell S; Frezza, Eldo E

    2006-09-01

    Sternal wound dehiscence is a serious complication occasionally requiring soft tissue coverage. The greater omentum typically has been used as a last resort because of the underlying morbidity from a laparotomy. We present a case in which a laparoscopically created omental flap with subsequent split-thickness skin grafting was used to correct a large soft tissue defect that occurred after sternal wound dehiscence developed. A nonambulatory 49-year-old man who underwent coronary artery bypass grafting developed sternal wound dehiscence. Because a large soft tissue defect developed after multiple debridements, soft tissue coverage was required. A laparoscopically harvested omental flap spared this man's upper extremity musculature and provided a soft tissue bed for split-thickness skin grafting. This case helps to establish the role of laparoscopically harvested omentum. If the results suggested by this case are confirmed in a large series, omental flaps should be considered as options of first choice in the management of sternal wound dehiscence.

  4. Sternal reconstruction of deep sternal wound infections following median sternotomy by single-stage muscle flaps transposition.

    PubMed

    Wu, Song; Wan, Feng; Gao, Yong-shun; Zhang, Zhe; Zhao, Hong; Cui, Zhong-qi; Xie, Ji-yan

    2014-12-01

    To assess clinical effectiveness of using bilateral pectoralis major or plus rectus abdominis muscle flaps in treating deep sternal wound infection (DSWI) following median sternotomy. Between January 2009 and December 2013, 19 patients with DSWI after median sternotomy for cardiac surgery were admitted to our hospital, including 14 males (73.7%) and 5 females (26.3%), aged 55±13 (18-78) years. According to the Pairolero classification of infected median sternotomies, 3 (15.8%) patients were type II, and the other 16 (84.2%) were type III. Surgical procedure consisted of adequate debridement of infected sternum, costal cartilage, granulation, steel wires, suture residues and other foreign substances. Sternal reconstruction used the bilateral pectoralis major or plus rectus abdominis muscle flaps to obliterate dead space. The drainage tubes were placed and connected to a negative pressure generator for adequate drainage. There were no intraoperative deaths. In 15 patients (78.9%), bilateral pectoral muscle flaps were mobilized sufficiently to cover and stabilize the defect created by wound debridement. 4 patients (21.0%) needed bilateral pectoral muscle flaps plus rectus abdominis muscle flaps because their pectoralis major muscle flaps could not reach the lowest portion of the wound. 2 patients (10.5%) presented with subcutaneous infection, and 3 patients (15.8%) had hematoma. They recovered following local debridement and medication. 17 patients (89.5%) were examined at follow-up 12 months later, all healed and having stable sternum. No patients showed infection recurrence during the follow-up period over 12 months. DSWI following median sternotomy may be effectively managed with adequate debridement of infected tissues and reconstruction with bilateral pectoralis major muscle or plus rectus abdominis muscle flap transposition.

  5. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  6. Sternal fractures and delayed cardiac tamponade due to a severe blunt chest trauma.

    PubMed

    Liang, Huai-min; Chen, Qiu-lin; Zhang, Er-yong; Hu, Jia

    2016-04-01

    Sternal fractures caused by blunt chest trauma are associated with an increased incidence of cardiac injury. Reports of the incidence of cardiac injury associated with sternal fracture range from 18% to 62%. Delayed cardiac tamponade is a rare phenomenon that appears days or weeks after injury. Moreover, after nonpenetrating chest trauma, cardiac tamponade is very rare and occurs in less than 1 of 1000. This case describes a patient who had delayed cardiac tamponade 17 days after a severe blunt chest trauma.

  7. Reconstruction of sternal cleft with autologous cartilage graft in an adult.

    PubMed

    Kuru, Pinar; Ermerak, Nezih Onur; Bostanci, Korkut; Yuksel, Mustafa

    2015-06-01

    Sternal cleft is a rare chest wall deformity associated with various malformations. Primary closure is the gold standard in the newborn period. Alternative techniques are possible for older patients. A 23-year-old woman with a partial sternal cleft and no additional deformity, underwent reconstruction using costal cartilage grafts. Postoperative physical and functional were excellent. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  8. Suction-irrigation drainage: an underestimated therapeutic option for surgical treatment of deep sternal wound infections.

    PubMed

    Deschka, Heinz; Erler, Stefan; El-Ayoubi, Lemir; Vogel, Cordula; Vöhringer, Luise; Wimmer-Greinecker, Gerhard

    2013-07-01

    Deep sternal wound infections are significant and severe complications following cardiac surgery and substantially influence perioperative morbidity and mortality. We present the experience of our department using two different surgical treatments over a three-year period. Between January 2009 and December 2011, a total of 3274 cardiac procedures with complete median sternotomy were performed in our department. In 94 patients (3%), a deep sternal wound infection occurred, including sternal instability with consecutive surgical treatment. The patients either received wound debridement with sternum refixation and suction-irrigation drainage (SID; n = 72) or sternum refixation only (RF; n = 22) if there was sternal instability with limited signs of infection. SID was routinely installed for 7 days: the irrigation solution contained neomycin. In all cases, swabs were taken and analysed. The different methods were evaluated in respect of their clinical outcomes. The success rate-defined as single, uncomplicated procedure-of the SID treatment was 74%, compared with 59% of the isolated sternum refixation. Complications included continuous infection, recurrence of sternal instability and wound necrosis. Eighty-eight percent of the swabs in the SID group were positive, compared with 32% in the sternal refixation only group. The dominating pathogenic germs were coagulase-negative staphylococci and staphylococcus aureus. Mortality was 10% for the SID group and 5% for the RF group. Contrary to accepted opinion, the suction-irrigation drainage is an appropriate therapy for deep sternal wound infections. Nevertheless, deep sternal wound infections after cardiac surgery remain severe complications and are related to increased morbidity and mortality.

  9. Fixation of sternal fracture using absorbable plating system, three years follow-up

    PubMed Central

    Katballe, Niels; Pilegaard, Hans

    2015-01-01

    Sternal fractures occur due to severe chest wall trauma in a small number of patients. They are often conservatively treated. The surgical intervention, although controversial, is indicated in case of deformity, severe pain, and ventilatory complications. We report the first case where absorbable plate has been used to fix a traumatic fracture in a 42-year-old female. After 3 years, the patient is still free of symptoms and CT scanning reveals intact sternal bone structure. PMID:26101659

  10. Recurrent sternal infection following treatment with negative pressure wound therapy and titanium transverse plate fixation.

    PubMed

    Gaudreau, Geneviève; Costache, Victor; Houde, Chanel; Cloutier, Daniel; Montalin, Livia; Voisine, Pierre; Baillot, Richard

    2010-04-01

    To provide a definition for recurrent sternal infection (RSI), analyse the risk factors and describe the management of this complication following treatment of deep sternal wound infection (DSWI) with horizontal titanium sternal osteosynthesis and coverage with pectoralis major myocutaneous flaps. Between 2002 and 2007, 10665 patients were submitted to open-heart surgery (OHS) in our institution, of whom 149 (1.4%) developed a DSWI. Negative pressure wound therapy (NPWT) followed by sternal osteosynthesis with musculocutaneous coverage was used in 92 (61.7%) patients. A retrospective review was done using a prospectively maintained database to identify risk factors for recurrent infection in this group of patients. Of the 92 patients who underwent sternal osteosynthesis, nine (9.8%) developed recurrent sternal infection requiring hardware removal. Univariate analysis showed that preoperative methicillin-resistant Staphylococcus aureus (MRSA) status (33.3% vs 6.1%; p=0.03) and prolonged intubation time in ICU (44.4% vs 14.6%; p<0.05) were significant risk factors. Two-thirds of these patients were also found to be infected with the same germ as the one responsible for their initial DSWI. No death was reported and sternal integrity was preserved in all patients despite plate removal. To lower the rate of RSI in patients treated with transverse sternal ostheosynthesis along with myocutaneous coverage for DSWI, surgeons must consider the MRSA preoperative status as a significant predictor of RSI and/or persistent infection. Chest-wall integrity in patients with RSI can be maintained after hardware removal, even after only a few weeks following initial plating. Copyright (c) 2009 European Association for Cardio-Thoracic Surgery. All rights reserved.

  11. Suction-irrigation drainage: an underestimated therapeutic option for surgical treatment of deep sternal wound infections†

    PubMed Central

    Deschka, Heinz; Erler, Stefan; El-Ayoubi, Lemir; Vogel, Cordula; Vöhringer, Luise; Wimmer-Greinecker, Gerhard

    2013-01-01

    OBJECTIVES Deep sternal wound infections are significant and severe complications following cardiac surgery and substantially influence perioperative morbidity and mortality. We present the experience of our department using two different surgical treatments over a three-year period. METHODS Between January 2009 and December 2011, a total of 3274 cardiac procedures with complete median sternotomy were performed in our department. In 94 patients (3%), a deep sternal wound infection occurred, including sternal instability with consecutive surgical treatment. The patients either received wound debridement with sternum refixation and suction-irrigation drainage (SID; n = 72) or sternum refixation only (RF; n = 22) if there was sternal instability with limited signs of infection. SID was routinely installed for 7 days: the irrigation solution contained neomycin. In all cases, swabs were taken and analysed. The different methods were evaluated in respect of their clinical outcomes. RESULTS The success rate—defined as single, uncomplicated procedure—of the SID treatment was 74%, compared with 59% of the isolated sternum refixation. Complications included continuous infection, recurrence of sternal instability and wound necrosis. Eighty-eight percent of the swabs in the SID group were positive, compared with 32% in the sternal refixation only group. The dominating pathogenic germs were coagulase-negative staphylococci and staphylococcus aureus. Mortality was 10% for the SID group and 5% for the RF group. CONCLUSIONS Contrary to accepted opinion, the suction-irrigation drainage is an appropriate therapy for deep sternal wound infections. Nevertheless, deep sternal wound infections after cardiac surgery remain severe complications and are related to increased morbidity and mortality. PMID:23529753

  12. A new cable-tie-based sternal closure device: infectious considerations†

    PubMed Central

    Melly, Ludovic; Gahl, Brigitta; Meinke, Ruth; Rueter, Florian; Matt, Peter; Reuthebuch, Oliver; Eckstein, Friedrich S.; Grapow, Martin T.R.

    2013-01-01

    OBJECTIVES To determine the difference in sternal infection and other infectious events between conventional wire and cable-tie-based closure techniques post-sternotomy in a collective of patients after cardiac surgery. METHODS The sternal ZipFix™ (ZF) system consists of a biocompatible poly-ether-ether-ketone (PEEK) cable-tie that surrounds the sternum through the intercostal space and provides a large implant-to-bone contact. Between 1 February 2011 and 31 January 2012, 680 cardiac operations were performed via sternotomy at our institution. After the exclusion of operations for active endocarditis and early mortality within 7 days, 95 patients were exclusively closed with ZF and could be compared with 498 who were closed with conventional wires (CWs) during the same period. A multivariable logistic regression analysis, including body mass index, renal impairment and emergency as suspected confounders and inverse propensity weights was performed on the infection rate. RESULTS Total infection rate was 6.1%, with a total of 36 diagnosed sternal infections (5 in ZF and 31 in CW). Comparing ZF with CW with regard to sternal infection, there is no statistically significant difference related to the device (odds ratio: 0.067, confidence interval: 0.04–9.16, P = 0.72). The propensity modelling provided excellent overlap and the mean propensity was almost the same in both groups. Thus, we have observed no difference in receiving either ZF or CW. No sternal instability was observed with the ZF device, unlike 4/31 patients in the CW group. The overall operation time is reduced by 11 min in the ZF group with identical perfusion and clamping times. CONCLUSIONS Our study underlines a neutral effect of the sternal ZipFix™ system in patients regarding sternal infection. Postoperative complications are similar in both sternal closure methods. The cable-tie-based system is fast, easy to use, reliable and safe. PMID:23624983

  13. [Progress in thin layer CT scan technology in estimating skeletal age of sternal end of clavicle].

    PubMed

    Wang, Ya-Hui; Wei, Hua; Ying, Chong-Liang; Wan, Lei; Zhu, Guang-You

    2013-04-01

    It is practical value for determination the teenagers whether the age is full of the legal responsibility age of 18 years old or not by estimating skeletal age of sternal end of clavicle. The traditional methods mainly based on X-ray radiography. However, sternal end of clavicle and adjacent lung, bronchus, sternum, rib, transverse process of thoracic vertebra are overlapped each other. As a result of overlapping, there will be obtained false negative or positive film reading results when according to X-ray observation of epiphyseal growth of sternal end of clavicle, which directly affect the scientificalness and accuracy of estimating of skeletal age. In recent years, the scholars at home and abroad have started to use thin layer CT scan technology to estimate skeletal age of the sternal end of clavicle. With the 2D and 3D CT recombination technology, the accuracy of the film reading distinctly improves by making the shape, size and position of epiphysis displayed clearly. This article reviews the application and research progress of thin layer CT scanning technology in estimating skeletal age of sternal end of clavicle at home and abroad, analyzes the superiority and value of thin layer CT scan technology, which applied to skeletal age of sternal end of clavicle.

  14. Risk factors for deep sternal wound infection after sternotomy: a prospective, multicenter study.

    PubMed

    1996-06-01

    Several risk factors for deep sternal wound infection after sternotomy remain unclear. To assess and compare risk factors among units, a prospective study included 1830 patients in 10 units during a 4-month period: 960 underwent coronary artery bypass grafting and 870 underwent other procedures. According to the Centers for Disease Control and Prevention definitions, 2.3% of patients (42/1830) acquired a deep sternal wound infection. Independent risk factors for deep sternal wound infection were obesity, coronary artery bypass grafting, reoperation, and postoperative inotropic support. Independent risk factors after coronary artery bypass grafting were obesity, bilateral internal thoracic artery grafting, reoperation, and postoperative inotropic support. In all five of the units usually performing bilateral internal thoracic artery graftings, this procedure was associated with high risk of deep sternal wound infection. Duration of operation was a major risk factor in comparison of the unit with the highest risk of deep sternal wound infection with the other nine units; this suggests that parameters related to the perioperative period were involved. Multicenter surveillance is useful to determine reliable risk factors for deep sternal wound infection, to define a high-risk population before operation, and to assess unit-specific risk factors.

  15. [Retrospective study on CT findings on the sternal bone after bone marrow aspiration procedure in hematological patients].

    PubMed

    Fujita, Hiroshi; Nishimura, Shigeko; Oyama, Kazuyuki

    2009-12-01

    We retrospectively studied the CT findings of sternal bone in 129 patients with hematological diseases who underwent bone marrow aspiration in Tokyo Metropolitan Bokutoh Hospital between August 2005 and July 2007. Sternal findings demonstrated sternal foramen (3 cases), incomplete fracture (1 case) and irregularity and decreased bone density of the visceral cortical bone (first intercostal space: 66 cases, third intercostal space: 3 cases). Irregularity and decreased bone density of the visceral cortical bone were significantly related to findings of decreased bone density in the third lumbar spine, indicating osteoporosis. These findings suggest that sternal bones demonstrated various bone diseases such as sternal foramen, fracture and osteoporosis, and that bone marrow aspiration from sternal bones might not be as safe as previously thought.

  16. Reduction in deep sternal wound infection with use of a peristernal cable-tie closure system: a retrospective case series.

    PubMed

    Stelly, Meghan M; Rodning, Charles B; Stelly, Terry C

    2015-11-14

    Deep sternal wound infections are a rare but serious complication after median sternotomy. We evaluated the incidence of deep sternal wound infection associated with two techniques for sternal closure. In this retrospective case series, we recorded the method of sternal closure in consecutive patients undergoing a variety of cardiothoracic surgical procedures. Sternal closure in the historical control group was performed using trans-sternal, stainless-steel wire sutures; subsequent patients were closed using wire sutures in conjunction with a novel, peristernal cable-tie closure system to reinforce the corpus sterni. Perioperative care was standardized between groups. Demographics, risk factors, and postoperative outcomes were analyzed. Between July 2010 and July 2014, 609 consecutive adult patients underwent sternal closure following open median sternotomy at a single hospital in Mobile, Alabama. Sternal closure was accomplished with wire sutures in the first 309 patients and with cable-tie reinforcement in the subsequent 300 patients. Baseline characteristics were comparable between groups, except that the cable-tie group exhibited greater preoperative comorbidity. Mean body mass index was comparable between groups (30.2 ± 6.6 kg/m(2) wire suture versus 30.5 ± 7.7 cable-tie, p = 0.568). Deep sternal wound infection occurred in 2.6 % (8/309) patients in the wire-suture group, whereas no deep sternal wound infections were observed in the cable tie group (p = 0.008). The peristernal cable-tie system was a simple and reliable method for sternal closure after open median sternotomy, and was associated with a reduced risk of deep sternal wound infection, even in an obese and comorbid population.

  17. Treatment of pseudoarthrosis of the upper limb using expanded mesenchymal stem cells: a pilot study.

    PubMed

    Giannotti, S; Bottai, V; Ghilardi, M; Dell'osso, G; Fazzi, R; Trombi, L; Petrini, M; Guido, G

    2013-01-01

    In orthopedic field is growing interest in the use of stem cells: this mesenchymal multipotent line (MSCs) can lead to differentiation into osteocytes and thus the formation of bone tissue. In literature applications of this line are described in injuries of tendons and ligaments, small bony avulsions, nonunion fractures and cartilage defects. Utilize MSCs expanded in laboratory in case of atrophic pseudoarthrosis of the upper limb. We obtain the amount of cell necessary for the implant by the collaboration with the UO Haematological Department. For the procedure we make a blood sample from the iliac crest bone marrow and a subsequent phase of selection and cultivation of mesenchymal line for 3 weeks, to get a sufficient amount of tissue to be used, which is presented at the time of surgery on a scaffold made by autologous plasma gel and CaCl(2). We reassessed our experience in 8 different types of upper limb fractures result in pseudarthrosis and delayed of consolidation: 4 women and 4 men, average 44 years old followed with a follow-up of 50.3 months. In all cases the site of non-union has been revitalized (by microfractures and drilling) and a synthesis was performed with a rigid plate. So we fill the bone gap with autologous bone and mesenchymal stem cells expanded in the laboratory. We have a radiographic healing in 8 cases and no adverse events were highlighted. Using this cells line we obtained encouraging but certainly not conclusive impressions, according to the limited number of cases and lack of adequate comparative studies. In tissue engineering are also certainly needed further investigations and developments.

  18. Aseptic meningitis due to Frater type virus in Ontario.

    PubMed

    KELEN, A; LESIAK, J; LABZOFFSKY, N A

    1963-07-06

    During the summer and fall of 1959 and 1960 a virus was isolated on 14 occasions from the stool or cerebrospinal fluid or both of 12 patients with a clinical picture of non-paralytic poliomyelitis or aseptic meningitis. The patients were from eight different localities in Ontario. The isolated virus was not neutralized by antisera to any of the known enteroviruses, reoviruses or adenoviruses, nor did antiserum to the isolate neutralize any of these viruses. Antiserum to Frater virus, however, did neutralize this isolate and in turn was itself neutralized by antiserum to this virus. Frater virus was isolated in Scotland from cases of aseptic meningitis during the same period in 1959 and 1960. In Ontario this virus was not encountered before 1959. Isolation of the virus from cerebrospinal fluid and demonstration of immunological response in the patients establish its etiological significance. Biological characteristics indicate that it belongs to the Echo group.

  19. Sternal Skin Conductance: A reasonable surrogate for Hot Flash Measurement?

    PubMed Central

    Pachman, Deirdre R.; Loprinzi, Charles L.; Novotny, Paul J; Satele, Daniel V; Linquist, Breanna M.; Wolf, Sherry; Barton, Debra L.

    2013-01-01

    Objective The aim of this study was to examine the accuracy of a new sternal skin conductance (SSC) device for the measurement of hot flashes, and secondly, to assess the acceptability of the device by women. Methods Three small descriptive pilot studies were performed utilizing two sequential prototypes of the SSC device developed by an engineering device company in the Midwest. The devices were worn either in a monitored setting for 24 hours or in an ambulatory setting for 5 weeks. During the study period, women recorded hot flashes in a prospective hot flash diary and also answered questions about the acceptability of wearing the SSC device. Results The first prototype was not able to collect any analyzable skin conductance data due to various malfunction issues; including poor conductance and battery failure. However, 16 patients did wear the device for 5 weeks and reported that wearing the device was acceptable, although 31% stated that it did interfere with daily activities. Hot flash data from the second prototype revealed a concordance rate between patient reported and device recorded hot flashes of 24%. Conclusions Findings from these studies support the discordance between SSC recorded and patient reported hot flashes. In addition, the studies reveal further limitations of SSC monitoring, including difficulties with data collection and lack of consistency in interpretation. Based on these results and other recent trials identifying issues with SSC methodology, it is time to find a better physiologic surrogate measure for hot flashes. PMID:23571528

  20. Sternal skin conductance: a reasonable surrogate for hot flash measurement?

    PubMed

    Pachman, Deirdre R; Loprinzi, Charles L; Novotny, Paul J; Satele, Daniel V; Linquist, Breanna M; Wolf, Sherry; Barton, Debra L

    2013-11-01

    This study aims to examine the accuracy of a new sternal skin conductance (SSC) device in measuring hot flashes and to assess the acceptability of the device by women. Three small descriptive pilot studies were performed using two sequential prototypes of the SSC device developed by an engineering device company in the Midwest. The devices were worn either in a monitored setting for 24 hours or in an ambulatory setting for 5 weeks. During the study period, women recorded hot flashes in a prospective hot flash diary and answered questions about the acceptability of wearing the SSC device. The first prototype was not able to collect any analyzable skin conductance data owing to various malfunction issues, including poor conductance and battery failure. However, 16 women wore the device for 5 weeks and reported that wearing the device was acceptable, although 31% stated that it interfered with daily activities. Hot flash data from the second prototype revealed a 24% concordance rate between self-reported and device-recorded hot flashes. Findings from these studies support discordance between device-recorded and self-reported hot flashes. In addition, the studies reveal further limitations of SSC monitoring, including difficulties with data collection and lack of consistency in interpretation. Based on these results and other recent trials identifying issues with SSC methodology, it is time to find a better physiologic surrogate measure for hot flashes.

  1. Cefazolin and linezolid penetration into sternal cancellous bone during coronary artery bypass grafting.

    PubMed

    Andreas, Martin; Zeitlinger, Markus; Wisser, Wilfried; Jaeger, Walter; Maier-Salamon, Alexandra; Thalhammer, Florian; Kocher, Alfred; Hiesmayr, Joerg-Michael; Laufer, Guenther; Hutschala, Doris

    2015-11-01

    Deep sternal wound infection is a severe complication after cardiac surgery. Insufficient antibiotic target site concentrations may account for variable success of perioperative prophylaxis. Therefore, we measured perioperative penetration of cefazolin and of linezolid into sternal cancellous bone after sternotomy in coronary artery bypass grafting (CABG) patients by in vivo microdialysis. Nine patients underwent CABG using a skeletonized left internal mammary artery. Standard antibiotic prophylaxis consisted of 4 g cefazolin prior to skin incision and additional 2 g during skin closure. In addition, 600 mg of linezolid were administered prior to skin incision and after 12 h for study purposes. Two microdialysis probes were inserted into the sternal cancellous bone (left and right side) after sternotomy. First mean peak cefazolin and linezolid plasma concentrations were 273 ± 92 µg/ml and 22.1 ± 8.9 µg/ml, respectively. Mean peak concentrations of antibiotics in sternal cancellous bone on the left and right sternal side were 112 ± 59 µg/ml and 159 ± 118 µg/ml for cefazolin and 10.9 ± 4.0 µg/ml and 12.6 ± 6.1 µg/ml for linezolid, respectively. Cefazolin exceeded the required tissue concentrations for relevant pathogens by far, but linezolid did not gain effective tissue concentrations in all patients for some relevant pathogens. Mammary artery harvesting had no significant effect on antibiotic tissue penetration. Direct measurement of antibiotic concentration in sternal cancellous bone with in vivo microdialysis is technically demanding but safe and feasible. We could demonstrate sufficient antibiotic coverage with our standard cefazolin-dosing regimen in the sternal cancellous bone during cardiac surgery. Mammary artery harvesting had no clinically relevant effect on tissue penetration. Linezolid concentrations were not sufficient for some relevant pathogens. © The Author 2014. Published by Oxford University Press on behalf of the European Association

  2. Multifilament Cable Wire versus Conventional Wire for Sternal Closure in Patients Undergoing Major Cardiac Surgery.

    PubMed

    Oh, You Na; Ha, Keong Jun; Kim, Joon Bum; Jung, Sung-Ho; Choo, Suk Jung; Chung, Cheol Hyun; Lee, Jae Won

    2015-08-01

    Stainless steel wiring remains the most popular technique for primary sternal closure. Recently, a multifilament cable wiring system (Pioneer Surgical Technology Inc., Marquette, MI, USA) was introduced for sternal closure and has gained wide acceptance due to its superior resistance to tension. We aimed to compare conventional steel wiring to multifilament cable fixation for sternal closure in patients undergoing major cardiac surgery. Data were collected retrospectively on 1,354 patients who underwent sternal closure after major cardiac surgery, using either the multifilament cable wiring system or conventional steel wires between January 2009 and October 2010. The surgical outcomes of these two groups of patients were compared using propensity score matching based on 18 baseline patient characteristics. Propensity score matching yielded 392 pairs of patients in the two groups whose baseline profiles showed no significant differences. No significant differences between the two groups were observed in the rates of early mortality (2.0% vs. 1.3%, p=0.578), major wound complications requiring reconstruction (1.3% vs. 1.3%, p>0.99), minor wound complications (3.6% vs. 2.0%, p=0.279), or mediastinitis (0.8% vs. 1.0%, p=1.00). Patients in the multifilament cable group had fewer sternal bleeding events than those in the conventional wire group, but this tendency was not statistically significant (4.3% vs. 7.4%, p=0.068). The surgical outcomes of sternal closure using multifilament cable wires were comparable to those observed when conventional steel wires were used. Therefore, the multifilament cable wiring system may be considered a viable option for sternal closure in patients undergoing major cardiac surgery.

  3. Aseptic nonunion of the tibia treated by intramedullary osteosynthesis.

    PubMed

    Gualdrini, G; Rollo, G; Montanari, A; Zinghi, G F

    1996-01-01

    The authors report 52 cases of aseptic nonunion of the tibia treated by intramedullary osteosynthesis. The means of synthesis used were the Küntscher nail, the Eiffel Tower Rush nail, and the Grosse-Kempf nail. Which means of synthesis was used depended on the site and the features of the nonunion. Healing occurred in all of the cases after an average of 5 months. Mean follow-up was 4.5 years.

  4. [Recurrent aseptic meningitis secondary to taking ibuprofen and ketorolac].

    PubMed

    Cano Vargas-Machuca, E; Mondéjar-Marín, B; Navarro-Muñoz, S; Pérez-Molina, I; Garrido-Robres, J A; Alvarez-Tejerina, A

    Aseptic meningitis is a process that is characterised by an inflammatory reaction of the meninges that is not due to any infectious agent. Its aetiology is varied and is most frequently caused by rheumatologic and/or autoimmune processes, chemical or medication-induced meningitis, the most notable drugs involved being antibiotics and non-steroidal anti-inflammatory drugs (NSAI). We report the case of a 70-year-old male, with no relevant history, who was admitted to hospital five times over a period of 16 months because of acute meningitis with polymorphonuclear pleocytosis, high protein levels in cerebrospinal fluid and normal glucose in cerebrospinal fluid. No evidence of an infectious causation, chemical meningitis, carcinomatosis or autoimmune disease was found and the patient was diagnosed with recurrent aseptic meningitis. It was found that the patient had taken ibuprofen or ketorolac on several occasions, a few hours before the appearance of symptoms. These episodes were quickly resolved after withdrawal of this medication. A number of NSAI have been reported as inducers of aseptic meningitis, one of the most notable being ibuprofen. We report the case of a patient who, as a consequence of taking ibuprofen and ketorolac, presented episodes of recurrent aseptic meningitis. To our knowledge this side effect of ketorolac has not been reported before. Its clinical features are impossible to differentiate from those of infectious meningitis. Diagnosis is reached by exclusion and a careful pharmacological study, including over-the-counter drugs like some of the NSAI, must be performed in patients with this condition, since it is a problem that can easily be solved by withdrawing the drug that causes it.

  5. Causes of Aseptic Persistent Pain after Total Knee Arthroplasty

    PubMed Central

    Lim, Hong-An; Seon, Jong-Keun; Park, Kyung-Soon; Shin, Young-Joo; Yang, Hong-Yeol

    2017-01-01

    Background Persistent pain after total knee arthroplasty (TKA) is dissatisfying to the patient and frustrating to the surgeon. The purpose of this study is to evaluate the aseptic causes and clinical course of intractable pain following TKA. Methods Of the total 2,534 cases of primary TKA reviewed, 178 cases were classified as having aseptic persistent pain that was not resolved within 1 year after surgery. Except for the cases with periprosthetic fracture (56 knees), 122 cases of aseptic painful TKA were divided into two groups: intra-articular group (83 knees) and extra-articular group (39 knees). Results In the intra-articular group, the main reasons for pain were aseptic loosening (n = 40), polyethylene wear (n = 16), instability (n = 10), recurrent hemarthrosis (n = 5), patellar maltracking (n = 4), tendon ruptures (n = 4), and stiffness (n = 2). In the extraarticular group, 10 knees (25.6%) were found to have nerve entrapment in the spine, 6 knees (15.4%) were found to have hip osteoarthritis or femoral head avascular necrosis. The reasons for persistent knee pain in the remaining 23 knees (59.0%) still remain elusive. Conclusions Persistent pain after TKA originated from pathology of extra-articular origin in a considerable number of cases in this study. Therefore, it is important to perform thorough preoperative evaluations to reduce pain resulting from extra-articular causes. Furthermore, meticulous surgical procedures and optimal alignment are required to reduce pain of intra-articular origin related to implant wear, instability, and patellar maltracking. PMID:28261427

  6. Clinical decision rules to distinguish between bacterial and aseptic meningitis

    PubMed Central

    Dubos, F; Lamotte, B; Bibi‐Triki, F; Moulin, F; Raymond, J; Gendrel, D; Bréart, G; Chalumeau, M

    2006-01-01

    Background Clinical decision rules have been derived to distinguish between bacterial and aseptic meningitis in the emergency room to avoid unnecessary antibiotic treatments and hospitalisations. Aims To evaluate the reproducibility and to compare the diagnostic performance of five clinical decision rules. Methods All children hospitalised for bacterial meningitis between 1995 and 2004 or aseptic meningitis between 2000 and 2004 have been included in a retrospective cohort study. Sensitivity and specificity were calculated by applying each rule to the patients. The best rule was a priori defined as the one yielding 100% sensitivity for bacterial meningitis, the highest specificity, and the greatest simplicity for a bedside application. Results Among the 166 patients included, 20 had bacterial meningitis and 146 had aseptic meningitis. Although three rules achieved 100% sensitivity (95% CI 84–100), one had a significantly lower specificity (13%, 95% CI 8–19) than those of the other two rules (57%, 95% CI 48–65; and 66%, 95% CI 57–73), which were not statistically different. The ease of manual computation of the rule developed by Nigrovic et al (a simple list of five items: seizure, blood neutrophil count, cerebrospinal fluid (CSF) Gram stain, CSF protein, CSF neutrophil count) was higher than the one developed by Bonsu and Harper. Conclusion On our population, the rule derived by Nigrovic et al had the best balance between accuracy and simplicity of manual computation and could help to avoid two thirds of unnecessary antibiotic treatments and hospitalisations. PMID:16595647

  7. Functional outcome following aseptic single-stage revision knee arthroplasty.

    PubMed

    Malviya, Ajay; Brewster, Nigel T; Bettinson, Karen; Holland, James P; Weir, David J; Deehan, David J

    2012-10-01

    This study attempts to quantify the influence of constraint and various indications upon functional outcome following aseptic first-time revision knee arthroplasty. A single-centre prospective study was performed to examine the outcome for 175 consecutive total revision knee replacements performed between 2003 and 2008 with a minimum follow-up of 2 years. Patient-reported outcome data were used to determine the influence of final level of component constraint, its relationship with primary indication for surgery and the predictor variable for functional outcome at 1 year. All patients were found to have a significant improvement for WOMAC pain, function and stiffness score and physical functioning, role physical, bodily pain and social functioning components of SF-36 score. About 69% were satisfied with the overall procedure. WOMAC function, pain and stiffness score was significantly worse for patients revised for instability (27%) compared to that for aseptic loosening (46%). A significantly higher proportion of patients were satisfied with the procedure, had a better quality of life and would have the surgery again in the aseptic loosening group as compared to the instability group. Revision to a higher level of constraint did not improve knee function irrespective of the primary indication for surgery. This study has found that revision for instability, irrespective of choice of new device, was met with significantly poorer functional outcome. The level of constraint did not influence functional outcome. II.

  8. [Use of a xenoimplant for the treatment of bone defects, benign tumors, pseudoarthrosis and arthrodesis. Preliminary report].

    PubMed

    Cueva del Castillo, J Fernando; Francisco Osuna, J; Elizondo, F; Pérez, O; Pérez, A; Hernández, Sergio; Mejía, Carlos

    2007-01-01

    To show that the ceramic produced at the Institute for Materials Research, National Autonomous University of Mexico, is an appropriate replacement of bone graft in patients with bone tumors, benign tumors, pseudoarthrosis and arthrodesis treated at "General Ignacio Zaragoza" Regional Hospital. An experimental, longitudinal study using bovine ceramic xenoimplants in patients covered by the Security and Social Services Institute for Civil Servants (ISSSTE), regardless of age and gender, all of whom consented to receiving the ceramic xenoimplant. Patients who did not consent or who discontinued treatment were excluded. A total of 24 patients were enrolled from March 1st to August 31st, 2006; two patients were withdrawn due to treatment discontinuation. They underwent X-ray evaluation of bone healing using the Montoya classification. The sample is composed of 14 male and 8 female patients, with a mean age of 46.6 years, and a standard deviation (s=) of 13.8. The most frequent indication was arthrodesis in 10 patients (45.45%), pseudoarthrosis in 6 (27.27%), benign tumors in 3 (13.63%), and bone defects in 3 (13.63%). Type II to type IV bone healing was observed in the sample. The use of ceramic xenoimplants is appropriate as a replacement of bone graft in patients with arthrodesis and bone defects, thus avoiding the need for autologous bone graft. This results in a decreased patient morbidity.

  9. Performance of aseptic technique during neuraxial analgesia for labor before and after the publication of international guidelines on aseptic technique

    PubMed Central

    2014-01-01

    Background Aseptic technique and handwashing have been shown to be important factors in perioperative bacterial transmission, however compliance often remains low despite guidelines and educational programs. Infectious complications of neuraxial (epidural and spinal) anesthesia are severe but fortunately rare. We conducted a survey to assess aseptic technique practices for neuraxial anesthesia in Israel before and after publication of international guidelines (which focused on handwashing, jewelry/watch removal and the wearing of a mask and cap). Methods The sampling frame was the general anesthesiology workforce in hospitals selected from each of the four medical faculties in Israel. Data was collected anonymously over one week in each hospital in two periods: April 2006 and September 2009. Most anesthesiologists received the questionnaires at departmental staff meetings and filled them out during these meetings; additionally, a local investigator approached anesthesiologists not present at these staff meetings individually. Primary endpoint questions were: handwashing, removal of wristwatch/jewelry, wearing mask, wearing hat/cap, wearing sterile gown; answering options were: "always", "usually", "rarely" or "never". Primary endpoint for analysis: respondents who both always wash their hands and always wear a mask ("handwash-mask composite") - "always" versus "any other response". We used logistic regression to perform the analysis. Time (2006, 2009) and hospital were included in the analysis as fixed effects. Results 135/160 (in 2006) and 127/164 (in 2009) anesthesiologists responded to the surveys; response rate 84% and 77% respectively. Respondents constituted 23% of the national anesthesiologist workforce. The main outcome "handwash-mask composite" was significantly increased after guideline publication (33% vs 58%; p = 0.0003). In addition, significant increases were seen for handwashing (37% vs 63%; p = 0.0004), wearing of mask (61% vs 78%; p < 0

  10. Sternal reconstruction by extracellular matrix: a rare case of phaces syndrome

    PubMed Central

    Molinaro, Francesco; Cerchia, Elisa; Di Crescenzo, Vincenzo Giuseppe; Luzzi, Luca; Bulotta, Anna Lavinia; Gotti, Giuseppe; Messina, Mario

    2016-01-01

    Abstract Congenital defects of the sternum are rare and due to a failure of midline development and fusion of the sternal bones. Surgical correction of a sternal cleft should be preferred during infancy for functional reasons. Chest wall reconstruction represented a complex problem in the last decades. We report our successful outcome of sternal reconstruction in a rare case of PHACES syndrome, in which the patient was submitted to reconstruction of the sternum and complete closure of the thoracic defect by the employ of an extracellular matrix XCM Biologic tissue matrix. We promote the use of extracellular matrix in surgical reconstruction of chest defects for its maneuverability, plasticity, tolerability and the possibility of growing with the children’s chest getting a good compliance and optimal cosmetic results.

  11. Anesthetic management in a case of congenital sternal cleft diagnosed incidentally on the operating table

    PubMed Central

    Gupta, Priyamvada; Kumar, Alok; Jethava, D. D.; Jethava, Durga

    2014-01-01

    Congenital absence of sternum, also known as sternal cleft, is a rare anomaly. It is due to impaired organogenesis leading to nonfusion of sternal bars. It may be of two types- complete or incomplete. It may be associated with other congenital malformations viz., cardiac, anorectal etc., or may be a part of Cantrell's pentalogy. Besides cosmetic concerns, mediastinal structures are at increased risk to damage in case of trauma to the anterior chest wall. Due to restricted mediastinal space, there may be restrictive pulmonary dysfunctions and unstable hemodynamics. It usually presents in the neonatal period or early infancy, rarely in adult age. The defect should be surgically closed as early as possible. If cardiac arrest occurs due to any reason, the only option is open cardiac massage. We report a case of complete congenital sternal cleft accidentally diagnosed on the operation table, while preparing the patient for diagnostic laparotomy. The patient was retrospectively assessed for the presence of other congenital malformations. PMID:25886344

  12. A meta-analysis of platelet gel for prevention of sternal wound infections following cardiac surgery

    PubMed Central

    Kirmani, Bilal H.; Jones, Siôn G.; Datta, Subir; McLaughlin, Edward K.; Hoschtitzky, Andreas J.

    2017-01-01

    Deep sternal wound infection and bleeding are devastating complications following cardiac surgery, which may be reduced by topical application of autologous platelet gel. Systematic review identified seven comparative studies involving 4,692 patients. Meta-analysis showed significant reductions in all sternal wound infections (odds ratio 3.48 [1.08–11.23], p=0.04) and mediastinitis (odds ratio 2.69 [1.20–6.06], p=0.02) but not bleeding. No adverse events relating to the use of topical platelet-rich plasma were reported. The use of autologous platelet gel in cardiac surgery appears to provide significant reductions in serious sternal wound infections, and its use is unlikely to be associated with significant risk. PMID:27177403

  13. Pectoralis Muscle Flap Repair Reduces Paradoxical Motion of the Chest Wall in Complex Sternal Wound Dehiscence

    PubMed Central

    Zeitani, Jacob; Russo, Marco; Pompeo, Eugenio; Sergiacomi, Gian Luigi; Chiariello, Luigi

    2016-01-01

    Background The aim of the study was to test the hypothesis that in patients with chronic complex sternum dehiscence, the use of muscle flap repair minimizes the occurrence of paradoxical motion of the chest wall (CWPM) when compared to sternal rewiring, eventually leading to better respiratory function and clinical outcomes during follow-up. Methods In a propensity score matching analysis, out of 94 patients who underwent sternal reconstruction, 20 patients were selected: 10 patients underwent sternal reconstruction with bilateral pectoralis muscle flaps (group 1) and 10 underwent sternal rewiring (group 2). Eligibility criteria included the presence of hemisternum diastases associated with multiple (≥3) bone fractures and radiologic evidence of synchronous chest wall motion (CWSM). We compared radiologically assessed (volumetric computed tomography) ventilatory mechanic indices such as single lung and global vital capacity (VC), diaphragm excursion, synchronous and paradoxical chest wall motion. Results Follow-up was 100% complete (mean 85±24 months). CWPM was inversely correlated with single lung VC (Spearman R=−0.72, p=0.0003), global VC (R=−0.51, p=0.02) and diaphragm excursion (R=−0.80, p=0.0003), whereas it proved directly correlated with dyspnea grade (Spearman R=0.51, p=0.02) and pain (R=0.59, p=0.005). Mean CWPM and single lung VC were both better in group 1, whereas there was no difference in CWSM, diaphragm excursion and global VC. Conclusion Our study suggests that in patients with complex chronic sternal dehiscence, pectoralis muscle flap reconstruction guarantees lower CWPM and greater single-lung VC when compared with sternal rewiring and it is associated with better clinical outcomes with less pain and dyspnea. PMID:27733997

  14. Cryptococcal sternal osteomyelitis in a healthy woman: a review of Cryptococcus neoformans.

    PubMed

    Jain, Deepali; Najjar, Mazen; Azher, Qazi; Bachuwa, Ghassan

    2013-04-25

    Cryptococcus, an opportunistic yeast, known to afflict immune-compromised patients is often overlooked in immune-competent patients. This has led to increasing morbidity and mortality worldwide. We present a case of Cryptococcus causing sternal osteomyelitis in an immune-competent individual. Till date no case of Cryptococcus causing sternal osteomyelitis in an immune-competent patient has been reported in the English literature since 1946-2011. With the rising incidence of Cryptococcus infection it should be included among the list of infections causing osteomyelitis. Early detection and prompt treatment can decrease both morbidity and mortality.

  15. Mesh-bone cement sandwich for sternal and sternoclavicular joint reconstruction.

    PubMed

    Collaud, Stéphane; Pfofe, Denis; Decurtins, Marco; Gelpke, Hans

    2013-03-01

    Resection of the manubrium including both sternoclavicular joints is occasionally performed in the case of sternal tumours. Sternoclavicular joints are the only true joints connecting the axial skeleton to the upper extremity. Therefore, they play an important role in shoulder function. However, data on their reconstruction are lacking. Here, we described the case of a sternal reconstruction including both sternoclavicular joints using a mesh-bone cement sandwich. The mechanical properties of the construct mimicked those of the original sternoclavicular joints and could therefore restore shoulder strength allowing the patient to perform overhead work.

  16. Feedback to the field: an assessment of sternal intraosseous (IO) infusion.

    PubMed

    Harcke, H Theodore; Crawley, Geoffrey; Mazuchowski, Edward

    2011-01-01

    Intraosseous vascular infusion (IO) is a recognized alternative to peripheral intravenous infusion when access is inadequate. The sternum and proximal tibia are the preferred sites. A review of 98 cases at autopsy revealed successful sternal IO placement in 78 cases (80%). Assuming a worst case scenario for placement (pin mark and no tip in bone [17 cases] and tip present and not in the sternum [3 cases]), attempts were unsuccessful in 20 cases (20%). We draw no specific conclusions regarding sternal IO use, but hope that personnel placing these devices and those providing medical training can use the information.

  17. Reconstruction of Chest Wall by Cryopreserved Sternal Allograft after Resection of Aneurysmal Bone Cyst of Sternum

    PubMed Central

    Sheikhy, Kambiz; Abbasi Dezfouli, Azizollah

    2017-01-01

    A 20-year-old female was referred to our hospital due to deformity and bulging in anterior aspect of chest wall in sternal area. Chest X-ray and CT scan confirmed a large mass with destruction of sternum. Pathologic diagnosis after incisional biopsy was compatible with aneurysmal bone cyst. We resected sternum completely and reconstructed large anterior defect by a cryopreserved sternal allograft. In follow-up of patient there was no unstability of chest wall with good cosmetic result. PMID:28299230

  18. Real-world injury patterns associated with Hybrid III sternal deflections in frontal crash tests.

    PubMed

    Brumbelow, Matthew L; Farmer, Charles M

    2013-01-01

    This study investigated the relationship between the peak sternal deflection measurements recorded by the Hybrid III 50th percentile male anthropometric test device (ATD) in frontal crash tests and injury and fatality outcomes for drivers in field crashes. ATD sternal deflection data were obtained from the Insurance Institute for Highway Safety's 64 km/h, 40 percent overlap crashworthiness evaluation tests for vehicles with seat belt crash tensioners, load limiters, and good-rated structure. The National Automotive Sampling System Crashworthiness Data System (NASS-CDS) was queried for frontal crashes of these vehicles in which the driver was restrained by a seat belt and air bag. Injury probability curves were calculated by frontal crash type using the injuries coded in NASS-CDS and peak ATD sternal deflection data. Fatality Analysis Reporting System (FARS) front-to-front crashes with exactly one driver death were also studied to determine whether the difference in measured sternal deflections for the 2 vehicles was related to the odds of fatality. For center impacts, moderate overlaps, and large overlaps in NASS-CDS, the probability of the driver sustaining an Abbreviated Injury Scale (AIS) score ≥ 3 thoracic injury, or any nonextremity AIS ≥ 3 injury, increased with increasing ATD sternal deflection measured in crash tests. For small overlaps, however, these probabilities decreased with increasing deflection. For FARS crashes, the fatally injured driver more often was in the vehicle with the lower measured deflection in crash tests (55 vs. 45%). After controlling for other factors, a 5-mm difference in measured sternal deflections between the 2 vehicles was associated with a fatality odds ratio of 0.762 for the driver in the vehicle with the greater deflection (95% confidence interval = 0.373, 1.449). Restraint systems that reduce peak Hybrid III sternal deflection in a moderate overlap crash test are beneficial in real-world crashes with similar or greater

  19. Congenital Sternal Cleft along with Persistent Left-Sided Superior Vena Cava: A Rare Presentation

    PubMed Central

    Saha, Anindya Kumar; Sardar, Syamal Kumar; Sur, Amitava

    2013-01-01

    Congenital sternal cleft is a rare abnormality resulting from fusion failure of sternum. It occurs in isolation or along with defects of abdominal wall, diaphragm, pericardium, and heart. Early surgical correction is required to protect the underlying structures for risk of cardiac compression. Here we report a case of 20-day female child presenting with congenital sternal cleft associated with multiple congenital heart disease and left-sided superior vena cava. She was operated by the cardiothoracic surgical team successfully and is doing well on followup. We discuss this rare case, imaging studies, and surgical strategy. PMID:23841006

  20. Oligophilic Bacteria as Tools To Monitor Aseptic Pharmaceutical Production Units

    PubMed Central

    Nagarkar, Parag P.; Ravetkar, Satish D.; Watve, Milind G.

    2001-01-01

    The bacterial loads of air, surfaces, and personnel in clean rooms are routinely monitored using a set of standard media. Bacteria that can grow on these media are a tiny fraction of the total numbers in any environment. A substantial proportion of bacteria long thought to be unculturable were recently shown to be oligophilic. Oligophile counts in clean rooms in our studies exceeded the standard plate counts by up to 2 orders of magnitude. They responded to disinfection routines in ways similar to the responses of conventional bacteria. We suggest that oligophiles are better tools than conventional bacteria for environmental monitoring in aseptic pharmaceutical production units. PMID:11229934

  1. Aseptic Meningitis Caused by Lassa Virus: Case Series Report.

    PubMed

    Okokhere, Peter O; Bankole, Idowu A; Iruolagbe, Christopher O; Muoebonam, Benard E; Okonofua, Martha O; Dawodu, Simeon O; Akpede, George O

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications.

  2. Idiopathic Facial Aseptic Granuloma: Review of an Evolving Clinical Entity.

    PubMed

    Zitelli, Kristine B; Sheil, Amy T; Fleck, Robert; Schwentker, Ann; Lucky, Anne W

    2015-01-01

    Idiopathic facial aseptic granuloma (IFAG), originally termed pyodermite froide du visage, describes a generally asymptomatic facial nodule presenting in childhood with clinical resemblance to pyoderma or cystic, granulomatous, or vascular lesions. Clinical understanding is constantly evolving, with recent observations indicating that IFAG may represent a subtype of childhood rosacea. We present a case of IFAG associated with eyelid chalazions in a 19-month-old boy. Although his clinical course paralleled previously reported IFAG cases, we observed a unique ultrasound variation during initial diagnostic examination. Further delineation of clinical, imaging, and histologic properties of IFAG may reveal insights into etiologic associations and ideal management.

  3. Survey of spine surgeons on attitudes regarding osteoporosis and osteomalacia screening and treatment for fractures, fusion surgery, and pseudoarthrosis.

    PubMed

    Dipaola, Christian P; Bible, Jesse E; Biswas, Debdut; Dipaola, Matthew; Grauer, Jonathan N; Rechtine, Glenn R

    2009-07-01

    Osteoporosis and osteomalacia are significant risk factors for fracture and spine instrumentation failure. Low-energy fractures are becoming increasingly more common because of an increase in life expectancy and age of the population. Decreased bone density is an independent risk factor for instrumentation failure in spinal fusion operations. To assess the awareness and practice patterns of spine surgeons regarding metabolic bone disorders and osteoporosis with emphasis on fracture care and arthrodesis. Questionnaire study. Spine surgeons attending the "Disorders of the Spine" conference (January 2007, Whistler, British Columbia, Canada). Respondent reported frequencies of diagnostics, screening, and treatment methods for patients with low-energy spine fractures, pseudoarthrosis, and those undergoing spinal arthrodesis. A ten-question survey was administered to orthopedic surgeons and neurosurgeons who treated spine fractures and degenerative spine conditions in their practice. The survey was given to those who were attending a continuing medical education spinal disorders conference. The survey asked about treatment patterns with respect to osteoporosis and osteomalacia workup and treatment for patients with low-energy spine fractures, pseudoarthrosis, and those undergoing spinal arthrodesis. Of the 133 surgeons to whom the questionnaire was distributed at this meeting, 114 questionnaires were returned that corresponds to a response rate of 86%. Twenty-one surveys were excluded because of incomplete biographical information, resulting in a total of 93 completed questionnaires that were available for analysis. When treating patients with low-energy spine fractures, 60% checked dual-energy X-ray absorptiometry (DEXA) and 39% checked metabolic laboratories (of those who did not order laboratories and DEXA about 63% refer for treatment). Before instrumented fusion, 44% of those queried checked DEXA and 12% checked metabolic laboratories (vitamin D, parathyroid hormone

  4. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.

  5. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  6. Extramedullary spinal teratoma presenting with recurrent aseptic meningitis.

    PubMed

    Mpayo, Lucy L; Liu, Xiao-Hong; Xu, Man; Wang, Kai; Wang, Jiao; Yang, Li

    2014-06-01

    Spinal teratomas are extremely rare; they constitute <0.5% of all spinal cord tumors. These rare tumors have nonspecific manifestations but in most cases are accompanied by neurological deficits. Rupture of a mature teratoma can cause chemical meningitis. A 7-year-old boy presented with paroxysmal abdominal pain and a history of recurrent aseptic meningitis. Kernig and Brudzinski signs were present. Lumber puncture revealed pleocytosis with no evidence of bacteria growth. Imaging of the spine revealed a cystic lesion in spinal cord at thoracic level 9-11. Endoscopic excision of the cyst was successfully performed. Surgical and histopathological findings confirmed extramedullary matured teratoma. As the symptomatic attacks of spontaneous rupture of spinal teratoma resemble presentations of Mollaret meningitis, spinal teratoma should be considered in the differential diagnosis of Mollaret meningitis. We describe a rare example of spinal teratoma causing recurrent meningitis. Spine imaging should be considered in individuals with recurrent aseptic meningitis as this promotes earlier diagnosis, more appropriate treatment, and improved neurological outcome. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  8. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening.

    PubMed

    Loria, Maria Paola; Dambra, Porzia; Moretti, Biagio; Patella, Vittorio; Capuzzimati, Laura; Cavallo, Elsa; Nettis, Eustachio; Pesce, Vito; Dell'Osso, Adriana; Simone, Carmelo; Tursi, Alfredo

    2004-01-01

    Cytokines, which have been demonstrated in synovial fluids during various joint diseases, play an important role in mediating synovial inflammation and in regulating the immune response of many inflammatory processes. We studied synovial fluid, serum, and synovial fragments obtained from 33 patients--10 affected by serious gonarthrosis re-quiring a prosthetic implant, 8 with knee prosthesis aseptic loosening, and (as controls) 15 affected by degenerative meniscopathies--to evaluate the degree of inflammation and level of interleukins (IL-2, IL-4, IL-6, IL-10) and interferon gamma secretion. Histological analysis revealed slightly more infiltration by inflammatory cells in the synovial tissue of patients with gonarthrosis and knee prosthesis aseptic loosening than in that of the control group, with a high prevalence of macrophages. Moreover, we observed enhanced production of the studied cytokines, especially in synovial fluid as compared to serum, indicating that in the pathological conditions examined the inflammatory events are mainly localized. Because the role of these cytokines is to modulate inflammation, better knowledge of the involvement of cells and their soluble mediators in articular damage could guide immunomodulating treatment.

  9. Sternal Cleft Associated with Cantrell's Pentalogy in a German Shepherd Dog.

    PubMed

    Benlloch-Gonzalez, Manuel; Poncet, Cyrill

    2015-01-01

    A 5 mo old male German shepherd dog weighing 15.5 kg was presented with an abdominal wall hernia and exercise intolerance. Physical examination showed a grade II/VI systolic heart murmur and an area of cutaneous atrophy overlying a midline supraumbilical wall defect. Thoracic radiography, computed tomography, and ultrasound examination revealed a congenital caudal sternal cleft, a supraumbilical diastasis rectus, and a patent ductus arteriosus. Exploratory surgery confirmed defects of the pars sternalis of the diaphragm and caudoventral pericardium and a persistent left cranial vena cava. Those findings were compatible with Cantrell's pentalogy. Surgical treatment included ligation of the patent ductus arteriosus through the sternal cleft, diaphragmatic reconstruction with paracostal extension of the diaphragmatic defect, pericardial and linea alba appositional reconstruction, and primary approximation of the sternal halves. Growth and exercise activity were normal 10 mo after surgery. The discovery of a midline cranial abdominal wall, pericardial, diaphragmatic, or sternal defect should prompt a thorough examination to rule out any possible associated syndrome. Cantrell's pentalogy presents various degrees of expression and is rare in dogs. Management involves early surgical repair of congenital anomalies to protect the visceral structures. The prognosis in dogs with mild forms of the syndrome is encouraging.

  10. Deep sternal wound infection after coronary artery bypass surgery: management and risk factor analysis for mortality.

    PubMed

    Yumun, Gunduz; Erdolu, Burak; Toktas, Faruk; Eris, Cuneyt; Ay, Derih; Turk, Tamer; As, Ahmet Kagan

    2014-08-01

    Deep sternal wound infection is a life-threatening complication after cardiac surgery. The aim of this study was to investigate the factors leading to mortality, and to explore wound management techniques on deep sternal wound infection after coronary artery bypass surgery. Between 2008 and 2013, 58 patients with deep sternal wound infection were analyzed. Risk factors for mortality and morbidity including age, gender, body mass index, smoking status, chronic renal failure, hypertension, diabetes, and treatment choice were investigated. In this study, 19 patients (32.7%) were treated by primary surgical closure (PSC), and 39 patients (67.3%) were treated by delayed surgical closure following a vacuum-assisted closure system (VAC). Preoperative patient characteristics were similar between the groups. Fourteen patients (24.1%) died in the postoperative first month. The mortality rate and mean duration of hospitalization in the PSC group was higher than in the VAC group (P = .026, P = .034). Significant risk factors for mortality were additional operation, diabetes mellitus, and a high level of EuroSCORE. Delayed surgical closure following VAC therapy may be associated with shorter hospitalization and lower mortality in patients with deep sternal wound infection. Additional operation, diabetes mellitus, and a high level of EuroSCORE were associated with mortality.

  11. Sternal metastasis - the forgotten column and its effect on thoracic spine stability.

    PubMed

    Piggott, Robert Pearse; Curtin, Mark; Munigangaiah, Sudarshan; Jadaan, Mutaz; McCabe, John Patrick; Devitt, Aiden

    2017-06-18

    Sternal metastases are not studied extensively in the literature. There is a paucity of information on their role in metastatic disease. The concept of the fourth column was described by Berg in 1993, and has been proven in case report, clinically and biomechanical studies. The role of the sternum as a support to the thoracic spine is well documented in the trauma patients, but not much is known about its role in cancer patients. This review examines what is known on the role of the fourth column. Following this we have identified two likely scenarios that sternal metastases may impact management: (1) sternal pathological fracture increases the mobility of the semi-rigid thorax with the loss of the biomechanical support of the sternum-rib-thoracic spine complex; and (2) a sternal metastasis increases the risk of fracture, and while being medical treated the thoracic spine should be monitored for acute kyphosis and neurological injury secondarily to the insufficiency of the fourth column.

  12. Sternal metastasis - the forgotten column and its effect on thoracic spine stability

    PubMed Central

    Piggott, Robert Pearse; Curtin, Mark; Munigangaiah, Sudarshan; Jadaan, Mutaz; McCabe, John Patrick; Devitt, Aiden

    2017-01-01

    Sternal metastases are not studied extensively in the literature. There is a paucity of information on their role in metastatic disease. The concept of the fourth column was described by Berg in 1993, and has been proven in case report, clinically and biomechanical studies. The role of the sternum as a support to the thoracic spine is well documented in the trauma patients, but not much is known about its role in cancer patients. This review examines what is known on the role of the fourth column. Following this we have identified two likely scenarios that sternal metastases may impact management: (1) sternal pathological fracture increases the mobility of the semi-rigid thorax with the loss of the biomechanical support of the sternum-rib-thoracic spine complex; and (2) a sternal metastasis increases the risk of fracture, and while being medical treated the thoracic spine should be monitored for acute kyphosis and neurological injury secondarily to the insufficiency of the fourth column. PMID:28660136

  13. Primary repair of a large incomplete sternal cleft in an asymptomatic infant with Prolene mesh.

    PubMed

    Baqain, Eyad B; Lataifeh, Isam M; Khriesat, Wadah M; Fraiwan, Nayef M; Armooti, Mohamed A

    2008-10-01

    A cleft of the sternum is a rare congenital anomaly, often diagnosed as an asymptomatic condition at birth. We present a case of a large incomplete sternal cleft in a full-term baby boy. Surgical repair of the sternum with the use of Prolene mesh was performed during the neonatal period without cardiac compression.

  14. Pain control for sternal fracture using an ultrasound-guided hematoma block.

    PubMed

    Wilson, Sharon R; Price, Daniel D; Penner, Erik

    2010-04-01

    In this case report, an ultrasound-guided hematoma block was performed in the Emergency Department (ED) for immediate and effective pain control in a patient suffering from a sternal fracture. This technique of anesthesia may allow safer and more effective analgesia and a more rapid discharge from the hospital or ED in selected cases.

  15. Associated injuries in traumatic sternal fractures: a review of the National Trauma Data Bank.

    PubMed

    Oyetunji, Tolulope A; Jackson, Hope T; Obirieze, Augustine C; Moore, Danier; Branche, Marc J; Greene, Wendy R; Cornwell, Edward E; Siram, Suryanarayana M

    2013-07-01

    Sternal fractures occur infrequently with blunt force trauma. The demographics and epidemiology of associated injuries have not been well characterized from a national trauma database. The National Trauma Data Bank was queried for patients with closed sternal fractures. The demographics were analyzed by age, gender, mechanism and indicators of anatomic and physiologic injuries. Types of commonly associated injuries were also determined. A total of 23,985 records were analyzed. Males accounted for 68.3 per cent and whites 70.9 per cent. Motor vehicle crash was the leading mechanism. More than 56 per cent had severe injuries based on Injury Severity Score (greater than 15) and 17 per cent with Glasgow Coma Score 8 or less. Crude mortality was 7.9 per cent. The majority (57.8%) and approximately one-third (33.7%) of the patients had rib fractures and lung contusions, respectively, 22.0 per cent with closed pneumothorax, 21.6 per cent had a closed thoracic vertebra fracture, 16.9 per cent with lumbar spine fracture, 3.9 per cent with concussion, and blunt cardiac injury in 3.6 per cent. Sternal fractures are usually associated with severe blunt trauma. Lung contusion remains the leading associated injury followed by vertebral spine fractures. Cardiac injuries are less frequent and vascular injuries less so. Mechanism of injury and presence of sternal fractures should alert providers to these potential associated injuries.

  16. Trail Following Activity in Extracts of Sternal Glands from Anacanthotermes turkestanicus (Isoptera: Hodotermitidae)

    USDA-ARS?s Scientific Manuscript database

    The Turkestan termite Anacanthotermes turkestanicus (Isoptera: Hodotermitidae) is a harvester termite found in the Central Asian region. The workers forage before sunrise or late in the evenings. This termite, like most other termites, has a sternal gland under the 4th sternite that produces a phero...

  17. Risk factors concerning sternal bone marrow aspiration and patient safety in Japan.

    PubMed

    Inoue, Hiroshi; Nakasato, Tatsuhiko; Yamauchi, Kohei; Nakamura, Yutaka; Oshida, Shigemi; Ehara, Shigeru

    2010-01-01

    Several reports have described adverse events resulting from sternal bone marrow aspiration procedures. We hypothesized about inevitable lacerations to the ascending aorta that occur from structural abnormalities in the needle passage. We evaluated dimensions in the thorax related to the sternal bone marrow aspiration, using a chest CT scan on a display terminal. Patients Among the 3,848 patients who visited our institution and underwent a chest CT scan between September 1, 2007 and December 31, 2008, a total of 153 subjects showing no particular chest CT findings were enrolled. Significant variation was observed in the distance from the sternum to the ascending aorta, from a minimum of 4.2 to a maximum of 47.6 mm (median 23.6) in men and a minimum of 5.2 to a maximum of 38.4 mm (median 21.3) in women. There were three men (3.6%) and women (4.3%) each having a distance within 10 mm. Our findings showed for the first time that an anterior chest approach to sternal bone marrow aspiration involves an inevitable risk of laceration of the ascending aorta, when the needle tip penetrates the sternum. Our analysis of dimension also suggested that the sternal marrow aspiration procedure involved a greater risk among older subjects of short stature.

  18. Sternal closure by rigid plate fixation in off-pump coronary artery bypass grafting: a comparative study.

    PubMed

    Matsuyama, Katsuhiko; Kuinose, Masahiko; Koizumi, Nobusato; Iwasaki, Tomoaki; Toguchi, Kayo; Ogino, Hitoshi

    2016-06-01

    Sternal instability or dehiscence results in serious sternal wound infection. We sought to assess the early outcomes with such a plating system for sternal closure in comparison to the conventional wiring technique in off-pump coronary artery bypass grafting (CABG). Patients who underwent off-pump CABG were enrolled. Thirty-one patients received plate sternal fixation. A total of 64 patients who underwent off-pump CABG by a single surgeon at our hospital from July 2013 to December 2014 were enrolled. Thirty-one patients received plate sternal fixation (Plate group), while 33 received conventional wire closure (Wire group). The early outcomes, including the pain score and analgesic usage count were compared. Dietary intake was also recorded to assess the duration of appetite loss. At discharge, the largest sternal displacement was measured on computed tomography. In the Plate group, the pain scores were significantly lower on post-operative day 5-8 and POD 9-12 from those in the Wire group. The analgesic usage count on POD 9-12 was significantly lower in the Plate group. The duration of appetite loss and hospital stay was significantly shorter in the Plate group. The displacement in both the anterior-posterior and lateral directions was significantly smaller in the Plate group. Sternal closure by rigid plate fixation contributes to a more rapid post-operative recovery through reduced pain.

  19. Sternal wound infections in patients after coronary artery bypass grafting using bilateral skeletonized internal mammary arteries.

    PubMed Central

    Sofer, D; Gurevitch, J; Shapira, I; Paz, Y; Matsa, M; Kramer, A; Mohr, R

    1999-01-01

    OBJECTIVES: This study evaluated the risks of sternal wound infections in patients undergoing myocardial revascularization using bilateral skeletonized internal mammary arteries (IMAs). BACKGROUND: The skeletonized IMA is longer than the pedicled one, thus providing the cardiac surgeon with increased versatility for arterial myocardial revascularization without the use of vein grafts. It is isolated from the chest wall gently with scissors and silver clips, and no cauterization is employed. Preservation of collateral blood supply to the sternum and avoidance of thermal injury enable more rapid healing and decrease the risk of sternal wound infection. METHODS: From April 1996 to August 1997, 545 patients underwent arterial myocardial revascularization using bilateral skeletonized IMAs. The right gastroepiploic artery was used in 100 patients (18%). The average age of the patients was 65 years; 431 (79%) were men and 114 (21%) were women; 179 (33%) were older than 70 years of age; 166 (30%) were diabetics. The average number of grafts was 3.2 per patient. RESULTS: The 30-day operative mortality rate was 2% (n = 11). There were six perioperative infarcts (1.1%) and six strokes (1.1%); 9 patients had sternal infection (1.7%) and 15 (2.8%) had superficial infection. Risk factors for sternal infection were chronic obstructive pulmonary disease and emergency operation. Superficial sternal wound infections were more common in women and in patients with chronic obstructive pulmonary disease, renal failure, or peripheral vascular disease. The 1-year actuarial survival rate was 97%. Two of the six late deaths were not cardiac-related. Late dehiscence occurred in three patients (0.6%). The death rate (early and late) of patients with any sternal complication was higher than that of patients without those complications (33% vs. 2.7%). CONCLUSIONS: Routine arterial myocardial revascularization using bilateral skeletonized IMAs is safe, and postoperative morbidity and mortality

  20. [Early aseptic loosening of the CF 30 femoral stem].

    PubMed

    Kovanda, M; Havlícek, V; Hudec, J

    2007-02-01

    The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months

  1. Triclosan-coated sutures and sternal wound infections: a prospective randomized clinical trial.

    PubMed

    Steingrimsson, S; Thimour-Bergström, L; Roman-Emanuel, C; Scherstén, H; Friberg, Ö; Gudbjartsson, T; Jeppsson, A

    2015-12-01

    Surgical site infection is a common complication following cardiac surgery. Triclosan-coated sutures have been shown to reduce the rate of infections in various surgical wounds, including wounds after vein harvesting in coronary artery bypass grafting patients. Our purpose was to compare the rate of infections in sternotomy wounds closed with triclosan-coated or conventional sutures. A total of 357 patients that underwent coronary artery bypass grafting were included in a prospective randomized double-blind single-center study. The patients were randomized to closure of the sternal wound with either triclosan-coated sutures (Vicryl Plus and Monocryl Plus, Ethicon, Inc., Somerville, NJ, USA) (n = 179) or identical sutures without triclosan (n = 178). Patients were followed up after 30 days (clinical visit) and 60 days (telephone interview). The primary endpoint was the prevalence of sternal wound infection according to the Centers for Disease Control and Prevention (CDC) criteria. The demographics in both groups were comparable, including age, gender, body mass index, and rate of diabetes and smoking. Sternal wound infection was diagnosed in 43 patients; 23 (12.8%) sutured with triclosan-coated sutures compared to 20 (11.2%) sutured without triclosan (p = 0.640). Most infections were superficial (n = 36, 10.1%), while 7 (2.0%) were deep sternal wound infections. There were 16 positive cultures in the triclosan group and 17 in the non-coated suture group (p = 0.842). The most commonly identified main pathogens were Staphylococcus aureus (45.4%) and coagulase-negative staphylococci (36.4%). Skin closure with triclosan-coated sutures did not reduce the rate of sternal wound infection after coronary artery bypass grafting. (clinicaltrials.gov: NCT01212315).

  2. Recurrent aseptic encephalitis in periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) syndrome.

    PubMed

    Frye, Richard E

    2006-05-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenitis (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA.

  3. Video-assisted structured teaching to improve aseptic technique during neuraxial block.

    PubMed

    Friedman, Z; Siddiqui, N; Mahmoud, S; Davies, S

    2013-09-01

    Teaching epidural catheter insertion tends to focus on developing manual dexterity rather than improving aseptic technique which usually remains poor despite increasing experience. The aim of this study was to compare epidural aseptic technique performance, by novice operators after a targeted teaching intervention, with operators taught aseptic technique before the intervention was initiated. Starting July 2008, two groups of second-year anaesthesia residents (pre- and post-teaching intervention) performing their 4-month obstetric anaesthesia rotation in a university affiliated centre were videotaped three to four times while performing epidural procedures. Trained blinded independent examiners reviewed the procedures. The primary outcome was a comparison of aseptic technique performance scores (0-30 points) graded on a scale task-specific checklist. A total of 86 sessions by 29 residents were included in the study analysis. The intraclass correlation coefficient for inter-rater reliability for the aseptic technique was 0.90. The median aseptic technique scores for the rotation period were significantly higher in the post-intervention group [27.58, inter-quartile range (IQR) 22.33-29.50 vs 16.56, IQR 13.33-22.00]. Similar results were demonstrated when scores were analysed for low, moderate, and high levels of experience throughout the rotation. Procedure-specific aseptic technique teaching, aided by video assessment and video demonstration, helped significantly improve aseptic practice by novice trainees. Future studies should consider looking at retention over longer periods of time in more senior residents.

  4. Associations between Meteorological Factors and Aseptic Meningitis in Six Metropolitan Provinces of the Republic of Korea

    PubMed Central

    Joshi, Yadav Prasad; Kim, Eun-Hye; Kim, Jong-Hun; Kim, Ho; Cheong, Hae-Kwan

    2016-01-01

    We assessed the association between climate factors and a number of aseptic meningitis cases in six metropolitan provinces of the Republic of Korea using a weekly number of cases from January 2002 to December 2012. Generalized linear quasi-Poisson models were applied to estimate the effects of climate factors on the weekly number of aseptic meningitis cases. We used generalized additive and generalized additive mixed models to assess dose–response relationships. A 1 °C increase in mean temperature was associated with an 11.4% (95% confidence interval (CI): 9.6%–13.3%) increase in aseptic meningitis with a 0-week lag; a 10 mm rise in rainfall was associated with an 8.0% (95% CI: 7.2%–8.8%) increase in aseptic meningitis with a 7-week lag; and a 1 mJ/m2 increase of solar radiation was associated with a 5.8% (95% CI: 3.0%–8.7%) increase in aseptic meningitis with a 10-week lag. Nino3 showed positive effects in all lags, and its one unit increase was associated with an 18.9% (95% CI: 15.3%–22.6%) increase of aseptic meningitis at lag 9. The variability in the relationship between climate factors and aseptic meningitis could be used to initiate preventive measures for climate determinants of aseptic meningitis. PMID:27916923

  5. RECURRENT ASEPTIC ENCEPHALITIS IN PERIODIC FEVER, APHTHOUS STOMATITIS, PHARYNGITISAND ADENOPATHY (PFAPA) SYNDROME

    PubMed Central

    Frye, Richard E.

    2008-01-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA. PMID:16645518

  6. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  7. Aseptic lung and liver abscesses: a diagnostic challenge.

    PubMed

    Yildiz, Halil; Munting, Aline; Komuta, Mina; Danse, Etienne; Lefebvre, Chantal

    2017-08-01

    A 67-year-old man known with systemic sarcoidosis was admitted to the department of internal medicine because of cough and chest pain for several weeks. Thoracic tomodensitometry demonstrated multiple pulmonary nodules. Biopsies revealed features compatible with abscesses. Cultures and serologic tests were negative and the patient was successfully treated with prednisone. Three years later, a thoraco-abdominal tomodensitometry showed a relapse in the lung and also the apparition of similar lesions in the liver. Blood test revealed elevated CRP level at 40 mg/L and mild cholestasis. Biopsies of the liver excluded neoplastic or infectious diseases and showed inflammatory granulation tissue with abscess formation. A diagnosis of sarcoidosis-associated aseptic abscesses syndrome was then made, which was successfully treated with corticosteroids.

  8. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  9. Aseptic meningitis and hydrocephalus after posterior fossa surgery.

    PubMed

    Kaufman, H H; Carmel, P W

    1978-01-01

    In an attempt to define the tissue of origin of substances causing aseptic meningitis and secondary hydrocephalus after posterior fossa surgery, analysis of several marker substances from blood, brain, tumour and muscle in the CSF was performed early in seven postoperative patients. No clear pattern emerged which could relate the substances, CSF reaction, and meningeal scarring. The effects of various factors such as contrast studies, drainage, and steroids were also not clear. Review of the literature reveals that all four tissues can cause inflammation. Certain facts about the anatomy of the basilar cisterns and arachnoid villi probably make them logical sites for problems in CFS circulation. Children, for several reasons, are most susceptible to this complication. The complexity of factors in human cases suggests that the problem should be studied in an animal model.

  10. Aseptic multiplication of banana from excised floral apices.

    PubMed

    Cronauer, S S; Krikorian, A D

    1985-08-01

    Most economically important bananas and plantains are large triploid seedless herbs that must be propagated vegetatively by removing small side shoots or "suckers" from the parent plant or by planting seed pieces of larger corms. Consequently, multiplication of stock material is time consuming, Recently, the rapid production of young banana plantlets suitable for use as "seed" material has been described. Vegetative shoot apices were isolated and multiplied using aseptic tissue culture techniques. Although these multiplication systems, once established, can produce thousands of plants in a relatively short period of time, their establishment necessitates the initial sacrifice of an individual specimen, which may not always be desirable or prudent should a limited parent stock be available. We describe here the production and multiplication of rooted banana plantlets from the isolation and culture of terminal floral apices.

  11. Aseptic Meningitis Caused by Lassa Virus: Case Series Report

    PubMed Central

    Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363

  12. Morbid Obesity: Increased Risk of Failure After Aseptic Revision TKA.

    PubMed

    Watts, Chad D; Wagner, Eric R; Houdek, Matthew T; Lewallen, David G; Mabry, Tad M

    2015-08-01

    Patients with obesity are known to have a higher risk of complications after primary TKA; however, there is a paucity of data regarding the effects of obesity with revision TKAs. We asked the following questions : (1) Are patients with morbid obesity (BMI≥40 kg/m2) at greater risk for repeat revision, reoperation, or periprosthetic joint infection (PJI) compared with patients without obesity (BMI<30 kg/m2) after an index revision TKA performed for aseptic reasons? (2) Do patients who are not obese achieve higher Knee Society pain and function scores after revision TKA for aseptic reasons? We used a retrospective cohort study with 1:1 matching for sex, age (±3 years) and date of surgery (±1 year) to compare patients with morbid obesity with patients without obesity with respect to repeat revision, reoperation, and PJI. Using our institution's total joint registry, we identified 1291 index both-component (femoral and tibial) aseptic revision TKAs performed during a 15-year period (1992-2007). Of these, 120 revisions were in patients with morbid obesity (BMI≥40 kg/m2) and 624 were in patients with a BMI less than 30 kg/m2. We then considered only patients with a minimum 5-year followup, which was available for 77% of patients with morbid obesity and 76% of patients with a BMI less than 30 kg/m2 (p=0.84). All patients with morbid obesity who met criteria were included (morbid obesity group: n=93; average followup, 7.9 years) and compared with a matched cohort of patients with a BMI less than 30 kg/m2 (nonmorbid obesity group: n=93; average followup, 7.3 years). Medical records were reviewed to gather details regarding complications and clinical outcomes. Overall, patients with morbid obesity had an increased risk of repeat revision (hazard ratio [HR], 3.8; 95% CI, 1.2-16.5; p<0.02), reoperation (HR, 2.9; 95% CI, 1.3-7.4; p<0.02), and PJI (HR, 6.4; 95% CI, 1.2-119.7; p<0.03). Implant survival rates were 96% (95% CI, 92%-100%) and 100% at 5 years, and 81% (95% CI

  13. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-05-31

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  14. Aseptic Laboratory Techniques: Volume Transfers with Serological Pipettes and Micropipettors

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: •Work within the sterile field created by the Bunsen burner flame. •Use serological pipettes without compromising instrument sterility.• Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. •Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. •Identify different applications for plastic versus glass serological pipettes. •State accuracy limitations for micropipettors.

  15. Combined use of Ilizarov external fixation and Papineau technique for septic pseudoarthrosis of the distal tibia in a patient with diabetes mellitus

    PubMed Central

    Koutsostathis, Stefanos D.; Lepetsos, Panagiotis; Polyzois, Vasilios D.; Pneumaticos, Spyros G.; Macheras, George A.

    2014-01-01

    The surgical treatment of open pilon fractures has a high complication rate especially in diabetic patients. In this article, we present a case of an infected tibial non-union after an open reduction and internal fixation in a diabetic patient, treated with Ilizarov external fixation combined with Papineau technique. Combined use of external fixation and Papineau technique can provide an alternative option for the treatment of septic pseudoarthrosis of the distal tibia. PMID:24563728

  16. A simple protocol for the management of deep sternal surgical site infection: a retrospective study of twenty-five cases.

    PubMed

    Shih, Yu-Jen; Chang, Shun-Cheng; Wang, Chih-Hsin; Dai, Niann-Tzyy; Chen, Shyi-Gen; Chen, Tim-Mo; Tzeng, Yuan-Sheng

    2014-12-01

    Deep sternal incisional surgical site infection is a serious and potentially life-threatening complication after open heart surgery. Although a rare post-operative complication, the rates of post-operative morbidity and mortality are greater in patients who develop a deep sternal incisional surgical site infection than in those who do not. We evaluated retrospectively the results of patients who developed a deep sternal incisional surgical site infection who were treated with either a pectoralis major flap or delayed primary closure after previous negative-pressure wound therapy (NWPT). From July 2007 to July 2012, 25 patients had a deep sternal incisional surgical site infection after open heart surgery in the Departments of Plastic Surgery and Cardiac Surgery of the Tri-Service General Hospital Medical Center. Sternal refixation was not performed in our patients. In 15 patients, a unilateral or bilateral pectoralis major advancement flap with a myocutaneous or muscle flap was used. In seven patients, delayed primary closure was performed after NPWT. One patient received a rectus abdominis myocutaneous flap and another received a free anterior lateral thigh flap. One patient died after developing nosocomial pneumonia with severe sepsis after debridement. In our series, no patient required sternal re-fixation. Our findings suggest that delayed primary closure and use of a unilateral or bilateral pectoralis major flap following NPWT for a deep sternal incisional surgical site infection are simple and quick methods for managing such difficult surgical incisions even if the deep sternal surgical site infection is located in the lower one-third of the sternum.

  17. Surgical fixation of sternal fractures: preoperative planning and a safe surgical technique using locked titanium plates and depth limited drilling.

    PubMed

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th; Mauerer, Andreas; Hennig, Friedrich F; Buder, Thomas

    2015-01-05

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture's morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology.

  18. Surgical Fixation of Sternal Fractures: Preoperative Planning and a Safe Surgical Technique Using Locked Titanium Plates and Depth Limited Drilling

    PubMed Central

    Schulz-Drost, Stefan; Oppel, Pascal; Grupp, Sina; Schmitt, Sonja; Carbon, Roman Th.; Mauerer, Andreas; Hennig, Friedrich F.; Buder, Thomas

    2015-01-01

    Different ways to stabilize a sternal fracture are described in literature. Respecting different mechanisms of trauma such as the direct impact to the anterior chest wall or the flexion-compression injury of the trunk, there is a need to retain each sternal fragment in the correct position while neutralizing shearing forces to the sternum. Anterior sternal plating provides the best stability and is therefore increasingly used in most cases. However, many surgeons are reluctant to perform sternal osteosynthesis due to possible complications such as difficulties in preoperative planning, severe injuries to mediastinal organs, or failure of the performed method. This manuscript describes one possible safe way to stabilize different types of sternal fractures in a step by step guidance for anterior sternal plating using low profile locking titanium plates. Before surgical treatment, a detailed survey of the patient and a three dimensional reconstructed computed tomography is taken out to get detailed information of the fracture’s morphology. The surgical approach is usually a midline incision. Its position can be described by measuring the distance from upper sternal edge to the fracture and its length can be approximated by the summation of 60 mm for the basis incision, the thickness of presternal soft tissue and the greatest distance between the fragments in case of multiple fractures. Performing subperiosteal dissection along the sternum while reducing the fracture, using depth limited drilling, and fixing the plates prevents injuries to mediastinal organs and vessels. Transverse fractures and oblique fractures at the corpus sterni are plated longitudinally, whereas oblique fractures of manubrium, sternocostal separation and any longitudinally fracture needs to be stabilized by a transverse plate from rib to sternum to rib. Usually the high convenience of a patient is seen during follow up as well as a precise reconstruction of the sternal morphology. PMID

  19. Delayed sternal closure after vacuum-assisted closure therapy for tracheo-innominate artery fistula repair.

    PubMed

    Suzuki, Ryo; Mikamo, Akihito; Kurazumi, Hiroshi; Hamano, Kimikazu

    2011-08-01

    We report a case of successful innominate artery resection with delayed sternal closure after vacuum-assisted closure (VAC) therapy for a tracheo-innominate artery fistula (TIF). A 42-year-old woman with cerebral palsy underwent tracheostomy for respiratory assistance. On postoperative day 14, she was transferred to our hospital after an episode of massive hemoptysis. TIF was diagnosed based on the findings of multidetector computed tomography. Thus, we resected the innominate artery and started VAC therapy to control the postoperative local infection. The patient recovered uneventfully, without any infectious sequelae. Our strategy, which includes VAC therapy, for TIF repair may eliminate postoperative infective problems that could induce sequential bleeding and sternal compromise. To our knowledge, this is the first report of using VAC therapy for TIF.

  20. Degradation of 316L stainless steel sternal wire by steam sterilization.

    PubMed

    Shih, Chun-Che; Su, Yea-Yang; Chen, Lung-Ching; Shih, Chun-Ming; Lin, Shing-Jong

    2010-06-01

    Sterilization is an important step prior to the implantation of medical devices inside the human body. In this work we studied the influence of steam sterilization cycles on the oxide film properties of stainless steel sternal wire. Characterization techniques such as open- circuit potential, potentiodynamic measurement, electrochemical impedance spectroscopy, cathodic stripping, transmission electron microscopy, atomic force microscopy and scanning electron microscopy were employed to investigate the cycles of steam sterilization on the corrosion behavior of sternal wire. The results showed that the oxide properties are a function of the number of steam sterilization cycles and deteriorate as the number of cycles increases. Steam sterilization might damage the implant integrity and heavy metals could be released to the surrounding tissues due to deterioration of the oxide film.

  1. Prophylactic antibiotic administration for post cardiothoracic surgery sternal wounds: a retrospective study

    PubMed Central

    Pitsiou, Georgia; Kioumis, Ioannis; Zarogoulidis, Konstantinos; Lazaridis, George; Papaiwannou, Antonis; Tsirgogianni, Katerina; Karavergou, Anastasia; Lampaki, Sofia; Rapti, Aggeliki; Trakada, Georgia; Zissimopoulos, Athanasios; Karaiskos, Theodoros; Madesis, Athanasios; Drosos, Georgios

    2015-01-01

    Background Cardiothoracic surgery sternal infections are difficult to treat situations. Until now there are no clear guidelines which or if an antibiotic could be used as prophylactic treatment. Patients and methods We collected retrospectively data from 535 patients from our hospital which underwent cardiothoracic surgery and recorded several biological parameters and technical aspects of the surgery. Results It was observed that patients to whom vancomycin was administered had less post surgery infection than those to whom begalin was administered. Male who were treated with vancomycin it was observed that they had 1.67 chances to be treated properly than female. Patients which were hospitalized for more than 7 days before surgery had 62.6% higher chances for post surgery infection. Conclusions It was observed that vancomycin can be used as a prophylactic treatment for cardiothoracic surgeries acting efficiently against sternal wounds. PMID:25861611

  2. Evolution and functional significance of derived sternal ossification patterns in ornithothoracine birds

    PubMed Central

    O’connor, J. K.; Zheng, X.-T.; Sullivan, C.; Chuong, C.-M.; Wang, X.-L.; Li, A.; Wang, Y.; Zhang, X.-M.; Zhou, Z.-H.

    2017-01-01

    The midline pattern of sternal ossification characteristic of the Cretaceous enantiornithine birds is unique among the Ornithodira, the group containing birds, nonavian dinosaurs and pterosaurs. This has been suggested to indicate that Enantiornithes is not the sister group of Ornithuromorpha, the clade that includes living birds and their close relatives, which would imply rampant convergence in many nonsternal features between enantiornithines and ornithuromorphs. However, detailed comparisons reveal greater similarity between neornithine (i.e. crown group bird) and enantiornithine modes of sternal ossification than previously recognized. Furthermore, a new subadult enantiornithine specimen demonstrates that sternal ossification followed a more typically ornithodiran pattern in basal members of the clade. This new specimen, referable to the Pengornithidae, indicates that the unique ossification pattern observed in other juvenile enantiornithines is derived within Enantiornithes. A similar but clearly distinct pattern appears to have evolved in parallel in the ornithuromorph lineage. The atypical mode of sternal ossification in some derived enantiornithines should be regarded as an autapomorphic condition rather than an indication that enantiornithines are not close relatives of ornithuromorphs. Based on what is known about molecular mechanisms for morphogenesis and the possible selective advantages, the parallel shifts to midline ossification that took place in derived enantiornithines and living neognathous birds appear to have been related to the development of a large ventral keel, which is only present in ornithuromorphs and enantiornithines. Midline ossification can serve to medially reinforce the sternum at a relatively early ontogenetic stage, which would have been especially beneficial during the protracted development of the superprecocial Cretaceous enantiornithines. PMID:26079847

  3. Evolution and functional significance of derived sternal ossification patterns in ornithothoracine birds.

    PubMed

    O'Connor, J K; Zheng, X-T; Sullivan, C; Chuong, C-M; Wang, X-L; Li, A; Wang, Y; Zhang, X-M; Zhou, Z-H

    2015-08-01

    The midline pattern of sternal ossification characteristic of the Cretaceous enantiornithine birds is unique among the Ornithodira, the group containing birds, nonavian dinosaurs and pterosaurs. This has been suggested to indicate that Enantiornithes is not the sister group of Ornithuromorpha, the clade that includes living birds and their close relatives, which would imply rampant convergence in many nonsternal features between enantiornithines and ornithuromorphs. However, detailed comparisons reveal greater similarity between neornithine (i.e. crown group bird) and enantiornithine modes of sternal ossification than previously recognized. Furthermore, a new subadult enantiornithine specimen demonstrates that sternal ossification followed a more typically ornithodiran pattern in basal members of the clade. This new specimen, referable to the Pengornithidae, indicates that the unique ossification pattern observed in other juvenile enantiornithines is derived within Enantiornithes. A similar but clearly distinct pattern appears to have evolved in parallel in the ornithuromorph lineage. The atypical mode of sternal ossification in some derived enantiornithines should be regarded as an autapomorphic condition rather than an indication that enantiornithines are not close relatives of ornithuromorphs. Based on what is known about molecular mechanisms for morphogenesis and the possible selective advantages, the parallel shifts to midline ossification that took place in derived enantiornithines and living neognathous birds appear to have been related to the development of a large ventral keel, which is only present in ornithuromorphs and enantiornithines. Midline ossification can serve to medially reinforce the sternum at a relatively early ontogenetic stage, which would have been especially beneficial during the protracted development of the superprecocial Cretaceous enantiornithines. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology

  4. A new case of Mycoplasma hominis mediastinitis and sternal osteitis after cardiac surgery.

    PubMed

    Le Guern, Rémi; Loïez, Caroline; Loobuyck, Valentin; Rousse, Natacha; Courcol, René; Wallet, Frédéric

    2015-02-01

    We report a case of nosocomial mediastinitis and sternal osteitis due to M. hominis after open-heart surgery in an immuno-competent patient. This infection has been diagnosed by incubating the culture media for an extended period of time, and sequencing 16S rDNA directly from the clinical samples. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Sternal Repair with Bone Grafts Engineered from Amniotic Mesenchymal Stem Cells

    PubMed Central

    Steigman, Shaun A.; Ahmed, Azra; Shanti, Rabie M.; Tuan, Rocky S.; Valim, Clarissa; Fauza, Dario O.

    2013-01-01

    Background We aimed at determining whether osseous grafts engineered from amniotic mesenchymal stem cells (aMSCs) could be employed in postnatal sternal repair. Methods Leporine aMSCs were isolated, identified, transfected with green fluorescent protein (GFP), expanded, and seeded onto biodegradable electrospun nanofibrous scaffolds (n=6). Constructs were dynamically maintained in an osteogenic medium and equally divided into two groups with respect to time in vitro, namely 14.6 or 33.9 weeks. They were then used to repair full thickness sternal defects spanning 2–3 intercostal spaces in allogeneic kits (n=6). Grafts were submitted to multiple analyses 2 months thereafter. Results Chest roentgenograms showed defect closure in all animals, confirmed at necropsy. Graft density as assessed by micro-CT scans increased significantly in vivo, yet there were no differences in mineralization by extracellular calcium measurements pre- and post-implantation. There was a borderline increase in alkaline phosphatase activity in vivo, suggesting ongoing graft remodeling. Histologically, implants contained GFP-positive cells and few mononuclear infiltrates. There were no differences between the two construct groups in any comparison. Conclusions Engineered osseous grafts derived from amniotic mesenchymal stem cells may become a viable alternative for sternal repair. The amniotic fluid can be a practical cell source for engineered chest wall reconstruction. PMID:19524727

  6. Corrosion of stainless steel sternal wire after long-term implantation.

    PubMed

    Tomizawa, Yasuko; Hanawa, Takao; Kuroda, Daisuke; Nishida, Hiroshi; Endo, Masahiro

    2006-01-01

    A variety of metallic components have been used in medical devices where lifelong durability and physical strength are demanded. To investigate the in vivo changes of implanted metallic medical devices in humans, stainless steel sternal wires removed from patients were evaluated. Stainless steel (316L) sternal wires removed from four patients after 10, 13, 22, and 30 years of implantation were evaluated using scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Macroscopically, the removed specimens maintained their metallic luster and color. Under SEM, small holes were observed sporadically at 10 years and they tended to connect in the drawing direction. The longer the implanted duration, the more numerous and deeper were the crevices observed. By EDS, sulfur, phosphorus, and calcium were identified in all areas at 10 years, in addition to the component elements of stainless steel, comprising iron, chromium, nickel, and manganese. Corrosion products observed at 30 years were identified as calcium phosphate. In conclusion, stainless steel sternal wires develop corroded pores that grow larger and deeper with time after implantation; however, the pores remain shallow even after decades of implantation and they may not be a cause of mechanical failure. An amount of metal ions equivalent to the corroded volume must have been released into the human body, but the effect of these metal ions on the body is not apparent.

  7. Sternal repair with bone grafts engineered from amniotic mesenchymal stem cells.

    PubMed

    Steigman, Shaun A; Ahmed, Azra; Shanti, Rabie M; Tuan, Rocky S; Valim, Clarissa; Fauza, Dario O

    2009-06-01

    We aimed at determining whether osseous grafts engineered from amniotic mesenchymal stem cells (aMSCs) could be used in postnatal sternal repair. Leporine aMSCs were isolated, identified, transfected with green fluorescent protein (GFP), expanded, and seeded onto biodegradable electrospun nanofibrous scaffolds (n = 6). Constructs were dynamically maintained in an osteogenic medium and equally divided into 2 groups with respect to time in vitro as follows: 14.6 or 33.9 weeks. They were then used to repair full-thickness sternal defects spanning 2 to 3 intercostal spaces in allogeneic kits (n = 6). Grafts were submitted to multiple analyses 2 months thereafter. Chest roentgenograms showed defect closure in all animals, confirmed at necropsy. Graft density as assessed by microcomputed tomographic scans increased significantly in vivo, yet there were no differences in mineralization by extracellular calcium measurements preimplantation and postimplantation. There was a borderline increase in alkaline phosphatase activity in vivo, suggesting ongoing graft remodeling. Histologically, implants contained GFP-positive cells and few mononuclear infiltrates. There were no differences between the 2 construct groups in any comparison. Engineered osseous grafts derived from amniotic mesenchymal stem cells may become a viable alternative for sternal repair. The amniotic fluid can be a practical cell source for engineered chest wall reconstruction.

  8. Gallium-67 scanning in the diagnosis of postoperative sternal osteomyelitis: concise communication.

    PubMed

    Salit, I E; Detsky, A S; Simor, A E; Weisel, R D; Feiglin, D

    1983-11-01

    Sternal osteomyelitis is an uncommon but serious complication of the median sternotomy incision. Definite diagnosis is clinically difficult and radionuclide scanning is of uncertain value in the early postoperative period. We conducted a prospective blind study of gallium scanning in the early period after cardiac surgery and reviewed clinically diagnosed cases that also had scans. Clinical status and scan interpretation were each independently assessed by three raters. Thirty-eight scans included six true positives, five true negatives (no sternotomy) and 27 post-sternotomy, clinically uninfected patients. Using categories of high, medium, and low for scan interpretation, the radiologic assessors agreed 90% of the time. Normal postoperative Ga-67 uptake could usually be differentiated from uptake by an infected sternum. The test had a sensitivity of 83% and specificity 96%. If the clinical (pretest) likelihood of sternal osteomyelitis is 30%, then the gallium scan will have a 90% positive predictive value and a 93% negative predictive value. This study of observer variation and validity indicates that Ga-67 scanning may be useful in confirming the diagnosis of poststernotomy sternal osteomyelitis.

  9. A review of eleven cases of tuberculosis presenting as sternal wound abscess after open heart surgery.

    PubMed

    Tabaja, Hussam; Hajar, Zeina; Kanj, Souha S

    2017-10-01

    Sternal wound infection with Mycobacterium tuberculosis is an uncommon yet highly challenging disease that can be quite insidious with various presentations. We hereby provide a review of 10 cases in current literature and describe an additional case which illustrates the difficulties associated with diagnosis. We used PubMed and Google search engine to search the literature for all published papers reporting on cases of sternal M. tuberculosis infections post open-heart surgeries. A total of 11 cases were presented, including a case of our own. The majority were males and were exposed to endemic areas. The average age was 59.6 ± 15.5 years. Coronary artery bypass surgery accounted for 73% of procedures and the average time to symptoms onset was 12.2 ± 16.6 months. Diabetes was the most reported non-cardiac comorbidity. Presenting symptoms varied and only 5 patients had other organs involved. Blood tests and radiographic studies were neither sensitive nor specific. M. tuberculosis culture on debrided tissues was the most sensitive test but often forgotten initially. Diagnostic delay was seen in almost all cases, often leading to unnecessary courses of antibiotics and aggressive surgical interventions. Finally, all patients responded well to anti-tuberculosis treatment, with reported treatment duration ranging from 9 to 12 months. M. tuberculosis infection of the sternum should be suspected in late-onset sternal wound infections post open-heart surgery especially when the course is chronic and indolent.

  10. Impact of deep sternal wound infection management with vacuum-assisted closure therapy followed by sternal osteosynthesis: a 15-year review of 23,499 sternotomies.

    PubMed

    Baillot, Richard; Cloutier, Daniel; Montalin, Livia; Côté, Louise; Lellouche, François; Houde, Chanel; Gaudreau, Geneviève; Voisine, Pierre

    2010-04-01

    This study was undertaken to examine the outcome of patients with deep sternal wound infection (DSWI) now treated with vacuum-assisted closure (VAC) therapy as a bridge to sternal osteosynthesis with horizontal titanium plate fixation. From 1992 to 2007, a consecutive cohort of 23,499 patients underwent open-heart surgery (OHS) in our institution. The period under study was divided in two according to the use of therapeutic modalities: conventional (1992-2001, N=118 DSWI): debridement/drainage with primary closure and irrigation (N=37), debridement/drainage, open packing followed by pectoralis myocutaneous flaps (PMFs) (N=81); contemporary (2002-2007, N=149 DSWI): conventional treatment (N=24) and VAC therapy (N=125/83.8%). VAC was followed by sternal osteosynthesis with horizontal titanium plates in 92 patients (61.7%). DSWI was diagnosed in 267 out of 23 499 (1.1%) patients of our entire series according to Center for Disease Control - Atlanta (CDC) criteria, 118 out of 13 180 (0.9%) in the first and 149 out of 10 319 (1.4%) in the second period (p=0.001). Hospital mortality (N=267/23,499) has been 10.25% for the entire cohort under study without any difference between groups (1992-2001: 11.4%; 2002-2007: 9.1%, p=0.67). More recently, VAC therapy (N=125) was associated with a lower mortality (4.8% vs 14.1%, p=0.01). Stepwise multivariable logistic regression analysis for both periods revealed that prolonged intubation in the intensive care unit (ICU), use of bilateral internal thoracic artery grafting (BIMA), diabetes, re-operation for bleeding and body mass index (BMI) >30 kgm(-2) are the most powerful predictors of DSWI. In the more recently treated patients using VAC therapy, combined procedures (valve and graft) also emerged as a significant predictor. For the entire study, Staphylococcus epidermidis (49.6%) has been the most frequently identified pathogen, followed by Staphylococcus aureus (38.8%). Methicillin-resistant S.aureus (MRSA) was observed in 4

  11. Atypical leptospirosis: an overlooked cause of aseptic meningitis.

    PubMed

    Wang, Ning; Han, Yu-Hsuan; Sung, Jia-Ying; Lee, Wen-Sen; Ou, Tsong-Yih

    2016-03-10

    Leptospirosis, probably the most common zoonosis in the world, is caused by pathogenic Leptospira species. Clinical presentations range from nonspecific fevers to fulminant diseases such as Weil's syndrome. Neurological forms of leptospirosis (neuroleptospirosis) are usually underestimated, and many cases of leptospirosis are overlooked because of the lack of specificity of signs and symptoms. Diagnosis confirmation is difficult because of the challenges associated with isolating the organism and positive serologic testing. A comprehensive understanding of the clinical presentation of leptospirosis and risk factors for exposure to leptospirae are required for early diagnosis, in order to initiate appropriate treatment immediately. Here we present one male patient with anicteric leptospirosis that manifested as neuroleptospirosis with aseptic meningitis, although he did not have impaired kidney function or thrombocytopenia. He recovered well after an early investigation and treatment for leptospirosis based on suspected relevant risk factors and clinical manifestations. To facilitate optimal use of antibiotic treatments and prevent lethal complications of leptospirosis, we report this case of leptospirosis, which highlights the importance of knowing the occupational history and environmental exposures of patients living in leptospirosis-endemic areas and presenting meningeal signs.

  12. Postoperative Aseptic Intracranial Granuloma: The Possible Influence of Fluid Hemostatics

    PubMed Central

    Ganau, Mario; Nicassio, Nicola; Tacconi, Leonello

    2012-01-01

    Background. Numerous reports have demonstrated how postoperative intracranial granulomas can often mimic neoplasm clinically, radiologically, and even macroscopically. Herein we present an unusual case of postsurgical intracranial aseptic granuloma secondary to a chronic inflammatory reaction without any identifiable retained foreign body. Case Description. A 71-year-old patient started complaining of severe headache seven months after surgical excision of WHO Grade I right frontal falx meningioma. CT and MRI scans disclosed a contrast-enhanced lesion with diffuse mass effect in the previous surgical site. The lesion was resected; intraoperative finding and histological specimens led to the diagnosis of postoperative granuloma, likely expression of a glial reaction to the fluid absorbable hemostatics applied in the surgical site after meningioma excision. The possible granuloma-inducing materials and the timing of granuloma formation are discussed. Conclusion. A comprehensive analysis of clinical and neuroradiological data, as well as results of blood tests including positive and negative acute phase proteins, is mandatory to raise the suspicion of postoperative granuloma. The treatment options should be evaluated on a case-by-case basis, with a conservative attitude being the one of choice only for patients without progressive neurological deficit. Alternatively, aggressive surgical treatment and histopathological examination should be advocated. PMID:22924150

  13. Mortality following revision total knee arthroplasty: a matched cohort study of septic versus aseptic revisions.

    PubMed

    Choi, Ho-Rim; Bedair, Hany

    2014-06-01

    We report the medium-term mortality after septic versus aseptic revision total knee arthroplasty (TKA) and factors that can contribute to mortality in revision TKA. Mortality rates of 88 patients undergoing septic revision (septic group) were compared with age- and year of surgery-matched 88 patients of aseptic revision (aseptic group). The overall mortality after revision TKA was 10.7% at a median of 4 years of follow-up (range, 2-7 years). However, the mortality after septic revision (18%, 16/88) was six times higher than that of aseptic revision (3%, 3/88) (P = 0.003). Infections with Staphylococcus aureus and/or methicillin resistance was not associated with higher mortality rates. Multivariate analysis indicated that increased age (P < 0.001), higher ASA class (P = 0.002), and septic revision (P < 0.001) were identified as independent predictors of increased mortality after revision TKA.

  14. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068652 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, holds a sample from bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  15. Recurrent case of ibuprofen-induced aseptic meningitis in mixed connective tissue disease.

    PubMed

    Karmacharya, Paras; Mainali, Naba Raj; Aryal, Madan Raj; Lloyd, Benjamin

    2013-04-30

    Although relatively uncommon, the incidence of non-steroidal anti-inflammatory drug-induced aseptic meningitis appears to be increasing among patients with connective tissue disease and also among the healthy population. Ibuprofen is the most common culprit identified. We report a case of a 28-year-old woman with mixed connective tissue disease and recent intake of ibuprofen, presenting with a recurrent episode of ibuprofen-induced aseptic meningitis.

  16. Do low profile implants provide reliable stability in fixing the sternal fractures as a "fourth vertebral column" in sternovertebral injuries?

    PubMed

    Krinner, Sebastian; Grupp, Sina; Oppel, Pascal; Langenbach, Andreas; Hennig, Friedrich F; Schulz-Drost, Stefan

    2017-04-01

    Flexion and compression forces to the trunk can cause severe instability of the vertebral column and the anterior chest wall, mostly associated with an unstable fracture of the sternum. In combination, the worst case would be a complete disruption of the trunk. Some authors consider the sternum-rib-complex to be the fourth vertebral column. This study discusses the possibilities to treat instable trunk injuries with sternal fractures concomitant to vertebral spine fractures through anterior sternal plating employing a locked plate osteosynthesis in a low profile design instead of the use of bulky implants. 11 Patients suffering from at least one fracture of a vertebral body in combination with an unstable sternum fracture were stabilized through a locked plate osteosynthesis in low profile design at the sternum between November 2011 and October 2014. The vertebral spine injury was stabilized as well, if necessary. Patients were followed up with a look at the consolidation of the fractures and the question if any failure of the implants occurred. Anterior sternal plating was uneventful in all cases. All Sternal fractures showed sufficient consolidation. No failure of implants has been seen during follow up over two years.. A locked plate osteosynthesis of a sternal fracture in low profile design seem to be an appropriate option for stabilization of the sternum in combined sternovertebral injuries.

  17. FDG-PET/CT for differentiating between aseptic and septic delayed union in the lower extremity.

    PubMed

    van Vliet, Kirsten E; de Jong, Vincent M; Termaat, M Frank; Schepers, Tim; van Eck-Smit, Berthe L F; Goslings, J Carel; Schep, Niels W L

    2017-09-27

    (18)F-fluorodeoxyglucose ((18)F-FDG) positron emission tomography (PET)/computed tomography (CT) has proven to have a high diagnostic accuracy for the detection of bone infections. In patients with delayed union it may be clinically important to differentiate between aseptic and septic delayed union. The aim of this study was to evaluate the efficacy and to assess the optimal diagnostic accuracy of FDG-PET/CT in differentiating between aseptic and septic delayed union in the lower extremity. This is a retrospective study of consecutive patients who underwent FDG-PET/CT scanning for suspicion of septic delayed union of the lower extremity. Diagnosis of aseptic delayed union or septic delayed union was made based on surgical deep cultures following PET/CT scanning and information on clinical follow-up. FDG-uptake values were measured at the fractured site by use of the maximum standardized uptake value (SUVmax). Sensitivity, specificity and diagnostic accuracy of FDG-PET/CT were calculated at various SUVmax cut-off points. A total of 30 patients were included; 13 patients with aseptic delayed unions and 17 patients with septic delayed unions. Mean SUVmax in aseptic delayed union patients was 3.23 (SD ± 1.21). Mean SUVmax in septic delayed union patients was 4.77 (SD ± 1.87). A cut-off SUVmax set at 4.0 showed sensitivity, specificity and diagnostic accuracy of FDG-PET/CT were 65, 77 and 70% to differentiate between aseptic and septic delayed union, respectively. Using a semi-quantitative measure (SUVmax) for interpretation of FDG-PET/CT imaging seems to be a promising tool for the discrimination between aseptic and septic delayed union.

  18. Factors affecting the incidence of aseptic nonunion after surgical fixation of humeral diaphyseal fracture.

    PubMed

    Ding, Liang; He, Zhimin; Xiao, Haijun; Chai, Leizi; Xue, Feng

    2014-11-01

    Although aseptic nonunion of humeral diaphyseal fracture is rare, it often is debilitating for the patient. Treatment is challenging for the surgeon when nonunion occurs. The purpose of this study was to analyze and identify independent risk factors for aseptic nonunion among patients with humeral diaphyseal fracture undergoing surgical fixation. The medical records of all humeral diaphyseal fracture patients who underwent surgical fixation from January 2005 to January 2011 were reviewed to identify those who developed aseptic nonunion. We performed univariate and multivariate logistic regression to identify independent associations of potential risk factors for aseptic nonunion among patients with surgical humeral diaphyseal fracture. A total of 686 patients were identified, with 659 meeting our inclusion criteria. Among these 659 cases there were 24 cases of septic nonunion, an incidence of 3.6%. The patients were followed for 9-24 months, with an average follow-up period of 14.8 months. In the final regression model, advanced age (odds ratio, 1.09; 95% CI: 1.03-1.14, P = 0.001), smoking (odds ratio, 5.34; 95% CI: 1.05-27.00, P = 0.043), use of NSAIDs (odds ratio, 2.51; 95% CI: 1.80-3.50, P < 0.001), and ASA score (odds ratio, 3.04; 95% CI: 1.06-8.74, P = 0.039) were risk factors for aseptic nonunion of humeral diaphyseal fracture after surgical fixation. This analysis confirms advanced age, smoking, use of NSAIDs, and ASA score were related to an increased risk of aseptic nonunion of humeral diaphyseal fracture after surgical fixation. Patients who have the risk factors identified in this study should be counseled about the possibility of aseptic nonunion occurring after surgical fixation.

  19. Hygienic interventions to decrease deep sternal wound infections following coronary artery bypass grafting.

    PubMed

    Lytsy, B; Lindblom, R P F; Ransjö, U; Leo-Swenne, C

    2015-12-01

    The department of Cardiothoracic Surgery at Uppsala University Hospital has 25 beds in one to four patient rooms and an operating suite consisting of five operating rooms with ultraclean air. Around 700 open heart (250 isolated coronary artery bypass grafting, CABG) operations are performed annually. In 2009, the numbers of deep sternal wound infections (DSWIs) increased to unacceptable rates despite existing hygienic guidelines. To show how root cause analysis (RCA) followed by quality improvement interventions reduced the rate of DSWI after CABG surgery. Only isolated CABG patients requiring surgical revision due to DSWI were included. Swabs and tissue biopsies were taken during surgical revision and analysed with standard methods. DSWIs were registered prospectively according to US Centers for Disease Control and Prevention definitions. RCA for infection was performed between September 2009 and April 2010. Interventions based on results of the RCA and on nationally recommended practices were concluded in April 2010, and thought to have taken full effect by July 1st, 2010. Air was actively sampled at ≤0.5m from the sternal incision. DSWI incidence rates per CABG operations decreased from 5.1% pre intervention to 0.9% post intervention. Wound cultures pre intervention grew Staphylococcus aureus 27.1% and coagulase negative staphylococcus (CoNS) 47.1%, post intervention S. aureus 23.1% and CoNS 30.8%. Air counts did not exceed 5cfu/m(3). When the aetiology of an error is multifactorial, RCA engaging both the medical professions and the infection control team is a potential tool to map causes leading to adverse events such as healthcare-associated infections. A systematic quality improvement intervention based on the RCA may reduce the number of deep sternal wound infections after CABG surgery. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  20. Multicenter Quality Improvement Project to Prevent Sternal Wound Infections in Pediatric Cardiac Surgery Patients.

    PubMed

    Woodward, Cathy; Taylor, Richard; Son, Minnette; Taeed, Roozbeh; Jacobs, Marshall L; Kane, Lauren; Jacobs, Jeffrey P; Husain, S Adil

    2017-07-01

    Children undergoing cardiac surgery are at risk for sternal wound infections (SWIs) leading to increased morbidity and mortality. Single-center quality improvement (QI) initiatives have demonstrated decreased infection rates utilizing a bundled approach. This multicenter project was designed to assess the efficacy of a protocolized approach to decrease SWI. Pediatric cardiac programs joined a collaborative effort to prevent SWI. Programs implemented the protocol, collected compliance data, and provided data points from local clinical registries using Society of Thoracic Surgery Congenital Heart Surgery Database harvest-compliant software or from other registries. Nine programs prospectively collected compliance data on 4,198 children. Days between infections were extended from 68.2 days (range: 25-82) to 130 days (range: 43-412). Protocol compliance increased from 76.7% (first quarter) to 91.3% (final quarter). Ninety (1.9%) children developed an SWI preprotocol and 64 (1.5%) postprotocol, P = .18. The 657 (15%) delayed sternal closure patients had a 5% infection rate with 18 (5.7%) in year 1 and 14 (4.3%) in year 2 P = .43. Delayed sternal closure patients demonstrated a trend toward increased risk for SWI of 1.046 for each day the sternum remained open, P = .067. Children who received appropriately timed preop antibiotics developed less infections than those who did not, 1.9% versus 4.1%, P = .007. A multicenter QI project to reduce pediatric SWIs demonstrated an extension of days between infections and a decrease in SWIs. Patients who received preop antibiotics on time had lower SWI rates than those who did not.

  1. Sternal wound infections in pediatric congenital cardiac surgery: a survey of incidence and preventative practice.

    PubMed

    Woodward, Cathy S; Son, Minnette; Calhoon, John; Michalek, Joel; Husain, S Adil

    2011-03-01

    Guidelines exist for prevention of sternal wound infections (SWI) in adults. There are no guidelines for pediatric patients and limited reports on SWI incidence. The purpose of this study was to determine the incidence of, and preventative practice regarding pediatric SWIs with a long-term aim to develop best practice guidelines. Eighty-nine congenital heart programs were sent a 31 question on-line survey regarding pediatric SWI. Thirty eight (43%) of the 89 programs responded. They reported 8,774 pediatric congenital procedures with a mean SWI rate of 1.53% (range, 0 to 9.09). Mean yearly volume was 237 operations (range, 50 to 720). Neither program size nor delayed sternal closure was associated with increased incidence of SWI. Variations in preoperative measures, antibiotic regimens, and wound care did not statistically impact incidence of SWI. Programs with protocols to monitor and control blood glucose levels postoperatively had statistically lower infection rates (1.04 vs 2.35, p = 0.03), and those that sent mediastinal cultures at time of delayed sternal closure reported lower infection rates (1.34 vs 1.74, p = 0.051). This report provides a multiinstitutional SWI incidence from pediatric programs of 1.53%. Despite variations in clinical practice between programs, this survey revealed two strategies resulting in reduced SWIs; protocol-based management of glucose levels and mediastinal wound cultures sent at time of closure. Pediatric programs do not consistently follow adult preventative guidelines. Multicenter randomized research is needed to formulate preventative guidelines to reduce the incidence of pediatric SWI. Copyright © 2011 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  2. Comparison of sternal, iliac, and humeral bone marrow aspiration in Beagle dogs.

    PubMed

    Defarges, Alice; Abrams-Ogg, Anthony; Foster, Robert A; Bienzle, Dorothee

    2013-06-01

    Sternal bone marrow aspiration in dogs is not commonly performed as it is considered technically challenging in smaller dogs. However, the sternum is readily accessible and associated with less pain from aspiration compared with other sites. The aim of the study was to investigate feasibility, ease, number of attempts, safety, and sample quality of sternal bone marrow aspirates in small dogs. Bone marrow aspirates were obtained in a randomized order from 3 sites in 26 clinically healthy Beagles under general anesthesia. Samples were obtained from the sternum using one-inch 20- or 22-gauge hypodermic needles, from the right greater tubercle of the humerus, and the right iliac crest using 18-gauge Illinois needles. The difficulty of each procedure was scored. Two types of bone marrow smears were prepared and reviewed by a pathologist unaware of site of aspiration or dog. The number of particles per slide and overall slide quality were scored. The site of aspiration and the cranial thoracic wall were evaluated at autopsy for evidence of trauma or pneumothorax. The number of attempts and time for bone marrow aspiration were greater for ilium than for sternum or humerus, but the sternum was the easiest to aspirate. Smear quality and particle number were similar for all sites. Neither trauma at the site of aspiration nor pneumothorax were identified. Aspiration of sternal bone marrow with hypodermic needles is feasible and safe in Beagle dogs. Samples equivalent in quality to those from the humerus or ilium can be obtained from clinically normal dogs. © 2013 American Society for Veterinary Clinical Pathology.

  3. An alternative approach to prescribing sternal precautions after median sternotomy, “Keep Your Move in the Tube”

    PubMed Central

    Lotshaw, Ana; Exum, Emelia; Campbell, Mark; Spranger, Cathy B.; Beveridge, Jim; Baker, Shawn; McCray, Stephanie; Bilbrey, Tim; Shock, Tiffany; Lawrence, Anne; Hamman, Baron L.; Schussler, Jeffrey M.

    2016-01-01

    Traditional sternal precautions, given to sternotomy patients as part of their discharge education, are intended to help prevent sternal wound complications. They vary widely but generally include arbitrary load and time restrictions (lifting no more than a specified weight for up to 12 weeks) and may prohibit common shoulder joint and shoulder girdle movements. Having observed the negative effects of restrictive sternal precautions for many years, our research team performed a series of studies that measured the forces exerted during various common activities and their relationship to the sternum. The results, though informative, led us to realize that the goal of identifying “the” appropriate load restriction to prescribe for sternotomy patients was futile. The alternative approach that we introduce applies standard kinesiological principles and teaches patients how to perform load-bearing movements in a way that avoids excessive stress to the sternum. PMID:26722187

  4. Sternal "retraction": a novel application of a mandibular distractor in treating ectopia cordis with complete cleft sternum.

    PubMed

    Gart, Michael S; Vicari, Frank A

    2015-05-01

    Complete thoracic ectopia cordis is associated with a uniformly dismal prognosis. The primary challenges of this disorder are (1) returning the heart to the thoracic cavity, (2) stabilizing the chest wall, and (3) repairing the sternal defect. Previously published techniques for achieving these goals have demonstrated very limited success and/or significant morbidity.We present a novel application of a mandibular distraction device as part of staged repair of this historically challenging problem. This method uses immediate stabilization and gradual "retraction" of the sternal remnants, thereby allowing physiologic compensation and avoiding the cardiorespiratory embarrassment associated with returning the heart to the thoracic cavity. Moreover, this technique allows stabilization of the associated sternal cleft and chest wall without the commonly associated morbidity of the currently available techniques.

  5. Identification of 4th intercostal space using sternal notch to xiphoid length for accurate electrocardiogram lead placement.

    PubMed

    Day, Kevin; Oliva, Isabel; Krupinski, Elizabeth; Marcus, Frank

    2015-01-01

    Precordial ECG lead placement is difficult in obese patients with increased chest wall soft tissues due to inaccurate palpation of the intercostal spaces. We investigated whether the length of the sternum (distance between the sternal notch and xiphoid process) can accurately predict the location of the 4th intercostal space, which is the traditional location for V1 lead position. Fifty-five consecutive adult chest computed tomography examinations were reviewed for measurements. The sternal notch to right 4th intercostal space distance was 67% of the sternal notch to xiphoid process length with an overall correlation of r=0.600 (p<0.001). The above measurement may be utilized to locate the 4th intercostal space for accurate placement of the precordial electrodes in adults in whom the 4th intercostal space cannot be found by physical exam. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Jugulo-sternal-gland tumors in male tree shrews (Tupaia belangeri).

    PubMed

    Brack, M

    1991-12-01

    Adenocarcinomas of the jugulo-sternal glands were observed in seven adult male tree shrews (Tupaia belangeri) at biopsy or necrospy. Five of these tumors were classified as carcinomas of the sebaceous gland compartment; one was diagnosed as a papilliform adenoma of apocrine (monoptychic) sweat glands; and one was of a mixed sebaceous gland/apocrine sweat gland structure. Four sebaceous gland carcinomas had histologic evidence of vascular invasion; one had metastasized to the regional lymph nodes and lungs and had also invaded the thoracic muscles.

  7. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery

    PubMed Central

    Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-01-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions. PMID:26336388

  8. Gentamicin-impregnated collagen sponge for preventing sternal wound infection after cardiac surgery.

    PubMed

    Kozioł, Małgorzata; Targońska, Sylwia; Stążka, Janusz; Kozioł-Montewka, Maria

    2014-03-01

    The frequency of sternal wound infection (SWI) after cardiac surgery ranges from 0.5% to 8% and is associated with significant morbidity, mortality, and treatment cost. Perioperative antibiotic prophylaxis is not sufficient to fully prevent the contamination of the surgical access site. One of the most effective methods for the prevention of wound infection seems to be the use of gentamicin-impregnated collagen sponge, which is successfully used in abdominal and orthopedic surgery. Surgically implantable topical antibiotics can reduce wound infection in cardiac patients as well, but the efficacy of SWI prevention in cardiac surgery still raises many questions.

  9. Does a gentamicin-impregnated collagen sponge reduce sternal wound infections in high-risk cardiac surgery patients?

    PubMed Central

    Birgand, Gabriel; Radu, Costin; Alkhoder, Soleiman; Al Attar, Nawwar; Raffoul, Richard; Dilly, Marie-Pierre; Nataf, Patrick; Lucet, Jean-Christophe

    2013-01-01

    OBJECTIVES Sternal wound infections occurring after cardiac surgery have a critical impact on morbidity, mortality and hospital costs. This study evaluated the efficacy of a gentamicin–collagen sponge in decreasing deep sternal-wound infections in high-risk cardiac surgery patients. METHODS We conducted a quasi-experimental single-centre prospective cohort study in diabetic and/or overweight patients undergoing coronary-artery bypass surgery with bilateral internal mammary artery grafts. The end-point was the rate of reoperation for deep sternal wound infection. The period from January 2006 to October 2008, before the introduction of the gentamicin sponge, was compared with the period from November 2008 to December 2010. RESULTS Of 552 patients (median body mass index, 31.5; 37.7% with diabetes requiring insulin), 68 (12.3%) had deep sternal wound infections. Reoperation for deep sternal wound infections occurred in 40/289 (13.8%) preintervention patients and 22/175 (12.6%) patients managed with the sponge. Independent risk factors were female sex and longer time on mechanical ventilation, but not use of the sponge (adjusted odds ratio, 0.95; 95% confidence interval, 0.52–1.73; P = 0.88). The group managed with the sponge had a higher proportion of gentamicin-resistant micro-organisms (21/27, 77.8%) compared with the other patients (23/56, 41.1%; P < 0.01). The median time to reoperation for wound infection was higher with the sponge (21 vs 17 days, P < 0.01). CONCLUSIONS A gentamicin–collagen sponge was not effective in preventing deep sternal wound infections in high-risk patients. Our results suggest that a substantial proportion of wound contaminations occur after bypass surgery with bilateral internal mammary artery grafts. PMID:23115102

  10. Comparative Analysis of Direct Hospital Care Costs between Aseptic and Two-Stage Septic Knee Revision

    PubMed Central

    Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen

    2017-01-01

    Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they

  11. Cerebrospinal fluid lactate dehydrogenase isoenzymes in children with bacterial and aseptic meningitis.

    PubMed

    Nussinovitch, Moshe; Finkelstein, Yaron; Elishkevitz, Keren Politi; Volovitz, Benjamin; Harel, Daniella; Klinger, Gil; Razon, Yaron; Nussinovitch, Udi; Nussinovitch, Naomi

    2009-10-01

    Differentiation of bacterial from aseptic meningitis may be difficult. Our aim was to determine the pattern of distribution of lactate dehydrogenase (LDH) isoenzymes in the cerebrospinal fluid (CSF) of patients with bacterial and aseptic meningitis. One hundred and fifty-seven patients with suspected meningitis were enrolled in the study. They were divided into 3 groups according to the culture- or bacterial antigen assay-proven diagnosis and CSF findings: bacterial meningitis (n = 31), aseptic meningitis (n = 65), and non-meningitis (n = 61). Total LDH level and percentages of LDH isoenzymes in the CSF were measured in each patient. Each group showed a distinct LDH isoenzyme distribution pattern, with a statistically significant difference among the groups in the percentages of the various isoenzymes. Compared with the non-meningitis group, total LDH activity in the CSF was high in the aseptic meningitis group (49.82+/-35.59 U/L, P < 0.001) and exaggerated in the bacterial meningitis group (944.53+/-112.3 U/L, P < 0.001). Low LDH-2 levels were unique to bacterial meningitis (P < 0.01), whereas high LDH-3 levels were characteristic of aseptic meningitis (P < 0.05). Both groups had low levels of LDH-1 and high levels of LDH-4 and LDH-5. In conclusion, the LDH isoenzyme pattern may be of clinical diagnostic value in meningitis, particularly when culture results are pending.

  12. Proposal for a new categorization of aseptic processing facilities based on risk assessment scores.

    PubMed

    Katayama, Hirohito; Toda, Atsushi; Tokunaga, Yuji; Katoh, Shigeo

    2008-01-01

    Risk assessment of aseptic processing facilities was performed using two published risk assessment tools. Calculated risk scores were compared with experimental test results, including environmental monitoring and media fill run results, in three different types of facilities. The two risk assessment tools used gave a generally similar outcome. However, depending on the tool used, variations were observed in the relative scores between the facilities. For the facility yielding the lowest risk scores, the corresponding experimental test results showed no contamination, indicating that these ordinal testing methods are insufficient to evaluate this kind of facility. A conventional facility having acceptable aseptic processing lines gave relatively high risk scores. The facility showing a rather high risk score demonstrated the usefulness of conventional microbiological test methods. Considering the significant gaps observed in calculated risk scores and in the ordinal microbiological test results between advanced and conventional facilities, we propose a facility categorization based on risk assessment. The most important risk factor in aseptic processing is human intervention. When human intervention is eliminated from the process by advanced hardware design, the aseptic processing facility can be classified into a new risk category that is better suited for assuring sterility based on a new set of criteria rather than on currently used microbiological analysis. To fully benefit from advanced technologies, we propose three risk categories for these aseptic facilities.

  13. Unusually severe varicella zoster (VZV) virus viral (aseptic) meningitis in an unimmunized, immunocompetent host with chickenpox.

    PubMed

    Cunha, Burke A; Warren-Favorito, Heather; Mickail, Nardeen

    2011-01-01

    Chickenpox is caused by the varicella zoster virus (VZV) and may be more severe in adults than in children. Central nervous system (CNS) manifestations of chickenpox and VZV are uncommon, for example, encephalitis and cerebellar ataxis. Viral (aseptic) meningitis is a rare CNS complication of VZV. The cerebrospinal fluid (CSF) profile in VZV viral (aseptic) meningitis is indistinguishable from other causes of viral meningitis. The clue to most of the diagnoses of VZV aseptic meningitis is based on the temporal relationship between antecedent or concomitant chickenpox. Chickenpox is a clinical diagnosis based on the appearance and distribution of the rash. The rash of chickenpox is vesicular/pruritic and typically appears in crops over 3 successive days. VZV vesicles are fragile, superficial, and surrounded by a erythematous halo. Common nonspecific laboratory findings in chickenpox include leukopenia, thrombocytopenia, and elevated serum transaminases (serum glutamate-oxaloacetate transaminase/serum glutamate-pyruvate transaminase). The erythrocyte sedimentation rate (ESR) is not highly elevated in chickenpox. In VZV aseptic meningitis, the CSF shows a lymphocytic pleocytosis with normal protein, glucose, and lactic acid levels. CSF red blood cells are not a feature of VZV meningitis. We present the case of a healthy unimmunized adult who was hospitalized with chickenpox complicated by VZV aseptic meningitis with an unusually severe headache and nuchal rigidity that occurred during hospitalization. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Aseptic peritonitis due to peptidoglycan contamination of pharmacopoeia standard dialysis solution.

    PubMed

    Martis, Leo; Patel, Mehul; Giertych, Joe; Mongoven, Jim; Taminne, Michel; Perrier, Michele A; Mendoza, Omar; Goud, Niranjan; Costigan, Aidan; Denjoy, Nicole; Verger, Christian; Owen, William F

    Manufacturers of parenteral solutions adhere to European and US Pharmacopoeia standards to define safety and sterility. In response to excess cases of aseptic peritonitis in peritoneal dialysis patients using icodextrin-containing dialysate that met all pharmacopoeia standards, a global recall was issued in May, 2002. We aimed to establish the cause of aseptic peritonitis. We analysed 186 reports of aseptic peritonitis between September, 2001, and January, 2003. Extensive physical, chemical, and microbiological investigations of recalled dialysate were done. We calculated dose-response curves for peptidoglycan-induced interleukin 6 elaboration in peripheral blood mononuclear cells (PBMCs) from healthy donors and for sterile peritonitis in rats. Although its chemical constituents and concentrations of endotoxin were within pharmacopoeia specifications, the dialysis solution elicited an interlukin 6 response in vivo and in vitro. We identified peptidoglycan from thermophilic acidophilic bacteria (Alicyclobacillus acidocaldarius) as the contaminating proinflammatory substance. In the PBMC assay, strong dose-response relations were noted between peptidoglycan concentrations and interleukin 6. In rats injected with peptidoglycan, dose-dependent increases of intraperitoneal neutrophils and pyrogenic cytokines were recorded. We measured a positive relation between peptidoglycan concentrations in recalled dialysate and reports of aseptic peritonitis. After implementation of corrective actions, the rate of peritonitis returned to baseline. Excess cases of aseptic peritonitis in peritoneal dialysis patients were due to peptidoglycan contamination of dialysate by Alicyclobacillus. This outbreak serves as an example of how contemporary parenteral products with microbial contaminants can be considered safe under current pharmacopoeia tests, but provoke adverse clinical effects.

  15. Flexible walled container having membrane fitment for use with aseptic filling apparatus

    SciTech Connect

    Davis, J.C.; Reiss, R.J.; Rica, A.F.

    1984-05-01

    There is disclosed an aseptic flexible walled container having a rigid fitment member cooperative with an aseptic filling apparatus and including a neck, outer flanges surrounding the neck, a frangible membrane and an outer end rim receptive of an hermetically sealed lid. The neck is formed with an internal chamferred seating shoulder for fluid-tight engagement with a fill tube. One outer flange cooperates with clamping jaws of the aseptic filling apparatus for detachably sealing the fitment to a sterilizing chamber and placing it in position for insertion of the filling tube which ruptures the membrane and permits the aseptic introduction of product to the container's interior. The other outer flange is secured to an opening in a wall of the flexible container. The joined fitment and container are presterilized prior to filling. Selected materials for the multi-ply container walls and the fitment permit the container to withstand gamma ray and other sterilization treatment, heat and pressure while maintaining required strength. After the container is aseptically filled, such as with flowable food product, the fill tube is withdrawn and a lid is hermetically sealed onto the rim of the fitment. A heat shield adjacent a container wall surrounds the fitment to protect the container from excessive heat generated by the associated filling apparatus during filling.

  16. [Segmental sternal dislocation in children. Apropos of a surgically treated case].

    PubMed

    Norotte, G; Peres, E; Vanderweyen, A; Razafindralasitra, P

    1997-01-01

    The authors report one operated case of traumatic sternal segmental dislocation in a child, and propose a mechanism for this uncommon lesion. A fourteen year old boy was admitted in emergency for anterior chest pain, occurring during an exercise in parallel bars without any fall. X ray showed traumatic dislocation of the upper sternal segment. After 12 hours, because of bad clinical tolerance (pain, dyspnea with sweats and disphagia) reduction and plate stabilization (Senegas plate) was performed with immediate pain relief. The boy returned to school after 10 days. Plate was removed two months later after healing, with good clinical and radiological results. According to rare published cases, conservative treatment can be proposed in very young children because of dislocation remodeling. By others, in case of bad tolerance, surgical treatment is suggested despite the inconvenient of device's removal. The originality of this case is the indirect lesion mechanism. Hypothesis is given by authors. Treatment by plate is easy and gives immediate pain relief with good clinical and radiological results in teen-agers.

  17. Sternal Gland Scent-Marking Signals Sex, Age, Rank, and Group Identity in Captive Mandrills.

    PubMed

    Vaglio, Stefano; Minicozzi, Pamela; Romoli, Riccardo; Boscaro, Francesca; Pieraccini, Giuseppe; Moneti, Gloriano; Moggi-Cecchi, Jacopo

    2016-02-01

    Mandrills are one of the few Old World primates to show scent-marking. We combined ethological and chemical approaches to improve our understanding of this behavior in 3 zoo-managed groups. We observed the olfactory behavior performed by adults and adolescents (N = 39) for 775h. We investigated the volatile components of sternal scent-marks using gas chromatography-mass spectrometry and compared volatile profiles with traits of the signaler. Males marked more than females and within each sex the frequency of scent-marking was related to age and dominance status, but alpha males scent-marked most frequently and particularly in specific areas at the enclosure boundaries. We identified a total of 77 volatile components of sternal gland secretion, including compounds functioning as male sex pheromones in other mammals, in scent-marks spontaneously released on filter paper by 27 male and 18 female mandrills. We confirmed our previous findings that chemical profiles contain information including sex, male age and rank, and we also found that odor may encode information about group membership in mandrills. Our results support the hypotheses that scent-marking signals the status of the dominant male as well as playing territorial functions but also suggest that it is part of sociosexual communication.

  18. Is skin closure with cyanoacrylate glue effective for the prevention of sternal wound infections?

    PubMed

    Chambers, Anthony; Scarci, Marco

    2010-05-01

    A best evidence topic in cardiac surgery was written according to a structured protocol. The question addressed whether cyanoacrylate glue was effective at preventing wound infection following sternotomy incision. Altogether more than 108 papers were found using the reported search, of which seven represented the best evidence to answer the clinical question. The authors, journal, date and country of publication, patient group studied, study type, relevant outcomes and results of these papers are tabulated. We conclude that applying cyanoacrylate glue to a sternal wound has superior outcomes in terms of infection rates, both if applied preoperatively (decreasing from 10.8% to 2.7% or 7.8% to 1.1%, according to two studies) and postoperatively (4.9%-2.1%). This trend is true of both deep surgical site infections (0.6%-0%) and superficial site infections (4.3%-2.1%). Furthermore, in patients who had developed mediastinitis following cardiac surgery rates of recurrent sternal detachment and osteomyelitis were significantly reduced in cases where sealant was applied compared to controls (35.3% vs. 0%). In all studies examining hospital stay, duration was reduced in cases where cyanoacrylate glue was used, both in patients treated for recurrent mediastinitis (24.06 vs. 14.16 days) and those with uncomplicated recovery following cardiac surgery (13 vs. 9 days). In addition, two studies examining the use of cyanoacrylate glue to secure the sternum in complicated cases of recurrent detachment report success rates of 86% and 100%.

  19. Hyperbaric oxygen therapy as additional treatment in deep sternal wound infections – a single center's experience

    PubMed Central

    Bryndza, Magdalena; Chrapusta, Anna; Kobielska, Ewa; Kapelak, Bogusław; Grudzień, Grzegorz

    2016-01-01

    Introduction Deep sternal wound infection (DSWI) is one of the most serious complications after cardiac surgery procedures, observed in 5% of patients. Current standard medical therapy for DSWI includes antibiotics, surgical debridement, resuturing or negative pressure wound therapy (NPWT). Unfortunately, in some cases these methods are insufficient, and additional therapeutic options are needed. Aim To assess the effects and usefulness of additional hyperbaric oxygen therapy (HBO2) in patients with DSWI after cardiac surgery procedures. Material and methods A retrospective analysis of 10 patients after cardiac surgery who developed DSWI in the period 2010–2012 was performed. After 3 months of ineffective conventional therapy including targeted antibiotic, surgical sternal debridement and NPWT, patients were qualified for additional HBO2 therapy. A total of 20 sessions of HBO2 therapy were performed, each 92 minutes long. Results After 4 weeks of HBO2 treatment, 7 patients presented complete wound healing with fibrous scar formation. One patient was qualified for the another cycle of HBO2 therapy with 20 additional sessions, and complete wound healing was observed. In 2 cases, after 5 and 19 sessions, HBO2 was interrupted because of improper qualifications. Conclusions The HBO2 as an additional therapy in DSWI was successful in 80% of cases, and no complications were observed. However, due to the small number of published studies with a small number of patients, randomized, clinical trials are needed to assess the clinical results of HBO2 in DSWI after cardiac surgery procedures. PMID:27785131

  20. Femoral cement within cement technique in carefully selected aseptic revision arthroplasties.

    PubMed

    Marcos, Lucas; Buttaro, Martin; Comba, Fernando; Piccaluga, Francisco

    2009-06-01

    The aim of this study was to evaluate the clinical and radiological results in a group of patients who underwent aseptic revision hip arthroplasty using the cement within cement (CWC) technique. Between 1999 and 2005, 37 aseptic revision hip operations were performed. There were 30 women and five men, with an average age of 68 years. The reasons for revision were femoral stem fracture, cup failure, acetabular protrusion after hemi-arthroplasty and recurrent dislocation. At an average follow-up of 46 months, none of the patients required further femoral revision. The average post-operative Merle D'Aubigne score was 16.6 points (p<0.05). No evidence of radiological stem failure was observed and no femoral component was considered to be at risk for loosening. In this series of patients, the CWC technique provided consistent with high functional outcomes. This valid and effective alternative should be considered in carefully selected aseptic cases.

  1. [The indicators of immunity in patients with aseptic instability of knee joint].

    PubMed

    Chepeleva, M V; Chegurov, O K; Kuznetsova, E I; Shved, N S

    2014-08-01

    The examination was applied to sampling of 17 patients with stable implants after 18-36 months after endoprosthesis replacement of knee joint and to sampling of 17 patients with developed within this time-frame aseptic instability of endoprosthesis within the same time-frame. The typing of lymphocytes of peripheral blood was implemented using laser flow cytometry. The detection of immunoglobulins, cytokines, circulating immune complexes was made applying the technique of enzymoimmunoassay. In case of development of aseptic instability the signs testifying moderate activation of immune system and starting dysfunction of monocyte macrophage component of immune system. At that, IL-6, TNFα, CD14+HLA-DR provided the most complete information on the side of diagnostic of developing aseptic instability of joint.

  2. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis.

    PubMed

    Godec, Matjaz; Kocijan, Aleksandra; Dolinar, Drago; Mandrino, Djordje; Jenko, Monika; Antolic, Vane

    2010-08-01

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  3. Aseptic meningitis outbreak associated with echovirus 9 among recreational vehicle campers--Connecticut, 2003.

    PubMed

    2004-08-13

    Aseptic meningitis is an inflammation of the tissues covering the brain and spinal cord and caused by a virus, most frequently an enterovirus. In August 2003, the Connecticut Department of Public Health (CDPH) received a report of three viral meningitis cases among recreational vehicle (RV) campers staying at a campground in northeastern Connecticut. CDPH, assisted by CDC, conducted an investigation, which 1) identified a total of 12 cases of aseptic meningitis and 24 cases of enterovirus-like illness among 201 campers interviewed, 2) demonstrated how transmission of enterovirus from persons with mild illness contributed to the aseptic meningitis outbreak, and 3) determined that crowded conditions inside RVs and in the campground swimming pool likely facilitated spread of enterovirus. Pool operators should check chlorine and pH levels frequently, particularly during peak pool occupancy; adults should take precautions against passing enterovirus to children, who are at greater risk for severe illness.

  4. How dose sparing of cardiac structures correlates with in-field heart volume and sternal displacement.

    PubMed

    Kim, Taeho; Reardon, Kelli; Trifiletti, Daniel M; Geesey, Constance; Sukovich, Kaitlyn; Crandley, Edwin; Read, Paul W; Wijesooriya, Krishni

    2016-11-01

    Cardiac irradiation increases the risk of coronary artery disease in patients with left-sided breast cancer. Techniques exist to reduce cardiac irradiation, but the optimum technique depends on individual patient anatomy and physiology. We investigated the correlation of delta heart volume in field (dHVIF) and sternal excursion with dose sparing in heart and left anterior descending artery (LAD) to develop quantitative predictive models for expected dose to heart and LAD. A treatment planning study was performed on 97 left-breast cancer patients who underwent whole breast radiotherapy (prescription dose = 50 Gy) under deep inspiratory breath hold (DIBH). Two CT datasets, free breathing (FB) and DIBH, were utilized for treatment planning and for determination of the internal anatomy-based DIBH amplitude. The mean heart and LAD dose were compared between FB and DIBH plans and dose to the heart and LAD as a function of dHVIF and sternal excursion were determined. The [Average (STD); Range] mean heart doses from free breathing and DIBH are [ 120.5(65.2); 28.9 ~ 393.8 ] cGy and [ 67.5(25.1); 19.7 ~ 145.6 ] cGy, respectively. The mean LAD doses from free breathing and DIBH are [ 571.0(582.2); 42.2 ~ 2332.2 ] cGy and [ 185.9(127.0); 41.2 ~ 898.4 ] cGy, respectively. The mean dose reductions with DIBH are [ 53.1(50.6); -15.4 ~ 295.1 ] cGy for the heart and [ 385.1(513.4); -0.6 ~ 2105.8 ] cGy for LAD. Percent mean dose reductions to the heart and LAD with DIBH are 44% (p < 0.0001) and 67% (p < 0.0001), respectively, compared to FB. The dHVIF mean dose reduction correlation is 8.1 cGy/cc for the heart and 81.6 cGy/cc for LAD (with linear trend and y intercept: 26.0 cGy for the heart, 109.1 cGy for LAD). DIBH amplitude using sternal position was [ 1.3(4.8); .38 ~2.5 ] cm. The DIBH amplitude mean dose reduction correlation is 14 cGy/cm for the heart and 212 cGy/cm for LAD (with linear trend with y

  5. How dose sparing of cardiac structures correlates with in-field heart volume and sternal displacement.

    PubMed

    Kim, Taeho; Reardon, Kelli; Trifiletti, Daniel M; Geesey, Constance; Sukovich, Kaitlyn; Crandley, Edwin; Read, Paul W; Wijesooriya, Krishni

    2016-11-08

    Cardiac irradiation increases the risk of coronary artery disease in patients with left-sided breast cancer. Techniques exist to reduce cardiac irradiation, but the optimum technique depends on individual patient anatomy and physiology. We investigated the correlation of delta heart volume in field (dHVIF) and sternal excursion with dose sparing in heart and left anterior descending artery (LAD) to develop quantitative predictive models for expected dose to heart and LAD. A treatment planning study was performed on 97 left-breast cancer patients who underwent whole breast radiotherapy (prescription dose = 50 Gy) under deep inspiratory breath hold (DIBH). Two CT datasets, free breathing (FB) and DIBH, were utilized for treatment planning and for determination of the internal anatomy-based DIBH amplitude. The mean heart and LAD dose were compared between FB and DIBH plans and dose to the heart and LAD as a function of dHVIF and sternal excursion were determined. The [Average (STD); Range] mean heart doses from free breathing and DIBH are [120.5(65.2); 28.9 ~ 393.8] cGy and [67.5(25.1); 19.7 ~ 145.6] cGy, respectively. The mean LAD doses from free breathing and DIBH are [571.0(582.2); 42.2 ~ 2332.2] cGy and [185.9(127.0); 41.2 ~ 898.4] cGy, respectively. The mean dose reductions with DIBH are [53.1(50.6); -15.4 ~ 295.1] cGy for the heart and [385.1(513.4); -0.6 ~ 2105.8] cGy for LAD. Percent mean dose reductions to the heart and LAD with DIBH are 44% (p < 0.0001) and 67% (p < 0.0001), respectively, compared to FB. The dHVIF mean dose reduction correlation is 8.1 cGy/cc for the heart and 81.6 cGy/cc for LAD (with linear trend and y intercept: 26.0 cGy for the heart, 109.1 cGy for LAD). DIBH amplitude using sternal position was [1.3(.48); .38 ~ 2.5] cm. The DIBH amplitude mean dose reduction correlation is 14 cGy/cm for the heart and 212cGy/cm for LAD (with linear trend with y intercept: 35.6 cGy for the heart, 102.4 cGy for LAD). The strong correlation of dose

  6. Quality comparison of continuous steam sterilization segmented-flow aseptic processing versus conventional canning of whole and sliced mushrooms.

    PubMed

    Anderson, N M; Walker, P N

    2011-08-01

    This study was carried out to investigate segmented-flow aseptic processing of particle foods. A pilot-scale continuous steam sterilization unit capable of producing shelf stable aseptically processed whole and sliced mushrooms was developed. The system utilized pressurized steam as the heating medium to achieve high temperature-short time processing conditions with high and uniform heat transfer that will enable static temperature penetration studies for process development. Segmented-flow technology produced a narrower residence time distribution than pipe-flow aseptic processing; thus, whole and sliced mushrooms were processed only as long as needed to achieve the target F₀  = 7.0 min and were not overcooked. Continuous steam sterilization segmented-flow aseptic processing produced shelf stable aseptically processed mushrooms of superior quality to conventionally canned mushrooms. When compared to conventionally canned mushrooms, aseptically processed yield (weight basis) increased 6.1% (SD = 2.9%) and 6.6% (SD = 2.2%), whiteness (L) improved 3.1% (SD = 1.9%) and 4.7% (SD = 0.7%), color difference (ΔE) improved 6.0% (SD = 1.3%) and 8.5% (SD = 1.5%), and texture improved 3.9% (SD = 1.7%) and 4.6% (SD = 4.2%), for whole and sliced mushrooms, respectively. Segmented-flow aseptic processing eliminated a separate blanching step, eliminated the unnecessary packaging of water and promoted the use of bag-in-box and other versatile aseptic packaging methods. Segmented-flow aseptic processing is capable of producing shelf stable aseptically processed particle foods of superior quality to a conventionally canned product. This unique continuous steam sterilization process eliminates the need for a separate blanching step, reduces or eliminates the need for a liquid carrier, and promotes the use of bag-in-box and other versatile aseptic packaging methods. © 2011 Institute of Food Technologists®

  7. A novel tantalum-containing bioglass. Part II. Development of a bioadhesive for sternal fixation and repair.

    PubMed

    Alhalawani, Adel Mf; Mehrvar, Cina; Stone, Wendy; Waldman, Stephen D; Towler, Mark R

    2017-02-01

    With over a million median sternotomy surgeries performed worldwide every year, sternal wound complications have posed a serious risk to the affected patients. A rigid therapeutic sternal fixation device has therefore become a necessity. In this work, the incorporation of up to 0.5mol% of tantalum pentoxide (Ta2O5), in exchange for zinc oxide (ZnO), into the SiO2-ZnO-CaO-SrO-P2O5 glass system is presented. The effect of Ta incorporation on the physical, chemical and biological properties of the glass polyalkenoate cements (GPCs) prepared from them have been presented in this manuscript. The data obtained have confirmed that Ta2O5 incorporation into the reference glass system results in increased working times, radiopacity, ion solubility, and long-term mechanical stability. The formulated glass systems have also shown clear antibacterial and antifungal activity against both Gram-negative (Escherichia coli) and Gram-positive prokaryotes (Staphylococcus aureus and Streptococcus epidermidis), as well as eukaryotes (Fusarium solani). Cytotoxicity testing showed that Ta incorporation results in no toxicity effect and may simulate osseo-integration when tested in animal models. These new metallic-containing biomaterial adhesives have been developed for sternal fixation and repair. As a permanent implant, the formulated adhesives can be used in conjunction with sternal cable ties to offer optimal fixation for patients and reduce post-operative complications such as bacterial infection and pain from micro-motion.

  8. Chest reconstruction using a custom-designed polyethylene 3D implant after resection of the sternal manubrium.

    PubMed

    Lipińska, Joanna; Kutwin, Leszek; Wawrzycki, Marcin; Olbrzymek, Leszek; Jabłoński, Sławomir

    2017-01-01

    Resection of manubrium or body of the sternum is associated with a necessity of chest wall reconstruction. Large sternal defects require the use of different types of implants to ensure acceptable esthetic effect for the patient and chest stabilization. The purpose of this case report is to present a novel method of reconstruction of manubrium removed due to renal cancer metastasis to the sternum. We present the case of a patient, who had underwent right nephrectomy for clear cell kidney cancer, diagnosed with a metastatic tumor in the sternum resulting in destruction of manubrium. The patient undergone tumor resection with primary reconstruction with an individual prosthesis. Sternal defect was filled with a personalized, computed tomography scan-based 3D-milled implant made of polyethylene. Sternal reconstruction was uneventful. The patient endured surgery well, and has been under surveillance in outpatient clinic, without any respiration disorders, implant movement or local recurrence. Custom-designed sternal implants created by 3D technique constitute an interesting alternative for previous methods of filling defects after resection of a tumor in this location.

  9. Prospective, randomized, single blinded pilot study of a new FlatWire based sternal closure system

    PubMed Central

    2014-01-01

    Background Unstable steel wire cerclage following open heart surgery may result in increased pain, sternal cut-through, non-union, or dehiscence. These complications lead to longer hospital stays, increased cost, higher morbidity, and patient dissatisfaction. The Figure 8 FlatWire Sternal Closure System is a new construct which is a simple, intuitive, and inexpensive alternative for primary sternal repair following open heart surgery. Prior bench-top testing of FlatWire has demonstrated superior strength and stiffness compared to traditional steel wire. We present our initial experience in a prospective, randomized, single blinded pilot study utilizing this FDA approved system. Methods Sixty-three patients undergoing elective complete sternotomies at a single institution were randomly assigned to receive either the Figure 8 FlatWire or standard steel wire cerclage. All surgeries were performed by a single board certified cardiothoracic surgeon. Data collected included: Age, BMI, pump time, off pump to surgical stop time, length of hospital stay after surgery, cost from time of surgery to discharge, and pain on a visual analog pain scale on the day of discharge, day 30, and day 60. Results The groups were well matched. Patients receiving the Figure 8 FlatWire (33) had a reduction in length of stay compared to patients receiving steel wire circlage (30), but it was not statistically significant (6.8 vs. 7.8 days respectively, p < 0.093). Additionally those with the FlatWire reported significantly decreased pain at day of discharge (3.07 vs. 4.92 points on pain scale, p < 0.0066), with similar pain scores at 30 and 60 days. Off pump to surgery stop time was increased by 15.9 minutes in patients receiving the FlatWire vs. steel wires (55.7 vs. 71.6 minutes, p = 0.00025). Mean cost from surgery until discharge was $87,820.98 in the FlatWire group vs. $91,930.29 in the steel wire group (p < 0.3082). Conclusion Early clinical results suggest that

  10. Chicken sternal cartilage for simulated septal cartilage graft carving: a rhinoplasty educational model.

    PubMed

    Weinfeld, Adam Bryce

    2010-01-01

    In rhinoplasty, cartilage is often harvested from the nasal septum and meticulously carved into delicate grafts designed to reshape and strengthen the nasal osteocartilaginous framework. Proficiency at this task develops with experience in the clinical setting. The author offers a simulated educational model designed to provide rhinoplasty surgeons with increased preclinical experience in cartilage graft carving. This model relies on inexpensive, food-grade chickens, which may be purchased at any grocery store. Four whole chickens were dissected to expose and harvest the sternal (breast/keel) cartilage. A technique was developed for preparing the cartilage to approximate the shape and dimensions of human septal cartilage. Measurements were made to demonstrate similarities between the model material and the human septum. The average weight of the chickens was 4.27 lb. The average cartilage height, length, and thickness were 2.36 cm, 6.13 cm, and 3.4 mm, respectively. This size compared favorably with typical septal harvest pieces, which had both heights and lengths of 2.5 cm and thicknesses of 3.25 mm. The author found that one sternal cartilage piece could be employed to carve two spreader grafts, a columellar strut graft, a tip graft, and two alar rim cartilage grafts. The performance of the avian cartilage was subjectively very similar to that of septal cartilage. Furthermore, two pieces of the sternal cartilage could be glued together and fastened within a model of a human skull to replicate the cartilaginous septum in situ. This construct was employed for demonstrations of actual septal cartilage harvest. Carving septal cartilage into grafts is a difficult process. Precision and improved results increase with clinical experience on human patients, but this cadaveric avian (chicken) model provides an opportunity for simulated surgical training on a very similar tissue type at a very low cost. This model has the potential to improve human outcomes by providing

  11. Hepatitis C virus transmission in hemodialysis units: importance of infection control practices and aseptic technique.

    PubMed

    Thompson, Nicola D; Novak, Ryan T; Datta, Deblina; Cotter, Susanne; Arduino, Matthew J; Patel, Priti R; Williams, Ian T; Bialek, Stephanie R

    2009-09-01

    We investigated 4 hepatitis C virus (HCV) infection outbreaks at hemodialysis units to identify practices associated with transmission. Apparent failures to follow recommended infection control precautions resulted in patient-to-patient HCV transmission, through cross-contamination of the environment or intravenous medication vials. Fastidious attention to aseptic technique and infection control precautions are essential to prevent HCV transmission.

  12. Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.

    PubMed

    Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W

    1996-01-01

    A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis.

  13. A low cost multi-level sampling device for synchronous aseptic collection of environmental water samples.

    PubMed

    McCormick, Michael L; Banishki, Nikola; Powell, Sarah; Rumack, Amy; Garrett, Jinnie M

    2014-10-01

    We describe a simple device for the aseptic collection of environmental water samples at high spatial resolution to depths of 50m. To demonstrate the utility of this technique we present geochemical and archaeal community data from samples collected throughout the water column of a stratified lake.

  14. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... HUMAN SERVICES Food and Drug Administration Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration,...

  15. Expression of tenascin-C in aseptic loosening of total hip replacement

    PubMed Central

    Konttinen, Y.; Li, T.; Michelsson, O.; Xu, J.; Sorsa, T.; Santavirta, S.; Imai, S.; Virtanen, I.

    1998-01-01

    OBJECTIVE—To assess if the bonding interlayer between the implant and bone in aseptic loosening of total hip replacement (THR) is qualitatively deteriorated by excessive accumulation of anti-adhesive glycoprotein, tenascin-C.
METHODS—Alkaline phosphatase-anti-alkaline phosphatase (APAAP) method was used for immunohistochemical staining of tenascin-C in interface tissue and control synovial tissue.
RESULTS—Tenascin-C was found to be a major component of the extracellular matrix at a hitherto unrecognised site, namely the synovial membrane-like interface tissue between implant and bone in aseptic loosening of THR. The overall tenascin-C staining (median score 4.0) was greatly increased in aseptic loosening compared with synovial membrane (median score 2.0; p<0.001) and fibrous capsule (median score 2.0; p<0.001) from primary THR operations. Topological analysis disclosed that tenascin-C was also found at the critical implant-interface and interface-bone surfaces.
CONCLUSION—Local tenascin-C expression is increased as a result of a chronic foreign body type reaction associated with excessive cytokine production and tissue injury mediated by microtrauma and neutral endoproteinases. This qualitative and topological deterioration of the bonding interlayer by an increase of anti-adhesive tenascin-C expression may inadvertantly contribute to loosening.

 Keywords: tenascin; aseptic loosening; total hip replacement PMID:9893574

  16. Continuous flow microwave-assisted processing and aseptic packaging of purple-fleshed sweetpotato purees

    USDA-ARS?s Scientific Manuscript database

    Pumpable purees from purple-flesh sweetpotatoes (PFSP) were subjected to microwave heating using a 915 MHz continuous flow system, followed by aseptic packaging in flexible containers to obtain a shelf-stable product. Initial test runs were conducted using a 5 kW microwave unit to measure dielectr...

  17. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068645 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  18. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068640 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  19. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068638 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  20. Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)

    NASA Astrophysics Data System (ADS)

    Ghiron, Kenneth; Litchfield, Bruce

    1997-04-01

    Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.

  1. The history of the management of sternal osteomyelitis and mediastinitis - from Hippocrates until today.

    PubMed

    Ennker, Ina Carolin; Ennker, Jürgen C

    2014-01-01

    Even during the time of Hippocrates, Galen and their colleagues recognized mediastinal affections. However, they were not considered with the surgical treatment. First progress in the treatment options of this severe disease, still denoted as 'terra incognita', over to today's gold standard are pictured. The mediastinitis-registry which was founded by the German Society for Thoracic and Cardiovascular Surgery (DGTHG) in 2011 and the recent establishment of the study group to adopt a guideline 'diagnosis and therapy of postoperative mediastinitis/sternal osteomyelitis following cardiac surgery' are attempts to a standardization of the treatment. Substantial advancement in the treatment of postoperative mediastinitis could be achieved in the past. The mortality dropped as low as less than 10%. With these implementations more benefit for the patients' outcome can be expected.

  2. The history of the management of sternal osteomyelitis and mediastinitis – from Hippocrates until today

    PubMed Central

    Ennker, Ina Carolin; Ennker, Jürgen C.

    2014-01-01

    Even during the time of Hippocrates, Galen and their colleagues recognized mediastinal affections. However, they were not considered with the surgical treatment. First progress in the treatment options of this severe disease, still denoted as ‘terra incognita’, over to today’s gold standard are pictured. The mediastinitis-registry which was founded by the German Society for Thoracic and Cardiovascular Surgery (DGTHG) in 2011 and the recent establishment of the study group to adopt a guideline ‘diagnosis and therapy of postoperative mediastinitis/sternal osteomyelitis following cardiac surgery’ are attempts to a standardization of the treatment. Substantial advancement in the treatment of postoperative mediastinitis could be achieved in the past. The mortality dropped as low as less than 10%. With these implementations more benefit for the patients’ outcome can be expected. PMID:26504718

  3. Estimating age at death using the sternal end of the fourth ribs from Mexican males.

    PubMed

    Cerezo-Román, Jessica Inés; Hernández Espinoza, Patricia Olga

    2014-03-01

    The indicators proposed by İşcan et al. (1984) are said to reflect age changes that occur in the sternal end of the fourth rib. These indicators have been used to estimate age-at-death in adult skeletal samples. However, Isçan et al. developed their methods using a forensic sample from Florida (U.S.A.). In order to test the reproducibility of those methods we evaluate its accuracy for the fourth ribs by applying it to a sample of known age and sex but of different biological affinity: modern males from Mexico City. We found that the method developed by İşcan et al. underestimates age-at-death in the Mexican sample.

  4. [Cardiac tamponade following sternal puncture. Usefulness of ultrasound focussed assessment with sonography for trauma].

    PubMed

    Magaldi, M; Hervías, A; Perelló, L; Fontanals, J

    2014-03-01

    One of the aims of the medical profession is to be able to detect complications in patients during diagnostic tests and treatments. The early diagnosis of these complications can prevent a fatal outcome. The diagnosis is often based on clinical symptoms and supported by complementary tests. Diagnostic tests have been developed in the last few years that are rapid and easy to use, as well as being cost effective and minimally invasive. Focussed assessment with sonography for trauma ultrasound (echo-FAST) was introduced in the 1990s in the field of resuscitation as a test for the rapid detection of intra-abdominal and pericardial fluid in multiple injury patients, but its uses in other cases not involving trauma still raise doubts and controversy. A case is presented of a patient subjected to a sternal puncture for a bone marrow aspirate, who had a complication of a secondary cardiac tamponade, which was diagnosed early using echo-FAST.

  5. Nuss procedure in adult pectus excavatum: a simple artifice to reduce sternal tension.

    PubMed

    Ravenni, Giacomo; Actis Dato, Guglielmo Mario; Zingarelli, Edoardo; Flocco, Roberto; Casabona, Riccardo

    2013-07-01

    Nowadays the Nuss operation represents the standard surgical choice for pectus excavatum repair in children and teenagers. Some concerns have been raised regarding its applicability in adults, as compared with younger patients, in view of the higher rate of complications after surgery. We describe an easy trick that has been performed on a 36-year old man with a moderate pectus excavatum after an unsatisfactory Nuss procedure. It consisted of a T-shaped partial anterior sternotomy, performed after positioning of the stainless steel bar, in order to promote a hinge mechanism of the sternum to reduce the tension over the reinforcement. This procedure was successful with well-controlled postoperative pain and great patient satisfaction. No complications were recorded at 1-year follow-up. In our opinion, this simple trick could represent a valid surgical option for pectus excavatum repair in late adolescents and adults to obviate the occurrence of major sternal tension.

  6. Double-wire sternal closure technique in bovine animal models for total artificial heart implant.

    PubMed

    Karimov, Jamshid H; Sunagawa, Gengo; Golding, Leonard A R; Moazami, Nader; Fukamachi, Kiyotaka

    2015-08-01

    In vivo preclinical testing of mechanical circulatory devices requires large animal models that provide reliable physiological and hemodynamic conditions by which to test the device and investigate design and development strategies. Large bovine species are commonly used for mechanical circulatory support device research. The animals used for chronic in vivo support require high-quality care and excellent surgical techniques as well as advanced methods of postoperative care. These techniques are constantly being updated and new methods are emerging.We report results of our double steel-wire closure technique in large bovine models used for Cleveland Clinic's continuous-flow total artificial heart development program. This is the first report of double-wire sternal fixation used in large bovine models.

  7. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products.

  8. Relationship between GNAS1 T393C polymorphism and aseptic loosening after total hip arthroplasty.

    PubMed

    Stelmach, Patrick; Kauther, Max D; Fuest, Lena; Kurscheid, Gina; Gehrke, Thorsten; Klenke, Stefanie; Jäger, Marcus; Wedemeyer, Christian; Bachmann, Hagen S

    2017-08-23

    Aseptic loosening is a main cause for revision surgery after total hip arthroplasty (THA) and there is no reliable marker for the early detection of patients at high risk. This study has been performed to validate association of the T393C polymorphism (rs7121) in the GNAS1 gene, encoding for the alpha-subunit of heterotrimeric G-protein Gs, with risk for and time to aseptic loosening after THA, which has been demonstrated in our previous study. 231 patients with primary THA and 234 patients suffering from aseptic loosening were genotyped for dependency on GNAS1 genotypes and analyzed. Genotyping revealed almost similar minor allele frequencies of 0.49 and 0.46, respectively. Consistently, genotype distributions of both groups were not significantly different (p = 0.572). Neither gender nor GNAS1 genotype showed a statistically significant association with time to loosening (p = 0.501 and p = 0.840). Stratification by gender, as performed in our previous study, was not able to show a significant genotype-dependent difference in time (female p = 0.313; male p = 0.584) as well as median time to aseptic loosening (female p = 0.353; male p = 0.868). This study was not able to confirm the results of our preliminary study. An association of the GNAS1 T393C polymorphisms with risk for and time to aseptic loosening after THA is unlikely.

  9. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  10. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses.

    PubMed

    Yang, Fei; Wu, Wen; Cao, Lei; Huang, Yan; Zhu, Zhenan; Tang, Tingting; Dai, Kerong

    2011-12-01

    Aseptic loosening is a major cause of failure of total hip arthroplasty (THA). Macrophage apoptosis in interface membrane has been proved to play an important role in the pathogenesis of aseptic loosening. The purpose of current study was to identify the apoptotic mechanism of macrophages in the interface membrane of aseptic loosening. We collected periprosthetic interface membrane from 23 patients undergoing the revision operations for aseptic loosening of hip joint prostheses. To serve as the control group, samples of capsule were collected from 18 patients undergoing the primary hip arthroplasties for osteoarthritis (OA). The ultrastructure of interface membrane was examined by transmission electron microscopy (TEM), and in situ apoptotic macrophage identification was performed by TUNEL staining. Furthermore, using immunohistochemical methods we investigated the expression of some apoptosis-related markers such as inducible nitric oxide synthase (iNOS), peroxynitrite (ONOO(-)), cleaved caspase-3/4/8/9, cytochrome c, glucose regulated protein 78 (GRP78), and growth arrest and DNA damage-inducible gene 153 (GADD153) in macrophages. These markers were regarded as apoptotic inducers or specific indicators of different apoptotic pathways such as death receptor pathway, mitochondrial pathway and endoplasmic reticulum (ER) stress pathway. TEM showed that a great deal of wear debris was phagocytosed by macrophages, which displayed morphological changes characteristic of apoptosis. The results of TUNEL staining demonstrated that there were more apoptotic macrophages in interface membrane. The expression levels of iNOS, ONOO(-), cleaved caspase-3/4/8/9, cytochrome c, GRP78 and GADD153 in macrophages in interface membrane were significantly higher than those in the control samples (p < 0.05). Our results suggest that death receptor pathway, mitochondria/cytochrosome c caspase-dependent pathway and ER stress pathway are involved in the process of macrophage apoptosis. A

  11. Negative-pressure wound therapy and laparoscopic omentoplasty for deep sternal wound infections after median sternotomy.

    PubMed

    De Brabandere, Kristof; Jacobs-Tulleneers-Thevissen, Daniel; Czapla, Jens; La Meir, Mark; Delvaux, Georges; Wellens, Francis

    2012-01-01

    Deep sternal wound infection remains one of the most serious complications in patients who undergo median sternotomy for coronary artery bypass surgery.We describe our experience in treating 6 consecutive patients with our treatment protocol that combines aggressive débridement, broad-spectrum antibiotics, negative-pressure wound therapy, omentoplasty with laparoscopically harvested omentum, and the use of bilateral pectoral muscle advancement flaps.The number of débridements needed in order to attain clinically clean wounds and negative cultures varied between 1 and 10, with a median of 5. The length of stay after omentoplasty and bilateral pectoral muscle advancement flap placement varied between 11 and 22 days. One of the 6 patients developed a small wound dehiscence that was treated conservatively. No bleeding related to vacuum-assisted closure therapy was identified. Three patients had pneumonia. Two of the 3 patients had an episode of acute renal failure. The 30-day mortality rate was zero, although 1 patient died in the hospital 43 days after the reconstructive surgery, of multiple-organ failure due to pneumonia that was induced by end-stage pulmonary fibrosis. No patient died between hospital discharge and the most recent follow-up date (4-12 mo). Late local follow-up results, both functional and aesthetic, were good.We conclude that negative-pressure wound therapy-in combination with omentoplasty using laparoscopically harvested omentum and with the use of bilateral pectoral advancement flaps-is a valuable technique in the treatment of deep sternal wound infection because it produces good functional and aesthetic results.

  12. Estimation of sex from sternal measurements in a Western Australian population.

    PubMed

    Franklin, Daniel; Flavel, Ambika; Kuliukas, Algis; Cardini, Andrea; Marks, Murray K; Oxnard, Charles; O'Higgins, Paul

    2012-04-10

    In Australia, particularly Western Australia, there is a relative paucity of contemporary population-specific morphometric standards for the estimation of sex from unknown skeletal remains. This is largely a historical artefact from lacking, or poorly documented, repositories of human skeletons available for study. However, medical scans, e.g. MSCT (multislice spiral computed tomography) are an ingenious and practical alternative source for contemporary data. To that end, this study is a comprehensive analysis of sternal sexual dimorphism in a sample of modern Western Australian (WA) individuals with a main purpose to develop a series of statistically robust standards for the estimation of sex. The sample comprises thoracic MSCT scans, with a mean of 0.9 millimeter (mm) slice thickness, on 187 non-pathological sterna. Following 3D volume rendering, 10 anatomical landmarks were acquired using OsiriX(®) (version 3.9) and a total of 8 inter landmark linear measurements were calculated using Morph Db (an in-house developed database application). Measurements were analyzed using basic descriptive statistics and discriminant function analyses, with statistical analyses performed using SPSS 19.0. All measurements are sexually dimorphic and sex differences explain 9.8-47.4% of sample variance. The combined length of the manubrium and body, sternal body length, manubrium width, and corpus sterni width at first sternebra contribute significantly to sex discrimination and yield the smallest sex-biases. Cross-validated classification accuracies, i.e., univariate, stepwise and direct function, are 72.2-84.5%, with a sex bias of less than 5%. We conclude that the sternum is a reliable element for sex estimation among Western Australians.

  13. Prevention of sternal dehiscence with the Sternum External Fixation (Stern-E-Fix) corset – a randomized trial in 750 patients

    PubMed Central

    2012-01-01

    Background The main objective of this study will be to determine the effects of a new advanced sternum external fixation (Stern-E-Fix) corset on prevention of sternal instability and mediastinitis in high-risk patients. Methods This prospective, randomized study (January 2009 – June 2011) comprised 750 male patients undergoing standard median sternotomy for cardiac procedures (78% CABG). Patients were divided in two randomized groups (A, n = 380: received a Stern-E-Fix corset postoperatively for 6 weeks and B, n = 370: control group received a standard elastic thorax bandage). In both groups, risk factors for sternal dehiscence and preoperative preparations were similar. Results Wound infections occurred in n = 13 (3.42%) pts. in group A vs. n = 35 (9.46%) in group B. In group A, only 1 patient presented with sternal dehiscence vs. 22 pts. in group B. In all 22 patients, sternal rewiring followed by antibiotic therapy was needed. Mediastinitis related mortality was none in A versus two in B. Treatment failure in group B was more than five times higher than in A (p = 0.01); the mean length of stay in hospital was 12.5 ± 7.4 days (A) versus 18 ± 15.1 days (B) (p=0.002). Re-operation for sternal infection was 4 times higher in group B. Mean ventilation time was relatively longer in B (2.5 vs. 1.28 days) (p = 0.01). The mean follow-up period was 8 weeks (range 6 – 12 weeks). Conclusions We demonstrated that using an external supportive sternal corset (Stern-E-Fix) yields a significantly better and effective prevention against development of sternal dehiscence and secondary sternal infection in high-risk poststernotomy patients. PMID:22958313

  14. SIRT1 protects osteoblasts against particle-induced inflammatory responses and apoptosis in aseptic prosthesis loosening.

    PubMed

    Deng, Zhantao; Wang, Zhenheng; Jin, Jiewen; Wang, Yong; Bao, Nirong; Gao, Qian; Zhao, Jianning

    2017-02-01

    We hypothesized that SIRT1 downregulation in osteoblasts induced by wear particles was one of the reasons for particle-induced osteolysis (PIO) in total joint arthroplasty failure. In the present study, the expression of SIRT1 was examined in osteoblasts treated with TiAl6V4 particles (TiPs) and CoCrMo particles (CoPs) from materials used in prosthetics and specimens from PIO animal models. To address whether SIRT1 downregulation triggers inflammatory responses and apoptosis in osteoblasts, the effect of a SIRT1 activator, resveratrol on the expression of inflammatory cytokines and apoptosis in particle-treated osteoblasts was tested. The results demonstrated that SIRT1 expression was significantly downregulated in particle-treated osteoblasts and PIO animal models. Both pharmacological activation and overexpression of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines and osteoblast apoptosis through NF-κB and p53 signaling, respectively. Furthermore, in PIO animal models, resveratrol significantly reduced the severity of osteolysis. Collectively, the results of the present study indicated that SIRT1 plays a vital role in the pathogenesis of aseptic loosening, and further treatment targeted at SIRT1 possibly lead to novel approaches for prevention of aseptic prosthesis loosening. Aseptic loosening is the most common cause of total hip arthroplasty (THA) and total knee arthroplasty (TKA) failure and revision surgery. However, there is still no effective therapeutic target in the clinical treatment. Besides, the underlying mechanism of aseptic loosening is largely unknown. The result of our study indicated that SIRT1 has the ability to effectively regulate the wear particle-induced inflammatory responses, apoptosis, osteolysis in particle-stimulated osteoblasts and particle-induced osteolysis animal models. Our study provides a potential target for the prevention and treatment of aseptic loosening and further investigated the

  15. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department.

    PubMed

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or

  16. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  17. Gentamicin-Impregnated Collagen Sponge: Effectiveness in Preventing Sternal Wound Infection in High-Risk Cardiac Surgery

    PubMed Central

    Rapetto, Filippo; Bruno, Vito D.; Guida, Gustavo; Marsico, Roberto; Chivasso, Pierpaolo; Zebele, Carlo

    2016-01-01

    Sternal wound infections represent one of the most frequent complications after cardiac surgery and are associated with high postoperative mortality. Several preventive methods have been introduced, and recently, gentamicin-impregnated collagen sponges (GICSs) have shown a promising effect in reducing the incidence of this type of complications. Gentamicin is an aminoglycoside antibiotic that has been widely used to treat infections caused by multiresistant bacteria; despite its effectiveness, its systemic use carries a risk of toxicity. GICSs appear to overcome this side effect, topically delivering high antibiotic concentrations to the wound and thus reducing the toxic-related events. Although several retrospective analyses and randomized controlled trials have studied the use of GICSs in cardiac surgery, conclusions regarding their efficacy in preventing sternal wound infection are inconsistent. We have reviewed the current literature focusing on high-risk patients. PMID:27279734

  18. [Reliability of the individual age assessment at the time of death based on sternal rib end morphology in Balkan population].

    PubMed

    Donić, Danijela; Durić, Marija; Babić, Dragan; Popović, Dorde

    2005-06-01

    This paper analyzes the reliability of the Iscan's sternal rib-ends phase method for the assessment of individual age at the time of death in the Balkan population. The method is based on the morphological age changes of the sternal rib ends. The tested samples consisted of 65 ribs from autopsy cases in the Institute for Forensic Medicine, University of Belgrade, during 1999-2002 (23 females, and 42 males of various ages, ranged from 17-91 years), according to the forensic documents. Significant differences between the real chronological age of the individuals and the values established by the Iscan's method was found, especially in the older categories (phases 6 and 7), in both males and females. The results of the discriminative analysis showed the values of the highest diagnostic relevance for the assessment of age in our population: the change of the depth of the articular fossa, the thickness of its walls, and the quality of the bones.

  19. Sternal resection for metastasis from thyroid carcinoma and reconstruction with the sandwiched Marlex and stainless steel mesh.

    PubMed

    Haraguchi, Shuji; Yamashita, Yasuo; Yamashita, Koji; Hioki, Masafumi; Matsumoto, Koshi; Shimizu, Kazuo

    2004-04-01

    A case of 69-year-old woman with a solitary sternal bone metastasis from thyroid carcinoma undergoing surgical therapy was reported here. On admission, most part of the body of the sternum was destroyed by tumor. Subtotal sternectomy was performed and a part of the major pectoral muscles adherent to the sternal tumor was also resected. The chest wall defect was reconstructed with a sandwiched Marlex and stainless steel mesh. Pathological examination of the resected specimen revealed metastatic papillary carcinoma of the thyroid. Her postoperative course was uneventful. The reconstruction with Marlex and stainless steel mesh seemed to be an appropriate procedure to prevent paradoxical movement of the thorax and protect the intrathoracic organs. Stainless steel mesh compensated for limited resiliency of Marlex mesh and remained rigid in all directions.

  20. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2014-10-29

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST. 2014 BMJ Publishing Group Ltd.

  1. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2015-12-01

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Recurrence of ibuprofen-induced aseptic meningitis in an otherwise healthy patient.

    PubMed

    Pisani, E; Fattorello, C; Leotta, M R; Marcello, O; Zuliani, C

    1999-02-01

    We report the case of a 74-year-old woman who had three episodes of aseptic meningitis in a period of 20 years. These episodes always occurred a few hours after the assumption of a non-steroidal anti-inflammatory drug (NSAID) per os. Nevertheless, the pharmacological anamnesis did not receive proper attention, neither the first nor the second time, and the meningeal syndrome with aseptic liquor was attributed to a viral aggression. However, when the third episode occurred, due to the strict time correlation between the assumption of the drug and the occurrence of symptoms, both the results of the liquoral analysis and the anamnestic records allowed recognition of ibuprofen as the cause of acute meningitis.

  3. A survey of rotational use of biocides in hospital pharmacy aseptic units.

    PubMed

    Murtough, S M; Hiom, S J; Palmer, M; Russell, A D

    2002-03-01

    A postal survey of biocide rotation in UK hospital pharmacy aseptic units was carried out. Seventy per cent of respondents stated that biocides were rotated, most frequently in areas outside critical work zones. High-level disinfection was employed when 'aseptic' conditions were required. Decisions on frequency of rotation were most often based on in-house validation or consultation with colleagues. Toxicity and corrosiveness were the criteria rated most important in a rotation policy. Microbiological monitoring was carried out most frequently in critical work zones but less often for handwashing. Most QC hospital pharmacists supported rotation and would prefer a standard period for all applications (monthly). Guidelines need to be clarified to assist staff in decisions regarding biocide rotation. Copyright 2002 The Hospital Infection Society.

  4. Aseptic abscess syndrome associated with traveler's diarrhea after a trip to Malaysia.

    PubMed

    Panos, Zois; Giannopoulos, George; Papangeli, Eymorfia; Antalis, Emmanouil; Pavli, Androula; Spathis, Aris; Poulakou, Garyfalia; Dimitriadis, George; Panayiotides, Ioannis; Boumpas, Dimitrios; Tsiodras, Sotirios

    2016-01-01

    The first, to our knowledge, case of the aseptic abscesses syndrome as a complication of traveler's diarrhea after a trip to Malaysia is presented. The patient failed to respond to several antimicrobials. The diagnosis was histologically confirmed and the patient only responded to immunomodulatory therapy with corticosteroids and methotrexate. Travel physicians should be aware of this entity reviewed herein in the context of traveler's diarrhea.

  5. The thin blue line: a review and discussion of aseptic technique and postprocedural infections in rodents.

    PubMed

    Cooper, D M; McIver, R; Bianco, R

    2000-11-01

    A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.

  6. Over-expression of p53/BAK in aseptic loosening after total hip replacement.

    PubMed

    Landgraeber, Stefan; Toetsch, Martin; Wedemeyer, Christian; Saxler, Guido; Tsokos, Michael; von Knoch, Fabian; Neuhäuser, Markus; Löer, Franz; von Knoch, Marius

    2006-05-01

    Particle-induced osteolysis is a major cause of aseptic loosening after total joint replacement. The possible induction of apoptosis has not been addressed in great detail. Thus far, it has been shown that ceramic and polyethylene particles can induce apoptosis of macrophages in vitro. The purpose of this study was to test the hypothesis that wears debris generated from total hip arthroplasty could induce cellular damage and apoptosis in vivo. We therefore determined by immunohistochemical methods if increased expression of p53, an important transcription factor, and BAK and Bcl-2, two important regulators of apoptosis, can be found in interface membranes and capsules of hips with aseptically loose implants. Strongly positive immunohistochemical staining for p53 and BAK was found in peri-implant tissues from patients with aseptic hip implant loosening. Differentiation of various cell types showed that macrophages stained positive for p53 in all capsule and interface specimens. p53 was frequently detected in giant cells. Positive staining of BAK in macrophages and giant cells was seen in all specimens. Some positive reactions were observed in fibroblasts, only two of 19 cases stained for p53 and three cases for BAK within synovial cells. Positive macrophages and giant cells were localized around polyethylene particles. While T-lymphocytes showed a regular BAK-staining, the other leukocytes were negative. Statistical analyses showed significant positive correlations (p < 0.001) between the presence of polyethylene and metal debris and the expression of BAK and p53. Polyethylene particles were surrounded by more positive macrophages and giant cells than were metal particles, indicating that polyethylene debris may be a stronger inductor of cell cycle arrest and apoptosis than metal debris. In this study apoptosis of macrophages, giant cells and T-lymphocytes in capsules and interface membranes of patients with aseptic hip implant loosening has been demonstrated in

  7. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  8. [Aseptic bone necroses as a late complication following successful treatment of leukemias and severe aplastic anemia].

    PubMed

    Slavc, I; Urban, C; Schwingshandl, J; Ritter, G; Trauner, R

    1987-01-01

    Aseptic bone necrosis is a well known complication after corticosteroid treatment in adults and several hundred cases have been reported. Alterations in fat metabolism with vascular occlusion due to fat embolization, as well as microtraumata and osteoporosis are discussed as etiologic factors. In contrast, aseptic bone necrosis in relation to corticosteroid treatment is rare in children and adolescents. We therefore report 3 patients, aged from 10 to 18 years, suffering from severe aplastic anemia, meningeal relapse after acute lymphocytic leukemia and acute myelocytic leukemia respectively, who developed aseptic bone necrosis 6, 11, and 20 months following the onset of corticoid therapy. The patients survive from 28+ to 50+ months after diagnosis of their initial hematologic disease, as it can be expected today for increasing numbers of patients. We therefore believe, that aseptic bone necrosis may represent a serious therapy related complication and suggest that, diagnostic examination in patients with suspicious complaints of the hip, shoulder or knee should also exclude the possibility of a bone necrosis after leucemic relapse has been ruled out. Since radiological changes only develop several weeks to months after the onset of the clinical symptoms and because of the disabling consequences for patients, misdiagnosed at the beginning, a 99 technetium bone scan should be done as early as possible. Corticosteroids, despite their serious side effects are still being considered as a important part of hematologic therapy and are not being omitted in the near future, so that the earliest possible diagnosis of bone necrosis will remain of great importance.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Behçet’s disease complicated by multiple aseptic abscesses of the liver and spleen

    PubMed Central

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-01-01

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn’s disease, and in other diseases. However, aseptic abscesses associated with Behçet’s disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet’s disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient’s response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet’s disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet’s disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet’s disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet’s disease. PMID:23717000

  10. Aseptic Handling of the MOMA Mass Spectrometer After Dry Heat Microbial Reduction

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2017-01-01

    Mars Organic Molecule Analyzer Mass Spectrometer (MOMA-MS) is an instrument in the larger MOMA instrument suite for the European Space Agency (ESA) ExoMars 2020 Rover. As a life-detection instrument on a Mars landing mission, MOMA-MS has very stringent Planetary Protection (PP) bioburden requirements. Within the MOMA instrument suite, the hardware surfaces of the sample path must be cleaned to a level of 0.03 spore/sq m. To meet this requirement, a process called Dry Heat Microbial Reduction (DHMR) is used to decrease the number of viable spores by 4 orders of magnitude. Before DHMR, the hardware is handled using standard cleanroom practices, while after DHMR, all sample path surfaces must be handled aseptically when exposed. Aseptic handling of the sample path involves a number of strategies and protocols including working only in an aseptic ISO class 5 work space, limiting the amount of time of exposure, using sterile garmenting with sterile gloves, and using sterile tools. Before work begins, the aseptic workspace will be tested for bioburden and particle fallout, and all tools that will contact sample path surfaces must be sterilized. During the exposure activity, sterile garments will be worn, sterile tools will be handled in a 2 person set up so that the operator touches only the sterile tool and not the exterior surfaces of the sterile pouch, and the environment will be monitored with active and passive fallout for bioburden and particle levels. Any breach in the planetary protection cleanliness can necessitate repeating DHMR, which not only has significant cost and schedule implications, it also become a risk to hardware that is not rated for repeated long exposures to high temperatures.

  11. Behçet's disease complicated by multiple aseptic abscesses of the liver and spleen.

    PubMed

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-05-28

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn's disease, and in other diseases. However, aseptic abscesses associated with Behçet's disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet's disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient's response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet's disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet's disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet's disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet's disease.

  12. Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel

    DTIC Science & Technology

    1977-06-01

    divers cannot be related to any specific index of diving activity, and may not be causally related to DCS. radiography dysbaric osteonecrosis ...other names, among them dysbaric osteonecrosis , caisson disease of bone, baro- traumatic arthropathy, and so forth.) For many years, the assumption was...underwater en- gineering group technical note 12. Davidson, J. K. 1976. Dysbaric osteonecrosis . Page 147, in J. K. Davidson, Ed. Aseptic necrosis of

  13. Chapter 6 Technology of Aseptic Cryoprotectant-Free Vitrification of Human ICSI Spermatozoa.

    PubMed

    Isachenko, Vladimir; Sanchez, Raul; Mallmann, Peter; Rahimi, Gohar; Isachenko, Evgenia

    2017-01-01

    The aim of this chapter was to describe the standardized aseptic technology of permeable cryoprotectant-free vitrification of human spermatozoa in capillaries (for ICSI or IVF in microvolume). Spermatozoa, vitrified by this technology, are free from seminal plasma owing to swim-up procedure preceding vitrification and are free from permeable cryoprotectants. They are ready for further use immediately after warming without any additional treatment.

  14. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  15. Sternal Precautions: Is It Time for Change? Precautions versus Restrictions – A Review of Literature and Recommendations for Revision

    PubMed Central

    LaPier, Tanya Kinney; Shaw, Donald K.

    2011-01-01

    The processes that occur with normal sternal healing and potential complications related to median sternotomy are of particular interest to physical therapists. The premise of patients following sternal precautions (SP) or specific activity restrictions is the belief that avoiding certain movements will reduce risk of sternal complications. However, current research has identified that many patients remain functionally impaired long after cardiothoracic surgery. It is possible that some SP may contribute to such functional impairments. Currently, SP have several limitations including that they: (1) have no universally accepted definition, (2) are often based on anecdotal/expert opinion or at best supported by indirect evidence, (3) are mostly applied uniformly for all patients without regard to individual differences, and (4) may be overly restrictive and therefore impede ideal recovery. The purpose of this article is to present an overview of current research and commentary on median sternotomy procedures and activity restrictions. We propose that the optimal degree and duration of SP should be based on an individual patient's characteristics (eg, risk factors, comorbidities, previous activity level) that would enable physical activity to be targeted to particular limitations rather than restricting specific functional tasks and physical activity. Such patient-specific SP focusing on function may be more likely to facilitate recovery after median sternotomy and less likely to impede it. PMID:21448343

  16. A new device producing manual sternal compression with thoracic constraint for cardiopulmonary resuscitation.

    PubMed

    Niemann, James T; Rosborough, John P; Kassabian, Leo; Salami, Bobak

    2006-05-01

    Blood flow during conventional cardiopulmonary resuscitation (CPR) is usually less than adequate to sustain vital organ perfusion. A new chest compression device (LifeBelt) which compresses both the sternum and the lateral thoraces (compression and thoracic constraint) has been developed. The device is light weight, portable, manually powered and mechanically advantaged to minimize user fatigue. The purpose of this study was to evaluate the mechanism of blood flow with the device, determine the optimal compression force and compare the device to standard manual CPR in a swine arrest model. Following anesthesia and instrumentation, intravascular contrast injections were performed in four animals and the performance characteristics of the device were evaluated in eight animals. In a comparative outcome study, 42 anesthetized and instrumented swine were randomized to receive LifeBelt or manual CPR. Ventricular fibrillation (VF) was induced electrically and was untreated for 7.5 min. After 7.5 min, countershocks were administered and chest compressions initiated. Pulseless electrical activity (PEA) was observed after one to three shocks in all animals. CPR was continued until restoration of spontaneous circulation (ROSC) or for 10 min after the first shock. If ROSC had not occurred within 5 min of beginning CPR, 0.01 mg/kg of epinephrine (adrenaline) was administered. During CPR, peak systolic aortic pressure (Ao), diastolic coronary perfusion pressure (CPP-diastolic aortic minus diastolic right pressure) and end-tidal CO(2) were measured. Angiographic studies demonstrated cardiac compression as the mechanism of blood flow. Optimal performance, determined by coronary perfusion pressure, was observed at a sternal force of 100-130 lb (45-59 kg). In the comparative trial, significant differences in the measured CPP were observed between LifeBelt and manual CPR both at 1 min (15+/-8 mmHg versus 10+/-6 mmHg, p<0.05) and 5 min (17+/-4 mmHg versus 13+/-7 mmHg, p<0.02) of

  17. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  18. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  19. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    PubMed Central

    Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    Objective: To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. Methods: In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. Results: Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barrier disturbance (p = 0.001). The Qalb as a marker for the leakiness of the BCSFB and, more indirectly, of the blood-brain barrier (BBB) was positively correlated with the incidence of leptomeningeal contrast enhancement seen on postcontrast fluid-attenuated inversion recovery (FLAIR) MRI (p = 0.003). Patients with a more pronounced brain barrier dysfunction recovered more slowly and stayed longer in the hospital. Conclusions: The severity of meningeal BBB disturbance can be estimated on postcontrast FLAIR MRI, which may be of diagnostic value in patients with aseptic meningitis. PMID:26516629

  20. The neurochemical markers in cerebrospinal fluid to differentiate between aseptic and tuberculous meningitis.

    PubMed

    Qureshi, G A; Baig, S M; Bednar, I; Halawa, A; Parvez, S H

    1998-02-01

    In this study, the use of neurochemical markers in patients with aseptic and tuberculous meningitis has been investigated. The cerebrospinal fluid levels of amino acids, nitrite (a metabolite of nitric oxide), vitamin B12 and homocysteine were quantitated in both groups of patients. Among the amino acids, aspartic acid and glutamic acid both excitatory amino acid, GABA, glycine and tryptophan were all significantly increased in both patient groups whereas decreased level of taurine and increased level of phenylalanine were only found in patients with tuberculous meningitis. The levels of nitrite and its precursor arginine were significantly higher in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. A significantly increased homocysteine level and a decreased level of vitamin B12 were found only in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. This indicates that patients with tuberculous meningitis are particularly prone to vitamin B12 deficiency resulting into increased level of HC, and involvement of free radical showing the importance of these biological markers for promoting the possibility for the design of therapeutic approach.

  1. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  2. Kotov collects samples from the Bioscience Experiment ASEPTIC (BTKh-39) in the MRM2 during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068654 (19 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, collects samples from the new bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  3. Kotov collects samples from the Bioscience Experiment ASEPTIC (BTKh-39) in the MRM2 during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068655 (19 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, collects samples from the new bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  4. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  5. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory.

    PubMed

    Neville, Michael W; Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-08-25

    To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students' aseptic technique at the conclusion of the semester. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos.

  6. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-02

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  7. Development and Validation of a Stratification Tool for Predicting Risk of Deep Sternal Wound Infection after Coronary Artery Bypass Grafting at a Brazilian Hospital

    PubMed Central

    Sá, Michel Pompeu Barros Oliveira; Ferraz, Paulo Ernando; Soares, Artur Freire; Miranda, Rodrigo Gusmão Albuquerque; Araújo, Mayara Lopes; Silva, Frederico Vasconcelos; Lima, Ricardo de Carvalho

    2017-01-01

    Objective Deep sternal wound infection following coronary artery bypass grafting is a serious complication associated with significant morbidity and mortality. Despite the substantial impact of deep sternal wound infection, there is a lack of specific risk stratification tools to predict this complication after coronary artery bypass grafting. This study was undertaken to develop a specific prognostic scoring system for the development of deep sternal wound infection that could risk-stratify patients undergoing coronary artery bypass grafting and be applied right after the surgical procedure. Methods Between March 2007 and August 2016, continuous, prospective surveillance data on deep sternal wound infection and a set of 27 variables of 1500 patients were collected. Using binary logistic regression analysis, we identified independent predictors of deep sternal wound infection. Initially we developed a predictive model in a subset of 500 patients. Dataset was expanded to other 1000 consecutive cases and a final model and risk score were derived. Calibration of the scores was performed using the Hosmer-Lemeshow test. Results The model had area under Receiver Operating Characteristic (ROC) curve of 0.729 (0.821 for preliminary dataset). Baseline risk score incorporated independent predictors of deep sternal wound infection: obesity (P=0.046; OR 2.58; 95% CI 1.11-6.68), diabetes (P=0.046; OR 2.61; 95% CI 1.12-6.63), smoking (P=0.008; OR 2.10; 95% CI 1.12-4.67), pedicled internal thoracic artery (P=0.012; OR 5.11; 95% CI 1.42-18.40), and on-pump coronary artery bypass grafting (P=0.042; OR 2.20; 95% CI 1.13-5.81). A risk stratification system was, then, developed. Conclusion This tool effectively predicts deep sternal wound infection risk at our center and may help with risk stratification in relation to public reporting and targeted prevention strategies in patients undergoing coronary artery bypass grafting.

  8. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  9. Growth and toxin production by Clostridium botulinum in steamed rice aseptically packed under modified atmosphere.

    PubMed

    Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo

    2005-05-01

    Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.

  10. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

  11. Persistent subcutaneous oedema and aseptic fatty tissue necrosis after using octenisept.

    PubMed

    Schupp, C J; Holland-Cunz, S

    2009-06-01

    Wound management and the prevention and treatment of tissue infections are part of daily routine. Octenisept (Schülke & Mayr), an antiseptic with a broad antimicrobiological effect, is widely used for various indications. This paper reports prolonged oedema and tissue swelling after treatment of deep wounds with Octenisept in three children. Three paediatric patients, aged between 2 months and 4 years, were treated with Octenisept in different hospitals. One initially presented with an abscess of the gluteal area, two with deep wounds of the cheek following injury with a wooden stick. The wounds were cleaned and washed out with Octenisept. Adequate drainage was in place at all times. COMMON FINDINGS: We observed aseptic, non painful subcutaneous tissue swelling and oedema in all three cases after wound lavage with Octenisept. This occurred shortly after the wound was initially treated and lasted for weeks until the symptoms slowly declined. It was not accompanied by persistent general infection parameters. A biopsy taken from one patient demonstrated an aseptic inflammatory reaction and oedema of the subcutaneous tissue, with partial tissue necrosis. Neither surgical revision nor antibiotic therapy brought any improvement. Retrospectively, one can consider these occurrences as a consequence of the use of Octenisept, since the changes are consistent with those described by Schülke & Mayr when Octenisept was accidentally administered by subcutaneous injection or under pressure to flush deep hand stab wounds that were not drained. The underlying pathobiological mechanism remains unclear. Hence, we recommend not to apply Octenisept in any wound cavity until further investigation has taken place. If aseptic fatty tissue necrosis and oedema develop after using Octenisept, further surgical intervention or antibiotic treatment will not give any benefit. Changes subside slowly. So far, adequate treatment is not available.

  12. Computed tomographic assessment of sternal lymph node dimensions and attenuation in healthy dogs.

    PubMed

    Milovancev, Milan; Nemanic, Sarah; Bobe, Gerd

    2017-03-01

    OBJECTIVE To assess dimensions and attenuation of sternal lymph nodes (SLNs) observed by means of CT in healthy dogs. ANIMALS 12 healthy adult research dogs. PROCEDURES Precontrast and postcontrast enhanced CT of the thorax was performed on each dog. Objective and subjective contrast-enhanced CT measurements were obtained. RESULTS By use of CT, 2 SLNs were identified in 10 of the 12 dogs and 1 SLN was identified in 2. Median SLN length, height, and width were 8.5 mm (range, 4 to 22 mm), 6.0 mm (range, 3 to 10 mm), and 5.0 mm (range, 3 to 10 mm), respectively. Median SLN length-to-T4 ratio, height-to-T4 ratio, and width-to-T4 ratio were 0.64 (range, 0.24 to 1.22), 0.37 (range, 0.25 to 0.53), and 0.29 (range, 0.19 to 0.67), respectively. Median SLN volume was 123 mm(3) (range, 38 to 484 mm(3)). Median height-to-length ratio, width-to-length ratio, and height-to-width ratio were 0.57 (range, 0.27 to 1.75), 0.51 (range, 0.31 to 1.25), and 1.27 (range, 0.50 to 2.50), respectively. All SLNs had homogenous contrast enhancement with median precontrast and postcontrast attenuation values of 18.3 Hounsfield units (HU; range, 4.4 to 36.9 HU) and 41.3 HU (range, 24.0 to 77.4 HU), respectively. All SLNs had a visible hilus, which was fat attenuating in 8 dogs and hypoattenuating in 4 dogs. CONCLUSIONS AND CLINICAL RELEVANCE CT imaging characteristics described in this study may provide a reference for dimensions and appearance of SLNs of healthy dogs and serve as a basis for comparison with results for diseased dogs.

  13. Another cause of chest pain: Staphylococcus aureus sternal osteomyelitis in an otherwise healthy adult

    PubMed Central

    Vacek, Thomas P; Rehman, Shahnaz; Yu, Shipeng; Moza, Ankush; Assaly, Ragheb

    2014-01-01

    Chest pain requires a detailed differential diagnosis with good history-taking skills to differentiate between cardiogenic and noncardiogenic causes. Moreover, when other symptoms such as fever and elevated white blood cell count are involved, it may be necessary to consider causes that include infectious sources. A 53-year-old female with no significant past medical history returned to the hospital with recurrent complaints of chest pain that was constant, substernal, reproducible, and exacerbated with inspiration and expiration. The chest pain was thought to be noncardiogenic, as electrocardiography did not demonstrate changes, and cardiac enzymes were found to be negative for signs of ischemia. The patient’s blood cultures were analyzed from a previous admission and were shown to be positive for Staphylococcus aureus. The patient was started empirically on vancomycin, which was later switched to ceftriaxone as the bacteria were more sensitive to this antibiotic. A transthoracic echocardiogram did not demonstrate any vegetation or signs of endocarditis. There was a small right pleural effusion discovered on X-ray. Therefore, computed tomography as well as magnetic resonance imaging of the chest were performed, and showed osteomyelitis of the chest. The patient was continued on intravenous ceftriaxone for a total of 6 weeks. Tests for HIV, hepatitis A, B, and C were all found to be negative. The patient had no history of childhood illness, recurrent infections, or previous trauma to the chest, and had had no recent respiratory infections, pneumonia, or any underlying lung condition. Hence, her condition was thought to be a case of primary sternal osteomyelitis without known cause. PMID:25246811

  14. Longitudinal myelitis, aseptic meningitis, and conus medullaris infarction as presenting manifestations of pediatric systemic lupus erythematosus.

    PubMed

    Katramados, A M; Rabah, R; Adams, M D; Huq, A H M M; Mitsias, P D

    2008-04-01

    A healthy boy developed subacutely progressive quadriparesis, complicated by sudden paraplegia, fever, and meningeal signs, diagnosed as longitudinal myelitis, aseptic meningitis, and conus medullaris infarction and identified as the presenting manifestations of neuropsychiatric systemic lupus erythematosus. Rapid expansion of the conus on serial neuroimaging led to emergent decompressive laminectomy and cord biopsy showing vasculitis and cord infarction. The patient had partial recovery after treatment with high-dose steroids. Increased vigilance is required when pediatric patients develop a similar subacute presentation on the ground of active systemic lupus erythematosus because it may herald the onset of a catastrophic neurological syndrome.

  15. Somatic embryogenesis ofCyclamen persicum Mill. 'Anneke' from aseptic seedlings.

    PubMed

    Takamura, T; Miyajima, I; Matsuo, E

    1995-01-01

    InCyclamen persicum 'Anneke', explants from the various vegetative organs of aseptic seedling formed embryoids. The optimal responses were recorded in Murashige and Skoog (MS) medium enriched with 5.0µM 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5µM kinetin and 3-6% sucrose. Embryogenesis was enhanced at higher temperature of 25-30°C. On the other hand, light inhibited embryogenesis. Histological and morphological studies confirmed that the embryoids were indeed somatic embryos.

  16. Aseptic addition method for Lactobacillus casei assay of folate activity in human serum

    PubMed Central

    Herbert, Victor

    1966-01-01

    An `aseptic addition' method is described for microbiological assay with Lactobacillis casei of folate activity in human serum. It has the following advantages over the previously reported `standard' method. 1 The manipulations involved in the assay are halved, by deleting autoclaving of serum in buffers. 2 The use of 1 g.% ascorbate better preserves serum folates than the lower amounts of ascorbate which are the maximum quantities usable in the standard methods. 3 Only 0·3 ml. of serum is required (0·1 ml. for one sample; 0·2 ml. for its duplicate). PMID:5904975

  17. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Aseptic necrosis of the femoral head after pregnancy: a case report

    PubMed Central

    Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa

    2016-01-01

    A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy. PMID:27795792

  19. Topical spraying of cefazolin and gentamicin reduces deep sternal wound infections after heart surgery: a multicenter, large volume, retrospective study.

    PubMed

    Osawa, Hiroshi; Yoshii, Shinpei; Abraham, Samuel J K; Okamoto, Yuki; Hosaka, Shigeru; Fukuda, Shoji; Tsuchiya, Koji; Nakajima, Masato; Honda, Yoshihiro; Takizawa, Kouki

    2016-04-01

    The use of topical antimicrobials applied to the sternum during cardiac procedures in combination with intravenous agents to prevent mediastinitis has been reported to yield good results. The objective of this study is to provide optimal method of topical antimicrobials for the prevention of sternal wound infection after cardiac surgery. We retrospectively evaluated the patients undergoing adult cardiac surgery at five institutions between January 1994 and August 2013 for the incidence of deep sternal wound infection (DSWI). The patients were sprayed with a solution of cefazolin and gentamicin into the surgical site several times during surgery. The incidence of DSWI was evaluated. Four major risk factors [diabetes mellitus (DM), emergency operation, dialysis and prolonged operation] were also evaluated for their implications in the outcome with the antimicrobial spraying. Totally, 6960 patients were analyzed. The incidence of DSWI was 0.46% in the spraying group versus 1.7% in control group (p < 0.0001). There is no significant difference of the incidence of DSWI between DM and non-DM groups (p = 1.00), emergency and elective operation groups (p = 0.25) under usage of antimicrobial spraying. However, there is significant difference of the incidence of DSWI between dialysis and non-dialysis groups (p = 0.0222), longer than six-hour duration and lesser than six-hour duration operation groups (p = 0.0269). Topical spraying of cefazolin and gentamicin reduces deep sternal wound infections after cardiac surgery. DM and emergency operation were not the risk factors of DSWI when antimicrobial spraying is administered. Considering the benefits, antimicrobial spraying could be used intermittently during such procedures.

  20. Molecular structure and physicochemical properties of pepsin-solubilized type II collagen from the chick sternal cartilage.

    PubMed

    Cao, H; Shi, F X; Xu, F; Yu, J S

    2013-06-01

    Recently, type II collagen (CII) was found to be effective clinically for treatment of rheumatoid arthritis (RA). However, the molecular properties of CII could be changed during the preparation process. In the present study, we isolated CII from chick sternal cartilage and studied the structural characteristics of purified CII. Pepsin-solubilized CII was purified from sternal cartilage of the chick using a combination of pepsin digestion, NaCl precipitation and DEAE-Sepharose CL 6B ion exchange chromatography. Then, the molecular structure and physicochemical properties of pepsin-solubilized CII were investigated. According to the electrophoretic patterns, the purified preparation consisted of a single band (α chain) and dimmers (β chains) with a subunit Mr of 110 kDa, were characterized to type II, and contained imino acid of 232 residues/1000 residues. The maximum transition temperature (Tmax) of the pepsin-solubilized CII measured by DSC was 45.60°C. Circular dichroism (CD) spectra analysis revealed that pepsin-solubilized CII retained more intermolecular crosslinks during the preparation process. Investigation results of atomic force microscope (AFM) indicated that the collagen fibrils from chick cartilage were about 146 nm in width and highly periodic with a banding pattern of -68.3 nm spacing. Analysis of physical properties indicated that pepsin-solubilized CII were highly solubilized in the pH range of 1-3.5 and the optimal NaCl concentration was 0.6 mol/L. Chick sternal cartilage can be used as an alternative CII source.

  1. Outbreak of aseptic meningitis by echo 4: prevalence of clinical cases among adults.

    PubMed

    Portolani, M; Pecorari, M; Pietrosemoli, P; Bartoletti, A; Sabbatini, A M; Meacci, M; Gennari, W; Bazzani, E; Beretti, F; Guaraldi, G

    2001-01-01

    Twenty five cases of meningitis occurred in urban areas surrounding a city (Modena) in Northern Italy, in the period May-July 1999. When the patients were admitted to the Infectious Diseases Division of the University of Modena and Reggio Emilia Hospital and studied by virological and serological methods, the meningitis proved to have an enteroviral origin and enterovirus ECHO 4 type was responsible for all cases of illness. An epidemiological characteristic of the enteroviral meninigitis outbreak was the adult age in 23 out of the 25 patients (mean age 24.50 +/- 7.84 years). The monthly distribution of the aseptic meningitis cases was the following: five cases occurred in May, 13 in June and seven in July. The origin of the spread of the virus infection and the reason for its sudden end remained unknown. The unusual drop in temperature which occurred in the geographic area involved in the aseptic meningitis outbreak at the beginning of August could have interfered with the slowdown in virus circulation.

  2. Factors affecting aseptic loosening of 4750 total hip arthroplasties: multivariate survival analysis

    PubMed Central

    Bordini, Barbara; Stea, Susanna; De Clerico, Manuela; Strazzari, Sergio; Sasdelli, Antonio; Toni, Aldo

    2007-01-01

    Background Total hip arthroplasty is a successful surgery, that fails at a rate of approximately 10% at ten years from surgery. Causes for failure are mainly aseptic loosening of one or both components partially due to wear of articular surfaces and partially to design. The present analysis aimed to identify risk factors and quantify their effects on aseptic failure. Methods Multivariate survival analysis was applied to 4,750 primary total hip arthroplasties performed between 1995 and 2000. Results The survival of the prosthesis is affected by gender, age, pathology, type of the prosthesis and skill of the. The worst conditions are male patients, younger than 40 years, affected by sequelae of congenital diseases, operated by a who performed less than 400 total hip artroplasty in the period. Furthermore, cemented cups and stems (less expensive) have a higher risk of failure compared with uncemented ones (more expensive). Conclusion The only variable that affects survival and that can be modified by is the type of prosthesis: a lower cost is associated to a higher risk. Results concerning the risk associated with cemented components are partially in disagreement with studies performed in countries where cemented prostheses are used more often than uncemented ones. PMID:17650301

  3. Aseptic Culture Systems of Radopholus similis for In Vitro Assays on Musa spp. and Arabidopsis thaliana.

    PubMed

    Elsen, A; Lens, K; Nguyet, D T; Broos, S; Stoffelen, R; De Waele, D

    2001-06-01

    Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana.

  4. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  5. Sternal Cleft and Pectus Excavatum: A Combined Approach for the Correction of a Complex Anterior Chest Wall Malformation in a Teenager.

    PubMed

    Tocchioni, Francesca; Ghionzoli, Marco; Lo Piccolo, Roberto; Deaconu, Diana E; Facchini, Flavio; Milanez De Campos, Jose R; Messineo, Antonio

    2015-06-01

    Congenital sternal cleft is a rare chest wall malformation. Because of the flexibility of the chest in infants, surgical repair should be performed by primary closure in the neonatal period. In adolescents and adults, different techniques have been suggested to overcome the lack of sternal bone tissue. We describe a very rare case of an 18-year-old woman with a complete bifid sternum associated with pectus excavatum for whom a satisfactory cosmetic and functional result was obtained by adequate surgical planning, which entailed a combination of two standardized surgical techniques.

  6. Pedicled and skeletonized single and bilateral internal thoracic artery grafts and the incidence of sternal wound complications: Insights from the Arterial Revascularization Trial.

    PubMed

    Benedetto, Umberto; Altman, Douglas G; Gerry, Stephen; Gray, Alastair; Lees, Belinda; Pawlaczyk, Rafal; Flather, Marcus; Taggart, David P

    2016-07-01

    The question of whether skeletonized internal thoracic artery harvesting reduces the incidence of sternal wound complications in comparison with the pedicled technique, in the context of single or bilateral internal thoracic arteries, remains controversial. We studied the impact of the internal thoracic artery harvesting strategy on sternal wound complication in the Arterial Revascularization Trial. Patients enrolled in the Arterial Revascularization Trial (n = 3102) were randomized to coronary artery bypass grafting with single or bilateral internal thoracic arteries. Sternal wound complication rates were examined according to the harvesting technique that was documented in 2056 patients. The internal thoracic artery harvesting technique, based on the surgeon's preference, resulted in 4 groups: pedicled single internal thoracic artery (n = 607), pedicled bilateral internal thoracic artery (n = 459), skeletonized single internal thoracic artery (n = 512), and skeletonized bilateral internal thoracic artery (n = 478). Propensity scores weighting was used to estimate the impact of the harvesting technique on sternal wound complications. A total of 219 of 2056 patients (10.6%) experienced a sternal wound complication within 1 year from the index operation. Of those, only 25 patients (1.2%) required sternal wound reconstruction. Pedicled bilateral internal thoracic artery (odds ratio [OR], 1.80; 95% confidence interval [CI], 1.23-2.63) but not skeletonized bilateral internal thoracic artery (OR, 1.00; 95% CI, 0.65-1.53) or skeletonized single internal thoracic artery (OR, 0.89; 95% CI, 0.57-1.38) was associated with a significantly increased risk of any sternal wound complications compared with pedicled single internal thoracic artery. The present Arterial Revascularization Trial substudy suggests that, with a skeletonization technique, the risk of sternal wound complication with bilateral internal thoracic artery grafting is similar to that after standard

  7. Patient satisfaction and functional status after aseptic versus septic revision total knee arthroplasty using the PROSTALAC articulating spacer.

    PubMed

    Meek, R M Dominic; Dunlop, David; Garbuz, Donald S; McGraw, Robert; Greidanus, Nelson V; Masri, Bassam A

    2004-10-01

    This study compared the functional results of an articulating antibiotic spacer for 2-stage revision knee arthroplasty for infection, to the functional results of aseptic revision. One hundred twenty-five patients who underwent revision of total knee arthroplasty for infection and aseptic loosening were identified. All of the patients with infection were treated with the PROSTALAC system (DePuy). At a minimum 2-year follow-up, WOMAC, Oxford-12, SF-12, patient satisfaction data, Harris Hip Score knee scores, and range of motion were assessed. The 2 cohorts (4 deaths in total, leaving 54 septic, 57 aseptic) were equivalent for age, gender, and comorbidity scores. At a mean of 41 months, none of the outcomes were significantly worse for the septic group, which had 2 recurrences of infection (4%). The satisfactory functional results of the PROSTALAC system may be related to the design features.

  8. Circulating biomarkers for discrimination between aseptic joint failure, low-grade infection, and high-grade septic failure.

    PubMed

    Ettinger, Max; Calliess, Tilman; Kielstein, Jan T; Sibai, Jasmin; Brückner, Thomas; Lichtinghagen, Ralf; Windhagen, Henning; Lukasz, Alexander

    2015-08-01

    Late-onset chronic (low-grade) periprosthetic joint infections are often accompanied by unspecific symptoms, false-negative cultures or nonspecific low values of serum biomarkers. This may lead to the unintended implantation of a revision prosthesis into an infected surgical site with the risk of short-term failure developing again. Conversely, false diagnosis of joint infection may result in multistage revision procedures, which expose the patient to unnecessary surgical procedures and inappropriate antibiotic treatment. Here, we investigated whether circulating biomarkers can preoperatively distinguish between aseptic prosthesis loosening and low-grade joint infection, and which biomarker combinations are most accurate. Inclusion criteria for the study were indication for revision arthroplasty due to aseptic implant failure, acute high-grade infection, or (suspected) low-grade infection. C-reactive protein (CRP), procalcitonin, tumor necrosis factor α, interleukin 6 (IL-6), interleukin 10, and lipopolysaccharide binding protein were assessed preoperatively in the serum of 98 adult patients. The classification tree method revealed IL-6 and CRP as the most suitable biomarker combination for the discrimination of aseptic loosening vs low-grade joint infection. The combination of IL-6 >5.12 pg/mL and CRP >0.3 mg/dL correctly identified 15 of 16 patients as having low-grade infection (94%) whereas just one patient was aseptic (6%). This is the first comprehensive prospective clinical study to our knowledge investigating the significance of a combined biomarker approach in differentiating between aseptic prosthesis loosening and low-grade joint infection. CRP plus IL-6 seems to be the most helpful combination for preoperative discrimination of aseptic loosening vs low-grade joint infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. The fine structural organization of sternal glands of pseudergates and workers in termites (Isoptera): a comparative survey.

    PubMed

    Quennedey, André; Sillam-Dussès, David; Robert, Alain; Bordereau, Christian

    2008-05-01

    Thirty-nine species belonging to different families of termites are studied to give a comprehensive view of the evolution of the sternal glands. Several modifications occurring at cuticular and cytological levels are described in neuter castes. The outer epicuticle is always pierced by epicuticular pores. In advanced termites the epicuticular filaments greatly increase in number and length creating a thick layer. The pore canals gradually enlarge while the cuticle changes into a lattice structure lining an extracellular space in which the secretion is stored. Two classes of cells are present in basal termites (Mastotermitidae, Hodotermitidae, Termopsidae and Kalotermitidae) but their glandular structures greatly differ between families. A more complex organization with three classes of cells is found in the Serritermitidae and Rhinotermitidae. A regressive evolution occurs in the Termitidae where only two classes of cells are present. A dual nervous control (campaniform sensilla and neurosecretory fibers) is found in lower termites, except for the Hodotermitidae which have mechanosensory bristles. In the other families, neurosecretory fibers are lacking. A comparison with phylogenetic data is given. A more versatile role of sternal glands in neuter castes is hypothesized.

  10. Chondrosarcoma from the sternum: reconstruction with titanium mesh and a transverse rectus abdominis myocutaneous flap after subtotal sternal excision.

    PubMed

    Koto, Kazutaka; Sakabe, Tomoya; Horie, Naoyuki; Ryu, Kazuteru; Murata, Hiroaki; Nakamura, Shinichiro; Ishida, Toshihiro; Konishi, Eiichi; Kubo, Toshikazu

    2012-10-01

    Chondrosarcoma arising from the sternum is extremely rare and is often untreatable. Removal of the sternum for malignant tumor results in large defects in bone and soft tissue, causing deformity and paradoxical movement of the chest wall and making subsequent repair of the thorax very important. We report a very rare patient with a chondrosarcoma of the sternum who underwent case chest wall resection, followed by reconstruction using a titanium mesh covered with a transverse rectus abdominis myocutaneous (TRAM) flap. A 63-year-old man was referred to our hospital with progressively enlarged swelling of his anterior chest wall. Physical examination showed a 2.5×2.0 cm mass fixed to the sternum, which was diagnosed as a chondrosarcoma based on clinical findings, imaging characteristics and incision biopsy results. The patient underwent a subtotal sternal and chest wall resection to remove the tumor, followed by reconstruction with a titanium mesh and a TRAM flap. There were no complications associated with surgery. We report an extremely rare case of a patient who underwent subtotal sternal resection, followed by reconstruction, for a large chondrosarcoma. The elasticity and rigidity provided by the titanium mesh and the complete coverage of the surgical wound by a TRAM flap suggest that these procedures may be useful in reconstructing large defects in the chest wall.

  11. Chondrosarcoma from the sternum: Reconstruction with titanium mesh and a transverse rectus abdominis myocutaneous flap after subtotal sternal excision

    PubMed Central

    Koto, Kazutaka; Sakabe, Tomoya; Horie, Naoyuki; Ryu, Kazuteru; Murata, Hiroaki; Nakamura, Shinichiro; Ishida, Toshihiro; Konishi, Eiichi; Kubo, Toshikazu

    2012-01-01

    Summary Background Chondrosarcoma arising from the sternum is extremely rare and is often untreatable. Removal of the sternum for malignant tumor results in large defects in bone and soft tissue, causing deformity and paradoxical movement of the chest wall and making subsequent repair of the thorax very important. We report a very rare patient with a chondrosarcoma of the sternum who underwent case chest wall resection, followed by reconstruction using a titanium mesh covered with a transverse rectus abdominis myocutaneous (TRAM) flap. Case Report A 63-year-old man was referred to our hospital with progressively enlarged swelling of his anterior chest wall. Physical examination showed a 2.5×2.0 cm mass fixed to the sternum, which was diagnosed as a chondrosarcoma based on clinical findings, imaging characteristics and incision biopsy results. The patient underwent a subtotal sternal and chest wall resection to remove the tumor, followed by reconstruction with a titanium mesh and a TRAM flap. There were no complications associated with surgery. Conclusions We report an extremely rare case of a patient who underwent subtotal sternal resection, followed by reconstruction, for a large chondrosarcoma. The elasticity and rigidity provided by the titanium mesh and the complete coverage of the surgical wound by a TRAM flap suggest that these procedures may be useful in reconstructing large defects in the chest wall. PMID:23018358

  12. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  13. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis.

    PubMed

    Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L

    2016-04-01

    Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15

  14. Mechanical properties of human bone-implant interface tissue in aseptically loose hip implants.

    PubMed

    Kraaij, Gert; Zadpoor, Amir A; Tuijthof, Gabrielle J M; Dankelman, Jenny; Nelissen, Rob G H H; Valstar, Edward R

    2014-10-01

    The main cause of failure in total hip replacement is aseptic loosening which is associated with the formation of a periprosthetic fibrous (interface) tissue. Despite important applications for finite element modeling of loose implants, the mechanical properties of the bone-implant interface tissue have never been measured in humans. In this study, we performed unconfined compression tests to characterize the mechanical properties of the interface tissue and to determine the parameters of various hyperelastic material models which were fitted to the measurements. Human interface tissues were retrieved during 21 elective revision surgeries from aseptically loosened cemented (N=10) and uncemented hip implants (N=11). Specimens were tested at a fixed deformation rate of 0.1mm/min up to a maximum force of 10N. Elastic moduli for low and high strain regions of the stress-strain curves were determined. Interface tissue from aseptically loose cemented prostheses shows higher elastic moduli (mean=1.85MPa, 95% C.I.=1.76-1.95MPa) in the high strain region as compared to that of the interface tissue from the cementless group (mean=1.65MPa, 95% C.I.=1.43-1.88MPa). The 5-terms Mooney-Rivlin model ( [Formula: see text] ) described the stress-strain behavior the best. Large variations in the mechanical behavior were observed both between specimens from the same patient as between those of different patients. The material model parameters were therefore estimated for the mean data as well as for the curves with the highest and lowest strain at the maximum load. The model parameters found for the mean data were C1=-0.0074MPa, C2=0.0019MPa, C3=0MPa, C4=-0.0032MPa and C5=0MPa in the cemented group and C1=-0.0137MPa, C2=0.0069MPa, C3=0.0026MPa, C4=-0.0094MPa and C5=0MPa in the cementless group. The results of this study can be used in finite element computer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Use of gentamicin sulfate-impregnated sponges as adjuvant therapy for the treatment of chronic foreign body associated sternal osteomyelitis in a dog

    PubMed Central

    Wainberg, Shannon H.; Brisson, Brigitte A.; Hayes, Galina M.; Mackenzie, Shawn

    2015-01-01

    A 2-year-old Labrador retriever dog was referred for evaluation of parasternal chronic draining sinus tracts associated with sternal osteomyelitis secondary to the presence of a residual wooden foreign body. The use of gentamicin-impregnated collagen sponges as adjunctive therapy to osteomyelitis treatment is reported herein. PMID:26538672

  16. Daptomycin as a possible new treatment option for surgical management of Methicillin-Resistant Staphylococcus aureus sternal wound infection after cardiac surgery

    PubMed Central

    2010-01-01

    We present a case of a 77-year old female who had undergone a coronary artery bypass grafting with an aortic valve replacement and developed three month later a Methicillin-Resistant Staphylococcus aureus (MRSA) sternal wound infection which was successful treated with Daptomycin combined with vacuum-assisted closure (VAC). PMID:20691034

  17. First epidemic of aseptic meningitis due to echovirus type 13 among Spanish children.

    PubMed Central

    Trallero, G.; Casas, I.; Avellón, A.; Pérez, C.; Tenorio, A.; De La Loma, A.

    2003-01-01

    Echoviruses are the commonest cause of aseptic meningitis (AM). Echovirus type 13 (EV-13) was the second enterovirus serotype associated with different local outbreaks of AM in Spain between February and October 2000. It was the first time that an epidemic AM caused by this virus was recognized in Spain. The index case appeared in the Canary Islands (Canarias). The EV-13 virus was isolated from 135 patients, predominantly from cerebrospinal fluid (CSF). All isolates were from children under 13 years. The age specific peak incidence was in infants under 1 year. Most patients had fever, headache and other meningeal signs. This enterovirus serotype, not previously detected in Spain, caused severe illness with a high attack rate. PMID:12729193

  18. [Acute disseminated encephalomyelitis in children as the result of aseptic meningitis - a report of two cases].

    PubMed

    Gołąbek, Violetta; Woźniakowska-Gęsicka, Teresa; Sokołowska, Dorota

    2011-01-01

    Acute disseminated encephalomyelitis (ADEM) is an inflammation of the spinal cord and brain. Diagnosis of ADEM, due to its rare occurrence and lack of definite laboratory indices, is difficult and is never totally certain. The clinical criterion required for the diagnosis is presence of acute symptoms from the brain and/or spine with fever, occurring after viral or bacterial infection, vaccination or serum administration. Differentiation between ADEM and acute multiple sclerosis in children is difficult, and diagnosis of ADEM may only be confirmed after years of observation, especially as multiple sclerosis is more common than ADEM. The most useful tool in differentiation between the two diseases is MRI. The aim of the study was to present two cases of ADEM with unknown aetiology after aseptic meningitis in children.

  19. Laser welding of thin polymer films to container substrates for aseptic packaging

    NASA Astrophysics Data System (ADS)

    Brown, N.; Kerr, D.; Jackson, M. R.; Parkin, R. M.

    2000-03-01

    Keyhole laser welding of polymers is a subject well covered and researched, but relatively little information exists regarding the welding of thin polymer films, particularly to a heavier substrate. This paper presents the design of a suitable test apparatus for laser welding thin film to a heavier substrate, and shows the results of an investigation into the feasibility of laser welding multi-layer polymer film lids to tubs for the manufacture of aseptic food containers. A consistent weld, free from defects, is the key to process success. Typical welding defects have been synthesised in order to investigate, and consequently remove, their cause. The result is a reliable welding method based on even film clamping. With careful attention to machine design, a seal of high mechanical strength and chemical integrity is possible.

  20. Aseptic meningitis in a patient taking etanercept for rheumatoid arthritis: a case report

    PubMed Central

    Booker, Matthew J; Flint, Julia; Saravana, Shanmugam

    2008-01-01

    Background We report a case of a 53 year old lady recently commenced on etanercept, an anti-TNF (tumour necrosis factor) therapy for rheumatoid arthritis presenting with confusion, pyrexia and an erythematous rash. Case presentation A lumbar puncture was highly suggestive of bacterial meningitis, but CSF cultures produced no growth, and polymerase chain reactions (PCR) for all previously reported bacterial, fungal and viral causes of meningitis were negative. Conclusion This case report describes aseptic meningitis as a previously unreported complication of etanercept therapy, and serves as a reminder of the rare but potentially life-threatening risk of serious infections in patients taking anti-TNF therapy for a variety of conditions. PMID:19046446

  1. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage.

  2. [Validation of a clinical prediction rule to distinguish bacterial from aseptic meningitis].

    PubMed

    Agüero, Gonzalo; Davenport, María C; Del Valle, María de la P; Gallegos, Paulina; Kannemann, Ana L; Bokser, Vivian; Ferrero, Fernando

    2010-02-01

    Despite most meningitis are not bacterial, antibiotics are usually administered on admission because bacterial meningitis is difficult to be rule-out. Distinguishing bacterial from aseptic meningitis on admission could avoid inappropriate antibiotic use and hospitalization. We aimed to validate a clinical prediction rule to distinguish bacterial from aseptic meningitis in children, on arriving to the emergency room. This prospective study included patients aged < 19 years with meningitis. Cerebrospinal fluid (CSF) and peripheral blood neutrophil count were obtained from all patients. The BMS (Bacterial Meningitis Score) described by Nigrovic (Pediatrics 2002; 110: 712), was calculated: positive CSF Gram stain= 2 points, CSF absolute neutrophil count > or = 1000 cells/mm(3), CSF protein > or = 80 mg/dl, peripheral blood absolute neutrophil count > or = 10.000/mm(3), seizure = 1 point each. Sensitivity (S), specificity (E), positive and negative predictive values (PPV and NPV), positive and negative likelihood ratios (PLR and NLR) of the BMS to predict bacterial meningitis were calculated. Seventy patients with meningitis were included (14 bacterial meningitis). When BMS was calculated, 25 patients showed a BMS= 0 points, 11 BMS= 1 point, and 34 BMS > or = 2 points. A BMS = 0 showed S: 100%, E: 44%, VPP: 31%, VPN: 100%, RVP: 1,81 RVN: 0. A BMS > or = 2 predicted bacterial meningitis with S: 100%, E: 64%, VPP: 41%, VPN: 100%, PLR: 2.8, NLR:0. Using BMS was simple, and allowed identifying children with very low risk of bacterial meningitis. It could be a useful tool to assist clinical decision making.

  3. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin N.; Berlin, David

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  4. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  5. Techniques and clinical effect of aseptic procedures on patients with acute leukemia in laminar airflow rooms.

    PubMed

    Takeo, H; Sakurai, T; Amaki, I

    1983-01-01

    The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.

  6. Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer

    NASA Astrophysics Data System (ADS)

    Lalime, Erin N.; Berlin, David

    2016-09-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  7. A pharmacodynamic investigation into the efficacy of osteoprotegerin during aseptic inflammation.

    PubMed

    Curl, Linda; Barker, Christopher; Dreyer, Craig; Sampson, Wayne

    2012-11-01

    Osteoprotegerin (OPG), as an osteoclast antagonist, limits mineralised tissue resorption under physiological conditions. Previous work investigating OPG in a rat periodontal ligament (PDL) ankylosis model found no inhibitory effect on osteoclasts when OPG was administered at a dosage of 2.5mg/kg. The object of this study was to determine whether dosages higher than 2.5 mg/kg of OPG were required to limit osteoclastic activity in an aseptic inflammatory model in rats. Dry ice was applied for 15 minutes to the upper right first molar crown of eighteen, 8-week-old, male Sprague-Dawley rats. Three groups of 3 were injected with OPG at dosages of 2.5, 5.0 and 7.5 mg/kg of body weight immediately following the thermal insult. After 7 days, the rats were sacrificed and each maxilla processed for histological examination and stained for osteoclastic activity using tartrate-resistant acid phosphatase (TRAP). Osteoclast population numbers were estimated via light microscopy and results were analysed using a comparative mixed model statistical analysis. Results showed OPG inhibited osteoclastic activity in a dose-dependent manner. From 2.5 mg/kg to 7.5 mg/kg, osteoclast populations were linearly reduced by 39.78% (p < 0.05). OPG did not appear to affect the inflammatory process and had varied efficacy in different regions of individual teeth. Although osteoclastic activity reduced, it was not completely eliminated, perhaps because dosages were still inadequate, or additional factors might influence OPG and osteoclast activation in the aseptic inflammatory model.

  8. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for Advancement of

  9. Aseptically Processed Placental Membrane Improves Healing of Diabetic Foot Ulcerations: Prospective, Randomized Clinical Trial

    PubMed Central

    DiDomenico, Lawrence A.; Orgill, Dennis P.; Galiano, Robert D.; Serena, Thomas E.; Carter, Marissa J.; Kaufman, Jarrod P.; Young, Nathan J.

    2016-01-01

    Background: Allogeneic grafts derived from amnion/chorion are known to be efficacious in healing chronic diabetic foot ulcerations (DFUs). The goal of this study was to compare aseptically processed dehydrated human amnion and chorion allograft (dHACA) versus standard of care (SOC) in facilitating wound closure in nonhealing DFUs. Methods: Patients with DFUs treated with SOC (off-loading, appropriate debridement, and moist wound care) after a 2-week screening period were randomized to either SOC or wound-size-specific dHACA (AmnioBand, Musculoskeletal Transplant Foundation, Edison, N.J.) applied weekly for up to 12 weeks plus SOC. Primary endpoint was the percentage of wounds healed at 6 weeks between groups. Results: At 6 weeks, 70% (14/20) of the dHACA-treated DFUs healed compared with 15% (3/20) treated with SOC alone. Furthermore, at 12 weeks, 85% (17/20) of the DFUs in the dHACA group healed compared with 25% (5/20) in the SOC group, with a corresponding mean time to heal of 36 and 70 days, respectively. At 12 weeks, the mean number of grafts used per healed wound for the dHACA group was 3.8 (median 3.0), and mean cost of the tissue to heal a DFU was $1400. The mean wastage at 12 weeks was 40%. One adverse event and 1 serious adverse event occurred in the dHACA group; neither was graft related. Three adverse events and 1 serious adverse event occurred in the SOC group. Conclusion: Aseptically processed dHACA heals diabetic foot wounds significantly faster than SOC at 6 and 12 weeks with minimal graft wastage. PMID:27826487

  10. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Smith, Alistair

    2015-01-01

    Abstract There is growing interest in the development of methods capable of non‐invasive characterization of stem cells prior to their use in cell‐based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm−1 after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up‐regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non‐invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for

  11. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  12. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  13. Report of Two Cases of Aseptic Meningitis with Persistence of Pneumococcal Cell Wall Components in Cerebrospinal Fluid after Pneumococcal Meningitis▿

    PubMed Central

    Angoulvant, François; Lachenaud, Julie; Mariani-Kurkdjian, Patricia; Aubertin, Guillaume; Houdouin, Véronique; Lorrot, Mathie; de Los Angeles, Laure; Bingen, Edouard; Bourrillon, Antoine; Faye, Albert

    2006-01-01

    We describe two cases of aseptic meningitis occurring some time after pneumococcal meningitis. Both cases may have resulted from an inflammatory response to persistent pneumococcal cell membrane components, as the cerebrospinal fluid samples were positive by the Binax NOW Streptococcus pneumoniae antigen test. Potential mechanisms and diagnostic impact are discussed. PMID:17005744

  14. Complete Genome Sequence Analysis of Echovirus 18 Associated with Aseptic Meningitis in Hebei Province, China, in 2015

    PubMed Central

    Sun, Su-zhen; Guo, Jia-yun; Li, Jing-jie

    2016-01-01

    Echovirus 18 is a member of the genus Enterovirus, family Picornaviridae, which can cause meningitis in children. Here, we report the echovirus 18 complete genome sequence, which was isolated from the cerebrospinal fluid of a child with aseptic meningitis in Hebei Province, China. PMID:27789638

  15. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from Diplodocidae and their morphological, functional and evolutionary implications

    PubMed Central

    Tschopp, Emanuel; Mateus, Octávio

    2013-01-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles – which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  16. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from diplodocidae and their morphological, functional and evolutionary implications.

    PubMed

    Tschopp, Emanuel; Mateus, Octávio

    2013-03-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  17. Are chest compressions safe for the patient reconstructed with sternal plates? Evaluating the safety of cardiopulmonary resuscitation using a human cadaveric model

    PubMed Central

    2010-01-01

    Background Plate and screw fixation is a recent addition to the sternal wound treatment armamentarium. Patients undergoing cardiac and major vascular surgery have a higher risk of postoperative arrest than other elective patients. Those who undergo sternotomy for either cardiac or major vascular procedures are at a higher risk of postoperative arrest. Sternal plate design allows quick access to the mediastinum facilitating open cardiac massage, but chest compressions are the mainstay of re-establishing cardiac output in the event of arrest. The response of sternal plates and the chest wall to compressions when plated has not been studied. The safety of performing this maneuver is unknown. This study intends to demonstrate compressions are safe after sternal plating. Methods We investigated the effect of chest compressions on the plated sternum using a human cadaveric model. Cadavers were plated, an arrest was simulated, and an experienced physician performed a simulated resuscitation. Intrathoracic pressure was monitored throughout to ensure the plates encountered an appropriate degree of force. The hardware and viscera were evaluated for failure and trauma respectively. Results No hardware failure or obvious visceral trauma was observed. Rib fractures beyond the boundaries of the plates were noted but the incidence was comparable to control and to the fracture incidence after resuscitation previously cited in the literature. Conclusions From this work we believe chest compressions are safe for the patient with sternal plates when proper plating technique is used. We advocate the use of this life-saving maneuver as part of an ACLS resuscitation in the event of an arrest for rapidly re-establishing circulation. PMID:20718981

  18. [Vacuum-assisted Closure (VAC) Treatment for Sternal Infection in a Patient after Cardiovascular Surgery; Report of a Case].

    PubMed

    Shima, Shotaro; Okamura, Kennichi; Morizumi, Sei; Kanamori, Taro; Ichihara, Tetsuya; Kawata, Mitsuhiro; Suematsu, Yoshihiro

    2015-03-01

    One year ago, a 42-year-old woman underwent aortic root replacement because of a pseudoaneurysm that developed at the site of an anastomosis after ascending aortic replacement for acute aortic dissection. Six months later, she complained of fever and cough. A computed tomography revealed recurrence of the peudoaneurysm at the proximal anastomosis of the aortic root replacement. After emergency re-do aortic root replacement, she was admitted to intensive care unit (ICU) without sternal closure because of mediastinitis. The mediastinitis was managed by debridement and lavage drainage, followed by vacuum-assisted closure (VAC) treatment. The VAC treatment facilitated wound healing and active rehabilitation using a portable device. Finally, the wound was closed completely using a skin graft. VAC treatment is considered very useful in a case of post-sternotomy madiastinitis.

  19. The vacuum-assisted closure system for the treatment of deep sternal wound infections after cardiac surgery.

    PubMed

    Fleck, Tatjana M; Fleck, Michael; Moidl, Reinhard; Czerny, Martin; Koller, Rupert; Giovanoli, Pietro; Hiesmayer, Michael J; Zimpfer, Daniel; Wolner, Ernst; Grabenwoger, Martin

    2002-11-01

    The VAC system (vacuum-assisted wound closure) is a noninvasive active therapy to promote healing in difficult wounds that fail to respond to established treatment modalities. The system is based on the application of negative pressure by controlled suction to the wound surface. The method was introduced into clinical practice in 1996. Since then, numerous studies proved the effectiveness of the VAC System on microcirculation and the promotion of granulation tissue proliferation. Eleven patients (5 men, 6 women) with a median age of 64.4 years (range 50 to 78 years) with sternal wound infection after cardiac surgery (coronary artery bypass grafting = 5, aortic valve replacement = 5, ascending aortic replacement = 1) were fitted with the VAC system by the time of initial surgical debridement. Complete healing was achieved in all patients. The VAC system was removed after a mean of 9.3 days (range 4 to 15 days), when systemic signs of infection resolved and quantitative cultures were negative. In 6 patients (54.5%), the VAC system was used as a bridge to reconstructive surgery with a pectoralis muscle flap, and in the remaining 5 patients (45.5%), primary wound closure could be achieved. Intensive care unit stay ranged from 1 to 4 days (median 1 day). Duration of hospital stay varied from 13 to 45 days (median 30 days). In-hospital mortality was 0%, and 30-day survival was 100%. The VAC system can be considered as an effective and safe adjunct to conventional and established treatment modalities for the therapy of sternal wound infections after cardiac surgery.

  20. Aseptic colon resection by an invagination technique. Experimental study on dogs.

    PubMed

    Jørgensen, L S; Raundahl, U; Knudsen, L L; Aksglaede, K; Søgaard, P

    1991-07-01

    A new aseptic colon resection by an invagination technique is presented. The bowel to be resected is invaginated down into the healthy intestine, and the anastomosis is sutured in one layer of continuous suture before transection by a diathermy wire, placed in the intestinal lumen via the anus. Sections of bowel that cannot be invaginated, e.g., because of a tumor, are first removed by transection between pairs of cable ties, which close the lumen. Twenty dogs were operated on without receiving prophylactic antibiotics. In 10, the intestine was transected between cable ties. An imprint, taken from the anastomosis and subcutis, was cultured. The bacterial count at the anastomosis exceeded 100 in only three cases; in the subcutis, this was the case in one dog. One wound infection developed. Serial barium enemas at 1, 2, 3, and 4 weeks revealed no anastomotic leakage. One early death because of a total anastomotic dehiscence was encountered, and two dogs were killed because of wound dehiscence and anastomotic stricture, respectively. It is concluded that, in dogs, the method is easily and safely performed, but further experimental studies are needed.

  1. Is recurrent aseptic meningitis a manifestation of familial Mediterranean fever? A systematic review.

    PubMed

    Capron, Jean; Grateau, Gilles; Steichen, Olivier

    2013-01-01

    Familial Mediterranean fever (FMF) causes recurrent episodes of fever and painful serositis. It has been suggested that FMF can cause recurrent aseptic meningitis (RAM). Due to the rarity of both diseases, this claim cannot be assessed with epidemiological methods. We therefore decided to perform a systematic review of the literature to assess the number and validity of published case reports. Medline, Embase, Pascal, Web of Science and the proceedings of relevant conferences were searched. Two independent investigators selected reports asserting RAM in FMF patients, abstracted data and rated the strength of evidence with a custom tool designed to assess: (a) the diagnosis of FMF; (b) the diagnosis of RAM; and (c) the link between FMF and RAM. A causal link was supported by (i) evidence of inflammation and/or clinical FMF features during episodes of RAM; (ii) effectiveness of colchicine to prevent further bouts of meningitis; and (iii) the exclusion of other causes of RAM. Among 944 retrieved references, 917 were rejected by title and abstract screening and 15 after full text review. The strength of evidence of 12 alleged cases of RAM due to FMF was assessed. FMF was unsupported in 4 cases and RAM in 3 further cases. Four of the 5 remaining cases did not provide adequate evidence to support a causal relationship between FMF and RAM. The possibility of RAM due to FMF is poorly supported by a single fairly documented case report that does not, however, meet current diagnostic standards.

  2. Growth and colour development of some surface ripening bacteria with Debaryomyces hansenii on aseptic cheese curd.

    PubMed

    Mounier, Jérôme; Irlinger, Françoise; Leclercq-Perlat, Marie-Noëlle; Sarthou, Anne-Sophie; Spinnler, Henry-Eric; Fitzgerald, Gerald F; Cogan, Timothy M

    2006-11-01

    The growth of five bacteria isolated from red-smear cheeses, Brevibacterium aurantiacum, Corynebacterium casei, Corynebacterium variabile, Microbacterium gubbeenense and Staphylococcus saprophyticus in mixed cultures with Debaryomyces hansenii on aseptic model cheese curd at 10 and 14 degrees C was investigated. At both temperatures, C. casei and Micro. gubbeenense had a longer lag phase than C. variabile, Brevi. aurantiacum and Staph. saprophyticus. In all cultures, lactose was utilised first and was consumed more rapidly at 14 degrees C than at 10 degrees C, i.e., 6 d at 14 degrees C and 10 d at 10 degrees C. This utilisation coincided with the exponential growth of Deb. hansenii on the cheese surface. Lactate was also used as a carbon source and was totally consumed after 21 d at 14 degrees C and approximately 90% was consumed after 21 d at 10 degrees C regardless of the ripening culture. Small differences (<0.5 pH unit) in the surface-pH during ripening were noticeable between ripening cultures. Differences in the colour development of the mixed cultures with the yeast control were only noticeable after 15 d for Brevi. aurantiacum and after 21 d for the other bacteria. Regardless of the organisms tested, colour development and colour intensity were also greater at 14 degrees C than at 10 degrees C. This study has provided useful information on the growth and contribution to colour development of these bacteria on cheese.

  3. Adhesion molecules in gonarthrosis and knee prosthesis aseptic loosening follow-up: possible therapeutic implications.

    PubMed

    Dambra, P; Loria, M P; Moretti, B; D'Oronzio, L; Patella, V; Pannofino, A; Cavallo, E; Pesce, V; Dell'Osso, A; Simone, C

    2003-05-01

    The involvement of the synovium is common in phlogistic processes of various joint diseases. Apart from synoviocytes and the other cells in the synovial tissue, circulating cells recruited from peripheral blood also participate in the phlogistic process. The increased expression of adhesion molecules on both circulating and endothelial cell surface may further this recruitment. We studied 15 patients affected by serious gonarthrosis requiring a prosthetic implant (GPI) and 7 with knee prosthesis aseptic loosening (KPL) to evaluate adhesion molecule expression and phlogistic infiltration in the synovium using immunohistochemistry and microscopic analysis. As control we studied 10 subjects affected by degenerative meniscopathies undergoing a selective arthroscopic surgical meniscectomy. Analysis with Kruskal-Wallis test showed no statistical significant differences in the expression of CD54, CD11a, CD11b and CD18 in three groups examined. The model of variance analysis (Friedman test), showed that CD54 expression is greater in patients with GPI and KPL in comparison with the other molecules. Adhesion molecules and their functions are important in arthropathies not only because their evaluation can allow us to identify the degree of inflammation and to predict its evolution, but also because pharmacological control of their expression could have important therapeutic implications.

  4. Teriparatide (rh [1-34] PTH) improved osteointegration of a hemiarthroplasty with signs of aseptic loosening.

    PubMed

    Oteo-Álvaro, Ángel; Matas, José A; Alonso-Farto, Juan C

    2011-09-09

    Incidences of osteoporosis and fragility fractures are constantly increasing, which are associated with increased morbidity and mortality. When these patients undergo surgery, a higher number of postoperative complications may be expected because of poor bone quality and delayed healing. As a result, poorer primary stability of the implant, initial loosening, and impaired fixation strength in different regions may be seen. In these patients, we can choose the most advanced implants, but it is necessary to stimulate bone biology to increase the stability of the implant. This article reports the result obtained in a patient diagnosed with osteoporosis with aseptic loosening of a hip hemiarthroplasty after treatment with teriparatide (rh [1-34] PTH). This drug is indicated for the treatment of osteoporosis in men and postmenopausal women with high fracture risk and glucocorticoid-induced osteoporosis, and is administered subcutaneously for 2 years. It has an anabolic effect through stimulation of the osteoblast population that increases trabecular connectivity, cortical thickness, and bone mineral content. In animal models, teriparatide improved implant fixation 2 to 4 weeks after administration, resulting in the thickening of bone trabeculae and increased bone mass in the peri-implant area. In this retrospective analysis of clinical data and radiographic and scintigraphic images, after 24 months of treatment, the patient experienced clinical improvement associated with the disappearance of radiographic signs of loosening and a decrease in pathological radiotracer uptake in the bone scan, which are signs of osteointegration after treatment with teriparatide. Copyright 2011, SLACK Incorporated.

  5. Iron Supplementation Effects on Redox Status following Aseptic Skeletal Muscle Trauma in Adults and Children

    PubMed Central

    Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis

    2017-01-01

    Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults (n = 14) and children (n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation (p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Clinicaltrials.gov Identifier: NCT02374619. PMID:28203319

  6. Acute respiratory distress syndrome complicating generalized pustular psoriasis (psoriasis-associated aseptic pneumonitis).

    PubMed

    Kluger, Nicolas; Bessis, Didier; Guillot, Bernard; Girard, Céline

    2011-06-01

    Generalized pustular and/or erythrodermic psoriasis may have severe or even lethal complications. A peculiar noninfectious acute respiratory distress syndrome (so-called "sterile pneumonitis") has been described in generalized pustular psoriasis and/or erythrodermic psoriasis. We report a new case in a 14-year-old girl with a long history of pustular psoriasis and review the published work on this complication. The girl developed sterile pneumonitis during a disease flare-up, and high-dose corticosteroid therapy was quickly initiated. Within a few days, her clinical and radiological status was dramatically improved. The pathogenesis of aseptic pneumonitis is unknown, but various proinflammatory cytokines have been implicated, especially tumor necrosis factor-alpha, which could play a role in the recruitment of leukocytes to the lung. This complication has rarely been reported but should be more widely known as the differential diagnoses include congestive heart failure, acute lung infection related or unrelated to immunosuppressive therapy, and drug hypersensitivity reaction. Early recognition would avoid delays in the correct management of this potentially lethal complication, which requires high-dose systemic corticosteroid therapy. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  7. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature

    PubMed Central

    Scaffidi, Michael A.; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon. PMID:28265555

  8. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature.

    PubMed

    Bollegala, Natasha; Khan, Rishad; Scaffidi, Michael A; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol; Grover, Samir C

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon.

  9. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    PubMed

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products.

  10. Cementless revisions of failed aseptic cemented and cementless total hip arthroplasties. 284 cases.

    PubMed

    Lord, G; Marotte, J H; Guillamon, J L; Blanchard, J P

    1988-10-01

    Over the past 13 years, 284 revisions of aseptic total hip arthroplasty failures have been performed with cementless implants. There were 213 cases involving cemented implant failures and 71 involving cementless ones. Considered as salvage procedures, these revisions provided a satisfactory result in about 70% of the reviewed patients after five years. A biologic fixation by bony ingrowth can be expected under certain conditions from decorticated living bone, a tight mechanical fitting, and a retentive corrugated surface of the implant. A prosthetic reimplantation, safely done without cement, appears more economical for the bone stock and prevents the long-term complications related with cement. Bone grafts are often required but cannot ensure the incoming osteogenic fixation of the implant. Long-term results and complications mandate harmless extractability of the revisional implant, a forged stem, an easy exchange of the plastic liner (in a two-part acetabular component), and an updated low-friction system (high-density polyethylene wear being a potential long-term problem).

  11. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  12. Molecular phylogeny and surface morphology of marine aseptate gregarines (Apicomplexa): Selenidium spp. and Lecudina spp.

    PubMed

    Leander, B S; Harper, J T; Keeling, P J

    2003-12-01

    Many aseptate gregarines from marine invertebrate hosts are thought to have retained several plesiomorphic characteristics and are instrumental in understanding the early evolution of intracellular parasitism in apicomplexans and the phylogenetic position of cryptosporidians. We sequenced the small-subunit (SSU) ribosomal RNA genes from 2 archigregarines, Selenidium terebellae and Selenidium vivax, and 2 morphotypes of the marine eugregarine Lecudina polymorpha. We also used scanning electron microscopy to investigate the surface morphology of trophozoites from Lecudina tuzetae, Monocystis agilis, the 2 species of Selenidium, and the 2 morphotypes of L. polymorpha. The SSU ribosomal DNA sequences from S. vivax and L. polymorpha had long branch lengths characteristic of other gregarine sequences. However, the sequence from S. terebellae was not exceptionally divergent and consistently emerged as 1 of the earliest 'true' gregarines in phylogenetic analyses. Statistical support for the sister relationship between Cryptosporidium spp. and gregarines was significantly bolstered in analyses including the sequence from S. terebellae but excluding the longest branches in the alignment. Eugregarines formed a monophyletic group with the neogregarine Ophryocystis, suggesting that trophozoites with elaborate cortex folds and gliding motility evolved only once. The trophozoites from the 2 species of Selenidium shared novel transverse striations but differed from one another in overall cell morphologies and writhing behavior.

  13. [Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 13 cases with mumps meningitis].

    PubMed

    Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru

    2015-01-01

    We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.

  14. A case of cerebral salt-wasting syndrome associated with aseptic meningitis in an 8-year-old boy.

    PubMed

    Inatomi, Jun; Yokoyama, Yoshiki; Sekine, Takashi; Igarashi, Takashi

    2008-04-01

    Cerebral salt-wasting syndrome is a disorder in which excessive natriuresis and subsequent hyponatremic dehydration occur in patients with intracranial diseases. Cerebral salt-wasting syndrome often develops in patients with severe neurosurgical disorders, such as hydrocephalus, cerebral infarction, and tuberculous meningitis. Here, we report on the case of an 8-year-old boy with cerebral salt-wasting syndrome associated with aseptic meningitis. He showed mild developmental retardation and had a history of convulsion. Four days after his admission, cerebral salt-wasting syndrome abruptly started: natriuresis and hyponatremia gradually improved over 10 days. To the best of our knowledge, this is the first report on cerebral salt-wasting syndrome associated with clinically benign aseptic meningitis.

  15. Vitrification of human laser treated blastocysts within cut standard straws (CSS): novel aseptic packaging and reduced concentrations of cryoprotectants.

    PubMed

    Isachenko, Vladimir; Katkov, Igor I; Yakovenko, Sergey; Lulat, Ayub G-M I; Ulug, Murat; Arvas, Ayse; Isachenko, Evgenia

    2007-06-01

    Vitrification of laser treated human blastocysts using reduced concentrations of permeable cryoprotectants was carried out by submerging cut standard straws (CSS) into liquid nitrogen. The CSS were made by cutting a standard 0.25 ml straw at an angle of approximately 45 degrees . After laser assisted hatching, 6 day blastocysts (n=250) were loaded into droplets of approximately 0.75 microl in the CSS and were either plunged directly into liquid nitrogen or first encased in a standard 0.5 ml straw (aseptic technique) before being vitrified. Permeable cryoprotectants (ethylene glycol+Me(2)SO) at concentrations of 15% and 20% v:v were tested for their effect on post warming re-expansion and post transfer pregnancy rates. Our results indicate that the use of reduced concentrations of cryoprotectants and aseptic packaging of blastocysts did not have any statistically significant impact on the study outcomes.

  16. High early post-operative complication rate after elective aseptic orthopedic implant removal of upper and lower limb.

    PubMed

    Suda, Arnold J; Heilgeist, Eva; Tinelli, Marco; Bischel, Oliver E

    2017-09-01

    The necessity of orthopedic implant removal is under intense discussion and even if it is performed as an elective procedure, the risk of complications is present. Aim of the study was to identify parameters responsible for an increased risk of early post-operative complications after elective aseptic orthopedic implant removal. We reviewed 1545 cases of aseptic and elective orthopedic implant removal between 2009 and 2011. The patient's demographic data, time and duration of operation, patient's comorbidities and presence of complications in the first four weeks after implant removal were evaluated. Patients with signs of infection at the time of the surgical procedure were excluded from this study. 579 women and 966 men who underwent elective aseptic orthopedic implant removal were identified. Mean age at implant removal was 42 years and mean duration of the surgical procedure was 37 minutes. In this cohort, 70 patients (4.5%) underwent elective aseptic implant removal after 6pm. 52 patients (3.37%) operated on during daytime suffered from complications postoperatively and 5 patients (0.3%) who were operated on during the night experienced complications. The parameters age, sex, BMI and surgeon showed no statistically significant differences for the risk of postoperative complications. Patients' comorbidities such as diabetes seem to have influence but were not statistically significant either. Patients with revision surgery since their first operation, nocturnal surgery and longer duration of the procedure showed a statistically significant higher risk for complications, especially in the lower leg. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Establishment of an operating room committee and a training program to improve aseptic techniques for rodent and large animal surgery.

    PubMed

    Héon, Hélène; Rousseau, Nathalie; Montgomery, Jane; Beauregard, Gilles; Choiniére, Manon

    2006-11-01

    Investigators of our research facility generally accept the concept of asepsis as an important component of adequate surgical care for animals. However, they experience difficulties putting it into practice, especially in the case of rodents. The reasons for this are inconvenience, cost, and lack of training. To better assist investigators in the implementation of aseptic surgical techniques in their laboratories, we have created an Operating Room (OR) Committee modeled after OR committees found in human hospitals. A reconstructive surgeon, a veterinarian, a research scientist, a nurse involved in the training of OR personnel, interns, graduate students, and an animal health technician were chosen as committee members in light of their OR and animal care expertise. The first task of the OR Committee was to establish institutional guidelines for aseptic surgery, taking into account the costs imposed on research budgets by these procedures. The OR Committee also supports a complete training program in aseptic surgery techniques, which consists of lectures, a training manual, videos, and a practical course. Furthermore, when experimental procedures require specialized equipment, the OR Committee collaborates with researchers to develop strategies to achieve asepsis. This OR Committee and the training program proved to be important tools to promote and improve the quality of animal care during surgery.

  18. Right Ventricular Perforation From a Floating Rib Following Deep Sternal Wound Infection Debridement and Application of a Vacuum-Assisted Closure Device: A Case Report and Literature Review

    PubMed Central

    2017-01-01

    Introduction: Deep sternal wound infection following major cardiac surgery is a deleterious complication with sequelae that can be life threatening. The use of vacuum-assisted closure therapy in management of sternal wounds with resultant right ventricular rupture has been documented in the cardiothoracic and to a lesser extent in the reconstructive literature. Methods/Case Report: We present a case of a 67-year-old male patient who suffered from right ventricular perforation from a floating rib following debridement of a deep sternal wound infection and placement of a vacuum-assisted closure device. Results: Despite meticulous debridement and ensuring the release of all retrosternal adhesions, massive bleeding was encountered shortly after application of the vacuum-assisted closure device. Fortunately, quick identification of the complication and the application of direct manual pressure allowed for swift return to the operating room for repair of the defect. The patient secondarily underwent definitive closure of the mediastinal wound with an omental flap and bilateral pectoral advancement flaps. Discussion: Following the conclusion of this article, the reconstructive surgeon should be able to (1) identify patients at risk for ventricular perforation, (2) exhaust all means intraoperatively to prevent cardiac perforation when using vacuum-assisted closure therapy, (3) comprehend the physiology associated with vacuum-assisted closure use in this patient population, (4) have protocols in place for the management of patients with deep sternal wound infection with vacuum-assisted closure therapy postoperatively, and (5) understand basic tenets of ventricular rupture treatment should this occur to ensure prompt repair and survival. PMID:28458765

  19. Concordance between self-reported and sternal skin conductance measures of hot flushes in symptomatic perimenopausal and postmenopausal women: a systematic review.

    PubMed

    Mann, Eleanor; Hunter, Myra S

    2011-06-01

    Sternal skin conductance is considered the gold standard in hot flush and night sweat measurement, but results sometimes differ from women's own self-reports. To date, there has been no systematic review of concordance between sternal skin conductance and self-report measures. An exploratory meta-analysis was conducted to quantify concordance between these measures and to explore the reasons for discordance between them. A search of Medline, EMBASE, Web of Science, and PsychInfo from inception to December 2009 was conducted. Studies that measured self-reported hot flushes and/or night sweats and sternal skin conductance concurrently in symptomatic perimenopausal and postmenopausal women were retained for data extraction. Studies were included if data on concordance between the two measures were available. Concordance rates overall were 29%, but variability between studies was too broad to identify a single typical concordance rate. However, concordance rates for ambulatory monitoring were more homogeneous and also had a 29% concordance rate. Nonambulatory studies tended to result in more concordant hot flushes (54%) than ambulatory studies did, and night sweats tended to be under-reported more often than over-reported (46% and 22%, respectively). Concordance rates were typically lower than early reports of sternal skin conductance measures but were highly variable between studies. Possible measurement error and study conditions might partly explain the discordance and variation in study findings, but further exploration of the effects of symptom perception is warranted. Use of both measures concurrently is likely to achieve more reliable and valid measurement of hot flushes and night sweats than either measure alone.

  20. Media-fill simulation tests in manual and robotic aseptic preparation of injection solutions in syringes.

    PubMed

    Krämer, Irene; Federici, Matteo; Kaiser, Vanessa; Thiesen, Judith

    2016-04-01

    The purpose of this study was to evaluate the contamination rate of media-fill products either prepared automated with a robotic system (APOTECAchemo™) or prepared manually at cytotoxic workbenches in the same cleanroom environment and by experienced operators. Media fills were completed by microbiological environmental control in the critical zones and used to validate the cleaning and disinfection procedures of the robotic system. The aseptic preparation of patient individual ready-to-use injection solutions was simulated by using double concentrated tryptic soy broth as growth medium, water for injection and plastic syringes as primary packaging materials. Media fills were either prepared automated (500 units) in the robot or manually (500 units) in cytotoxic workbenches in the same cleanroom over a period of 18 working days. The test solutions were incubated at room temperature (22℃) over 4 weeks. Products were visually inspected for turbidity after a 2-week and 4-week period. Following incubation, growth promotion tests were performed with Staphylococcus epidermidis. During the media-fill procedures, passive air monitoring was performed with settle plates and surface monitoring with contact plates on predefined locations as well as fingerprints. The plates got incubated for 5-7 days at room temperature, followed by 2-3 days at 30-35℃ and the colony forming units (cfu) counted after both periods. The robot was cleaned and disinfected according to the established standard operating procedure on two working days prior to the media-fill session, while on six other working days only six critical components were sanitized at the end of the media-fill sessions. Every day UV irradiation was operated for 4 h after finishing work. None of the 1000 media-fill products prepared in the two different settings showed turbidity after the incubation period thereby indicating no contamination with microorganisms. All products remained uniform, clear, and light

  1. Transmission of Seasonal Outbreak of Childhood Enteroviral Aseptic Meningitis and Hand-foot-mouth Disease

    PubMed Central

    Park, Sue K.; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu

    2010-01-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD. PMID:20436701

  2. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  3. Evaluation of disinfecting procedures for aseptic transfer in hospital pharmacy departments.

    PubMed

    Mehmi, Manita; Marshall, Lindsay J; Lambert, Peter A; Smith, Julian C

    2009-01-01

    Current practice in National Health Service (NHS) hospitals employs 70% Industrial Methylated Spirit spray for surface disinfection of components required in Grade A pharmaceutical environments. This study seeks to investigate other agents and procedures that may provide more effective sanitisation. Several methods are available to test the efficacy of disinfectants against vegetative organisms. However, no methods currently available test the efficacy of disinfectants against spores on the hard surfaces encountered in the pharmacy aseptic processing environment. Therefore, a method has been developed to test the efficacy of disinfectants against spores, modified from British Standard 13697 and Association of Analytical Chemists standards. The testing procedure was used to evaluate alternative biocides and disinfection methods for transferring components into hospital pharmacy cleanrooms, and to determine which combinations of biocide and application method have the greatest efficacy against spores of Bacillus subtilis subspecies subtilis 168, Bacillus subtilis American Type Culture Collection (ATCC) 6633, and Bacillus pumilis ATCC 27142. Stainless steel carrier test plates were used to represent the hard surfaces in hospital pharmacy cleanrooms. Plates were inoculated with 10(7)-10(8) colony-forming units per milliliter (CFU/mL) and treated with the various biocide formulations, using different disinfection methods. Sporicidal activity was calculated as log reduction in CFU. Of the biocides tested, 6% hydrogen peroxide and a quaternary ammonium compound/chlorine dioxide combination were most effective compared to a Quat/biguanide, amphoteric surfactant, 70% v/v ethanol in deionised water and isopropyl alcohol in water for injection. Of the different application methods tested, spraying followed by wiping was the most effective, followed closely by wiping alone. Spraying alone was least effective.

  4. Management and outcome of diaphyseal aseptic non-unions of the lower limb: a systematic review.

    PubMed

    Pneumaticos, Spiros G; Panteli, Michalis; Triantafyllopoulos, Georgios K; Papakostidis, Costas; Giannoudis, Peter V

    2014-06-01

    To review current treatments utilising biological enhancement modalities and their efficacy for the management of lower limb long bone aseptic non-unions. A systematic review of English articles using PubMed Medline; Ovid Medline; Embase; and the Cochrane Library was performed, supplemented by a manual search of bibliographies. Thirteen manuscripts met the inclusion criteria reporting on 428 patients. The overall healing had a pooled estimate of effect size at 94.3%. The calculated summarised estimate of effect size for deep infection rate (413 patients) was 2.3%. Three subgroups were then created on the basis of the exact type of graft used at the non-union site (ABG, BMP-7, BMP-7 + ABG). Comparison between the above subgroups revealed that ABG resulted in approximately 3-fold increase of the odds of healing compared with the use of BMP-7. Combined use of ABGs and BMP-7 improved the odds of healing by 3.5 times compared with BMP-7 alone. However, the previous median operations prior to the implantation of ABG or BMP-7 treatment was 1.09 versus 2.3 respectively (p = 0.02). Although the implantation of ABG was associated with a greater incidence of infection the documented differences did not reach significance. Although ABG was found to have a higher success rate compared to BMP-7 (95% Vs 87%), patients treated with BMP-7 had a higher number of previous failed interventions, statistically significantly so (BMP-7 is used for the treatment of more recalcitrant non-unions). It is the surgeon's judgement that should determine the most suitable treatment modality, depending on the nature and characteristics (personality) of the non-union and the patient. Copyright © 2013 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  5. Economic assessment of aseptic compounding rooms in hospital pharmacies in five European countries.

    PubMed

    Dekyndt, Bérengère; Décaudin, Bertrand; Lannoy, Damien; Odou, Pascal

    2015-04-01

    The aims of the study are to make an inventory of fixtures of aseptic compounding structures, to compare, using real examples, the design and operating costs of controlled atmosphere area (CAA) with isolators and CAA with laminar flow biological safety cabinets (BSCs) in order to determine the most economical scheme in hospitals and to give a final facilities cost calculated for one workstation. Forty-three hospitals were interviewed (21 French and 22 from four European countries) over seven months. Hospital pharmacists completed a form with 390 items. Hospitals are compared according to their workstation type: BSCII or BSCIII (group B) and isolator (group I), using Mann and Whitney's statistical test and Monte-Carlo modeling. Twenty-one hospitals responded (11 French and 10 from other European countries). All European compounding unit organizations are not significantly different. The study compared items such as infrastructure cost, equipment cost, staff cost, consumable cost, cleaning cost and control cost. A synthesis of all costs has been drafted to calculate an estimated preparation cost which seemed to be higher for group B than for group I when staff costs were included ($46 and $31, respectively, in study conditions). The different costs studied have revealed little significant difference between group B and I. The preparation cost in group B appears higher than in group I. This pilot study has resulted in the calculation of an estimated manufactured preparation cost but this work should be completed to help optimize resources and save money. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  6. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD.

  7. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae).

    PubMed

    Vujisić, Ljubodrag V; Vučković, Ivan M; Makarov, Slobodan E; Ilić, Bojan S; Antić, Dragan Z; Jadranin, Milka B; Todorović, Nina M; Mrkić, Ivan V; Vajs, Vlatka E; Lučić, Luka R; Curčić, Božidar P M; Mitić, Bojan M

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  8. Chemistry of the sternal gland secretion of the Mediterranean centipede Himantarium gabrielis (Linnaeus, 1767) (Chilopoda: Geophilomorpha: Himantariidae)

    NASA Astrophysics Data System (ADS)

    Vujisić, Ljubodrag V.; Vučković, Ivan M.; Makarov, Slobodan E.; Ilić, Bojan S.; Antić, Dragan Ž.; Jadranin, Milka B.; Todorović, Nina M.; Mrkić, Ivan V.; Vajs, Vlatka E.; Lučić, Luka R.; Ćurčić, Božidar P. M.; Mitić, Bojan M.

    2013-09-01

    The geophilomorph centipede, Himantarium gabrielis, when disturbed, discharges a viscous and proteinaceous secretion from the sternal glands. This exudate was found by gas chromatography-mass spectrometry, liquid chromatography-high resolution mass spectrometry, liquid chromatography-mass spectrometry-mass spectrometry and NMR analyses to be composed of hydrogen cyanide, benzaldehyde, benzoyl nitrile, benzyl nitrile, mandelonitrile, mandelonitrile benzoate, 3,7,6 O-trimethylguanine (himantarine), farnesyl 2,3-dihydrofarnesoate and farnesyl farnesoate. This is the first report on the presence of benzyl nitrile and mandelonitrile benzoate in secreted substances from centipedes. Farnesyl 2,3-dihydrofarnesoate is a new compound, while himantarine and farnesyl farnesoate were not known as natural products. A post-secretion release of hydrogen cyanide by reaction of mandelonitrile and benzoyl nitrile was observed by NMR, and hydrogen cyanide signals were completely assigned. In addition, a protein component of the secretion was analysed by electrophoresis which revealed the presence of a major 55 kDa protein. Analyses of the defensive exudates of other geophilomorph families should produce further chemical surprises.

  9. The effects of sternal intraosseous and intravenous administration of amiodarone in a hypovolemic swine cardiac arrest model.

    PubMed

    Smith, Samuel; Borgkvist, Bradley; Kist, Teara; Annelin, Jason; Johnson, Don; Long, Robert

    2016-01-01

    This study compared the effects of amiodarone via sternal intraosseous (SIO) and intravenous (IV) routes on return of spontaneous circulation (ROSC), time to ROSC, concentration maximum (Cmax), time to maximum concentration (Tmax), and mean concentrations over time in a hypovolemic cardiac arrest model. Prospective, between subjects, randomized experimental design. TriService Research Facility. Yorkshire-cross swine (n = 28). Swine were anesthetized and placed into cardiac arrest. After 2 minutes, cardiopulmonary resuscitation was initiated. After an additional 2 minutes, amiodarone 300 mg was administered via the tibial intraosseous TIO or the IV route. Blood samples were collected over 5 minutes. The plasma concentrations were analyzed using high-performance liquid chromatography tandem mass spectrometry. ROSC, time to ROSC, Cmax, Tmax, and mean concentrations over time. A multivariate analyses of variance indicated that there were no significant differences in the SIO and IV groups in ROSC (p = 0.191), time to ROSC (p > 0.05), Tmax mean 88.1 ± 24.8 seconds versus 49.5 ± 21.8 seconds (p = 0.317), or Cmax mean 92,700 ± 161,112 ng/mL versus 64,159.8 ± 14,174.8 ng/mL (p = 0.260). A repeated analyses of variance indicated that there were no significant differences between the groups relative to concentrations over time (p > 0.05). The SIO provides rapid and reliable access to administer life-saving medications during cardiac arrest.

  10. Concomitant Sternal Fracture in Flail Chest: An Analysis of 21,741 Polytrauma Patients from the TraumaRegister DGU®.

    PubMed

    Schulz-Drost, Stefan; Krinner, Sebastian; Langenbach, Andreas; Oppel, Pascal; Lefering, Rolf; Taylor, Dominic; Hennig, Friedrich F; Mauerer, Andreas

    2017-02-10

    Background Isolated sternal fractures (SFs) rarely show complications, but their influence in a thorax trauma of the seriously injured still remains unclear. Methods A retrospective analysis of the TraumaRegister DGU(®) was performed involving the years 2009 to 2013 (Injury Severity Score [ISS] ≥ 16, primary admission to a trauma center). Cohort formation: Unilateral and bilateral flail chest (FC) injuries with and without a concomitant SF, respectively. Results In total, 21,741 patients (25% female) met the inclusion criteria, with 3,492 (16.1%) showing SF. Unilateral FC patients were on average 53.6 ± 18.4 years old, and bilateral FC patients were on average 55.2 ± 17.7 years old. The ISS in unilateral FC and bilateral FC amounted to 31.2 ± 13.0 and 43.4 ± 13.1 points, respectively. FC with an SF occurred more frequently as an injury to car occupants and less frequently as an injury to motorcyclists or in injuries due to falls. Conclusion Patients with an SF additional to an FC had longer hospital and intensive care unit stays and were longer artificially respirated than those patients without an SF. SF indicates possible cardiac and thoracic spine injuries.

  11. Absolute identification of muramic acid, at trace levels, in human septic synovial fluids in vivo and absence in aseptic fluids.

    PubMed

    Fox, A; Fox, K; Christensson, B; Harrelson, D; Krahmer, M

    1996-09-01

    This is the first report of a study employing the state-of-the-art technique of gas chromatography-tandem mass spectrometry for absolute identification of muramic acid (a marker for peptidoglycan) at trace levels in a human or animal body fluid or tissue. Daughter mass spectra of synovial fluid muramic acid peaks (> or = 30 ng/ml) were identical to those of pure muramic acid. Absolute chemical identification at this level represents a 1,000-fold increase in sensitivity over previous gas chromatography-mass spectrometry identifications. Muramic acid was positively identified in synovial fluids during infection and was eliminated over time but was absent from aseptic fluids.

  12. Recurrent aseptic meningitis as a rare but important presentation of congenital petrous apex cholesteatoma: the value of appropriate imaging

    PubMed Central

    MacKeith, Samuel A; Soledad-Juarez, Maria; Tiberti, Liliana; Orfila, Daniel

    2014-01-01

    We describe the presentation, investigation and challenging management of a young adult with recurrent aseptic meningitis. The presence of cholesterol and triglycerides in the cerebrospinal fluid sample was recognised as a potential sign of an underlying dermoid or epidermoid cyst. We demonstrate how appropriate imaging of the skull base with diffusion-weighted imaging (DWI) MRI can help differentiate between lesions of the petrous apex, facilitating the diagnosis of a petrous apex congenital cholesteatoma/epidermoid cyst. Awareness of this unusual mode of presentation of a rare disease, as well as knowledge of key diagnostic investigations, may allow for earlier identification, treatment and reduced morbidity/mortality. PMID:24614768

  13. Transcriptome-Wide High-Density Microarray Analysis Reveals Differential Gene Transcription in Periprosthetic Tissue From Hips With Chronic Periprosthetic Joint Infection vs Aseptic Loosening.

    PubMed

    Omar, Mohamed; Klawonn, Frank; Brand, Stephan; Stiesch, Meike; Krettek, Christian; Eberhard, Jörg

    2017-01-01

    Differentiating between periprosthetic hip infection and aseptic hip prosthesis loosening can be challenging, especially in patients with chronic infections. This study used whole-genome microarray analysis to investigate the transcriptomes of periprosthetic hip tissues to identify genes that are differentially transcripted between chronic periprosthetic hip infection and aseptic hip prosthesis loosening. In this pilot study, a total of 24 patients with either chronic periprosthetic hip infection (n = 12) or aseptic hip prosthesis loosening (n = 12) were analyzed. Periprosthetic hip infection was diagnosed based on modified criteria of the Musculoskeletal Infection Society. To evaluate differences in gene transcription, whole-genome microarray analysis was performed on the mRNA of periprosthetic tissue. Microarray analysis revealed differential gene transcription in periprosthetic hip tissue affected by chronic hip infection vs aseptic hip prosthesis loosening. A total of 39 genes had area under the curve values greater than 0.9 for diagnosing chronic periprosthetic hip infection; 5 genes had annotations relevant to infection and metabolism. The 39 genes also included 7 genes that were differentially transcribed but that have no apparent connection to immune response processes plus 27 genes with unknown function. Differences in gene transcription profiles might represent novel diagnostic targets that can be used to differentiate between chronic periprosthetic hip infections and aseptic hip prosthesis loosening. Secondary metabolites of differentially transcripted genes might serve as easily accessible markers for detecting chronic periprosthetic joint infection in future. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Unresectable huge sternal and mediastinal metastasis of follicular thyroid carcinoma; radiotherapy as first-line and palliative therapy.

    PubMed

    Nar Demirer, A; Ayturk, S; Tutuncu, N B; Gursoy, A; Pak, Y; Demirag, N G

    2009-04-01

    Distant metastases as initial manifestation of follicular thyroid carcinoma is rare. We report a case of an unusual initial presentation of follicular thyroid carcinoma on follow-up. A 52- year-old woman presented with a 12-month history of progressively enlarging mass in the anterior chest wall. The mass was fixed to the chest wall, measuring 12 x 10 cm in diameter. Computed tomography demonstrated a lobulated soft-tissue mass (17 x 11 x 6 cm) destructing sternum and extending into the anterior mediastinum. There was no lung metastasis. Invasion of tumor to the ascending aorta, superior vena cava, and right atrium could not be excluded. Multiple lymph nodes were observed in the supraclavicular regions. Ultrasonography of the thyroid gland showed 46 x 37 mm nodule in the left lobe with milimetric gross calcifications and cystic-necrotic areas. Hyperthyroidism was detected. Biopsy from this nodule and the sternal mass revealed typical histology of follicular carcinoma. She was considered inoperable. Since there was huge tumor burden and iodinated contrast exposure for several times during evaluation, we decided to treat the patient with external beam radiotherapy (EBRT) rather than radioiodine as first-line therapy. After a course of conventional radiation with 50 Gy in 25 fractions over 4 weeks, encompassing the thyroid bed and the gross disease, tumor regressed remarkably in 6 months. In conclusion, when surgical resection is not possible, EBRT may be used for palliative purpose to obtain local control for extensive disease as first-line therapy. The indications of EBRT for differentiated thyroid cancer still remain poorly defined.

  15. The monoptychic glands of the jugulo-sternal scent gland field of Tupaia: a TEM and SEM study.

    PubMed

    Zeller, U; Richter, J

    1990-10-01

    The monoptychic 'apocrine' scent glands of the sternal region of two adult male Tupaia belangeri were studied by transmission and scanning electron microscopy, in order to assess the modes of release of their secretory products. In segments of the secretory tubules with a narrow lumen the epithelial cells are columnar and are firmly connected to each other by desmosomes and junctional complexes. Myoepithelial cells are interspersed between the secretory epithelium and the basement membrane. The cytoplasm of the secretory epithelial cells contains granular and agranular endoplasmic reticulum, mitochondria, Golgi apparatus, lysosomes and secretory granules. The free surface of the secretory epithelium is furnished with densely arranged microvilli. The apices of the cells protrude as dome-shaped extensions into the glandular lumen. At the tip of these extensions cellular processes of irregular shape are found. The surface of these processes shows no microvilli. They contain densely packed and dilated cisternae of agranular endoplasmic reticulum and free ribosomes. The constriction of the base of these processes and the occasional observation of a 'demarcation membrane' between a process and the secretory cell indicate that these secretory processes become detached from the secretory cells according to the apocrine mode of extrusion. Within the glandular lumen they break down and form secretion. Parallel to this apocrine extrusion the same cells produce secretory granules, the diameter of which measures 300-900 nm. The contents of these granules are released into the glandular lumen by exocytosis according to the eccrine mode of secretion. This resembles the situation in other mammals in which monoptychic glands release their secretory products by means of both apocrine and eccrine extrusion. Therefore monoptychic skin glands should not be classified into apocrine and eccrine glands. Our results corroborate Schaffer's (1927, 1940) more general classification of

  16. Vitrified sperm banks: the new aseptic technique for human spermatozoa allows cryopreservation at -86 °C.

    PubMed

    Sánchez, R; Risopatrón, J; Schulz, M; Villegas, J V; Isachenko, V; Isachenko, E

    2012-12-01

    The vitrification technique is simple, quick, cost-effective and has showed a significantly stronger cryoprotective effect in contrast to conventional freezing. The method is based on the rapid cooling of the cell by direct immersion in liquid nitrogen (LN (2) ), thereby avoiding the formation of ice crystals, due to the lower risk of water thawing, which impairs cell function. The aim of this study was to evaluate the effect of storage at -86 °C compared to the conventional -196 °C (under LN (2) ) on essential parameters of the functioning of aseptically vitrified human sperm. Sperm motility, integrity of mitochondrial membrane potential and the rate of DNA fragmentation were determined. The comparison of -86 °C and -196 °C demonstrated no statistical difference in sperm progressive motility (73% vs. 77%), integrity of mitochondrial membrane potential (71% vs. 74%) or DNA fragmentation (3.1% vs. 2.9%). In conclusion, aseptically vitrified sperm can be preserved at -86 °C; eliminating the use of LN (2) simplifies and significantly reduces the costs associated with storage in sperm banks by decreasing the time and space needed for storage, the effort in finding stored samples, and by improving safety for the operator. However, for prolonged storage further studies are needed.

  17. [Detection of enterovirus RNA in cerebrospinal fluid from patients with aseptic meningitis and encephalitis and its clinical significance].

    PubMed

    Li, A; Chen, Z; Liu, Q

    2001-12-01

    To study the pathogenicity of enterovirus (EV) infection in central nervous system and the method for its detection. Using reverse transcription polymerase chain reaction (RT-PCR) and viral culture techniques to detect EV from 46 cerebrospinal fluid (CSF) samples of aseptic meningitis and encephalitis patients. The sensitivity and specificity of RT-PCR for EV RNA detection was affirmed by specific RNA identification of 40 strains of prototype enterovirus. By the virus culture method, 14 out of the 46 CSF sample were tested to beEV positive (26.1%) including 6 Echovirus type 2 (ECV2), 2 Coxackie virus type B2 (CVB2), 2CVB6, 1 ECV3 and 1 ECV11. By RT-PCR method, 31 of 46 CSF sample were tested EV RNA positive (67.4%) through amplified product agarose electrophoresis and northern blot hybridizition. The positive CSF included 14 samples that had been tested positive by virus culture and 17 samples that accounted for 53.9% of the 32 CSF samples which were negetive by virus culture. The sensitivity of RT-PCR was statistically higher than that of the virus culture method, Chi(2) =12.57, P <0.01. EV is known as important etiological agents of aseptic meningitis and encephalitis. RT-PCR is sensitivity, specificity and rapidity, it may be popularized as an effective method to the detection of enterovirus.

  18. Resection of sternal metastasis from endometrial carcinoma followed by reconstruction with sandwiched marlex and stainless steel mesh: report of a case.

    PubMed

    Haraguchi, Shuji; Hioki, Masafumi; Hisayoshi, Takao; Yamashita, Koji; Koizumi, Kiyoshi; Shimizu, Kazuo

    2006-01-01

    We report the successful resection of sternal metastasis from endometrial carcinoma, followed by reconstruction of the chest defect, in an 87-year-old woman. We performed subtotal sternectomy and concurrent resection of the ribs and overlying soft tissue. The skeletal defect was then reconstructed with sandwiched Marlex and stainless steel mesh, and soft tissue coverage was accomplished by using a pectoralis major advancement flap. The patient had an uneventful postoperative course with no sign of recurrence during 5 years of follow-up. Thus, reconstruction with Marlex and stainless steel mesh could be an effective technique for preventing paradoxical movement of the thorax and protecting the intrathoracic organs.

  19. [FDG PET as an early nuclear medical diagnostic tool for aseptic wear-induced loosening of hip joint endoprostheses--a report of two cases].

    PubMed

    Mumme, T; Cremerius, U; Hermanns, B; Neuss, M; Müller-Rath, R; Büll, U; Wirtz, D C

    2003-07-01

    To date, 2-[F-18]fluoro-2-deoxy-D-glucose PET (FDG PET) is used as a tool in oncology as well as myocardiological and cerebral functional diagnostics in the clinical routine. False positive results of tumor search imply new possibilities for use in diagnostics of inflammation. The two case reports presented here on aseptic loosening of endoprostheses caused by the rub of polyethylene with histological and immunohistological refurbishing call attention to the possible diagnostic valency of FDG PET as an early warning system regarding aseptic artificial limb loosening induced by the rub of polyethylene. By quantification of glucose metabolism with the "standard uptake value" (SUV) as well as specific storage samples from around the artificial limb, it is the aim of our study group in further examinations to develop an algorithm which permits to distinguish between septic and aseptic loosening.

  20. Low Rates of Aseptic Tibial Loosening in Obese Patients With Use of High-Viscosity Cement and Standard Tibial Tray: 2-Year Minimum Follow-Up.

    PubMed

    Crawford, David A; Berend, Keith R; Nam, Denis; Barrack, Robert L; Adams, Joanne B; Lombardi, Adolph V

    2017-09-01

    Total knee arthroplasty is overall a very successful surgery, but complications do occur. These complications include aseptic loosening of the tibial component, and obese patients are among the highest risk group. High-viscosity cement (HVC) has been implicated as a possible cause for aseptic loosening of the tibial component. The purpose of this study was to evaluate the incidence of aseptic loosening of the tibial component in obese patients with the use of HVC and standard tibial tray. We identified 1366 obese patients (1851 knees) with a body mass index >35 kg/m(2) and 2-year minimum follow-up who underwent primary total knee arthroplasty using HVC and a symmetrical, grit-blasted, cobalt-chrome tibial component with 40-mm stem. Preoperative and postoperative range of motion, Knee Society (KS) scores, complications, and reoperations were evaluated. Specifically, we assessed the rate of tibial aseptic loosening. At a mean 5.4 years follow-up, only 1 in 1851 knees had aseptic loosening of the tibial component for an incidence of 0.054%. There was a mean increase of 3.3 degrees of knee range of motion. KS pain level decreased by 38.6 points (50 point scale). KS clinical scores improved by 52.2, Knee Society functional scores improved by 19.5, University of California, Los Angeles, activity score improved by 0.9, and Oxford Knee Score by 15.7. All these improvements were statistically significant with P < .001. Standard tibial components and HVC can be used in most patients, including the high-risk obese group, with low rates of tibial aseptic loosening. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Metal is not inert: role of metal ions released by biocorrosion in aseptic loosening--current concepts.

    PubMed

    Cadosch, Dieter; Chan, Erwin; Gautschi, Oliver P; Filgueira, Luis

    2009-12-15

    Metal implants are essential therapeutic tools for the treatment of bone fractures and joint replacements. The metals and metal alloys used in contemporary orthopedic and trauma surgery are well tolerated by the majority of patients. However, complications resulting from inflammatory and immune reactions to metal implants have been well documented. This review briefly discusses the different mechanisms of metal implant corrosion in the human body, which lead to the release of significant levels of metal ions into the peri-implant tissues and the systemic blood circulation. Additionally, this article reviews the effects of the released ions on bone metabolism and the immune system and discusses their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity in patients with metal implants.

  2. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  3. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  4. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  5. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared.

  6. Aseptic lymphocyte dominated vasculitis-associated lesion resulting from trunnion corrosion in a cobalt-chrome unipolar hemiarthroplasty.

    PubMed

    Khair, M Michael; Nam, Denis; DiCarlo, Edward; Su, Edwin

    2013-01-01

    Most of the published descriptions of adverse soft tissue reactions that have been reported in the context of a metal-on-metal articulation have been in cases of total hip arthroplasty or resurfacing arthroplasty. Recently, several case reports have been published describing aseptic lymphocyte dominated vasculitis-associated lesions (ALVAL) in metal-on-polyethylene. To our knowledge, there has not been a description of a similar, aggressive reaction secondary to metal debris from the head-neck junction of a unipolar hemiarthroplasty component. In this case report, we describe a patient with a catastrophic failure of a unipolar hip hemiarthroplasty, secondary to aggressive osteolysis and an inflammatory mediated immunological reaction to metal debris. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  8. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  9. The metal nanoparticle-induced inflammatory response is regulated by SIRT1 through NF-κB deacetylation in aseptic loosening.

    PubMed

    Deng, Zhantao; Jin, Jiewen; Wang, Zhenheng; Wang, Yong; Gao, Qian; Zhao, Jianning

    2017-01-01

    Aseptic loosening is the most common cause of total hip arthroplasty (THA) failure, and osteolysis induced by wear particles plays a major role in aseptic loosening. Various pathways in multiple cell types contribute to the pathogenesis of osteolysis, but the role of Sirtuin 1 (SIRT1), which can regulate inflammatory responses through its deacetylation, has never been investigated. We hypothesized that the downregulation of SIRT1 in macrophages induced by metal nanoparticles was one of the reasons for osteolysis in THA failure. In this study, the expression of SIRT1 was examined in macrophages stimulated with metal nanoparticles from materials used in prosthetics and in specimens from patients suffering from aseptic loosening. To address whether SIRT1 downregulation triggers these inflammatory responses, the effects of the SIRT1 activator resveratrol on the expression of inflammatory cytokines in metal nanoparticle-stimulated macrophages were tested. The results demonstrated that SIRT1 expression was significantly downregulated in metal nanoparticle-stimulated macrophages and clinical specimens of prosthesis loosening. Pharmacological activation of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines in vitro and osteolysis in vivo. Furthermore, SIRT1 regulated particle-induced inflammatory responses through nuclear factor kappa B (NF-κB) acetylation. Thus, the results of this study suggest that SIRT1 plays a key role in metal nanoparticle-induced inflammatory responses and that targeting the SIRT1 pathway may lead to novel therapeutic approaches for the treatment of aseptic prosthesis loosening.

  10. EVALUATION OF THE EFFECTS OF STERNAL VERSUS LATERAL RECUMBENCY ON TRENDS OF SELECTED PHYSIOLOGIC PARAMETERS DURING ISOFLURANE ANESTHESIA IN ZOO-HOUSED BLACK-TAILED PRAIRIE DOGS (CYNOMYS LUDOVICIANUS).

    PubMed

    Eshar, David; Mason, Diane; Avni-Magen, Nili; Kaufman, Elizabeth; Paz, Avital; Beaufrère, Hugues

    2017-06-01

    Isoflurane gas anesthesia is often used for immobilization of prairie dogs in field studies, laboratory research, and veterinary clinical purposes. The goals of this prospective study were to evaluate the effects of sternal versus right lateral recumbency on trends of selected physiologic parameters during isoflurane anesthesia in black-tailed prairie dogs ( Cynomys ludovicianus ). Fourteen adult, zoo-housed black-tailed prairie dogs were tested during the study. Animals were anesthetized using isoflurane and randomly placed in either sternal or right lateral recumbency to evaluate changes in trends of physiologic parameters, measured selectively every 30 min throughout a 60-min anesthesia period. Results were analyzed using linear mixed modeling. Right lateral recumbency resulted in a decrease in anion gap of about 4.6 mEq/L (95% confidence interval [95% CI]: 3.1-6.0, P < 0.001), whereas sternal recumbency resulted in a lower decrease of 2.1 mEq/L (95% CI: 0.7-3.6, P = 0.02). However, the absolute values at the beginning and at the end of the anesthesia time were not significantly different between the right lateral and sternal recumbency (all P > 0.57). Body position did not have any effect on any other variables, and most of the observed physiologic changes were due to the duration of anesthesia. Our results indicate no significant effect on trends of selected physiologic parameters between sternal recumbency and right lateral recumbency during 1 hr of isoflurane anesthesia in black-tailed prairie dogs.

  11. Preliminary Outcomes of Distal IMAP and SEAP Flaps for the Treatment of Unstable Keloids Subject to Recurrent Inflammation and Infections in the Lower Sternal and Upper Abdominal Areas.

    PubMed

    Wang, Jue; Min, Peiru; Grassetti, Luca; Lazzeri, Davide; Zhang, Yi Xin; Nicoli, Fabio; Innocenti, Marco; Torresetti, Matteo; Levin, L Scott; Persichetti, Paolo

    2015-11-01

    We present the clinical application of the sixth internal mammary artery perforator (IMAP) and superior epigastric artery perforator (SEAP) flaps for the treatment of defects resulting from the excision of large lower sternal and upper abdominal keloids. Perforator selection and flap design were based solely on preoperative multidetector-row computed tomographic angiography (MDCTA) of the areas adjacent to the soft tissue defects. Between January 2009 and June 2014, 15 patients with large, unstable keloids subject to recurrent inflammation and infections and with a history of multiple failed treatments underwent surgical excision and early postoperative radiation therapy. The defects were located in the upper abdomen (n = 6) or lower sternum (n = 9). All patients underwent preoperative MDCTA for perforator localization. A total of 15 patients underwent keloid removal followed by IMAP (n = 10) and SEAP (n = 6) flap coverage combined with early postoperative low-dose radiation therapy (350 cGy/5 fractions/5 days or 400 cGy/4 fractions/4 days). Flap sizes ranged from 9 × 5 to 17 × 6 cm. Only one IMAP flap developed a 2 × 2 cm tip necrosis, which was managed with dressing changes. The remaining flaps healed uneventfully with no keloid recurrence at 23.4 months. In all cases, the perforator location determined by preoperative MDCTA was precisely consistent with the intraoperative findings. The sixth IMAP and SEAP flaps combined with early postoperative radiation therapy provided a valid and feasible approach for the surgical treatment of large keloids in the lower sternal and upper abdominal. MDCTA enabled detailed preoperative assessment of the perforators, facilitating both flap design and dissection, and saving operating time. Although longer follow-up is required, these preliminary results are encouraging. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  12. Younger age is associated with a higher risk of early periprosthetic joint infection and aseptic mechanical failure after total knee arthroplasty.

    PubMed

    Meehan, John P; Danielsen, Beate; Kim, Sunny H; Jamali, Amir A; White, Richard H

    2014-04-02

    Although early aseptic mechanical failure after total knee arthroplasty has been reported in younger patients, it is unknown whether early revision due to periprosthetic joint infection is more or less frequent in this patient subgroup. The purpose of this study was to determine whether the incidence of early periprosthetic joint infection requiring revision knee surgery is significantly different in patients younger than fifty years of age compared with older patients following primary unilateral total knee arthroplasty. A large population-based study was conducted with use of the California Patient Discharge Database, which allows serial linkage of all discharge data from nonfederal hospitals in the state over time. Patients undergoing primary unilateral total knee arthroplasty during 2005 to 2009 were identified. Principal outcomes were partial or complete revision arthroplasty due to periprosthetic joint infection or due to aseptic mechanical failure within one year. Multivariate analysis included risk adjustment for important demographic and clinical variables. The effect of hospital total knee arthroplasty volume on the outcomes of infection and mechanical failure was analyzed with use of hierarchical modeling. At one year, 983 (0.82%) of 120,538 primary total knee arthroplasties had undergone revision due to periprosthetic joint infection and 1385 (1.15%) had undergone revision due to aseptic mechanical failure. The cumulative incidence in patients younger than fifty years of age was 1.36% for revision due to periprosthetic joint infection and 3.49% for revision due to aseptic mechanical failure. In risk-adjusted models, the risk of periprosthetic joint infection was 1.8 times higher in patients younger than fifty years of age (odds ratio = 1.81, 95% confidence interval = 1.33 to 2.47) compared with patients sixty-five years of age or older, and the risk of aseptic mechanical failure was 4.7 times higher (odds ratio = 4.66, 95% confidence interval = 3.77 to

  13. Case report of early aseptic loosening of total hip arthroplasty in monostotic paget disease, a diagnostic challenge.

    PubMed

    Crego-Vita, Diana; Aedo-Martín, Daniel; Sánchez-Pérez, Coral

    2016-01-01

    Paget's disease of bone is a localised chronic osteopathy which produces bone deformities, bone hypervascularity, structural weakness and altered joint biomechanics. Although radiological diagnosis of Paget's disease of bone is usually straightforward, monostotic cases may potentially raise specific problems which require invasive and expensive procedures such as bone biopsies. The pelvis and upper femur are frequently affected, resulting in disabling hip disease that may require total hip arthroplasty. We report a case of Paget disease of bone in an 84-year-old woman, which was initially identified as avascular necrosis of the hip, reason for which she underwent total hip arthroplasty. During follow up, the patient complained about hip pain and in a few months she was not able to walk because of an early loosening with bone destruction. Radiological and laboratory exams were carried out with normal results except for alkaline phosphatase (AP). After treatment with biphosphonates hip pain relieved but hip reconstruction was not possible. In this paper we present an early aseptic loosening of hip arthroplasty due to monostotic Paget's disease of bone, a rare ethiology of loosening which poses particular diagnostic difficulties prompting an excessive use of excisional biopsies.

  14. Interferon-gamma and cortisol levels in cerebrospinal fluid and its relationship to the etiology of aseptic meningoencephalitis.

    PubMed

    Holub, M; Beran, O; Lacinová, Z; Cinek, O; Chalupa, P

    2006-01-01

    The aim of the study was to analyze the concentrations of Th1/Th2 cytokines and cortisol in the cerebrospinal fluid (CSF) from patients with aseptic meningoencephalitis (AM). The study enrolled 37 patients with AM and 11 control subjects. CSF concentrations of IL-2, IL-4, IL-5, IL-10, IFN-gamma, and TNF-alpha were analyzed using cytokine bead array and flow cytometry; CSF cortisol concentrations were measured by a RIA method. Cortisol was detected in 37 CSF samples (100%) from patients with AM, and it was significantly elevated in comparison to control subjects. IFN-gamma was detected in 32 CSF samples (86.5%) and IL-10 was detectable in 9 CSF samples (24.3%). The CSF cortisol levels correlated negatively with the duration of AM. The intrathecal concentration of IFN-gamma correlated positively with CSF numbers of leukocytes and lymphocytes, and negatively with the duration of AM. The etiology of AM influenced the CSF cortisol concentration, which was significantly higher in patients with tick-borne encephalitis when compared to persons with AM of unknown origin and control subjects. The results indicate that the prevailing intrathecal immune reaction during AM is shifted to a Th1-like response, whereas anti-inflammatory response in the brain is executed by the effect of cortisol.

  15. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  16. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  17. Broad-range 16S rRNA PCR with cerebrospinal fluid may be unreliable for management of postoperative aseptic meningitis.

    PubMed

    Zarrouk, Virginie; Leflon-Guibout, Véronique; Robineaux, Sébastien; Kalamarides, Michel; Nicolas-Chanoine, Marie-Hélène; Sterkers, Olivier; Fantin, Bruno

    2010-09-01

    We previously demonstrated that discontinuing presumptive antibiotic treatment in cases of negative conventional cultures is safe and effective for patients with postoperative aseptic meningitis (PAM). Here, we prospectively investigated 32 patients with postoperative meningitis. All 26 patients with PAM diagnosed on the basis of conventional cultures demonstrated negative 16S rRNA PCR results. Our results suggest that the PCR technique does not change PAM management.

  18. An Unusual Case of Primary Human Immunodeficiency Virus Infection Presenting as Mononucleosis-like Syndrome and Acute Aseptic Meningoencephalitis. Report of a Case and Review of the Literature.

    PubMed

    Corti, Marcelo; Gilardi, Leonardo

    2014-07-01

    Clinical presentation of primary human immunodeficiency virus (HIV) infection includes a wide spectrum of manifestations from asymptomatic infection to a symptomatic and severe illness. Central nervous system involvement should be always considered as a severe clinical form of primary HIV infection. Physicians should be aware to the broad clinical spectrum of primary HIV infection. We report a case of a female with diagnosis of mononucleosis-like syndrome and acute aseptic meningoencephalitis during primary HIV infection.

  19. An Unusual Case of Primary Human Immunodeficiency Virus Infection Presenting as Mononucleosis-like Syndrome and Acute Aseptic Meningoencephalitis. Report of a Case and Review of the Literature

    PubMed Central

    Corti, Marcelo; Gilardi, Leonardo

    2014-01-01

    Clinical presentation of primary human immunodeficiency virus (HIV) infection includes a wide spectrum of manifestations from asymptomatic infection to a symptomatic and severe illness. Central nervous system involvement should be always considered as a severe clinical form of primary HIV infection. Physicians should be aware to the broad clinical spectrum of primary HIV infection. We report a case of a female with diagnosis of mononucleosis-like syndrome and acute aseptic meningoencephalitis during primary HIV infection. PMID:25374871

  20. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    PubMed Central

    Orion, Camille; Sfecci, Alicia; Tisseau, Laurent; Darrieux, Laure; Safa, Gilles

    2016-01-01

    Idiopathic facial aseptic granuloma (IFAG) is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea. PMID:27920676

  1. Low aseptic loosening and revision rate in Zweymüller-Plus total hip arthroplasty with ceramic-on-ceramic bearings.

    PubMed

    Bouras, T; Repantis, T; Fennema, P; Korovessis, P

    2014-12-01

    A recent comparative study reported lower revision rate and higher survival in ceramic-on-ceramic (CoC) than in metal-on-metal (MoM) coupling in Zweymüller-Plus THA. We retrospectively studied 87 consecutive patients (94 hips), who primarily received Zweymüller-Plus THA (SL-Plus stem, ceramic 28-mm ball head, Bicon cup) with third-generation CoC bearing surfaces for osteoarthritis. Survival, revision and osteolysis rate were studied and compared to those observed in historical series from this institution with the same THA and MoM articulation. The mean ± SD follow-up was 7.4 ± 1.7 years (range 6-10 years). Four hips (4%) in four patients were revised 1-6 years following primary implantation: one (1%) for aseptic loosening of SL-Plus stem and Bicon 5 years after index surgery; one (1%) for malpositioning of the Bicon and recurrent dislocations 1 year following implantation; and two (2%) for septic loosening 1 and 6 years postoperatively. Intraoperatively on inspection, there were neither findings for impingement in the revised hips, nor fracture of the Bicon ceramic inlay and ball head. Expansile osteolysis was shown around SL-Plus stem and Bicon in the revised for aseptic loosening hip. With revision of any component for aseptic loosening as the endpoint, the survival was 99% (95% CI 91-100%), while for revision for any reason, it was 95% (95% CI 87-98%) at 10 years. Zweymüller-Plus THA with CoC bearings showed, at mid-term follow-up, high survival and low revision rate for aseptic loosening. These rates were better than the historical series of the same THA with MoM articulation performed by the same surgeon. Level IV.

  2. Feasibility of aseptic processing of a low-acid multiphase food product (salsa con queso) using a continuous flow microwave system.

    PubMed

    Kumar, P; Coronel, P; Simunovic, J; Sandeep, K P

    2007-04-01

    Aseptic processing of a low-acid multiphase food product using a continuous flow microwave heating system can combine the advantages of an aseptic process along with those of microwave heating. Dielectric properties of 2 different brands of 1 such product (salsa con queso) were measured under continuous flow conditions at a temperature range of 20 to 130 degrees C. At 915 MHz, the dielectric constant ranged from 58.7 at 20 degrees C to 41.3 at 130 degrees C with dielectric loss factor ranging from 41.0 at 20 degrees C to 145.5 at 130 degrees C. The loss tangent at 915 MHz ranged from 0.61 at 20 degrees C to 3.52 at 130 degrees C. The temperature profiles at the outlet during processing of salsa con queso in a 5-kW microwave unit showed a narrow temperature distribution between the center and the wall of the tube. The study showed the feasibility of aseptic processing of salsa con queso using a continuous flow microwave system.

  3. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    PubMed

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. [Aseptic loosening of total ankle replacement : Two-stage revision with bone augmentation of osseous defects and secondary prosthesis implantation].

    PubMed

    Barg, A; Wiewiorski, M; Valderrabano, V

    2017-06-01

    To remove loosened ankle prosthesis components, perform osseous defect augmentation, and reimplant definitive prosthesis components to preserve ankle range of motion. Aseptic loosening of the tibial and/or talar ankle prosthesis components with substantial bone defect. General surgical/anesthesiological risks, infections, critical soft tissue conditions, nonmanageable hindfoot instability, neurovascular impairment of the lower extremity, neuroarthropathy, substantial nonreconstructable osseous defects with or without cysts on the tibial and/or talar side, noncompliance, primary total ankle replacement (TAR) using intramedullary fixation (stem fixation), severely reduced bone quality, insulin-dependent diabetes mellitus, smoking, unrealistic patients' expectations, high activity in sports. Exposure of the ankle joint using the previous incision. Mobilization and removal of loosened prosthesis components. Debridement of bone stock. Assessment and measurement of osseous defects. Harvesting of iliac crest autograft. Screw fixation of iliac crest autograft. Placement of polyethylene inlay as a spacer. Wound closure in layers at the ankle and the iliac crest. Implantation of definitive prosthesis components. A soft wound dressing. Thromboprophylaxis recommended. Mobilization on postoperative day 1 using a stabilizing walking boot/cast for 6 weeks (sole contact but no weight bearing). Clinical and radiographic follow-up 3 months postoperatively including computed tomography to assess osseous consolidation. After the second surgery, patient mobilization on postoperative day 1 with 15 kg partial weight bearing using a stabilizing walking boot/cast for 6 weeks. Following clinical and radiographic follow-up at 6 weeks, full weight bearing is initiated gradually. From January 2007 to December 2012, a two-stage revision TAR was performed in 5 patients (46.8 and 71.4 years). The time between the initial TAR and revision was 2.4-11.5 years. No intra

  5. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression.

  6. 18F-FDG microPET imaging differentiates between septic and aseptic wound healing after orthopedic implant placement

    PubMed Central

    Odekerken, Jim C E; Brans, Boudewijn T; Welting, Tim J M; Walenkamp, Geert H I M

    2014-01-01

    Background and purpose 18F-FDG PET is a widely used tool for molecular imaging of oncological, cardiovascular, and neurological disorders. We evaluated 18F-FDG microPET as an implant osteomyelitis imaging tool using a Staphylococcus aureus-induced peroperative implant infection in rabbits. Methods Intramedullary titanium nails were implanted in contaminated and uncontaminated (control) proximal right tibiae of rabbits. Tibiae were quantitatively assessed with microPET for 18F-FDG uptake before and sequentially at 1, 3, and 6 weeks after surgery. Tracer uptake was assessed in soft tissue and bone in both treatment groups with an additional comparison between the operated and unoperated limb. MicroPET analysis was combined with radiographic assessment and complementary histology of the tibiae. Results At the first postoperative week, the 18F-FDG uptake in the contaminated implant group was significantly higher than the preoperative measurement, without a significant difference between the contaminated and uncontaminated tibiae. From the third postoperative week onward, 18F-FDG uptake allowed discrimination between osteomyelitis and postoperative aseptic bone healing, as well as quantification of the infection at distinct locations around the implant. Interpretation 18F-FDG-based microPET imaging allows differentiation between deep infection and undisturbed wound healing after implantation of a titanium intramedullary nail in this rabbit model. Furthermore, our results indicate that 18F-FDG PET may provide a tool in human clinical diagnostics and for the evaluation of antimicrobial strategies in animal models of orthopedic implant infection. PMID:24673540

  7. Impact of rapid enterovirus molecular diagnosis on the management of infants, children, and adults with aseptic meningitis.

    PubMed

    Archimbaud, C; Chambon, M; Bailly, J L; Petit, I; Henquell, C; Mirand, A; Aublet-Cuvelier, B; Ughetto, S; Beytout, J; Clavelou, P; Labbé, A; Philippe, P; Schmidt, J; Regagnon, C; Traore, O; Peigue-Lafeuille, H

    2009-01-01

    Enteroviruses (EV) are the main etiological agents of aseptic meningitis. Diagnosis is made by detecting the genome using RT-PCR. The aim of the study was to evaluate the impact of a positive diagnosis on the management of infants, children, and adults. During 2005, 442 patients were admitted to hospital with suspected meningitis. Clinical and laboratory data and initial treatment were recorded for all patients with enteroviral meningitis. The turnaround time of tests and the length of hospital stay were analyzed. The results showed that EV-PCR detected EV in 69 patients (16%), 23% (16/69) were adults. About 18% of CSF samples had no pleocytosis. After positive PCR results, 63% of children were discharged immediately (mean 2 hr 30 min) and 95% within 24 hr. Infants and adults were discharged later (after 1.8 and 2 days, respectively). The use of antibiotics was significantly lower in children than in infants and adults. The PCR results allowed discontinuation of antibiotics in 50-60% of all patients treated. Patients received acyclovir in 16% of cases (7% children vs. 50% adults) and 23% (11% vs. 69%) underwent a CT scan. Clinical data were compared between patients whose positive EV-PCR results were available within 24 hr (n = 32) and those whose results were available > 24 hr after collection of CSF (n = 14). Duration of antibiotic treatment (difference: 2.3 days; P = 0.05) was reduced between the two groups. No statistical difference in the length of stay was observed. The EV-PCR assay should be performed daily in hospital laboratory practice and considered as part of the initial management of meningitis.

  8. [Analysis of surgical treatment with pectoralis major muscle flap for deep sternal infection after cardiac surgery: a case series of 189 patients].

    PubMed

    Liu, Dong; Wang, Wenzhang; Cai, Aibing; Han, Zhiyi; Li, Xiyuan; Ma, Jiagui

    2015-03-01

    To analyze and summarize the clinical features and experience in surgical treatment of deep sternal infection (DSWI). This was a retrospective study. From January 2008 to December 2013, 189 patients with secondary DSWI after cardiac surgery underwent the pectoralis major muscle flap transposition in our department. There were 116 male and 73 female patients. The mean age was (54 ± 21) years, the body mass index was (26. 1 ± 1. 3) kg/m2. The incidence of postoperation DSWI were after isolated coronary artery bypass grafting (CABG) in 93 patients, after other heart surgery plus CABG in 13 patients, after valve surgery in 47 patients, after thoracic aortic surgery in 16 patients, after congenital heart disease in 18 patients, and after cardiac injury in 2 patients. Clean patients' wound and extract secretions, clear the infection thoroughly by surgery and select antibiotics based on susceptibility results, and then repair the wound with appropriate muscle flap, place drain tube with negative pressure. Of all the 189 patients, 184 used isolate pectoralis, 1 used isolate rectus, and 4 used pectoralis plus rectus. The operative wounds of 179 patients were primary healing (94. 7%). Hospital discharge was postponed by 1 week for 7 patients, due to subcutaneous wound infection. Subcutaneous wound infection occurred again in 8 patients 1 week after hospital discharge, and their wounds healed after wound dressing. Nine patients (4. 7%) did not recover, due to residue of the sequestrum and costal chondritis, whom were later cured by undergoing a second treatment of debridement and pectoralis major muscle flap transposition. Eight patients died, in which 2 died of respiratory failure, 2 died of bacterial endocarditis with septicemia, 2 died of renal failure, 1 died of intraoperative bleeding leading to brain death and the 1 died of heart failure. The mortality rate was 4. 2% . The average length of postoperative hospital stay was (14 ± 5) days. The longest postoperative

  9. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum

    PubMed Central

    Zheng, Xiaoting; O’Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-01-01

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements. PMID:25201982

  10. On the absence of sternal elements in Anchiornis (Paraves) and Sapeornis (Aves) and the complex early evolution of the avian sternum.

    PubMed

    Zheng, Xiaoting; O'Connor, Jingmai; Wang, Xiaoli; Wang, Min; Zhang, Xiaomei; Zhou, Zhonghe

    2014-09-23

    Anchiornis (Deinonychosauria: Troodontidae), the earliest known feathered dinosaur, and Sapeornis (Aves: Pygostylia), one of the basalmost Cretaceous birds, are both known from hundreds of specimens, although remarkably not one specimen preserves any sternal ossifications. We use histological analysis to confirm the absence of this element in adult specimens. Furthermore, the excellent preservation of soft-tissue structures in some specimens suggests that no chondrified sternum was present. Archaeopteryx, the oldest and most basal known bird, is known from only 10 specimens and the presence of a sternum is controversial; a chondrified sternum is widely considered to have been present. However, data from Anchiornis and Sapeornis suggest that a sternum may also have been completely absent in this important taxon, suggesting that the absence of a sternum could represent the plesiomorphic avian condition. Our discovery reveals an unexpected level of complexity in the early evolution of the avian sternum; the large amount of observable homoplasy is probably a direct result of the high degree of inherent developmental plasticity of the sternum compared with observations in other skeletal elements.

  11. Une observation d'un goitre sur dysgénésie thyroïdienne pré-sternale

    PubMed Central

    Fanantenana, Herinirina Nicolas; Hasina, Rajaonarison Ny Ony Narindra Lova; Hery, Rafanomezantsoa; Claude, Rakotoarisoa Andriamihaja Jean; Ahmad, Ahmad

    2015-01-01

    L'hétérotopie thyroïdienne est une localisation anormale de tissus thyroïdiens normaux coexistant avec un organe normal et de localisation normale. Elle se distingue de l'ectopie thyroïdienne et d'une métastase du cancer de la thyroïde. Nous rapportons un cas d'hétérotopie thyroïdienne pré-sternale chez une femme de 65 ans afin de discuter le mécanisme de la migration de la thyroïde, le problème diagnostique et thérapeutique posé par cette topographie exceptionnelle. L'origine thyroïdienne de la masse est confirmée par l'histologie. Dans les lieux isolés, la chirurgie d'exérèse reste le seul moyen pour avoir le diagnostic et pour traiter les patients. PMID:26327954

  12. Syphilitic aseptic meningitis

    MedlinePlus

    ... Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ed. Philadelphia, PA: Elsevier Saunders; 2015:chap 89. Review Date 7/31/2016 Updated by: Jatin M. Vyas, MD, PhD, Assistant ...

  13. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  14. Radiological assessment of the PRF/BMSC efficacy in the treatment of aseptic nonunions: A retrospective study on 90 subjects.

    PubMed

    Dallari, D; Rani, N; Sabbioni, G; Mazzotta, A; Cenacchi, A; Savarino, L

    2016-11-01

    Nonunion is a major orthopaedic concern because of treatment difficulty, high costs and devastating effects on the patients' life quality. Therefore, there is interest in the use of bone substitutes and cell-based strategies to augment fracture repair. We aimed to verify if Platelet Rich Fibrin (PRF) added with bone marrow stromal cells (BMSC) was able to improve the reparative process in the aseptic nonunion, and to establish whether it was worthwhile with atrophic nonunion. The primary outcome was radiological union. As secondary endpoint, the healing time was assessed, and the radiological consolidation grade at each follow-up. We identified 113 subjects with tibia or femur nonunion and retrospectively created two groups. Group A was constituted by 56 subjects who underwent the standard procedure, i.e. Judet decortication with/out internal fixation devices, and opposite cortical homoplastic stick. In 57 patients, the standard procedure was modified by adding PRF and BMSC carried by homologous lyophilised bone chips (group B). The same surgeon performed all the operations. To our knowledge, no data are reported in the literature about such application. Since a "gold standard" for healing quantification does not exist, a new scoring radiological system was applied, at 1.5, 3, 6, 12 and 24 months after treatment. At the final 24-month follow-up, the radiological union percentage was 94,12 in group B and 95,12% in group A. A decreased healing time was demonstrated in the presence of PRF/BMSC in comparison with the standard procedure. When we compared the radiological scores at each follow-up, we found that the PRF/BMSC combination significantly improved the consolidation grade at 1.5-, 3- and 6-month follow-up in femurs and at 1.5-month follow-up in tibiae. Furthermore, an improved consolidation grade was demonstrated in the atrophic subjects treated with adjuvants compared to atrophic patients treated with the standard procedure at 1.5-month follow-up. This study

  15. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  16. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Proximal femoral reconstruction after aseptic loosening following proximal femoral replacement for Ewing sarcoma: a case report with one-year follow-up.

    PubMed

    Schoof, Benjamin; Jakobs, Oliver; Gehrke, Thorsten; Gebauer, Matthias

    2014-01-01

    We report the case of a 30-year-old patient initially treated for a proximal femoral Ewing's sarcoma when 12 years old. Index treatment comprised tumour resection and total hip arthroplasty. Two years later revision for aseptic loosening was performed. Subsequently, six further surgical revisons were performed for varying causes. At the age of 23 years the proximal femur was resected and a proximal femoral endoprosthesis implanted.Eighteen years after initial diagnosis the patient presented with recurrent aseptc loosening. Both the proximal femur and acetabulum were reconstructed. For acetabular reconstruction a structural allograft and a tantalum cup were utilised. Reconstruction of the femur utilsed extensive wire mesh and circlage wiring with impaction bone allograft into which a femoral stem was implanted.At one-year follow-up the patient was pain free, had no evidence of infection with satisfactory radiographs and no evidence of implant loosening. This is the first case reporting an extended proximal femoral reconstruction with a wire mesh in combination with impaction bone grafting in an aseptic loosened proximal femoral replacement following Ewing's Sarcoma.

  18. Risk analysis of aseptic meningitis after measles-mumps-rubella vaccination in Korean children by using a case-crossover design.

    PubMed

    Ki, Moran; Park, Taesung; Yi, Sung Gon; Oh, Jin Kyoung; Choi, BoYoul

    2003-01-15

    Epidemiologic study of a vaccine's adverse events is not easy; so many countries have no reliable data. Vaccines containing the Urabe or Hoshino strain have been withdrawn from use in several countries. However, the data are not strong enough to form the basis of a recommendation not to use specific strains. The authors used a case-crossover design to estimate the relative risk of aseptic meningitis in children after receiving the measles-mumps-rubella vaccine in Korea. Study subjects were hospitalized children aged 8-36 months who had aseptic meningitis in 1998. Cases were confirmed by hospital chart reviews using previously defined criteria. Through a telephone survey, the authors obtained vaccination date and place information from parents' vaccination records. Study results showed that no significant risk was associated with the Jeryl Lynn or Rubini strain of the vaccine (relative risk = 0.6, 95% confidence interval (CI): 0.18, 1.97). For the Urabe or Hoshino strain, the relative risk was 5.5 (95% CI: 2.6, 11.8); the risk increased in the third week after vaccination (relative risk = 15.6, 95% CI: 5.9, 41.2) and was elevated until the sixth week. The case-crossover design was useful in confirming the risk of acute adverse events after receiving vaccines.

  19. Comparison of the effects of sternal and tibial intraosseous administered resuscitative drugs on return of spontaneous circulation in a swine model of cardiac arrest.

    PubMed

    O'Sullivan, Mara; Martinez, Andre; Long, Audrey; Johnson, Michelle; Blouin, Dawn; Johnson, Arthur D; Burgert, James M

    2016-01-01

    Compare vasopressin, amiodarone, and epinephrine administration by sternal intraosseous (SIO), tibial intraosseous (TIO), and intravenous (IV) routes in a swine model of cardiac arrest. Prospective, randomized, between subjects, experimental design. Laboratory. Male Yorkshire-cross swine (N = 35), seven per group. Swine were randomized to SIO, TIO, IV, cardiopulmonary resuscitation (CPR) with defibrillation, or CPR-only groups. Ventricular fibrillation (VF) was induced under general anesthesia. Mechanical CPR began 2 minutes postarrest. Vasopressin (40 U) was administered to the SIO, TIO, and IV groups 4 minutes postarrest. Defibrillation was performed and amiodarone (300 mg) was administered 6 minutes postarrest. Defibrillation was repeated, and epinephrine (1 mg) was administered 10 minutes postarrest. Defibrillation was repeated every 2 minutes and epinephrine repeated every 4 minutes until return of spontaneous circulation (ROSC) or 26 postarrest minutes elapsed. Rate of ROSC, time to ROSC, and odds of ROSC. There were no significant differences in rate of ROSC between the SIO and TIO (p = 0.22) or IV groups (p = 1.0). Time to ROSC was five times less in the SIO group than the TIO group (p = 0.003) but not compared to IV (p = 0.125). Time to ROSC in the IV group was significantly less than the TIO group (p = 0.04). Odds of ROSC for the SIO group were five times higher compared to the TIO group but same as IV. Odds of ROSC in the IV group were higher than the TIO group. There was a statistically significant delay in the time to ROSC and a clinically significant difference in odds of ROSC when resuscitative drugs, including lipophilic amiodarone, were administered by the TIO route compared to the SIO and IV routes in a swine model of sudden cardiac arrest. Further investigations are warranted to isolate the mechanism behind these findings.

  20. Surgical approaches for stage I and II thymoma-associated myasthenia gravis: feasibility of complete video-assisted thoracoscopic surgery (VATS) thymectomy in comparison with trans-sternal resection

    PubMed Central

    He, Zhicheng; Zhu, Quan; Wen, Wei; Chen, Liang; Xu, Hai; Li, Hai

    2013-01-01

    Complete resection could be achieved in virtually all myasthenic patients with Masaoka stage I and II thymoma using the trans-sternal technique. Whether this is appropriate for minimally invasive approach is not yet clear. We evaluated the feasibility of complete video-assisted thoracoscopic surgery (VATS) thymectomy for the treatment of Masaoka stage I and II thymoma-associated myasthenia gravis, compared to conventional trans-sternal thymectomy. We summarized 33 patients with Masaoka stage I and II thymoma-associated myasthenia gravis between April 2006 and September 2011. Of these, 15 patients underwent right-sided complete VATS (the VATS group) by using adjuvant pneuomomediastinum, comparing with 18 patients using the trans-sternal approach (the T3b group). No intraoperative death was found and no VATS case required conversion to median sternotomy. Significant differences between the two groups regarding duration of surgery and volume of intraoperative blood loss (P = 0.001 and P < 0.001, respectively) were observed. Postoperative morbidities were 26.7% and 33.3% for the VATS and T3b groups, respectively. All 33 patients were followed up for 12 to 61 months in the study. The cumulative probabilities of reaching complete stable remission and effective rate were 26.7% (4/15) and 93.3% (14/15) in the VATS group, which had a significantly higher complete stable remission and effective rate than those in the T3b group (P = 0.026 and P = 0.000, respectively). We conclude that VATS thymectomy utilizing adjuvant pneuomomediastinum for the treatment of stage I and II thymoma-associated myasthenia gravis is technically feasible but deserves further investigation in a large series with long-term follow-up. PMID:23554796

  1. [Use of ProSeal laryngeal mask airway in a patient with spontaneous ventilation for anesthetic management in off-pump coronary artery bypass grafting by lower-end sternal splitting approach].

    PubMed

    Matsumoto, Kappei

    2006-10-01

    Use of the laryngeal mask airway in off-pump coronary artery bypass grafting is controversial, largely because of a concern about increased risk for derangement in pulmonary mechanics. The author used the ProSeal LMA in a patient with spontaneous respiration for anesthetic management of off-pump coronary artery bypass grafting by the lower-end sternal splitting approach. There were no critical hypercapnea, hypoxia, ventilatory problems and pulmonary hypertension. This method provided suitable conditions for maintenance and emergence of anesthesia, providing shorter stay of less than 22 hours in ICU.

  2. Partial median sternotomy as a minimal access for off-pump coronary artery bypass grafting: feasibility of the lower-end sternal splitting approach.

    PubMed

    Niinami, H; Takeuchi, Y; Ichikawa, S; Suda, Y

    2001-09-01

    Off-pump coronary artery bypass grafting (OPCAB) can be performed in several ways using a minimally invasive approach (MIDCAB). Using the left anterior small thoracotomy (LAST) approach, only the LAD can be grafted. To expand the indications for MIDCAB from single-vessel disease to double-vessel disease, we have used a partial sternotomy without a transverse cut, namely, the lower-end sternal splitting (LESS) approach. Through this approach, the LAD and RCA can be revascularized by means of a single small incision without the risk of damaging the tissue around the intercostal space during harvesting of ITA when the sternum is transversely divided. The purpose of this study was to demonstrate the feasibility and safety of this technique. Between November 1999 and November 2000, a total of 22 patients underwent MIDCAB through a lower midline skin incision from the fourth intercostal space to the xiphoid process with longitudinal division of the lower half sternum up to the 3rd rib, without either a T- or reversed L-shaped division of the sternum. Of the patients, 14 had LAD disease only, 5 had both LAD and RCA disease, 2 had RCA disease only, and 1 had left main trunk disease. Two of the operations were of redo coronary artery bypass grafting. The mean age was 69.5 +/- 6.1 years (range 58 to 77 years). The mean length of the skin incision was 8.5 +/- 1.4 cm (range 7 to 12 cm). No hospital death or morbidity was observed. All patients had arterial conduits: LIMA in 20 patients, RIMA in 3, RGEA in 4, and RA in 1. The mean number of grafts per patient was 1.3 +/- 0.6 (range 1 to 3). No blood transfusion was required perioperatively. The patency rate was 96%. All patients were in New York Heart Association class I and no wound complications or postoperative pain occurred during follow-up. Our experience demonstrates that the LESS approach for MIDCAB is technically feasible for revascularizing not only the LAD but also the RCA system, with the same small incision using

  3. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs

    PubMed Central

    Wolff, Carsten; Scholtz, Gerhard

    2006-01-01

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans – the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip – the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI – a lipophilic fluorescent dye – to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the

  4. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs.

    PubMed

    Wolff, Carsten; Scholtz, Gerhard

    2006-12-04

    The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans--the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip--the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI--a lipophilic fluorescent dye--to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds in the same region of the mandibular

  5. Skeletonized versus pedicled internal thoracic artery and risk of sternal wound infection after coronary bypass surgery: meta-analysis and meta-regression of 4817 patients

    PubMed Central

    Sá, Michel Pompeu Barros de Oliveira; Ferraz, Paulo Ernando; Escobar, Rodrigo Renda; Vasconcelos, Frederico Pires; Ferraz, Álvaro Antonio Bandeira; Braile, Domingo Marcolino; Lima, Ricardo Carvalho

    2013-01-01

    It is suggested that the internal thoracic artery (ITA) harvesting technique influences the incidence of sternal wound infection (SWI) after coronary artery bypass graft (CABG). To determine if there is any real difference between skeletonized vs pedicled ITA, we performed a meta-analysis to determine if there is any real difference between these two established techniques in terms of SWI. We performed a systematic review using MEDLINE, EMBASE, CENTRAL/CCTR, SciELO, LILACS, Google Scholar and reference lists of relevant articles to search for studies that compared the incidence of SWI after CABG between skeletonized vs pedicled ITA until June 2012. The principal summary measures were odds ratio (OR) with 95% confidence interval (CI) and P values (statistically significant when <0.05). The ORs were combined across studies using the weighted DerSimonian–Laird random effects model and weighted Mantel–Haenszel fixed effects. Meta-analysis, sensitivity analysis and meta-regression were completed using the software Comprehensive Meta-Analysis version 2 (Biostat, Inc., Englewood, NJ, USA). Twenty-two studies involving 4817 patients (2424 skeletonized; 2393 pedicled) met the eligibility criteria. There was no evidence for important heterogeneity of effects among the studies. The overall OR (95% CI) of SWI showed a statistically significant difference in favour of skeletonized ITA (fixed effect model: OR 0.443, 95% CI 0.323–0.608, P < 0.001; random effect model: OR 0.443, 95% CI 0.323–0.608, P < 0.001). In the sensitivity analysis, the difference in favour of skeletonized ITA was also observed in subgroups such as diabetic, bilateral ITA and diabetic with bilateral ITA; we also observed that there was a difference in the type of study, since non-randomized studies together demonstrated the benefit of skeletonized ITA in comparison with pedicled ITA, but the randomized studies together did not show this difference (although close to statistical significance and with

  6. Effect of negative pressure wound therapy followed by tissue flaps for deep sternal wound infection after cardiovascular surgery: propensity score matching analysis.

    PubMed

    Morisaki, Akimasa; Hosono, Mitsuharu; Murakami, Takashi; Sakaguchi, Masanori; Suehiro, Yasuo; Nishimura, Shinsuke; Sakon, Yoshito; Yasumizu, Daisuke; Kawase, Takumi; Shibata, Toshihiko

    2016-09-01

    Deep sternal wound infection (DSWI) after cardiovascular surgery via median sternotomy remains a severe complication associated with a drastic decrease in the quality of life. We assessed the risk factors for in-hospital death caused by DSWI and the available treatments for DSWI. Between January 1991 and August 2015, we retrospectively reviewed 73 patients (51 males and 22 females, mean age 67.5 ± 10.3 years) who developed DSWI after cardiovascular surgery via median sternotomy. Pathogenic bacteria mainly comprised methicillin-resistant Staphylococcus aureus (MRSA) (49.3%). Fifteen patients (20.5%) died in hospital with DSWI. Treatment of DSWI consisted of open daily irrigation (up to 2006) or negative pressure wound therapy (NPWT) (2007 onwards), followed by primary closure or reconstruction of tissue flaps. We assessed the risk factors for in-hospital mortality from DSWI by comparing data from the 15 patients who died and the 58 survivors using propensity score matching analysis of the treatments used for DSWI. Univariate analysis identified age, use of intra-aortic balloon pumping, prolonged mechanical ventilation, tracheotomy, prolonged intensive care unit stay, postoperative low output syndrome, postoperative myocardial infarction, postoperative renal failure, postoperative use of haemodialysis, postoperative pneumonia, postoperative cerebral disorder, MRSA infection, NPWT and tissue flaps as being associated with in-hospital mortality (P < 0.05). Multivariate analysis identified NPWT (odds ratio, 0.062; 95% confidence interval, 0.004-0.897; P = 0.041) and tissue flaps (odds ratio, 0.022; 95% confidence interval, 0.000-0.960; P = 0.048) as independently associated with reduced in-hospital mortality after DSWI. On comparing 22 patients receiving NPWT with 22 not on NPWT using propensity score matching, patients on NPWT had significantly lower in-hospital mortality than those without NPWT (NPWT vs non-NPWT, 5 vs 36%, P = 0.021). In DSWI infected by MRSA, NPWT

  7. Anaesthetic drug administration as a potential contributor to healthcare-associated infections: a prospective simulation-based evaluation of aseptic techniques in the administration of anaesthetic drugs.

    PubMed

    Gargiulo, Derryn A; Sheridan, Janie; Webster, Craig S; Swift, Simon; Torrie, Jane; Weller, Jennifer; Henderson, Kaylene; Hannam, Jacqueline; Merry, Alan F

    2012-10-01

    To evaluate the possibility that anaesthetists are administering potentially pathogenic micro-organisms to their patients. Prospective microbiological and observational study in a realistic simulated setting. Ten anaesthetists supported by 10 anaesthetic technicians. The presence or absence of organisms cultured from sterile intravenous bags used to collect drugs injected during the simulated cases and from the needles and the contents of the syringes used. The authors also observed the aseptic techniques used. Organisms were isolated from five of 38 (13%) bags from five of 20 simulated cases anaesthetised by four of 10 anaesthetists, 10 of 197 (5%) syringes and six of 17 (35%) needles. None of the anaesthetists washed their hands prior to entry, used the hand gel provided, disinfected the phial septa before drawing up drugs or disinfected the intravenous ports on the intravenous administration set before use. One was seen to recap a needle left on a syringe for possible reuse. Three participants were observed to place equipment such as stethoscopes, drug charts and pens on top of their inuse drug trays. The administration of intravenous drugs during anaesthesia may be an important factor in the genesis (or potentially the prevention) of healthcare-associated infection. These observations suggest room for improvement in the aseptic techniques of at least some anaesthetists when preparing and administering intravenous drugs. Confirmation of these findings in clinical settings is needed. STUDY REGISTRY NUMBER (FOR THE VASER STUDY): Australian New Zealand Clinical Trials Registry: Ref: ACTRN 12609000530224, https://www.anzctr.org.au/registry/trial_review.aspx?ID=308128; note that the work presented here is a subset of the registered trial and its outcomes were not included in this registration.

  8. Impact of an aseptic procedure for breaking the integrity of the urinary drainage system on the development of catheter-associated urinary tract infections in the intensive care unit.

    PubMed

    Powers, Jan

    2016-12-01

    Catheter associated urinary tract infections (CAUTI) are a common complication in the hospital, especially in intensive care units (ICU). These infections are directly linked to the use of an indwelling urinary catheter. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. The primary purpose of this observational study was to assess if there is a relationship between CAUTI incidence and breaking the closed drainage system using an aseptic procedure. A process improvement effort was developed to ensure an aseptic technique was utilised when there was a need to break the integrity of the urinary drainage system. Because this was a new practice and not supported by the Centres for Disease Control (CDC) recommendations, this change in practice was evaluated as an observational study. In an eight month period there were 53 documented breaks in the urinary drainage system. There were 28 total cases of CAUTI overall during this same time period. Only four patients with a system break developed a CAUTI (7.5%). In almost 93% of the patients where aseptic technique was used for breaks in the drainage system, there was no occurrence of CAUTI. A follow-up evaluation was performed after a year of this practice in three adult ICUs. During this three month evaluation period, there were 47 documented cases of breaking this system using aseptic technique. Of the patients who had a documented break in their drainage system, none developed subsequent CAUTIs. One commonly identified factor related to the development of CAUTI has been thought to be violating the integrity of the closed drainage system. However, a paucity of research exists to support or refute this practice. This observational study found that utilising an aseptic technique to break the integrity system did not result in an associated increase in CAUTI

  9. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine

    PubMed Central

    Dumaidi, Kamal; Al-Jawabreh, Amer

    2017-01-01

    Background Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. Aim To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. Methods During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. Results HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. Conclusion HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period. PMID:28225788

  10. Molecular detection and genotyping of enteroviruses from CSF samples of patients with suspected sepsis-like illness and/or aseptic meningitis from 2012 to 2015 in West Bank, Palestine.

    PubMed

    Dumaidi, Kamal; Al-Jawabreh, Amer

    2017-01-01

    Human enteroviruses (HEVs) are the most frequently reported cause of aseptic meningitis with or without CSF pleocytosis in childhood. Rapid detection and genotype of HEVs is essential to determine the causative agent and variant causing sepsis-like illness and/or aseptic meningitis. To investigate the molecular epidemiology of enteroviruses (EVs) among patients with sepsis-like illness and/or aseptic meningitis admitted to three major hospitals in West Bank, Palestine from 2012 to 2015. During the study period, 356 CSF samples were collected from patients with sepsis-like illness and/or aseptic meningitis. Two RT-nested PCR assays targeting a partial part of 5'UTR for direct diagnosis and the VP1 region for genotyping by sequence analysis of the viral genome were used. HEV RNA was detected in 66 of 356 (18.5%) of CSF samples. Age distribution showed that 64% (42/66) were infants (<1 year), 18% were children between 1 and 5 years old, 12% were children between 5 and 10 years old, and 6% were more than 10 years old. Of the 66 EV cases, 12 were successfully genotyped. Five different EV genotypes were identified. All of them belonged to HEV-B species. The study showed that echovirus 6 genotype accounted for 42% of the sequenced cases. The HEV infections in the present study tended to show slight seasonal pattern with more cases occurring during spring and summer, yet still significant numbers were also reported in fall and winter seasons. HEV was isolated from a significant number of children with sepsis-like illness and/or aseptic meningitis. In addition, the molecular method utilized for direct diagnosis and genotyping of HEV from CSF revealed that more than one HEV type circulated in the West Bank, Palestine during the study period.

  11. Nucleotide sequencing of a part of the 5'-noncoding region of echovirus type 9 and rapid virus detection during the acute phase of aseptic meningitis.

    PubMed

    Kim, G R; Lee, J S; Jung, Y T; Chung, Y J; Rhyu, M G

    1997-01-01

    A part of the 5'-noncoding region of echovirus type 9 isolates was sequenced, and an attempt was made for rapid virus detection in clinical samples obtained from 22 subjects hospitalized with aseptic meningitis. The sequence identity of 440-bp products amplified from the region by RT-PCR was 87.7% between the standard echovirus type 9(Hill strain) and the isolates. Specific IgM antibodies to Hill strain were positive in 45.5% by immunofluorescent antibody staining of virus-infected cells. A high detection rate of PCR products was observed in cerebrospinal fluids (CSFs; 54.5%) at admission, and in peripheral mononuclear cells (PMCs; 72.7%) at the end of hospitalization. Viral genomes were detectable for 2 days in serum samples, and for 6 days in PMC samples after onset of disease. When specific IgM antibody titers were less than 1:40, the amplification rate of viral genome from serum samples was 50.0%. These results indicate that the combination of specific IgM determination and viral genome amplification from CSFs will be a rapid and reliable method for early diagnosis.

  12. Ibandronate and cementless total hip arthroplasty: densitometric measurement of periprosthetic bone mass and new therapeutic approach to the prevention of aseptic loosening

    PubMed Central

    Muratore, Maurizio; Quarta, Eugenio; Quarta, Laura; Calcagnile, Fabio; Grimaldi, Antonella; Orgiani, M. Antonio; Marsilio, Antonio; Rollo, Giuseppe

    2012-01-01

    Summary Studies of the mechanisms of periprosthetic bone loss have led to the development of pharmacologic strategies intended to enhance bone mass recovery after surgery and consequently prevent aseptic loosening and prolong the implant survival. Bisphosphonates, potent anti-resorptive drugs widely used in the treatment of osteoporosis and other disorders of bone metabolism, were shown to be particularly effective in reducing periprosthetic bone resorption in the first year after hip and knee arthroplasty, both cemented and cementless. Based on these results, we investigated the inhibitory effects of ibandronate on periprosthetic bone loss in a 2-year study of postmenopausal women that underwent cementless total hip arthroplasty. In the first 6 months both groups (A, treated with ibandronate 3 mg i.v. within five days after surgery and then with oral ibandronate 150 mg/month, plus calcium and vitamin D supplementation; and B, treated with calcium and vitamin D supplementation only) experienced bone loss, though to a lesser extent in group A. After 12 months, group A showed a remarkable BMD recovery, that was statistically significant versus baseline values (about +1, 74% of global BMD) and most evident in region R1 (+3, 81%) and R2 (+4, 12%); in group B, on the contrary, BMD values were unchanged compared with those at 6 months post-surgery. Quality of life scores also showed a greater improvement in group A, both at 6 and 12 months after surgery, likely because of the pain-reducing effects of ibandronate treatment. PMID:22783337

  13. A retrospective epidemiological study of clinical signs and familial predisposition associated with aseptic meningitis in the Norwegian population of Nova Scotia duck tolling retrievers born 1994–2003

    PubMed Central

    Anfinsen, Kristin P.; Berendt, Mette; Liste, Flora J.H.; Haagensen, Therese R.; Indrebo, Astrid; Lingaas, Frode; Stigen, Oyvind; Alban, Lis

    2008-01-01

    Aseptic meningitis (AM) is a disease that causes grave clinical signs such as intensive neck pain, fever, and lethargy. The severity of this disease is reflected in the fact that affected animals require long-term, and in chronic cases, lifelong therapy with corticosteroids. A number of dogs must be euthanized because of therapeutic failure. In recent years, the Norwegian population of Nova Scotia duck tolling retrievers has experienced an increase in individuals with AM. The aim of the present study was to investigate the prevalence of AM and to pursue the suspicion of hereditary factors influencing an accumulation of AM cases in the breed. Using the Norwegian Kennel Club registery, a random sample (362 dogs) stratified by year of birth was drawn from the total population born from 1994 to 2003 (1525 individuals). The owners were contacted and questioned about clinical signs of AM in their dogs. Subsequently, the practising veterinarians and the breeders of positive responders were contacted in order to confirm a clinical diagnosis of AM and to identify possible affected family members. Pedigrees of AM positive individuals and affected relatives were investigated. The study estimated a prevalence of AM of 2.5%. For all affected dogs, it was possible to trace the pedigree of both parents of affected dogs back to a specific founder dog. The genealogical investigation strongly indicates that genetic factors are involved in the etiology of the disease. PMID:18783024

  14. Genomic characterization of echovirus 6 causing aseptic meningitis in Hokkaido, Japan: a novel cluster in the nonstructural protein coding region of human enterovirus B.

    PubMed

    Miyoshi, Masahiro; Komagome, Rika; Ishida, Setsuko; Nagano, Hideki; Takahashi, Kenichi; Okano, Motohiko

    2013-04-01

    We determined four complete nucleotide sequences of echovirus 6 (E6) isolated from an epidemic of aseptic meningitis (AM) in Hokkaido, Japan, in 2011. Phylogenetic analysis of the genes encoding viral capsid protein 1 revealed that the strains were closely related to E6 strains isolated in China in recent years, but they were distantly related to E6 strains isolated from patients with AM in Osaka Prefecture, Japan, in 2011. The genes encoding the viral protease and RNA-dependent RNA polymerase (3CD) were closely related to those of several non-E6 strains of the species Human enterovirus B isolated in China, South Korea, and Australia from 1999 to 2010, resulting in a novel cluster in the phylogenetic tree. These results suggest that the incidence of AM in Japan in 2011 was caused by at least two lineages of E6 strains, and a lineage of the 3CD gene was interspersed among different serotypic strains isolated in Western Pacific countries.

  15. Monocystis julkae sp.nov., (Protista: Apicomplexa: Monocystidae) a new aseptate gregarine species of the genus Monocystis Stein, 1848 obtain from an Indian Earthworm, Eutyphoeus kherai, Julka, 1978.

    PubMed

    Bhowmik, Biplab; Bandyopadhyay, P K

    2017-03-01

    During the course of a biodiversity survey of the endoparasitic aseptate gregarines in the Malda district of West Bengal, India, seminal vesicles of the earthworm, Eutyphoeus kherai, Julka 1978 were found to be infested with a new species, Monocystis julkae sp.nov., of the genus, Monocystis Stein (Arch Anat Phys Med 181-223, 1848). The trophozoite is elongated but slightly constricted posteriorly. A tail like protrusion appears in the posterior end. Anterior end is rather wider than the posterior one. The whole body size of the trophozoite measures 102.2-184.0 (126.7 ± 19.9) µm × 40.9-81.8 (58.2 ± 10.0) µm. Size of the nucleus ranges from 10.2 to 16.3 (11.9 ± 1.9) µm × 8.1-12.2 (8.8 ± 1.2) µm. The gametocysts are ovoidal containing two unequal gametocytes. Diameter of it measures 61.3-98.1 (75.8 ± 8.6) µm. Oocysts are navicular and measures 6.9-10.0 (8.7 ± 0.9) µm × 3.0-4.6 (4.3 ± 0.4) µm.

  16. Recurrent fever of unknown origin (FUO): aseptic meningitis, hepatosplenomegaly, pericarditis and a double quotidian fever due to juvenile rheumatoid arthritis (JRA).

    PubMed

    Cunha, Burke A; Hage, Jean E; Nouri, Yelda

    2012-01-01

    Fever of unknown origin (FUO) has been defined as a fever of ≥101°F that persists for 3 weeks or more. It is not readily diagnosed after 1 week of intensive in-hospital testing or after intensive outpatient or inpatient testing. Fevers of unknown origin may be caused by infectious diseases, malignancies, collagen vascular diseases, or a variety of miscellaneous disorders. The relative distribution of causes of FUOs is partly age-related. In the elderly, the preponderance of FUOs is attributable to neoplastic and infectious etiologies, whereas in children, collagen vascular diseases, neoplasms, and viral infectious disease predominate. The diagnostic approach to FUOs depends on a careful analysis of the history, physical findings, and laboratory tests. Most patients with FUOs exhibit localizing findings that should direct the diagnostic workup and limit diagnostic possibilities. The most perplexing causes of FUOs involve those without specific diagnostic tests, e.g., juvenile rheumatoid arthritis (JRA) or adult Still's disease. In a young adult with FUO, if all of the cardinal symptoms are present, JRA may present either a straightforward or an elusive diagnosis, if key findings are absent or if the diagnosis goes unsuspected. We present a 19-year-old man with a recurrent FUO. His illness began 3 years before admission and has recurred twice since. In the past, he did not manifest arthralgias, arthritis, or a truncal rash. On admission, he presented with an FUO with hepatosplenomegaly, aseptic meningitis, and pericarditis. An extensive diagnostic workup ruled out lymphoma and leukemia. Moreover, a further extensive workup eliminated infectious causes of FUO appropriate to his clinical presentation, ie, tuberculosis, histoplasmosis, brucellosis, Q fever, typhoid fever, Epstein-Barr virus, infectious mononucleosis, cytomegalovirus, human herpes virus (HHV)-6, babesiosis, ehrlichiosis, viral hepatitis, and Whipple's disease. The diagnosis of JRA was based on the

  17. Systematic review and meta-analysis of the risk of microbial contamination of parenteral doses prepared under aseptic techniques in clinical and pharmaceutical environments: an update.

    PubMed

    Austin, P D; Hand, K S; Elia, M

    2015-12-01

    Administration of parenteral doses with microbial contamination can lead to infective morbidity or death. To test whether aseptic preparation of parenteral doses or additives to sterile doses undertaken in dedicated pharmaceutical rather than clinical environments reduces the risk of microbial dose contamination. Data identified from a systematic review were examined using random effects meta-analyses, and t-tests were used to compare dose contamination frequencies. In all, 16,552 doses from 34 studies (33 records) were identified. For all the data combined there was a significantly higher frequency of contamination of doses prepared in clinical than in pharmaceutical environments {3.7% [95% confidence interval (CI): 2.2, 6.2; N = 10,272 doses] vs 0.5% (95% CI: 0.1, 1.6; N = 6280 doses); P = 0.007}. Contamination of doses was significantly higher when prepared as individual lots than as part of a batch in pharmaceutical environments [2.1% (95% CI: 0.7, 5.8; N = 168 doses) vs 0.2% (95% CI: 0.1, 0.9; N = 6112 doses); P = 0.002]. There was a significantly higher frequency of dose contamination if additions were made to sterile parenteral doses in clinical environments [risk ratio: 2.121 (95% CI: 1.093, 4.114); P = 0.026]. The overall quality of the studies was judged to be low. Reported rates of parenteral dose contamination were orders of magnitude higher than accepted reference standards, which may increase infection risk. The limited evidence on contamination rates supports dose preparation in pharmaceutical rather than clinical environments, and does not support batch preparation in clinical environments. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  18. Treatment of Aseptic Necrosis of the Lunate Bone (Kienböck Disease) Using a Nickel-Titanium Memory Alloy Arthrodesis Concentrator: A Series of 24 Cases.

    PubMed

    Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang

    2015-10-01

    Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel-titanium (Ni-Ti) memory alloy arthrodesis concentrator in the treatment of this disease.A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni-Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale.Patients were followed up for a mean of 12 months (range, 6-24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred.STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni-Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results.

  19. Treatment of Aseptic Necrosis of the Lunate Bone (Kienböck Disease) Using a Nickel–Titanium Memory Alloy Arthrodesis Concentrator

    PubMed Central

    Xu, Yongqing; Li, Chuan; Zhou, Tianhua; Su, Yongyue; He, Xiaoqing; Fan, Xinyu; Zhu, Yueliang

    2015-01-01

    Abstract Avascular necrosis of the lunate bone (Kienböck disease) is caused by loss of blood supply of the bone. This study aimed to evaluate the efficacy and safety of a novel nickel–titanium (Ni–Ti) memory alloy arthrodesis concentrator in the treatment of this disease. A consecutive 24 patients with stage IIIb aseptic lunate necrosis were treated with scapho-trapezio-trapezoeid (STT) arthrodesis using a Ni–Ti arthrodesis concentrator from August 2008 to December 2012. Wrist pain, grip strength, carpal height, and scapholunate angle were measured and compared before and after the surgery. The wrist functions were evaluated using the Mayo scale. Patients were followed up for a mean of 12 months (range, 6–24 months). Grip strength of the affected side was significantly improved after the surgery (18 ± 4.74 kg vs. 30.21 ± 7.14 kg, P < 0.0001). Wrist pain score was significantly decreased from 5.88 ± 0.9 to 0.5 ± 0.51 (P < 0.0001). Carpal height and Mayo score were also significantly increased after the surgery (P < 0.0001). Scapholunate angle was significantly decreased after the surgery (68.38 ± 7.28° vs. 49.91 ± 4.28°, P < 0.0001). No implant breakage, loose implant, wound infection, or nonunion occurred. STT arthrodesis is effective for the treatment of stage IIIb lunate necrosis. The Ni–Ti memory alloy arthrodesis concentrator is a convenient tool for STT arthrodesis with excellent and reliable results. PMID:26496298

  20. Incidence and clinical features of herpes simplex viruses (1 and 2) and varicella-zoster virus infections in an adult Korean population with aseptic meningitis or encephalitis.

    PubMed

    Choi, Rihwa; Kim, Gyeong-Moon; Jo, Ik Joon; Sim, Min Seob; Song, Keun Jeong; Kim, Byoung Joon; Na, Duk L; Huh, Hee Jae; Kim, Jong-Won; Ki, Chang-Seok; Lee, Nam Yong

    2014-06-01

    Since there are limited data on the incidence and clinical findings of central nervous system (CNS) infection by three α-herpesviruses including human herpes simplex virus 1 (HSV-1), HSV-2 and varicella-zoster virus (VZV) in Korea, a retrospective analysis of clinical data and polymerase chain reaction (PCR) results was performed in patients who presented with suspicion of acute viral meningitis and/or encephalitis at the emergency department of a tertiary referral hospital in Seoul, Korea. During the 3-year study period, a total of 224 cerebrospinal fluid (CSF) samples from 224 patients were examined. Among the 224 patients, 135 (60.3%) patients were identified as having aseptic meningitis (n = 70, 51.9%), encephalitis (n = 41, 30.4%) or meningoencephalitis (n = 24, 17.8%) at discharge. Twenty-four (17.8%) patients were identified as having VZV meningitis (n = 16, 11.9%), VZV meningoencephalitis (n = 2, 1.5%), HSV-2 meningitis (n = 4, 3.0%), or HSV-1 encephalitis (n = 2, 1.5%). Of the 24 patients infected with the three herpesviruses, immunocompromised patients accounted for 33.3% (n = 8). Skin rashes were observed in half (n = 9) of the patients with VZV, and none with HSV-1 or HSV-2. One patient with VZV meningitis and four patients with brain parenchymal involvement had neurologic sequelae. In conclusion, three herpesviruses are important causative agents of CNS infectious disease with significant morbidity in adults, regardless of the immunologic status. Therefore, CSF should be examined for HSV-1, HSV-2, and VZV using sensitive diagnostic methods in all cases of adult patients with clinical manifestations of CNS disease in order to identify the correct etiology and to determine appropriate therapy.

  1. Interrelations among the adipocytokines leptin and adiponectin, oxidative stress and aseptic inflammation markers in pre- and early-pubertal normal-weight and obese boys.

    PubMed

    Paltoglou, George; Schoina, Maria; Valsamakis, George; Salakos, Nicolaos; Avloniti, Alexandra; Chatzinikolaou, Athanasios; Margeli, Alexandra; Skevaki, Chrysanthi; Papagianni, Maria; Kanaka-Gantenbein, Christina; Papassotiriou, Ioannis; Chrousos, George P; Fatouros, Ioannis G; Mastorakos, George

    2017-03-01

    and catalase. In all subjects, leptin and adiponectin predict negatively and positively anti-oxidation, respectively, while high sensitivity IL-6 predicts positively and negatively pro- and anti-oxidation, respectively. High-sensitivity C-reactive protein is increased and negatively associated with anti-oxidation in pre-pubertal obese boys, suggesting that childhood obesity is associated with aseptic inflammation and oxidative stress.

  2. An ion-pairing, reversed-phase liquid chromatography method to assess the cross-contamination of cancer chemotherapy infusions prepared in a dual-operator aseptic isolator.

    PubMed

    Brachet, G; Bruno, C; Boulay, D; Tournamille, J F; Gyan, E; Viaud-Massuard, M C; Respaud, R

    2016-09-01

    of nursing and pharmacy staff with anticancer drugs. No cross-contamination was detected in cancer chemotherapy infusions prepared in a dual-operator aseptic isolator. Copyright © 2015 John Wiley & Sons, Ltd.

  3. Enhancing global vaccine pharmacovigilance: Proof-of-concept study on aseptic meningitis and immune thrombocytopenic purpura following measles-mumps containing vaccination.

    PubMed

    Perez-Vilar, Silvia; Weibel, Daniel; Sturkenboom, Miriam; Black, Steven; Maure, Christine; Castro, Jose Luis; Bravo-Alcántara, Pamela; Dodd, Caitlin N; Romio, Silvana A; de Ridder, Maria; Nakato, Swabra; Molina-León, Helvert Felipe; Elango, Varalakshmi; Zuber, Patrick L F

    2017-05-27

    New vaccines designed to prevent diseases endemic in low and middle-income countries (LMICs) are now being introduced without prior record of utilization in countries with robust pharmacovigilance systems. To address this deficit, our objective was to demonstrate feasibility of an international hospital-based network for the assessment of potential epidemiological associations between serious and rare adverse events and vaccines in any setting. This was done through a proof-of-concept evaluation of the risk of immune thrombocytopenic purpura (ITP) and aseptic meningitis (AM) following administration of the first dose of measles-mumps-containing vaccines using the self-controlled risk interval method in the primary analysis. The World Health Organization (WHO) selected 26 sentinel sites (49 hospitals) distributed in 16 countries of the six WHO regions. Incidence rate ratios (IRR) of 5.0 (95% CI: 2.5-9.7) for ITP following first dose of measles-containing vaccinations, and of 10.9 (95% CI: 4.2-27.8) for AM following mumps-containing vaccinations were found. The strain-specific analyses showed significantly elevated ITP risk for measles vaccines containing Schwarz (IRR: 20.7; 95% CI: 2.7-157.6), Edmonston-Zagreb (IRR: 11.1; 95% CI: 1.4-90.3), and Enders'Edmonston (IRR: 8.5; 95% CI: 1.9-38.1) strains. A significantly elevated AM risk for vaccines containing the Leningrad-Zagreb mumps strain (IRR: 10.8; 95% CI: 1.3-87.4) was also found. This proof-of-concept study has shown, for the first time, that an international hospital-based network for the investigation of rare vaccine adverse events, using common standardized procedures and with high participation of LMICs, is feasible, can produce reliable results, and has the potential to characterize differences in risk between vaccine strains. The completion of this network by adding large reference hospitals, particularly from tropical countries, and the systematic WHO-led implementation of this approach, should permit the

  4. The Bolognese surgeon Giuseppe Ruggi: how and why the aseptic surgery was introduced in Bologna in the middle half of the XIX century.

    PubMed

    Sabbatani, Sergio; Catena, Fausto; Neri, Flavia; Vallicelli, Carlo; Ansaloni, Luca; Sartelli, Massimo; Coccolini, Federico; Di Saverio, Salomone; Catena, Rodolfo; Lazzareschi, Daniel; Tarasconi, Antonio; Abongwa, Hariscine K; De Simone, Belinda; Pinna, Antonio

    2014-12-01

    The first reliable statistic data about perioperatory mortality were published in 1841 by the French Joseph-Francois Malgaigne (1806-1863): he referred to a mean mortality of 60% for amputations and this bad result was to be attributed mainly to hospital acquired diseases. The idea of "hospital acquired disease" although vague, included five infective nosologic entities, which at that time were diagnosed more frequently: erysipelas, tetan, pyemia, septicemia, and gangrene. Nonetheless, the suppuration with pus production was considered from most of the surgeons and doctors of that time as a necessary and unavoidable step in the process of wound healing. During the end of the eighteenth century, hospitals of the main European cities were transforming into aggregations of several wards, where the high concentration of patients created poor sanitary conditions and a consistent increase of perioperatory mortality. In 1865, Lister applied his first antiseptic dressing on the surface of an exposed fracture. These experimental attempts lead to an effective reduction of wound infections respect to the dressing with strings used previously. Lister's innovations in the field of wound treatment were based on two brand new concepts: germs causing rot were ubiquitarious and the wound infection was not a normal step in the process of wound healing. The concept of antisepsis was hardly accepted in the European surgical world: "Of all countries, Italy is the most indifferent and uninterested in experimenting this method, which has been so favorably judged from the greatest surgical societies in Germany". This quotation from the young surgeon Giuseppe Ruggi (1844-1925) from Bologna comes from his article where he presented his first experiences on aseptic medications started the previous year in the Surgical Department of Maggiore Hospital in Bologna. In his report, Ruggi described the adopted technique and suggested that the medication should be extended to all the surgical

  5. Good diagnostic performance of early migration as a predictor of late aseptic loosening of acetabular cups: results from ten years of follow-up with Roentgen stereophotogrammetric analysis (RSA).

    PubMed

    Nieuwenhuijse, Marc J; Valstar, Edward R; Kaptein, Bart L; Nelissen, Rob G H H

    2012-05-16

    Excessive early migration of femoral stems following total hip arthroplasty and tibial components following total knee arthroplasty is associated with their long-term survival and allows reliable early evaluation of implant performance. However, a similar relationship involving acetabular components following hip arthroplasty has not been evaluated. This prospective, long-term study with clinical and Roentgen stereophotogrammetric analysis (RSA) follow-up establishes the existence of this relationship and its associated diagnostic performance. Thirty-nine consecutive patients (forty-one hips) who underwent total hip arthroplasty with a cemented Exeter stem and a cemented Exeter all-polyethylene cup had prospective clinical and RSA follow-up. Patients were evaluated postoperatively at six weeks, at three, six, and twelve months, and annually thereafter. Conventional anteroposterior and lateral radiographs were made at six weeks and at two, five, and ten years postoperatively as well as when indicated. The mean duration of follow-up (and standard deviation) was 9.4 ± 3.2 years. No patients were lost to follow-up; fifteen patients died during the follow-up period. Eleven acetabular components were observed to be loose on conventional radiographs after a mean of seventy-six months (range, twelve to 140 months). During the first two postoperative years, the failed acetabular components showed markedly greater and more rapid cranial translation and sagittal rotation. Both cranial translation (hazard ratio = 19.9 [95% confidence interval, 4.94 to 80.0], p < 0.001) and sagittal rotation (hazard ratio = 11.1 [95% confidence interval, 2.83 to 43.9], p = 0.001) were strong risk factors for late aseptic loosening. Eight of the eleven failed components showed a distinctive pattern of excessive cranial translation combined with excessive sagittal rotation. The associated diagnostic performance of two-year cranial translation and/or sagittal rotation for predicting late aseptic

  6. Continuous postoperative insulin infusion reduces deep sternal wound infection in patients with diabetes undergoing coronary artery bypass grafting using bilateral internal mammary artery grafts: a propensity-matched analysis.

    PubMed

    Ogawa, Shinji; Okawa, Yasuhide; Sawada, Koshi; Goto, Yoshihiro; Yamamoto, Masanori; Koyama, Yutaka; Baba, Hiroshi; Suzuki, Takahiko

    2016-02-01

    Deep sternal wound infection (DSWI), especially in patients with diabetes mellitus (DM), is a major concern after coronary artery bypass grafting (CABG) with bilateral internal mammary artery (BIMA) grafts. We evaluated the risk of DSWI and other clinical outcomes between continuous insulin infusion therapy (CIT) and insulin sliding scale therapy (IST) in a cohort of DM patients who underwent CABG with BIMA. The clinical records of DM patients who underwent isolated CABG with BIMA were retrospectively reviewed. The study population consisted of 95 patients who received CIT and 126 patients who received IST. Furthermore, a one-to-one matched analysis based on estimated propensity scores for patients who received CIT or IST yielded two groups comprising 58 patients each. The proportion of patients with DSWI, overall survival rates and major adverse cardiac events were compared between the two groups in the overall and the propensity-matching cohort. The prevalence of DSWI requiring debridement and closure was significantly reduced in the CIT group compared with that in the IST group [1/95 (1.1%) vs 9/126 (7.1%), P = 0.031]; these results were not attenuated even after propensity-matching analysis [0/58 (0%) vs 6/58 (10.3%), P = 0.031]. The mean preoperative glucose levels were similar between the two groups (157.5 ± 54.6 vs 176.1 ± ±70 mg/dl, P = 0.063), whereas the mean glucose values were significantly lower on the first and second operative days in the CIT group than in the IST group (132.9 ± 44.1 vs 197.8 ± 78.6 mg/dl, P < 0.0001; 153.5 ± 58.8 vs 199.6 ± 89.1 mg/dl, P < 0.0001, respectively). The glucose variability levels within 24 h postoperatively were significantly higher in the IST group (46.1 ± 19.4 vs 66.4 ± 26.8 mg/dl, P < 0.0001). The 30-day and 1-year survival rates were similar between the two groups (100 vs 99.2%, P = 0.384; 96.6 vs 94.4%, P = 0.454). No results were changed in the propensity-matching models. The CIT approach reduced the

  7. Treatment of Pseudoarthrosis After Minimally Invasive Hallux Valgus Correction

    PubMed Central

    Cianforlini, Marco; Rosini, Cristina; Marinelli, Mario; de Palma, Luigi

    2014-01-01

    Objective: Treatment of mild and moderate hallux valgus deformities. Discussion: Minimally invasive technique enables surgeons to treat mild and moderate hallux valgus deformities with excellent and good results in the majority of patients. Nonunion of first metatarsal, moreover, has only rarely been reported. Summary: We describe the essential steps of a surgical technique for the treatment of nonunions after miniinvasive subcapital first metatarsal osteotomy reconstructed using a tricortical iliac crest bone graft. PMID:25013553

  8. Influence of the antiseptic agents polyhexanide and octenidine on FL cells and on healing of experimental superficial aseptic wounds in piglets. A double-blind, randomised, stratified, controlled, parallel-group study.

    PubMed

    Kramer, A; Roth, B; Müller, G; Rudolph, P; Klöcker, N

    2004-01-01

    The main target of the combination of octenidine with phenoxyethanol (Octenisept) is the antisepsis of acute wounds, whereas polyhexanide combined with polyethylene glycol in Ringer solution (Lavasept) is the agent of choice for antisepsis of chronic wounds and burns. Because comparative data for both agents on the effects on wound healing are lacking, we investigated the influence of preparations based on polyhexanide and octenidine versus placebo (Ringer solution) in experimental superficial aseptic skin wounds (n = 108) of 20 mm diameter, using a double-blind, randomised, stratified, controlled, parallel-group design in piglets. Computerised planimetry and histopathological methods were used for the assessment of wound healing. Histologically, no significant differences could be verified at any time between the 3 groups. However, in the early phase (day 9 after wounding), the octenidine-based product retarded wound contraction to a significantly greater extent than placebo and polyhexanide, whereas in the later phase (days 18 and 28), polyhexanide promoted contraction significantly more than did placebo and octenidine. The consequence is complete wound closure after 22.9 days using polyhexanide, in comparison to the placebo after 24.1 days (p < 0.05) and octenidine after 28.3 days (no statistical difference to placebo). This may be explained by the better tolerance of polyhexanide in vitro, which was demonstrated with dose and time dependence in cytotoxicity tests on human amnion cells. Copyright 2004 S. Karger AG, Basel

  9. Longest form of CCTG microsatellite repeat in the promoter of the CD2BP1/PSTPIP1 gene is associated with aseptic abscesses and with Crohn disease in French patients.

    PubMed

    André, Marc F J; Aumaître, Olivier; Grateau, Gilles; Chamaillard, Mathias; Costedoat-Chalumeau, Nathalie; Cardoso, Marie-Céleste; Henry-Berger, Joëlle; Ramakrishna, Balakrishnan S; Delpech, Marc; Piette, Jean-Charles; Creveaux, Isabelle

    2010-06-01

    Aseptic abscesses syndrome (AA) is an inflammatory disease in which non-infectious deep abscesses develop; these respond quickly to corticosteroids. AA is associated with Crohn disease (CD) in 57% of cases and with neutrophilic dermatosis (ND) in 20%. Pyoderma gangrenosum is usually a sporadic ND. A hereditary autosomal dominant syndromic kind of pyoderma gangrenosum, the PAPA syndrome, is linked to mutations in the CD2BP1/PSTPIP1 gene. We systematically screened this gene in French AA patients. One microsatellite (CCTG)n with 3 alleles was identified in the promoter. The longest form (CCTG)7 was significantly more frequent in AA patients than in French controls (P = 0.0154). We also found an association of the (CCTG)7 allele with CD in French patients (P = 0.0351). This association was not found in a sample of Indian patients. The CCTG repeat in the PSTPIP1 promoter may play a role in the pathogenesis of AA and of CD. Further investigations are required to demonstrate the possible modulation of gene expression by the (CCTG)n motif.

  10. Occurrence of molds on laminated paperboard for aseptic packaging, selection of the most hydrogen peroxide- and heat-resistant isolates and determination of their thermal death kinetics in sterile distilled water.

    PubMed

    Delgado, Denise Aparecida; de Souza Sant'ana, Anderson; de Massaguer, Pilar Rodriguez

    2012-07-01

    This study aimed at enumerating molds (heat-labile and heat-resistant) on the surface of paperboard material to be filled with tomato pulps through an aseptic system and at determining the most heat- and hydrogen peroxide-resistant strains. A total of 118 samples of laminated paperboard before filling were collected, being 68 before and 50 after the hydrogen peroxide bath. Seven molds, including heat-resistant strains (Penicillium variotii and Talaromyces flavus) with counts ranging between 0.71 and 1.02 CFU/cm(2) were isolated. P. variotii was more resistant to hydrogen peroxide than T. flavus and was inactivated after heating at 85 °C/15 min. When exposed to 35 % hydrogen peroxide at 25 °C, T. flavus (F5E2) and N. fischeri (control) were less resistant than P. variotti (F1A1). P. citrinum (F7E2) was shown to be as resistant as P. variotti. The D values (the time to cause one logarithmic cycle reduction in a microbial population at a determined temperature) for spores of P. variotii (F1A1) and N. fischeri (control) with 4 months of age at 85 and 90 °C were 3.9 and 4.5 min, respectively. Although the contamination of packages was low, the presence of heat- and chemical-resistant molds may be of concern for package sterility and product stability during shelf-life. To our knowledge, this is the first report that focuses on the isolation of molds, including heat-resistant ones, contaminating paperboard packaging material and on estimating their resistance to the chemical and physical processes used for packaging sterilization.

  11. Samokutyaev works with the bioscience experiment ASEPTIC

    NASA Image and Video Library

    2014-09-30

    ISS041-E-042459 (30 Sept. 2014) --- Russian cosmonaut Alexander Samokutyaev, Expedition 41 flight engineer, works with test samples in a glovebox in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  12. Samokutyaev works with the bioscience experiment ASEPTIC

    NASA Image and Video Library

    2014-09-30

    ISS041-E-042451 (30 Sept. 2014) --- Russian cosmonaut Alexander Samokutyaev, Expedition 41 flight engineer, works with test samples in a glovebox in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  13. Recalcitrant aseptic atrophic non-union of the shaft of the humerus after failure of surgical treatment: management by excision of non-union, bone grafting and stabilization by LCP in different modes.

    PubMed

    Babhulkar, Sudhir; Babhulkar, Sushrut; Vasudev, Aditya

    2017-08-01

    Non-union of the humeral shaft is infrequently noticed after surgical fixation. Sixty eight patients whose osteosynthesis of humeral shaft had failed leading to non-union were identified over a duration of 10 years from (January 2006 to December 2015). Clinical and radiographical follow-up was available for 64 patients (4 patients were lost for follow-up), with a mean age of 58 years (range 25-78 years). All patients had aseptic atrophic non-union of either: proximal shaft (n=12), mid shaft (n=38), and lower shaft (n=14). All these patients had failure of primary fixation, with a minimum duration from 36 to 110 weeks. Non-unions were operated by excision of non-union, autogenous bone grafting and osteosynthesis by locking compression plating. Adequate fixation of non-union with bone grafting was achieved in all patients. All non-unions healed well at an average of 16 weeks (range 6-36 weeks). The mean length of follow-up was 120 weeks (range 60-250 weeks). The mean range of movements following healing of non-union was forward flexion of 140°, external rotation and internal rotation of 30° at shoulder and average fixed flexion deformity of 10° and flexion of 130° at elbow. Two patients had postoperative radial nerve palsy because of neuropraxia, which recovered in eight weeks. Three patient developed superficial infections at the iliac crest, which settled with antibiotics, dressings in 3 weeks time and two patients had some discomfort over the fibular graft harvest site. In all patients complete clinical and radiological union was achieved with satisfactory outcome in terms of relief of symptoms and functional improvement in the range of movements. The main points in surgical treatment were complete excision of non-union, correction of deformity, use of plenty of corticocancellous graft, furthermore the use of intramedullary fibula and osteosynthesis by long locking compression plating in different modes of fixation provided good to excellent results and

  14. Evaluation of the BioVigilant IMD-A, a novel optical spectroscopy technology for the continuous and real-time environmental monitoring of viable and nonviable particles. Part II. Case studies in environmental monitoring during aseptic filling, intervention assessments, and glove integrity testing in manufacturing isolators.

    PubMed

    Miller, Michael J; Walsh, Michael R; Shrake, Jerry L; Dukes, Randall E; Hill, Daniel B

    2009-01-01

    This paper describes the use of the BioVigilant IMD-A, a real-time and continuous monitoring technology based on optical spectroscopy, to simultaneously and instantaneously detect, size, and enumerate both viable and nonviable particles in a variety of filling and transfer isolator environments during an aseptic fill, transfer of sterilized components, and filling interventions. Continuous monitoring of three separate isolators for more than 16 h and representing more than 28 m3 of air per isolator (under static conditions) yielded a mean viable particle count of zero (0) per cubic meter. Although the mean count per cubic meter was zero, the detection of very low levels of single viable particles was randomly observed in each of these sampling runs. No viable particles were detected during the manual transfer of sterilized components from transfer isolators into a filling isolator, and similar results were observed during an aseptic fill, a filling needle change-out procedure, and during disassembly, movement, and reassembly of a vibrating stopper bowl. During the continuous monitoring of a sample transfer port and a simulated mousehole, no viable particles were detected; however, when the sampling probe was inserted beyond the isolator-room interface, the IMD-A instantaneously detected and enumerated both viable and nonviable particles originating from the surrounding room. Data from glove pinhole studies showed no viable particles being observed, although significant viable particles were immediately detected when the gloves were removed and a bare hand was allowed to introduce microorganisms into the isolator. The IMD-A technology offers the industry an unprecedented advantage over growth-based bioaerosol samplers for monitoring the state of microbiological control in pharmaceutical manufacturing environments, and represents significant progress toward the acceptance of microbiology process analytical technology solutions for the industry.

  15. The sternalis muscle in the Bulgarian population: classification of sternales

    PubMed Central

    JELEV, L.; GEORGIEV, G.; SURCHEV, L.

    2001-01-01

    The sternalis muscle (musculus sternalis) is the name usually given to this common anatomical variant, but the terms ‘episternalis’, ‘presternalis’, ‘sternalis brutorum’, ‘rectus thoracis’, ‘rectus sterni’, ‘superficial rectus abdominis’ and ‘japonicus’ have also been used in the literature (for reviews see Le Double, 1879; Calori, 1888; Pichler, 1911; Blees, 1968). According to Turner (1867), Cabrolius was the first, in 1604, to describe sternalis. Nevertheless this muscle is often unknown even in clinical practice (Bailey & Tzarnas, 1999; Vandeweyer, 1999). Thus far, investigations on the incidence of sternalis have been made both in large populations such as the American (Barlow, 1935) and small populations, for example in Taiwan (Shen et al. 1992; Jeng & Su, 1998). In Europe, all studies on the frequency of this muscle have been made amongst subpopulations in Western (e.g. Cunningham, 1888; Le Double, 1890, 1897) and Northern Europe (Gruber, 1860) although the reported frequencies have been quite different. There is a lack of information about sternalis in Eastern European populations. We therefore present data from a study on the incidence of sternalis muscle in Bulgaria. PMID:11554516

  16. [Pseudoarthrosis of the scaphoid bone associated with carpal collapse: factors in choice of surgical approach].

    PubMed

    Miric, D; Senohradski, K; Vucetic, C; Djordjevic, Z

    2001-01-01

    The most common fracture involving the wrist is a fracture of the scaphoid bone [1], and only 5% to 10% of these fractures proceed to nonunion. Although not symptomatic initially, most (if not all) nonunions later produce a painful wrist with impaired function, clinically significant loss of motion, increased weakness and degenerative arthritis. Nonunion of the scaphoid bone should be treated by open reduction and internal fixation. Many surgical procedures have been advocated to achieve union. Most widely used technique for the treatment of scaphoid nonunion was described by Russe [2], but this method may overcome the flexion deformity of the scaphoid and carpal deformities. The ununited scaphoid usually undergoes resorption of the fractures surfaces, principally over the anterolateral aspect of the fracture, so that the scaphoid becomes misshapen. The restoration of the exact length and form is enabled by insertion of a tight-fitting trapezoidal corticocancellous graft, a technique described by Fernandez [11]. We analysed the results of treatment of scaphoid nonunion utilized by two bone-grafting techniques and pointed out the need of choice of the best operative method. From 1977 to 1993, at the Institute of Orthopaedic Surgery and Traumatology in Belgrade, 40 patients were surgically treated for symptomatic nonunion of the scaphoid bone. The mean duration of follow-up was 10.2 years (range, from 6 to 22 years). Eighteen (45%) patients were operated by Fernandez technique and 22 (55%) patients were operated using Russe's technique. Volar approach and Kirschner's wire fixation were performed in both operative methods. We used two rating scales proposed by Cooney [13] to evaluate the results. Objective scale (Table 1a) included the radiographic appearance of the wrist, the range of motion and grip strength. Subjective scale (Table 1b) comprised function, pain perception of a decrease in performance because of limited motion or strength, and satisfaction. These scales were used to compare the objective and subjective results in patients who had postoperatively carpal collapse with the results in patients who had not such deformity. The union rate was 92.5% in both methods. Russe's technique resulted in union in 20 (91%) of 22 cases with two ununited. Fernandez technique achieved union in 17 (94%) of 18 cases. Fracture union was determined by both clinical and roentgenographic examinations. Correction of the lateral interscaphoid angle was obtained in 14 (82%) patients operated by Fernandez technique and 9 (45%) patients operated by Russe's technique. Correction of dorsal tilt of the lunate were achieved in 6 (30%) patients operated by Russe's technique, and 13 (76.6%) patients operated by Fernandez technique. There was a highly significant correlation (p < 0.01) between increased deformity of the scaphoid and extent of carpal collapse (Graph 1). Also, there was significant difference between two operative techniques regarding correction of lateral interscaphoid angle (p < 0.05). Arthrosis of the wrist was present in all patients. We could not demonstrate a significant difference (p > 0.05) between intensity of degenerative changes and increase of lateral interscaphoid angle, but obviously, the large flexion deformity of the scaphoid the worse intensity of degenerative changes (Graph 2). The grip strength significantly increased after Fernandez technique (p > 0.05) (Graph 3), but wrist motion changed a little. The average objective score was 71 points for the patients in whom the lateral interscaphoid angle was 45 degrees or less, and 63 points for those in whom the angle was more than 45 degrees. This difference was significant (p < 0.05), but we could not demonstrate a significant difference between the two groups in terms of the average subjective score. In our series, both procedures provided a high union rate [2]. In cases with severe scaphoid shortening and flexion deformity, Russe's procedure has proved to be insufficient to restore anatomic length and correction of carpal alignment [6, 11, 17]. Previous authors have reported that the progression in degenerative changes was slower in patients who had a lateral interscaphoid angle less than 45 degrees [13]. Also, grip strength and range of motion increased in patients in whom flexion deformity of the scaphoid had been corrected [2, 4, 6, 16, 17]. Our study supports these findings, except results regarding the movement. We believe that this was due to postoperative scarring. Discrepancy between the subjective and objective results may have been due to postoperative relief of pain obtained by increased carpal stability or decreased range of motion of the carpal joints due to postoperative scarring. If pain is relieved, patients readily adapt to the functional deficit of decreased range of motion. We concluded that angulatory collapse of the scaphoid resulted in nonunion as well as malunion with secondary functional loss. Recognition and avoidance in acute fractures were important. When recognised late, volar wedge grafting appeared to be a satisfactory method of treatment.

  17. [Bone loss treatment, pseudoarthrosis, arthrodesis and benign tumors using xenoimplant: clinical study].

    PubMed

    Cueva-Del Castillo, José Fernando; Valdés-Gutiérrez, Gustavo Adolfo; Elizondo-Vázquez, Francisco; Pérez-Ortiz, Omar; Piña Barba, María Cristina; León-Mancilla, Benjamín Herminio

    2009-01-01

    Bone loss as a result of arthrodesis, pseudarthrosis, benign tumors and bone defects was treated using a xenoimplant (Nukbone). The effectiveness of the material was evaluated through a longitudinal and observational study at the Hospital Regional "General Ignacio Zaragoza" (HRGIZ) ISSSTE. The Mexican xenoimplant is a patent of the National Autonomous University of Mexico (UNAM). Fifty two patients were considered regardless of age or gender. Of these patients, 28 were male and 24 female. Average age of the patients was 47.7 years (9-84 years). Twenty eight patients had arthrodesis, 16 were treated with pseudarthrosis, three patients had benign tumors and five patients presented bone defects, which were implanted with Nukbone at the site and was the correct treatment for the problem. The xenoimplant is fully integrated during a period of 3-18 months, depending on the size of the pathology and the region where it was placed. Fracture healing was evaluated radiographically according to the classification of Montoya. No patient had clinical signs of rejection. In Mexico, bony xenoimplants (osseous) have been used, all of foreign origin due to the high degree of technological dependence in this country. In this study we describe the use, for the first time, of a Mexican xenoimplant with a patent from the Universidad Nacional Autónoma de México (UNAM). The Mexican xenoimplant is biocompatible and can be adapted to treat pathologies where bony (osseous) material is needed.

  18. Revision of the aseptic and septic total ankle replacement.

    PubMed

    Espinosa, Norman; Wirth, Stephan Hermann

    2013-04-01

    Total ankle replacement has become a popular treatment of symptomatic end-stage ankle osteoarthritis. Contemporary total ankle replacement systems provide more anatomic and biomechanically sound function. However, longevity is still limited and long-term results of modern total ankle replacement designs are not available. In the case of failure, conversion into arthrodesis has remained the treatment of choice but at the cost of hindfoot function and potential degeneration of the adjacent joints. Thus, revision total ankle replacement by exchange of the prosthetic components represents an attractive solution. This article focuses on revision total ankle replacement and conversion to ankle arthrodesis.

  19. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  20. Acute pelvic pain in females in septic and aseptic contexts.

    PubMed

    Pages-Bouic, E; Millet, I; Curros-Doyon, F; Faget, C; Fontaine, M; Taourel, P

    2015-10-01

    Acute pelvic pain in women is a common reason for emergency department admission. There is a broad range of possible aetiological diagnoses, with gynaecological and gastrointestinal causes being the most frequently encountered. Gynaecological causes include upper genital tract infection and three types of surgical emergency, namely ectopic pregnancy, adnexal torsion, and haemorrhagic ovarian cyst rupture. The main gastrointestinal cause is acute appendicitis, which is the primary differential diagnosis for acute pelvic pain of gynaecological origin. The process of diagnosis will be guided by the clinical examination, laboratory study results, and ultrasonography findings, with suprapubic transvaginal pelvic ultrasonography as the first-line examination in this young population, and potentially cross-sectional imaging findings (computed tomography and MR imaging) if diagnosis remains uncertain.

  1. [Graner's intercarpal arthrodesis as therapy of aseptic lunate bone necrosis].

    PubMed

    Ehall, R; Neubauer, W; Stampfel, O; Peicha, G

    1990-07-01

    From 1978 till 1989 at the Department of Orthopaedics (University of Graz, Faculty of Medicine, Division of Surgery) 25 patients were operated for the reason of an avascular necrosis of the lunate bone when the bone structures were already destroyed. The form of therapy was the intercarpal-arthrodesis, developed by Orlando Graner 1966, in a slightly modified way. On the one hand through creating an intercarpal block it is possible to create more or less plain sides of the radiocarpal joint and on the other hand one can stop the carpal collapse what explains long-term-results rather acceptable. The most important disadvantage of this form of therapy is the often found loss of range of movement in the operated radiocarpal joint.

  2. The use of Papineau technique for the treatment of diabetic and non-diabetic lower extremity pseudoarthrosis and chronic osteomyelitis.

    PubMed

    Polyzois, Vasilios D; Galanakos, Spyridon P; Tsiampa, Vassiliki A; Papakostas, Ioannis D; Kouris, Nikiforos K; Avram, Adrian M; Papalois, Apostolos E; Ignatiadis, Ioannis A

    2011-01-01

    The treatment of 31 consecutive adult patients, ages 25-67 years with chronic draining osteomyelitis (12 cases) or infected pseudarthrosis (19 cases) by the Papineau technique was retrospectively reviewed. The initial injury was an open fracture in 24 patients and a closed fracture in 7 patients. In all cases an Ilizarov circular external fixation device was used for the stabilization of the fracture or for bone lengthening. Mean follow-up for the group was 20 months (range, 10 months to 5 years) and there was successful limb salvage in all cases with eradication of infection and bone consolidation was achieved. The Ilizarov circular external fixation was removed at a mean of 18 weeks (range, 14-24 weeks). The mean time to bone union was 5 months (range, 4-10 months). All patients returned to their pre-treatment activity levels or better.

  3. The use of Papineau technique for the treatment of diabetic and non-diabetic lower extremity pseudoarthrosis and chronic osteomyelitis

    PubMed Central

    Polyzois, Vasilios D.; Galanakos, Spyridon P.; Tsiampa, Vassiliki A.; Papakostas, Ioannis D.; Kouris, Nikiforos K.; Avram, Adrian M.; Papalois, Apostolos E.; Ignatiadis, Ioannis A.

    2011-01-01

    The treatment of 31 consecutive adult patients, ages 25–67 years with chronic draining osteomyelitis (12 cases) or infected pseudarthrosis (19 cases) by the Papineau technique was retrospectively reviewed. The initial injury was an open fracture in 24 patients and a closed fracture in 7 patients. In all cases an Ilizarov circular external fixation device was used for the stabilization of the fracture or for bone lengthening. Mean follow-up for the group was 20 months (range, 10 months to 5 years) and there was successful limb salvage in all cases with eradication of infection and bone consolidation was achieved. The Ilizarov circular external fixation was removed at a mean of 18 weeks (range, 14–24 weeks). The mean time to bone union was 5 months (range, 4–10 months). All patients returned to their pre-treatment activity levels or better. PMID:22396823

  4. [Examination of the opportunity costs and turnover situation in patients with deep sternal infections].

    PubMed

    Ennker, I C; Kojcici, B; Ennker, J; Vogt, P; Melichercik, J

    2012-06-01

    Each and every hospital of any kind is forced, due to increased cost pressure, to work as economically and as efficiently as possible. This even applies when the operational orientations of the hospitals institutions are different. In the present article an analysis of the repercussions of the treatment of postoperative complications in terms of entrepreneurial practice is given. Our focus is on the opportunity cost. A theoretical calculation of opportunity costs is made based on the example of postoperative infections following cardiac surgery and the resulting treatment. The bases of the examinations are the results collected at the hospital Mediclin Herzentrum Lahr / Baden in 2008. The wound healing disorders were recorded from November 2004 until November 2007 and include 3675 patients who were operated on using a median sternotomy. Out of the 3675 patients 45 (1.2 %) were affected. Various treatment options are at hand. The used therapy algorithm in our practice is dependent on the stage and the development of the infection. If the high trim point, the medial trim point and the low trim point of the mediastinitis patients, as well as the average revenue and the surcharge omission on exceeding the high trim point (these data can be found in the annual accounts) and knowledge of the actual length of stay of the mediastinitis patient are known, the opportunity cost, respectively potential turnover increases, can be calculated. Reducing the medial trim point from 48.43 to, for example, 36.37 days could potentially produce a turnover increase of as much as 10 633.41 €. Keeping patient safety in mind, significant turnover increases can be achieved with adequate planning. The considered sales situation, however, can only be achieved under the same terms: these being free operating room and bed capacities, available personnel, equal cost of materials as well as enough patients. The consideration of opportunity costs could be important for entrepreneurs if staff shortage continues and, in economical terms, non-expendable capacities are created. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Solitary sternal metastasis from hepatocellular carcinoma detected by F-18 FDG PET/CT.

    PubMed

    Kamaleshwaran, Koramadai Karuppusamy; Kashyap, Raghava; Bhattacharya, Anish; Mittal, Bhagwant Rai

    2013-01-01

    Fluorine-18 fluoro-deoxy-glucose positron emission tomography (F-18 FDG PET) is not sensitive modality for the diagnosis of primary hepatocellular carcinoma (HCC). However, FDG-PET imaging may be useful in the identification of extrahepatic metastases. We report an interesting image of HCC with solitary metastasis to sternum detected by F-18 FDG PET/CT.

  6. Sternal vibrations during head-out immersion: A preliminary demonstration of underwater wearable ballistocardiography.

    PubMed

    Wiens, Andrew D; Carek, Andrew M; Inan, Omer T

    2015-09-01

    Ballistocardiography (BCG) measures vibrations of the body caused by ejection of blood from the heart, and the root mean square (RMS) of BCG measured with a weighing scale trends with cardiac output. However, BCG underwater has not been studied. Head-to-foot BCG signals were recorded with an accelerometer on the sternum of three human subjects. The heartbeats were clearly visible in the signals recorded underwater, and the resting change in RMS BCG was +360 μg (+36%) from air to cold water immersion (27.8 °C) while standing. This is within the 32%-62% increase in cardiac output observed in previous head-out immersion studies.

  7. Sternal wound infection caused by Gordonia bronchialis: identification by MALDI-TOF MS

    PubMed Central

    Rodriguez-Lozano, Jesús; Pérez-Llantada, Enrique; Agüero, Jesús; Rodríguez-Fernández, Ana; Ruiz de Alegria, Carlos; Martinez-Martinez, Luis

    2016-01-01

    Introduction: Gordonia spp. infections are uncommon. However, a few clinical cases have been reported in the literature, particularly those involving immunocompromised hosts. Advanced microbiology diagnosis techniques, such as matrix-assisted laser desorption ionization-time of flight MS (MALDI-TOF MS), have been recently introduced in clinical microbiology laboratories in order to improve microbial identification, resulting in better patient management. Case presentation: Here, we present a new clinical case of persistent wound infection caused by Gordonia bronchialis in a 64-year-old woman after a mitral valve replacement, using two MALDI-TOF-based systems for identifying this micro-organism. Conclusion: Both MALDI-TOF systems were able to identify Gordonia spp.; thus, providing a useful tool that overcomes the current limitations of phenotypic identification associated with this micro-organism. Although the technique validation deserves additional verification, our study provides guidance about MALDI-TOF as a fast and easy method for Gordonia spp. identification. PMID:28348789

  8. Simultaneous repair of pectus excavatum and congenital heart disease without cardiopulmonary bypass or sternal osteotomy.

    PubMed

    Sun, Yong; Zhu, Peng; Zheng, Shao-Yi

    2014-10-16

    A 8-year-old girl with severe pectus excavatum and an atrial septal defect had simultaneous repair of the both defects, using thransthoracic occlusion for atrial septal defect and improved Nuss technique for the pectus excavatum. Neither cardiopulmonary bypass nor sternotomy was required in this procedure. Details of the procedure and outcome are described.

  9. Respiratory Function in Voluntary Participating Patagonia Sea Lions (Otaria flavescens) in Sternal Recumbency

    PubMed Central

    Fahlman, Andreas; Madigan, Johnny

    2016-01-01

    We measured esophageal pressures (n = 4), respiratory flow rates (n = 5), and expired O2 and CO2 (n = 4) in five adult Patagonia sea lions (Otaria flavescens, body mass range 94.3–286.0 kg) during voluntary breaths while laying down out of water. The data were used to estimate the dynamic specific lung compliance (sCL), the O2 consumption rate (V˙O2) and CO2 production rates (V˙CO2) during rest. Our results indicate that the resting tidal volume in Patagonia sea lions is approximately 47–73% of the estimated total lung capacity. The esophageal pressures indicated that expiration is passive during voluntary breaths. The average sCL of sea lions was 0.41 ± 0.11 cmH2O−1, which is similar to those measured in anesthetized sea lions and awake cetaceans, and significantly higher as compared to humans (0.08 cmH2O−1). The average estimated V˙O2 and V˙CO2 using breath-by-breath respirometry were 1.023 ± 0.327 L O2 min−1 (range: 0.695–1.514 L O2 min−1) and 0.777 ± 0.318 L CO2 min−1, (range: 0.510–1.235 L CO2 min−1), respectively, which is similar to previously published metabolic measurements from California and Steller sea lions using conventional flow-through respirometry. Our data provide end-tidal gas composition and offer novel data for respiratory physiology in pinnipeds, which may be important for clinical medicine and conservation efforts. PMID:27899896

  10. Respiratory Function in Voluntary Participating Patagonia Sea Lions (Otaria flavescens) in Sternal Recumbency.

    PubMed

    Fahlman, Andreas; Madigan, Johnny

    2016-01-01

    We measured esophageal pressures (n = 4), respiratory flow rates (n = 5), and expired O2 and CO2 (n = 4) in five adult Patagonia sea lions (Otaria flavescens, body mass range 94.3-286.0 kg) during voluntary breaths while laying down out of water. The data were used to estimate the dynamic specific lung compliance (sCL), the O2 consumption rate ([Formula: see text]O2) and CO2 production rates ([Formula: see text]CO2) during rest. Our results indicate that the resting tidal volume in Patagonia sea lions is approximately 47-73% of the estimated total lung capacity. The esophageal pressures indicated that expiration is passive during voluntary breaths. The average sCL of sea lions was 0.41 ± 0.11 cmH2O(-1), which is similar to those measured in anesthetized sea lions and awake cetaceans, and significantly higher as compared to humans (0.08 cmH2O(-1)). The average estimated [Formula: see text]O2 and [Formula: see text]CO2 using breath-by-breath respirometry were 1.023 ± 0.327 L O2 min(-1) (range: 0.695-1.514 L O2 min(-1)) and 0.777 ± 0.318 L CO2 min(-1), (range: 0.510-1.235 L CO2 min(-1)), respectively, which is similar to previously published metabolic measurements from California and Steller sea lions using conventional flow-through respirometry. Our data provide end-tidal gas composition and offer novel data for respiratory physiology in pinnipeds, which may be important for clinical medicine and conservation efforts.

  11. Environmental regulation of type X collagen production by cultures of limb mesenchyme, mesectoderm, and sternal chondrocytes.

    PubMed

    Solursh, M; Jensen, K L; Reiter, R S; Schmid, T M; Linsenmayer, T F

    1986-09-01

    We have examined whether the production of hypertrophic cartilage matrix reflecting a late stage in the development of chondrocytes which participate in endochondral bone formation, is the result of cell lineage, environmental influence, or both. We have compared the ability of cultured limb mesenchyme and mesectoderm to synthesize type X collagen, a marker highly selective for hypertrophic cartilage. High density cultures of limb mesenchyme from stage 23 and 24 chick embryos contain many cells that react positively for type II collagen by immunohistochemistry, but only a few of these initiate type X collagen synthesis. When limb mesenchyme cells are cultured in or on hydrated collagen gels or in agarose (conditions previously shown to promote chondrogenesis in low density cultures), almost all initiate synthesis of both collagen types. Similarly, collagen gel cultures of limb mesenchyme from stage 17 embryos synthesize type II collagen and with some additional delay type X collagen. However, cytochalasin D treatment of subconfluent cultures on plastic substrates, another treatment known to promote chondrogenesis, induces the production of type II collagen, but not type X collagen. These results demonstrate that the appearance of type X collagen in limb cartilage is environmentally regulated. Mesectodermal cells from the maxillary process of stages 24 and 28 chick embryos were cultured in or on hydrated collagen gels. Such cells initiate synthesis of type II collagen, and eventually type X collagen. Some cells contain only type II collagen and some contain both types II and X collagen. On the other hand, cultures of mandibular processes from stage 29 embryos contain chondrocytes with both collagen types and a larger overall number of chondrogenic foci than the maxillary process cultures. Since the maxillary process does not produce cartilage in situ and the mandibular process forms Meckel's cartilage which does not hypertrophy in situ, environmental influences, probably inhibitory in nature, must regulate chondrogenesis in mesectodermal derivatives. (ABSTRACT TRUNCATED AT 250 WORDS)

  12. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... the Agency's current good manufacturing practice regulations for PET drugs. DATES: Submit either... good manufacturing practices for PET drugs (21 CFR part 212) regarding media fills. A draft guidance of... HUMAN SERVICES Food and Drug Administration Guidance on Media Fills for Validation of...

  13. A moderate aseptic local inflammation does not induce a significant systemic inflammatory response.

    PubMed

    Bauer, Natali; Mensinger, Sandra; Daube, Gert; Failing, Klaus; Moritz, Andreas

    2012-08-01

    The aim of this prospective study was to characterize the response of the coagulation system to a defined sterile localized inflammatory process. Tissue cages were implanted subcutaneously in five healthy Beagles. After 9-10 weeks, local inflammation was induced by an injection of 0.5 ml 1% carrageenan. Serial samples of tissue cage fluid (TCF) and blood were collected at 10 time points (0-168 h). Nucleated cells (NC) of TCF were counted automatically to characterize local inflammation. C-reactive protein (CRP), leukocytes and coagulation variables (PT, aPTT, fibrinogen, factor VIII, antithrombin, protein C, protein S, and d-dimers) were determined in blood samples. Carrageenan induced a significant 32-fold increase of NCs in TCF (P<0.0001). A slight increase in leukocytes (P<0.0001) was observed. There was a significant 1.3- to 1.5-fold increase in protein C (P=0.0001) and protein S (P=0.0028). CRP, secondary hemostasis and fibrinolysis did not change. The mild increase from baseline in PC/PS, may reflect a physiological counter reaction. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Subsurface Organics in Aseptic Cores From the MARTE Robotic Drilling Experiment: Ground truth and Contamination Issues

    NASA Astrophysics Data System (ADS)

    Bonaccorsi, R.; Stoker, C. R.

    2006-12-01

    The subsurface is the key environment for searching for life on planets lacking surface life. This includes the search for past/present life on Mars where possible subsurface life could exist [1]. The Mars-Analog-Rio-Tinto-Experiment (MARTE) performed a simulation of a Mars robotic drilling at the RT Borehole#7 Site ~6.07m, atop a massive-pyrite deposit from the Iberian Pyritic Belt. The RT site is considered an important analog of Sinus Meridiani on Mars, an ideal model analog for a subsurface Martian setting [2], and a relevant example of deep subsurface microbial community including aerobic and anaerobic chemoautotrophs [4-5]. Searching for microbes or bulk organics of biological origin in a subsurface sample from a planet is a key scientific objective of Robotic drilling missions. During the 2005 Field experiment 28 minicores were robotically handled and subsampled for life detection experiments under anti-contamination protocols. Ground truth included visual observation of cores and lab based Elemental and Isotope Ratios Mass Spectrometry analysis (EA-IRMS) of bulk organics in Hematite and Gohetite-rich gossanized tuffs, gossan and clay layers within 0-6m-depth. C-org and N-tot vary up to four orders of magnitude among the litter (~11Wt%, 0-1cm) and the mineralized (~3Wt%, 1-3cm) layers, and the first 6 m-depth (C-org=0.02-0.38Wt%). Overall, the distribution/ preservation of plant and soil-derived organics (d13C-org = 26 per mil to 24 per mil) is ten times higher (C-org=0.33Wt%) that in hematite-poor clays, or where rootlets are present, than in hematite- rich samples (C-org=<0.01Wt%). This is consistent with ATP assay (Lightning-MVP, Biocontrol) for total biomass in subsurface (Borehole#7 ~6.07m, ~avg. 153RLU) vs. surface soil samples (~1,500-81,449RLU) [5]. However, the in-situ ATP assay failed in detecting presence of roots during the in-situ life detection experiment. Furthermore, cm-sized roots were overlooked during remote observations. Finally, ATP Luminometry provided insights for potential contamination from core-handling and environmental dust loadings on cleaned/sterilized control surfaces (e.g., 6,782-36,243RLU/cm2). Cleanliness/sterility can be maintained by applying a simple sterile protocol under field conditions. Science results from this research will support future Astrobiology driven drilling mission planned on Mars. Specifically, ground truth offers relevant insights to assess strengths and limits of in-situ/remote observations vs. laboratory measurements. Results from this experiment will also aid the debate on advantages/ disadvantages of manned vs. robotic drilling missions on Mars or other planets. [1] Boston et al., 1997; [2] http://marte.arc.nasa.gov; [3] Stoker, C., et al., 2006 AbSciCon, [4] Stoker et al., submitted; [5] Bonaccorsi., et al., 2006 AbSciCon.

  15. Decision-making support system based on LCA for aseptic packaging recycling.

    PubMed

    Varžinskas, Visvaldas; Staniškis, Jurgis K; Knašyte, Milda

    2012-09-01

    In Europe post-consumer beverage carton packages are treated in three ways: dumped in a landfill, incinerated for energy recovery, and recycled. In recent years new technologies for beverage carton recycling have been developed and tested. At the same time in Europe the collection of second-hand raw materials is becoming more efficient. In order to facilitate and justify the decision-making process, different possibilities of poly-aluminium handling were analysed. For this reason, the objective of this study was to compare carbon footprints in the whole life cycle of selected technologies and to provide decision-making with data for beverage carton recycling. The paper is based on some of the results of the project 'Sustainable Production through Innovations in small- and medium-sized enterprises (SPIN)'. The SPIN project is providing small- and medium-sized enterprises with a whole set of instruments that put entrepreneurs in a position to innovate their production processes and products leading to improved business and public benefits.

  16. [Silicate coating of cemented titanium-based shafts in hip prosthetics reduces high aseptic loosening].

    PubMed

    Marx, R; Faramarzi, R; Jungwirth, F; Kleffner, B V; Mumme, T; Weber, M; Wirtz, D C

    2009-01-01

    For cemented hip prostheses, all requirements can be fulfilled by using forged Co/Cr/Mo stems. Co/Cr/Mo alloys, however, are contraindicated for allergy sufferers. For these patients, a cemented prosthesis made of titanium (alloy) would be indicated. Cemented stems from titanium (alloy), depending on the geometry of the prosthesis and its specific surface texture, however, may have loosening rates which are clinically not tolerable. In comparison to Co/Cr/Mo alloys, the greater roughness in conjunction with lesser abrasion resistance of titanium-based alloys leads to high loosening rates caused by abrasion. On the other hand, the greater surface roughness permits good mechanical retention of bone cement to the surface. Good mechanical retention enhances migration behaviour and reduces micromotions. However, there is no stable hydrolytic bond between bone cement and metallic surface; intermediate-term debonding between metal and bone cement is predictable. This debonding results in relative movements, consequently in wear particles which have their origin both from the rough metallic surface and from the PMMA cement. The roughness of the metallic surface operates as emery and with that, a rubbing wear from the PMMA. For the above reasons, a low or moderate roughness is essential for easily abradable implants such as shafts made of titanium (alloy) because low roughness provides a fail-safe running function in case of debonding. Thus, one must allow for inappropriate migration behaviour accompanied by greater micromotions due to insufficient mechanical retention in the case of low roughness. This can be accomplished by a silicate layer coating applied to the metal shaft surface via electrochemical "ECD" or physical vapour deposition "PVD". For analysis, specimens (screws for pull-out, cones for push-out tests) were sand-blasted, so that roughnesses between Ra = 0.8 microm (Rz = 4 microm) and Ra = 2.0 microm (Rz = 9 microm) were generated. The bond strengths observed in tensile tests for roughnesses of Ra = 1.7 mm were always well above 25 MPa for all periods of hydrolytic load. Therefore, the investigation shows that surfaces of moderate roughness (Ra = 1.7 microm), however coated, provide a steady retention. Cave-in and micromotions should widely be prevented. The abrasion, which is a consequence of and reason for debonding and loosening at the same time, should be avoidable if the bonding of cement on the metallic shaft is stabilised with the help of a suitable chemical bond system.

  17. The Role of Oxidative Stress in Aseptic Loosening of Total Hip Replacements

    PubMed Central

    Steinbeck, Marla J; Jablonowski, Lauren J; Parviz, Javad; Freeman, Theresa A

    2013-01-01

    This study investigated the hypothesis that wear particle-induced oxidative stress initiates osteolysis after total hip replacement (THR). Patient radiographs were scored for osteolysis and periprosthetic tissues were immunostained and imaged to quantify polyethylene wear, inflammation, and five osteoinflammatory and oxidative stress-responsive factors. These included high mobility group protein-B1 (HMGB1), cyclooxygenase-2 (COX2), inducible nitric oxide synthase (iNOS), 4-hydroxynonenal (4-HNE), and nitrotyrosine (NT). The results show wear debris correlated with inflammation, 4-HNE, NT and HMGB1, whereas inflammation only correlated with NT and HMGB1. Similar to wear debris and inflammation, osteolysis correlated with HMGB1. Additionally, osteolysis correlated with COX2 and 4-HNE, but not iNOS or NT. Understanding the involvement of oxidative stress in wear-induced osteolysis will help identify diagnostic biomarkers and therapeutic targets to prevent osteolysis after THR. PMID:24290740

  18. The role of oxidative stress in aseptic loosening of total hip arthroplasties.

    PubMed

    Steinbeck, Marla J; Jablonowski, Lauren J; Parvizi, Javad; Freeman, Theresa A

    2014-04-01

    This study investigated the hypothesis that wear particle-induced oxidative stress initiates osteolysis after total hip arthroplasty (THA). Patient radiographs were scored for osteolysis and periprosthetic tissues were immunostained and imaged to quantify polyethylene wear, inflammation, and five osteoinflammatory and oxidative stress-responsive factors. These included high mobility group protein-B1 (HMGB1), cyclooxygenase-2 (COX2), inducible nitric oxide synthase (iNOS), 4-hydroxynonenal (4-HNE), and nitrotyrosine (NT). The results show wear debris correlated with inflammation, 4-HNE, NT and HMGB1, whereas inflammation only correlated with NT and HMGB1. Similar to wear debris and inflammation, osteolysis correlated with HMGB1. Additionally, osteolysis correlated with COX2 and 4-HNE, but not iNOS or NT. Understanding the involvement of oxidative stress in wear-induced osteolysis will help identify diagnostic biomarkers and therapeutic targets to prevent osteolysis after THA. © 2014.

  19. Mesenchymal stem cells in the aseptic loosening of total joint replacements

    PubMed Central

    Pajarinen, Jukka; Lin, Tzu-hua; Nabeshima, Akira; Jämsen, Eemeli; Lu, Laura; Nathan, Karthik; Yao, Zhenyu; Goodman, Stuart B.

    2017-01-01

    Peri-prosthetic osteolysis remains as the main long-term complication of total joint replacement surgery. Research over four decades has established implant wear as the main culprit for chronic inflammation in the peri-implant tissues and macrophages as the key cells mediating the host reaction to implant-derived wear particles. Wear debris activated macrophages secrete inflammatory mediators that stimulate bone resorbing osteoclasts; thus bone loss in the peri-implant tissues is increased. However, the balance of bone turnover is not only dictated by osteoclast-mediated bone resorption but also by the formation of new bone by osteoblasts; under physiological conditions these two processes are tightly coupled. Increasing interest has been placed on the effects of wear debris on the cells of the bone-forming lineage. These cells are derived primarily from multipotent mesenchymal stem cells (MSCs) residing in bone marrow and the walls of the microvasculature. Accumulating evidence indicates that wear debris significantly impairs MSC-to-osteoblast differentiation and subsequent bone formation. In this review, we summarize the current understanding of the effects of biomaterial implant wear debris on MSCs. Emerging treatment options to improve initial implant integration and treat developing osteolytic lesions by utilizing or targeting MSCs are also discussed. PMID:27977880

  20. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment

    PubMed Central

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Summary Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn’t seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only. PMID:27134631

  1. Outbreak of aseptic meningitis in Djibouti in the aftermath of El Niño.

    PubMed

    Koeck, Jean Louis; Modica, Claude; Chomel, Jean Jacques; Nizou, Jacques Yves; Lina, Bruno; Nicand, Elisabeth

    2003-01-01

    At the end of 1990s, an outbreak of enteroviral meningitis in Djibouti was associated with the cocirculation of multiple serotypes. This uncommon distribution was related to the dissemination of enterically transmitted agents in the aftermath of El Nino events disturbing the Horn of Africa. Both Djiboutians and expatriate residents were infected.

  2. The presence of TNF-alpha and TNFR1 in aseptic root resorption. A preliminary study.

    PubMed

    Curl, Linda; Sampson, Wayne

    2011-11-01

    It is hypothesised that osteoprotegerin (OPG), as an osteoclast antagonist, may offer molecular control over the process of orthodontic root resorption. Previous work investigating OPG in a rat periodontal ligament (PDL) ankylosis model found no inhibitory effect on osteoclasts and odontoclasts when given at a recommended dosage of 2.5 mg/kg. It was considered that traumatically-induced PDL inflammation produces mediators and cytokines with the ability to stimulate clast cell differentiation and counter the effects of OPG. The present study investigated the presence of Tumour Necrosis Factor Alpha (TNF-alpha) and its receptor Tumour Necrosis Factor Receptor 1 (TNFR1) in a PDL sterile inflammatory model. Dry ice was applied for 15 minutes to the upper right first molar crown of eighteen, 8-week-old, male Sprague-Dawley rats of which 9 were injected with OPG at a dose of 2.5 mg/kg of body weight at the time of freezing. After 7 days, the rats were sacrificed and each maxilla processed for immunohistochemical identification of TNF-alpha and TNFR1. Results showed the presence of root resorption in varying amounts and locations in both experimental and control rats. Reparative processes appeared greater in the OPG-treated rats, often with the presence of an ankylotic union. Immunolabelling showed the presence of TNF-alpha and TNFR1 in the sterile inflammation located mainly in the interradicular PDL area. More definitive labelling appeared in OPG-treated rats. The results indicated that TNF-alpha, and its receptor TNFR1, by their presence, may modify OPG effectiveness by offering an alternative pathway for osteoclast formation, which counters the anti-resorptive effects of OPG.

  3. Feasibility of Applying Ohmic Heating and Split-Phase Aseptic Processing for Ration Entree Preservation

    DTIC Science & Technology

    1994-08-01

    process. The retort process, due to its long-time low -temperature nature, allows macaroni to continue absorbing moisture from the sauce during...and safe under ambient distribution and storage conditions. There is also a need for a high-quality, low cost, and shelf-stable military ration...given in Appendix A. Among the six products, all but Ratatouille (mixed vegetables) are low -acid foods (pH > 4.5) and therefore required sterilization

  4. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment.

    PubMed

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn't seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only.

  5. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease

    PubMed Central

    Hieken, Tina J.; Chen, Jun; Hoskin, Tanya L.; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C.; Knutson, Keith L.; Kalari, Krishna R.; Yao, Janet Z.; Baddour, Larry M.; Chia, Nicholas; Degnim, Amy C.

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  6. Aseptic tissue necrosis and chronic inflammation after irrigation of penetrating hand wounds using Octenisept®.

    PubMed

    Franz, T; Vögelin, E

    2012-01-01

    Penetrating hand wounds are common and these are managed by thorough debridement. However, stab wounds without evidence of divided structures are often treated with irrigation using antiseptic substances, antibiotic therapy, and immobilization. Octenisept® (Schülke & Mayr Ltd) is a widely used antiseptic agent for disinfection of acute or chronic wounds. It has a broad spectrum of antiseptic efficacy and has become an antiseptic of first choice in many hospitals. Within a few months, four patients presented to us with chronic inflammation and severe tissue necrosis after irrigation of penetrating hand wounds with Octenisept®. Repeated surgery and debridement was required in all patients. Wound healing was prolonged and patients had persisting oedema. Penetrating hand wounds must not be irrigated with Octenisept®.

  7. Indirect measurement of water content in an aseptic solid substrate cultivation pilot-scale bioreactor.

    PubMed

    Peña Y Lillo, M; Pérez-Correa, R; Agosin, E; Latrille, E

    2001-01-01

    A lack of models and sensors for describing and monitoring large-scale solid substrate cultivation (SSC) bioreactors has hampered industrial development and application of this type of process. This study presents an indirect dynamic measurement model for a 200-kg-capacity fixed-bed SSC bioreactor under periodic agitation. Growth of the filamentous fungus Gibberella fujikuroi on wheat bran was used as a case study. Real data were preprocessed using previously reported methodology. The model uses CO2 production rate and inlet air conditions to estimate average bed water content and average bed temperature. The model adequately reproduces the evolution of the average bed water content and can therefore be used as an on-line estimator in pilot-scale SSC bioreactors. To obtain a reasonable fit of the bed temperature, however, inlet air humidity measurements will have to be adjusted with a data reconciliation algorithm. Good estimation of temperature is important for the future design of improved water content estimation using state observers. The model also provides insight into understanding the complex behavior of the dynamic system, which could prove useful when establishing advanced model-based operational and control strategies.

  8. Aseptic HLA B27-positive spondylodiscitis: decreased 18F-FDG uptake after etanercept treatment.

    PubMed

    Benucci, M; Damiani, A; Arena, A; Infantino, M; Manfredi, M; Li Gobbi, F

    2016-12-16

    We observed a 69-year old man suffering from HLA B27 ankylosing spondylitis with persistent night back pain. 18F-FDG-PET/CT showed an increased metabolism at the level of the spinal space of L2-L3, L3-L4 with increased uptake compatible with spondylodiscitis. He started therapy with etanercept 50 mg/week. After six months of treatment repeated testing showed no uptake of the discs and vertebral bodies.

  9. Chronic granulomatous disease presenting as aseptic ascites in a 2-year-old child.

    PubMed

    Moreau, J F; Ozolek, John A; Lin, P Ling; Green, Todd D; Cassidy, Elaine A; Venkat, Veena L; Buchert, Andrew R

    2013-01-01

    Chronic granulomatous disease (CGD) is a rare inherited immunodeficiency syndrome that results from abnormal nicotinamide adenine dinucleotide phosphate (NADPH) oxidase function. This defect leads to recurrent catalase-positive bacterial and fungal infections as well as associated granuloma formation. We review the case of a 2-year-old boy who presented with ascites and fever of an unknown origin as manifestations of CGD. Cultures were negative for infection throughout his course, and CGD was suspected after identification of granulomas on peritoneal biopsy. Genetic testing revealed a novel mutation in the CYBB gene underlying his condition. This paper highlights the importance of considering CGD in the differential diagnosis of fever of unknown origin and ascites in children.

  10. Acute aseptic meningitis and diffuse myelitis as the presenting features of neurological Behcet disease.

    PubMed

    Mullins, G M; Elamin, M; Saidha, S; Ali, E; Jennings, L; Counihan, T J; Hennessy, M

    2009-12-01

    We report an explosive presentation of neurological Behcet disease, in an Irish male patient. We present the clinical and radiological findings in our patient and discuss a novel and effective therapeutic approach. We review other treatment modalities of patients with neurological involvement.

  11. Aseptics and aesthetics of chlorine bleach: can its use in laundering be safely abandoned?

    PubMed

    Belkin, N L

    1998-04-01

    The disinfecting and cleansing properties of chlorine bleach in high-temperature laundering formulations first was demonstrated in 1938, and subsequently was found to be equally effective in lower-temperature formulations that included modifications in the laundering cycle. Until another well-documented bleaching additive becomes commercially available, chlorine bleach should continue to be an integral part of the laundering formulations for all textiles used in health care facilities.

  12. Determination of the Residence Time of Food Particles During Aseptic Sterilization

    NASA Technical Reports Server (NTRS)

    Carl, J. R.; Arndt, G. D.; Nguyen, T. X.

    1994-01-01

    The paper describes a non-invasive method to measure the time an individual particle takes to move through a length of stainless steel pipe. The food product is in two phase flow (liquids and solids) and passes through a pipe with pressures of approximately 60 psig and temperatures of 270-285 F. The proposed problem solution is based on the detection of transitory amplitude and/or phase changes in a microwave transmission path caused by the passage of the particles of interest. The particles are enhanced in some way, as will be discussed later, such that they will provide transitory changes that are distinctive enough not to be mistaken for normal variations in the received signal (caused by the non-homogeneous nature of the medium). Two detectors (transmission paths across the pipe) will be required and place at a known separation. A minimum transit time calculation is made from which the maximum velocity can be determined. This provides the minimum residence time. Also average velocity and statistical variations can be computed so that the amount of 'over-cooking' can be determined.

  13. Loading and unloading of freeze-dryers: airborne contamination risks for aseptically manufactured sterile drug products.

    PubMed

    Ljungqvist, Bengt; Reinmüller, Berit

    2007-01-01

    In pharmaceutical manufacturing, freeze-drying processes can be adversely affected by temperature differences relative to the surrounding air. Loading and unloading of freeze-dryers are performed either without or with temperature differences between the cleanroom and the chamber of the freeze-dryer. This operation can cause a flow of room air through the opening, creating a contamination risk, especially when manual handling of material is performed in this area. To minimize this risk, a high-efficiency particulate air (HEPA) filter unit should be installed above the opening to provide clean air and protect the opening. Here the theoretical relationships are discussed and design criteria are presented.

  14. Microbiological Profiles of Deep Terrestrial Sedimentary Rocks Revealed by an Aseptic Drilling Procedure

    NASA Astrophysics Data System (ADS)

    Suzuki, Y.; Suko, T.; Fukuda, A.; Kouduka, M.; Nanba, K.; Sakata, S.; Ito, K.

    2009-12-01

    Unlike the near-surface environments, it is difficult to determine the community structure and biogeochemical functions of microorganisms in the deep subsurface mainly due to accessibility without contamination and disturbance. In an inland fore-arc basin in central Japan, we applied a new drilling procedure using deoxygenated and/or filter-sterilized drilling fluid(s). Although DNA-stained and cultivable cell numbers and the contents of phospholipid fatty acids (PLFA) all indicated the presence of metabolically active microbial populations in sedimentary rocks at a depth range from 200 to 350 m, it was not successful to extract DNA from the drilled core samples. During drilling, drilling fluid used for drilling and coring in the borehole was collected from the borehole bottom and subjected to DNA extraction. Quantitative fluorogenic PCR revealed that bacterial DNA were detected in drilling fluid samples when drilling was performed for siltstone and silty sandstone layers with the limited flow of drilling fluid. Bacterial 16S rRNA gene sequences retrieved from the drilling fluid samples below a depth of 324 m were mostly related to Pseudomonas putida or Flavobacterium succinicans, while those related to other Pseudomonas spp. were predominant at depths of 298 and 299m. PLFA profiles of core samples from a depth range between 250 and 351 m showed the abundance of 16:0, 16:1ω7 and 18:1ω9 fatty acids, which are known as major cellular lipid components of Pseudomonas and Flavobacterium spp. From these results, it was suggested that the members of the genera Pseudomonas and F. succinicans might represent dominant microbial populations that inhabit the deep terrestrial sedimentary rocks in Central Japan. This study was supported by grants from the Nuclear and Industrial Safety Agency (NISA) and Japan Nuclear Energy Safety Organization (JNES).

  15. Identification of a sex pheromone produced by sternal glands in females of the caddisfly Molanna angustata curtis.

    PubMed

    Löfstedt, Christer; Bergmann, Jan; Francke, Wittko; Jirle, Erling; Hansson, Bill S; Ivanov, Vladimir D

    2008-02-01

    In the caddisfly Molanna angustata, females produce a sex pheromone in glands with openings on the fifth sternite. Gas chromatographic analyses of pheromone gland extracts with electroantennographic detection revealed four major compounds that stimulated male antennae. These compounds were identified by means of gas chromatography-mass spectrometry and enantioselective gas chromatography as heptan-2-one, (S)-heptan-2-ol, nonan-2-one, and (S)-nonan-2-ol in the approximate ratio of 1:1:4:10, respectively. Field tests showed that the mixture of the two alcohols was attractive to males whereas addition of the corresponding ketones reduced trap catches. The sex pheromone of M. angustata, a species in the family Molannidae within the suborder Integripalpia, is similar to the pheromones or pheromone-like compounds previously reported from six other trichopteran families, including members of the basal suborder Annulipalpia. This suggests that minimal evolutionary change of the pheromone chemistry has taken place within the leptoceroid branch of integripalpian Trichoptera compared to the ancestral character state.

  16. Selective culturing and genus-specific PCR detection for identification of Aeromonas in tissue samples to assist the medico-legal diagnosis of death by drowning.

    PubMed

    Huys, Geert; Coopman, Vera; Van Varenbergh, Dirk; Cordonnier, Jan

    2012-09-10

    The detection of autochthonous aquatic bacteria in tissue samples from drowning cases is increasingly considered as an alternative approach to assist th