Sample records for assisted binding site

  1. Identification of the bile acid-binding site of the ileal lipid-binding protein by photoaffinity labeling, matrix-assisted laser desorption ionization-mass spectrometry, and NMR structure.

    PubMed

    Kramer, W; Sauber, K; Baringhaus, K H; Kurz, M; Stengelin, S; Lange, G; Corsiero, D; Girbig, F; König, W; Weyland, C

    2001-03-09

    The ileal lipid-binding protein (ILBP) is the only physiologically relevant bile acid-binding protein in the cytosol of ileocytes. To identify the bile acid-binding site(s) of ILBP, recombinant rabbit ILBP photolabeled with 3-azi- and 7-azi-derivatives of cholyltaurine was analyzed by a combination of enzymatic fragmentation, gel electrophoresis, and matrix-assisted laser desorption ionization (MALDI)-mass spectrometry. The attachment site of the 3-position of cholyltaurine was localized to the amino acid triplet His(100)-Thr(101)-Ser(102) using the photoreactive 3,3-azo-derivative of cholyltaurine. With the corresponding 7,7-azo-derivative, the attachment point of the 7-position could be localized to the C-terminal part (position 112-128) as well as to the N-terminal part suggesting more than one binding site for bile acids. By chemical modification and NMR structure of ILBP, arginine residue 122 was identified as the probable contact point for the negatively charged side chain of cholyltaurine. Consequently, bile acids bind to ILBP with the steroid nucleus deep inside the protein cavity and the negatively charged side chain near the entry portal. The combination of photoaffinity labeling, enzymatic fragmentation, MALDI-mass spectrometry, and NMR structure was successfully used to determine the topology of bile acid binding to ILBP.

  2. Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

    PubMed

    Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

    2010-08-01

    Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

  3. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  4. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  5. How Cations Can Assist DNase I in DNA Binding and Hydrolysis

    PubMed Central

    Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

    2010-01-01

    DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

  6. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  7. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  9. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  10. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  11. Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response

    PubMed Central

    Goldstein, Ido; Baek, Songjoon; Presman, Diego M.; Paakinaho, Ville; Swinstead, Erin E.; Hager, Gordon L.

    2017-01-01

    Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. PMID:28031249

  12. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  13. Hydrogen bonding-assisted interaction between amitriptyline hydrochloride and hemoglobin: spectroscopic and molecular dynamics studies.

    PubMed

    Maurya, Neha; Maurya, Jitendra Kumar; Kumari, Meena; Khan, Abbul Bashar; Dohare, Ravins; Patel, Rajan

    2017-05-01

    Herein, we have explored the interaction between amitriptyline hydrochloride (AMT) and hemoglobin (Hb), using steady-state and time-resolved fluorescence spectroscopy, UV-visible spectroscopy, and circular dichroism spectroscopy, in combination with molecular docking and molecular dynamic (MD) simulation methods. The steady-state fluorescence reveals the static quenching mechanism in the interaction system, which was further confirmed by UV-visible and time-resolved fluorescence spectroscopy. The binding constant, number of binding sites, and thermodynamic parameters viz. ΔG, ΔH, ΔS are also considered; result confirms that the binding of the AMT with Hb is a spontaneous process, involving hydrogen bonding and van der Waals interactions with a single binding site, as also confirmed by molecular docking study. Synchronous fluorescence, CD data, and MD simulation results contribute toward understanding the effect of AMT on Hb to interpret the conformational change in Hb upon binding in aqueous solution.

  14. Structural and biochemical studies on ATP binding and hydrolysis by the Escherichia coli RNA chaperone Hfq.

    PubMed

    Hämmerle, Hermann; Beich-Frandsen, Mads; Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)(15) and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq(65)) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions.

  15. Defects in the calcium-binding region drastically affect the cadherin-like domains of RET tyrosine kinase.

    PubMed

    Gao, Chunxia; Grøtli, Morten; Eriksson, Leif A

    2016-03-28

    Mutations in the rearranged during transfection (RET) tyrosine kinase gene leading to gain or loss of function have been associated with the development of several human cancers and Hirschsprung's disease (HSCR). However, to what extent these mutations affect individual bio-molecular functions remains unclear. In this article, the functionally significant mutations in the RET CLD1-4 calcium-binding site which lead to HSCR, and depletion of calcium ions in the RET CLD1-4 calcium binding site, were investigated by molecular dynamics simulations--to understand the mechanistic action of the mutations or loss of calcium ions in altering the protein kinase structure, dynamics, and stability. The mutations or loss of calcium ions change the local conformation and change the free energy landscape. Specifically, the mutations and loss of calcium ions decrease the radius of gyration of the whole structure, leading to improper protein folding and GFL-GFRα contact site reduction. Furthermore, based on the most populated conformation in the wildtype MD simulations, a pharmacophore was generated by fragment docking to identify key features of the possible inhibitors targeting the calcium binding site. Overall, the findings may provide useful structural insights into the molecular mechanism underlying RET calcium-binding site mutations and assist in development of novel drugs targeting the extracellular ligand contact site of wildtype RET.

  16. Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

    PubMed Central

    Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

    2011-01-01

    RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

  17. Transcription factor assisted loading and enhancer dynamics dictate the hepatic fasting response.

    PubMed

    Goldstein, Ido; Baek, Songjoon; Presman, Diego M; Paakinaho, Ville; Swinstead, Erin E; Hager, Gordon L

    2017-03-01

    Fasting elicits transcriptional programs in hepatocytes leading to glucose and ketone production. This transcriptional program is regulated by many transcription factors (TFs). To understand how this complex network regulates the metabolic response to fasting, we aimed at isolating the enhancers and TFs dictating it. Measuring chromatin accessibility revealed that fasting massively reorganizes liver chromatin, exposing numerous fasting-induced enhancers. By utilizing computational methods in combination with dissecting enhancer features and TF cistromes, we implicated four key TFs regulating the fasting response: glucocorticoid receptor (GR), cAMP responsive element binding protein 1 (CREB1), peroxisome proliferator activated receptor alpha (PPARA), and CCAAT/enhancer binding protein beta (CEBPB). These TFs regulate fuel production by two distinctly operating modules, each controlling a separate metabolic pathway. The gluconeogenic module operates through assisted loading, whereby GR doubles the number of sites occupied by CREB1 as well as enhances CREB1 binding intensity and increases accessibility of CREB1 binding sites. Importantly, this GR-assisted CREB1 binding was enhancer-selective and did not affect all CREB1-bound enhancers. Single-molecule tracking revealed that GR increases the number and DNA residence time of a portion of chromatin-bound CREB1 molecules. These events collectively result in rapid synergistic gene expression and higher hepatic glucose production. Conversely, the ketogenic module operates via a GR-induced TF cascade, whereby PPARA levels are increased following GR activation, facilitating gradual enhancer maturation next to PPARA target genes and delayed ketogenic gene expression. Our findings reveal a complex network of enhancers and TFs that dynamically cooperate to restore homeostasis upon fasting. Published by Cold Spring Harbor Laboratory Press.

  18. Donor assists acceptor binding and catalysis of human α1,6-fucosyltransferase.

    PubMed

    Kötzler, Miriam P; Blank, Simon; Bantleon, Frank I; Wienke, Martin; Spillner, Edzard; Meyer, Bernd

    2013-08-16

    α1,6-Core-fucosyltransferase (FUT8) is a vital enzyme in mammalian physiological and pathophysiological processes such as tumorigenesis and progress of, among others, non-small cell lung cancer and colon carcinoma. It was also shown that therapeutic antibodies have a dramatically higher efficacy if the α1,6-fucosyl residue is absent. However, specific and potent inhibitors for FUT8 and related enzymes are lacking. Hence, it is crucial to elucidate the structural basis of acceptor binding and the catalytic mechanism. We present here the first structural model of FUT8 in complex with its acceptor and donor molecules. An unusually large acceptor, i.e., a hexasaccharide from the core of N-glycans, is required as minimal structure. Acceptor substrate binding of FUT8 is being dissected experimentally by STD NMR and SPR and theoretically by molecular dynamics simulations. The acceptor binding site forms an unusually large and shallow binding site. Binding of the acceptor to the enzyme is much faster and stronger if the donor is present. This is due to strong hydrogen bonding between O6 of the proximal N-acetylglucosamine and an oxygen atom of the β-phosphate of GDP-fucose. Therefore, we propose an ordered Bi Bi mechanism for FUT8 where the donor molecule binds first. No specific amino acid is present that could act as base during catalysis. Our results indicate a donor-assisted mechanism, where an oxygen of the β-phosphate deprotonates the acceptor. Knowledge of the mechanism of FUT8 is now being used for rational design of targeted inhibitors to address metastasis and prognosis of carcinomas.

  19. Facilitated dissociation of transcription factors from single DNA binding sites

    PubMed Central

    Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

    2017-01-01

    The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

  20. Structural and Biochemical Studies on ATP Binding and Hydrolysis by the Escherichia coli RNA Chaperone Hfq

    PubMed Central

    Večerek, Branislav; Rajkowitsch, Lukas; Carugo, Oliviero; Djinović-Carugo, Kristina; Bläsi, Udo

    2012-01-01

    In Escherichia coli the RNA chaperone Hfq is involved in riboregulation by assisting base-pairing between small regulatory RNAs (sRNAs) and mRNA targets. Several structural and biochemical studies revealed RNA binding sites on either surface of the donut shaped Hfq-hexamer. Whereas sRNAs are believed to contact preferentially the YKH motifs present on the proximal site, poly(A)15 and ADP were shown to bind to tripartite binding motifs (ARE) circularly positioned on the distal site. Hfq has been reported to bind and to hydrolyze ATP. Here, we present the crystal structure of a C-terminally truncated variant of E. coli Hfq (Hfq65) in complex with ATP, showing that it binds to the distal R-sites. In addition, we revisited the reported ATPase activity of full length Hfq purified to homogeneity. At variance with previous reports, no ATPase activity was observed for Hfq. In addition, FRET assays neither indicated an impact of ATP on annealing of two model oligoribonucleotides nor did the presence of ATP induce strand displacement. Moreover, ATP did not lead to destabilization of binary and ternary Hfq-RNA complexes, unless a vast stoichiometric excess of ATP was used. Taken together, these studies strongly suggest that ATP is dispensable for and does not interfere with Hfq-mediated RNA transactions. PMID:23226421

  1. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  2. Glomerular anionic site distribution in nonproteinuric rats. A computer-assisted morphometric analysis.

    PubMed

    Pilia, P A; Swain, R P; Williams, A V; Loadholt, C B; Ainsworth, S K

    1985-12-01

    The cationic ultrastructural tracer polyethyleneimine (PEI: pI approximately equal to 11.0), binds electrophysically to uniformly spaced discrete electron-dense anionic sites present in the laminae rarae of the rat glomerular basement membrane (GBM), mesangial reflections of the GBM, Bowman's capsule, and tubular basement membranes when administered intravenously. Computer-assisted morphometric analysis of glomerular anionic sites reveals that the maximum concentration of stainable lamina rara externa (lre) sites (21/10,000 A GBM) occurs 60 minutes after PEI injection with a site-site interspacing of 460 A. Lamina rara interna (lri) sites similarly demonstrate a maximum concentration (20/10,000 A GBM) at 60 minutes with a periodicity of 497 A. The concentration and distribution of anionic sites within the lri was irregular in pattern and markedly decreased in number, while the lre possesses an electrical field that is highly regular at all time intervals analyzed (15, 30, 60, 120, 180, 240, and 300 minutes). Immersion and perfusion of renal tissue with PEI reveals additional heavy staining of the epithelial and endothelial cell sialoprotein coatings. PEI appears to bind to glomerular anionic sites reversibly: ie, between 60 and 180 minutes the concentration of stained sites decreases. At 300 minutes, the interspacing once again approaches the 60-minute concentration. This suggests a dynamic turnover or dissociation followed by a reassociation of glomerular negatively charged PEI binding sites. In contrast, morphometric analysis of anionic sites stained with lysozyme and protamine sulfate reveals interspacings of 642 A and 585 A, respectively; in addition, these tracers produce major glomerular ultrastructural alterations and induce transient proteinuria. PEI does not induce proteinuria in rats, nor does it produce glomerular morphologic alterations when ten times the tracer dosage is administered intravenously. These findings indicate that the choice of ultrastructural charge tracer, the method of administering the tracer, and the time selected for analysis of tissue after administration of tracer significantly influences results. Morphometric analysis of the distribution of glomerular anionic sites in nonproteinuric rats provides a method of evaluating quantitative alterations of the glomerular charge barrier in renal disease models.

  3. HI-6 assisted Catalytic Scavenging of VX by Acetylcholinesterase Choline Binding Site Mutants

    PubMed Central

    Hrvat, Nikolina Maček; Žunec, Suzana; Taylor, Palmer; Radić, Zoran; Kovarik, Zrinka

    2016-01-01

    The high toxicity of organophosphorus compounds originates from covalent inhibition of acetylcholinesterase (AChE), an essential enzyme in cholinergic neurotransmission. Poisonings that lead to life-threatening toxic manifestations require immediate treatment that combines administration of anticholinergic drugs and an aldoxime as a reactivator of AChE. An alternative approach to reduce the in vivo toxicity of OPs focuses on the use of bioscavengers against the parent organophosphate. Our previous research showed that AChE mutagenesis can enable aldoximes to substantially accelerate the reactivation of OP-enzyme conjugates, while dramatically slowing down rates of OP-conjugate dealkylation (aging). Herein, we demonstrate an efficient HI-6-assisted VX detoxification, both ex vivo in human blood and in vivo in mice by hAChE mutants modified at the choline binding site (Y337A and Y337A/F338A). The catalytic scavenging of VX in mice improved therapeutic outcomes preventing lethality and resulted in a delayed onset of toxicity symptoms. PMID:27083141

  4. Rpn1 provides adjacent receptor sites for substrate binding and deubiquitination by the proteasome

    PubMed Central

    Shi, Yuan; Chen, Xiang; Elsasser, Suzanne; Stocks, Bradley B.; Tian, Geng; Lee, Byung-Hoon; Shi, Yanhong; Zhang, Naixia; de Poot, Stefanie A. H.; Tuebing, Fabian; Sun, Shuangwu; Vannoy, Jacob; Tarasov, Sergey G.; Engen, John R.; Finley, Daniel; Walters, Kylie J.

    2016-01-01

    Structured Abstract INTRODUCTION The ubiquitin-proteasome system comprises hundreds of distinct pathways of degradation, which converge at the step of ubiquitin recognition by the proteasome. Five proteasomal ubiquitin receptors have been identified, two that are intrinsic to the proteasome (Rpn10 and Rpn13) and three reversibly associated proteasomal ubiquitin receptors (Rad23, Dsk2, and Ddi1). RATIONALE We found that the five known proteasomal ubiquitin receptors of yeast are collectively nonessential for ubiquitin recognition by the proteasome. We therefore screened for additional ubiquitin receptors in the proteasome and identified subunit Rpn1 as a candidate. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the structure of the binding site within Rpn1, which we term the T1 site. Mutational analysis of this site showed its functional importance within the context of intact proteasomes. T1 binds both ubiquitin and ubiquitin-like (UBL) proteins, in particular the substrate-delivering shuttle factor Rad23. A second site within the Rpn1 toroid, T2, recognizes the UBL domain of deubiquitinating enzyme Ubp6, as determined by hydrogen-deuterium exchange mass spectrometry analysis and validated by amino acid substitution and functional assays. The Rpn1 toroid thus serves a critical scaffolding role within the proteasome, helping to assemble multiple proteasome cofactors as well as substrates. RESULTS Our results indicate that proteasome subunit Rpn1 can recognize both ubiquitin and UBL domains of substrate shuttling factors that themselves bind ubiquitin and function as reversibly-associated proteasomal ubiquitin receptors. Recognition is mediated by the T1 site within the Rpn1 toroid, which supports proteasome function in vivo. We found that the capacity of T1 to recognize both ubiquitin and UBL proteins was shared with Rpn10 and Rpn13. The surprising multiplicity of ubiquitin-recognition domains within the proteasome may promote enhanced, multipoint binding of ubiquitin chains. The structures of the T1 site in its free state and complexed with monoubiquitin or K48-linked diubiquitin were solved, revealing that three neighboring outer helices from the T1 toroid engage two ubiquitins. This binding mode leads to a preference for certain ubiquitin chain types, especially K6- and K48-linked chains, in a distinct configuration that can position substrates close to the entry port of the proteasome. The fate of proteasome-docked ubiquitin conjugates is determined by a competition between deubiquitination and substrate degradation. We find that proximal to the T1 site within the Rpn1 toroid is a second UBL-binding site, T2, that does not assist in ubiquitin chain recognition, but rather in chain disassembly, by binding to the UBL domain of deubiquitinating enzyme Ubp6. Importantly, the UBL interactors at T1 and T2 are distinct, assigning substrate localization to T1 and substrate deubiquitination to T2. CONCLUSION A ligand-binding hotspot was identified in the Rpn1 toroid, consisting of two adjacent receptor sites, T1 and T2. The Rpn1 toroid represents a novel class of binding domains for ubiquitin and UBL proteins. This study thus defines a novel two-site recognition domain intrinsic to the proteasome that uses homologous ubiquitin/UBL-class ligands to assemble substrates, substrate shuttling factors, and a deubiquitinating enzyme in close proximity. A ligand-binding hotspot in the proteasome for assembling substrates and cofactors Schematic (top) and model structure (bottom, left) mapping the UBL-binding Rpn1 T1 (indigo) and T2 (orange) sites. (Bottom, right) Enlarged region of the proteasome to illustrate the Rpn1 T1 and T2 sites bound to a ubiquitin chain (yellow) and deubiquitinating enzyme Ubp6 (green), respectively. PDB 4CR2 and 2B9R were used for this figure. Hundreds of pathways for degradation converge at ubiquitin recognition by proteasome. Here we found that the five known proteasomal ubiquitin receptors are collectively nonessential for ubiquitin recognition, and identified a sixth receptor, Rpn1. A site (T1) in the Rpn1 toroid recognized ubiquitin and ubiquitin-like (UBL) domains of substrate shuttling factors. T1 structures with monoubiquitin or K48 diubiquitin show three neighboring outer helices engaging two ubiquitins. T1 contributes a distinct substrate-binding pathway with preference for K48-linked chains. Proximal to T1 within the Rpn1 toroid is a second UBL-binding site (T2) that assists in ubiquitin chain disassembly, by binding the UBL of deubiquitinating enzyme Ubp6. Thus a two-site recognition domain intrinsic to the proteasome uses homologous ubiquitin/UBL-class ligands to assemble substrates, shuttling factors, and a deubiquitinating enzyme. PMID:26912900

  5. Structures of Saccharomyces cerevisiae D-arabinose dehydrogenase Ara1 and its complex with NADPH: implications for cofactor-assisted substrate recognition.

    PubMed

    Hu, Xiao-Qian; Guo, Peng-Chao; Ma, Jin-Di; Li, Wei-Fang

    2013-11-01

    The primary role of yeast Ara1, previously mis-annotated as a D-arabinose dehydrogenase, is to catalyze the reduction of a variety of toxic α,β-dicarbonyl compounds using NADPH as a cofactor at physiological pH levels. Here, crystal structures of Ara1 in apo and NADPH-complexed forms are presented at 2.10 and 2.00 Å resolution, respectively. Ara1 exists as a homodimer, each subunit of which adopts an (α/β)8-barrel structure and has a highly conserved cofactor-binding pocket. Structural comparison revealed that induced fit upon NADPH binding yielded an intact active-site pocket that recognizes the substrate. Moreover, the crystal structures combined with computational simulation defined an open substrate-binding site to accommodate various substrates that possess a dicarbonyl group.

  6. Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho

    PubMed Central

    Shashni, Rajesh; Qayyum, M. Zuhaib; Vishalini, V.; Dey, Debashish; Sen, Ranjan

    2014-01-01

    The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. PMID:25081210

  7. A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data

    PubMed Central

    2014-01-01

    Abstract ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data. Reviewers This article was reviewed by Prof. Sandor Pongor, Dr. Yuriy Gusev, and Dr. Shyam Prabhakar (nominated by Prof. Limsoon Wong). PMID:24555784

  8. Insights into the glycyl radical enzyme active site of benzylsuccinate synthase: a computational study.

    PubMed

    Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark

    2013-08-21

    The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.

  9. Exploiting conformational dynamics in drug discovery: design of C-terminal inhibitors of Hsp90 with improved activities

    PubMed Central

    Moroni, Elisabetta; Zhao, Huiping; Blagg, Brian S.J.; Colombo, Giorgio

    2014-01-01

    The interaction that occurs between molecules is a dynamic process that impacts both structural and conformational properties of the ligand and the ligand binding site. Herein, we investigate the dynamic cross-talk between a protein and the ligand as a source for new opportunities in ligand design. Analysis of the formation/disappearance of protein pockets produced in response to a first-generation inhibitor assisted in the identification of functional groups that could be introduced onto scaffolds to facilitate optimal binding, which allowed for increased binding with previously uncharacterized regions. MD simulations were used to elucidate primary changes that occur in the Hsp90 C-terminal binding pocket in the presence of first-generation ligands. This data was then used to design ligands that adapt to these receptor conformations, which provides access to an energy landscape that is not visible in a static model. The newly synthesized compounds demonstrated anti-proliferative activity at ~150 nanomolar concentration. The method identified herein may be used to design chemical probes that provide additional information on structural variations of Hsp90 C-terminal binding site. PMID:24397468

  10. Interfering lipoproteins in magnetic field-assisted agglutination of superparamagnetic particles immunoassay.

    PubMed

    Cauet, Gilles; Daynès, Aurélien; Temurok, Nevzat

    2016-04-01

    The technology of magnetic field-assisted immuno-agglutination of superparamagnetic particles allows sensitive detection of biomarkers in whole blood. However, we observed non-specific agglutination (NSA), due to interfering plasma proteins, that negatively affects C-reactive protein immunoassay. The objective of the study was to identify the plasma proteins involved and to eliminate these interferences. Plasma was fractionated by size exclusion HPLC and each fraction was tested for non-specific agglutination. In addition, plasma proteins bound to magnetic particles were analyzed by SDS-gel electrophoresis and identified by mass spectrometry. We found that NSA was due to the binding of some lipoproteins to the particles. NSA was observed in the presence of purified LDL and VLDL but not HDL. NSA was mediated by the binding of ApoB100 to magnetic particles through its heparin binding sites. These interferences could be eliminated by addition of heparin or other polyanions like dextran sulfate to the assay buffer. NSA results from the binding of some plasma lipoproteins to magnetic particles. The use of a polyanion to eliminate these interferences allows the formulation of a stable reagent.

  11. Association with AflR in Endosomes Reveals New Functions for AflJ in Aflatoxin Biosynthesis

    PubMed Central

    Ehrlich, Kenneth C.; Mack, Brian M.; Wei, Qijian; Li, Ping; Roze, Ludmila V.; Dazzo, Frank; Cary, Jeffrey W.; Bhatnagar, Deepak; Linz, John E.

    2012-01-01

    Aflatoxins are the most potent naturally occurring carcinogens of fungal origin. Biosynthesis of aflatoxin involves the coordinated expression of more than 25 genes. The function of one gene in the aflatoxin gene cluster, aflJ, is not entirely understood but, because previous studies demonstrated a physical interaction between the Zn2Cys6 transcription factor AflR and AflJ, AflJ was proposed to act as a transcriptional co-activator. Image analysis revealed that, in the absence of aflJ in A. parasiticus, endosomes cluster within cells and near septa. AflJ fused to yellow fluorescent protein complemented the mutation in A. parasiticus ΔaflJ and localized mainly in endosomes. We found that AflJ co-localizes with AflR both in endosomes and in nuclei. Chromatin immunoprecipitation did not detect AflJ binding at known AflR DNA recognition sites suggesting that AflJ either does not bind to these sites or binds to them transiently. Based on these data, we hypothesize that AflJ assists in AflR transport to or from the nucleus, thus controlling the availability of AflR for transcriptional activation of aflatoxin biosynthesis cluster genes. AflJ may also assist in directing endosomes to the cytoplasmic membrane for aflatoxin export. PMID:23342682

  12. Ligand-Assisted Protein Structure (LAPS): An Experimental Paradigm for Characterizing Cannabinoid-Receptor Ligand-Binding Domains.

    PubMed

    Janero, David R; Korde, Anisha; Makriyannis, Alexandros

    2017-01-01

    Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such as X-ray crystallography. © 2017 Elsevier Inc. All rights reserved.

  13. Human renin 5'-flanking DNA to nucleotide-2750.

    PubMed

    Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

    1995-01-01

    Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

  14. Free-Energy-Based Protein Design: Re-Engineering Cellular Retinoic Acid Binding Protein II Assisted by the Moveable-Type Approach.

    PubMed

    Zhong, Haizhen A; Santos, Elizabeth M; Vasileiou, Chrysoula; Zheng, Zheng; Geiger, James H; Borhan, Babak; Merz, Kenneth M

    2018-03-14

    How to fine-tune the binding free energy of a small-molecule to a receptor site by altering the amino acid residue composition is a key question in protein engineering. Indeed, the ultimate solution to this problem, to chemical accuracy (±1 kcal/mol), will result in profound and wide-ranging applications in protein design. Numerous tools have been developed to address this question using knowledge-based models to more computationally intensive molecular dynamics simulations-based free energy calculations, but while some success has been achieved there remains room for improvement in terms of overall accuracy and in the speed of the methodology. Here we report a fast, knowledge-based movable-type (MT)-based approach to estimate the absolute and relative free energy of binding as influenced by mutations in a small-molecule binding site in a protein. We retrospectively validate our approach using mutagenesis data for retinoic acid binding to the Cellular Retinoic Acid Binding Protein II (CRABPII) system and then make prospective predictions that are borne out experimentally. The overall performance of our approach is supported by its success in identifying mutants that show high or even sub-nano-molar binding affinities of retinoic acid to the CRABPII system.

  15. Structural insights into the catalytic mechanism of a family 18 exo-chitinase

    PubMed Central

    van Aalten, D. M. F.; Komander, D.; Synstad, B.; Gåseidnes, S.; Peter, M. G.; Eijsink, V. G. H.

    2001-01-01

    Chitinase B (ChiB) from Serratia marcescens is a family 18 exo-chitinase whose catalytic domain has a TIM-barrel fold with a tunnel-shaped active site. We have solved structures of three ChiB complexes that reveal details of substrate binding, substrate-assisted catalysis, and product displacement. The structure of an inactive ChiB mutant (E144Q) complexed with a pentameric substrate (binding in subsites −2 to +3) shows closure of the “roof” of the active site tunnel. It also shows that the sugar in the −1 position is distorted to a boat conformation, thus providing structural evidence in support of a previously proposed catalytic mechanism. The structures of the active enzyme complexed to allosamidin (an analogue of a proposed reaction intermediate) and of the active enzyme soaked with pentameric substrate show events after cleavage of the glycosidic bond. The latter structure shows reopening of the roof of the active site tunnel and enzyme-assisted product displacement in the +1 and +2 sites, allowing a water molecule to approach the reaction center. Catalysis is accompanied by correlated structural changes in the core of the TIM barrel that involve conserved polar residues whose functions were hitherto unknown. These changes simultaneously contribute to stabilization of the reaction intermediate and alternation of the pKa of the catalytic acid during the catalytic cycle. PMID:11481469

  16. HI-6 assisted catalytic scavenging of VX by acetylcholinesterase choline binding site mutants.

    PubMed

    Maček Hrvat, Nikolina; Žunec, Suzana; Taylor, Palmer; Radić, Zoran; Kovarik, Zrinka

    2016-11-25

    The high toxicity of organophosphorus compounds originates from covalent inhibition of acetylcholinesterase (AChE), an essential enzyme in cholinergic neurotransmission. Poisonings that lead to life-threatening toxic manifestations require immediate treatment that combines administration of anticholinergic drugs and an aldoxime as a reactivator of AChE. An alternative approach to reduce the in vivo toxicity of OPs focuses on the use of bioscavengers against the parent organophosphate. Our previous research showed that AChE mutagenesis can enable aldoximes to substantially accelerate the reactivation of OP-enzyme conjugates, while dramatically slowing down rates of OP-conjugate dealkylation (aging). Herein, we demonstrate an efficient HI-6-assisted VX detoxification, both ex vivo in human blood and in vivo in mice by hAChE mutants modified at the choline binding site (Y337A and Y337A/F338A). The catalytic scavenging of VX in mice improved therapeutic outcomes preventing lethality and resulted in a delayed onset of toxicity symptoms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.

    PubMed

    Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan

    2014-09-01

    The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Identification of protein–protein interfaces by decreased amide proton solvent accessibility

    PubMed Central

    Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.

    1998-01-01

    Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953

  19. Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

    PubMed

    Wang, G; Liao, J; Tang, M; Yu, S

    2018-02-01

    1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

  20. The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I).

    PubMed

    Salinas, Gustavo; Gao, Wei; Wang, Yang; Bonilla, Mariana; Yu, Long; Novikov, Andrey; Virginio, Veridiana G; Ferreira, Henrique B; Vieites, Marisol; Gladyshev, Vadim N; Gambino, Dinorah; Dai, Shaodong

    2017-12-20

    New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with Au I -MPO, a novel gold inhibitor, together with inhibition assays were performed. Au I -MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer-monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxin (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys 519 and Cys 573 in the Au I -TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys 519 and Cys 573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491-1504.

  1. The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Salinas, Gustavo; Gao, Wei; Wang, Yang

    Aims: New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with AuI-MPO, a novel gold inhibitor, together with inhibition assays were performed. Results: AuI-MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer–monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxinmore » (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys519 and Cys573 in the AuI-TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. Innovation: The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. Conclusions: The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys519 and Cys573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491–1504.« less

  2. Studies of the Binding of Modest Modulators of the Human Enzyme, Sirtuin 6, by STD NMR.

    PubMed

    Bolívar, Beatriz E; Welch, John T

    2017-05-18

    Pyrazinamide (PZA), an essential constituent of short-course tuberculosis chemotherapy, binds weakly but selectively to Sirtuin 6 (SIRT6). Despite the structural similarities between nicotinamide (NAM), PZA, and pyrazinoic acid (POA), these inhibitors modulate SIRT6 by different mechanisms and through different binding sites, as suggested by saturation transfer difference (STD) NMR. Available experimental evidence, such as that derived from crystal structures and kinetic experiments, has been of only limited utility in elucidation of the mechanistic details of sirtuin inhibition by NAM or other inhibitors. For instance, crystallographic structural analysis of sirtuin binding sites does not help us understand important differences in binding affinities among sirtuins or capture details of such dynamic process. Hence, STD NMR was utilized throughout this study. Our results not only agreed with the binding kinetics experiments but also gave a qualitative insight into the binding process. The data presented herein suggested some details about the geometry of the binding epitopes of the ligands in solution with the apo- and holoenzyme. Recognition that SIRT6 is affected selectively by PZA, an established clinical agent, suggests that the rational development of more potent and selective NAM surrogates might be possible. These derivatives might be accessible by employing the malleability of this scaffold to assist in the identification by STD NMR of the motifs that interact with the apo- and holoenzymes in solution. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Perspective: Watching low-frequency vibrations of water in biomolecular recognition by THz spectroscopy.

    PubMed

    Xu, Yao; Havenith, Martina

    2015-11-07

    Terahertz (THz) spectroscopy has turned out to be a powerful tool which is able to shed new light on the role of water in biomolecular processes. The low frequency spectrum of the solvated biomolecule in combination with MD simulations provides deep insights into the collective hydrogen bond dynamics on the sub-ps time scale. The absorption spectrum between 1 THz and 10 THz of solvated biomolecules is sensitive to changes in the fast fluctuations of the water network. Systematic studies on mutants of antifreeze proteins indicate a direct correlation between biological activity and a retardation of the (sub)-ps hydration dynamics at the protein binding site, i.e., a "hydration funnel." Kinetic THz absorption studies probe the temporal changes of THz absorption during a biological process, and give access to the kinetics of the coupled protein-hydration dynamics. When combined with simulations, the observed results can be explained in terms of a two-tier model involving a local binding and a long range influence on the hydration bond dynamics of the water around the binding site that highlights the significance of the changes in the hydration dynamics at recognition site for biomolecular recognition. Water is shown to assist molecular recognition processes.

  4. Perspective: Watching low-frequency vibrations of water in biomolecular recognition by THz spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Yao; Havenith, Martina

    2015-11-01

    Terahertz (THz) spectroscopy has turned out to be a powerful tool which is able to shed new light on the role of water in biomolecular processes. The low frequency spectrum of the solvated biomolecule in combination with MD simulations provides deep insights into the collective hydrogen bond dynamics on the sub-ps time scale. The absorption spectrum between 1 THz and 10 THz of solvated biomolecules is sensitive to changes in the fast fluctuations of the water network. Systematic studies on mutants of antifreeze proteins indicate a direct correlation between biological activity and a retardation of the (sub)-ps hydration dynamics at the protein binding site, i.e., a "hydration funnel." Kinetic THz absorption studies probe the temporal changes of THz absorption during a biological process, and give access to the kinetics of the coupled protein-hydration dynamics. When combined with simulations, the observed results can be explained in terms of a two-tier model involving a local binding and a long range influence on the hydration bond dynamics of the water around the binding site that highlights the significance of the changes in the hydration dynamics at recognition site for biomolecular recognition. Water is shown to assist molecular recognition processes.

  5. Computer-assisted identification of novel small molecule inhibitors targeting GLUT1

    NASA Astrophysics Data System (ADS)

    Wan, Zhining; Li, Xin; Sun, Rong; Li, Yuanyuan; Wang, Xiaoyun; Li, Xinru; Rong, Li; Shi, Zheng; Bao, Jinku

    2015-12-01

    Glucose transporters (GLUTs) are the main carriers of glucose that facilitate the diffusion of glucose in mammalian cells, especially GLUT1. Notably, GLUT1 is a rate-limiting transporter for glucose uptake, and its overexpression is a common characteristic in most cancers. Thus, the inhibition of GLUT1 by novel small compounds to lower glucose levels for cancer cells has become an emerging strategy. Herein, we employed high-throughput screening approaches to identify potential inhibitors against the sugar-binding site of GLUT1. Firstly, molecular docking screening was launched against the specs products, and three molecules (ZINC19909927, ZINC19908826, and ZINC19815451) were selected as candidate GLUT1 inhibitors for further analysis. Then, taking the initial ligand β-NG as a reference, molecular dynamic (MD) simulations and molecular mechanics/generalized born surface area (MM/GBSA) method were applied to evaluate the binding stability and affinity of the three candidates towards GLUT1. Finally, we found that ZINC19909927 might have the highest affinity to occupy the binding site of GLUT1. Meanwhile, energy decomposition analysis identified several residues located in substrate-binding site that might provide clues for future inhibitor discovery towards GLUT1. Taken together, these results in our study may provide valuable information for identifying new inhibitors targeting GLUT1-mediated glucose transport and metabolism for cancer therapeutics.

  6. Molecular modeling and structural analysis of nAChR variants uncovers the mechanism of resistance to snake toxins.

    PubMed

    Gunasekaran, D; Sridhar, J; Suryanarayanan, V; Manimaran, N C; Singh, Sanjeev Kumar

    2017-06-01

    Nicotinic acetylcholine receptors (nAChRs) are neuromuscular proteins responsible for muscle contraction upon binding with chemical stimulant acetylcholine (ACh). The α-neurotoxins of snake mimic the structure of ACh and attacks nAChRs, which block the flow of ACh and leads to numbness and paralysis. The toxin-binding site of alpha subunit in the nAChRs is highly conserved throughout chordate lineages with few exceptions in resistance organisms. In this study, we have analyzed the sequence and structures of toxin-binding/resistant nAChRs and their interaction stability with toxins through molecular docking and molecular dynamics simulation (MDS). We have reported the potential glycosylation residues within the toxin-binding cleft adding sugar moieties through N-linked glycosylation in resistant organisms. Residue variations at key positions alter the secondary structure of binding cleft, which might interfere with toxin binding and it could be one of the possible explanations for the resistance to snake venoms. Analysis of nAChR-α-neurotoxin complexes has confirmed the key interacting residues. In addition, drastic variation in the binding stability of Mongoose nAChR-α-Bungarotoxin (α-BTX) and human nAChR-α-BTX complexes were found at specific phase of MDS. Our findings suggest that specific mutations in the binding site of toxin are potentially preventing the formation of stable complex of receptor-toxin, which might lead to mechanism of resistance. This in silico study on the binding cleft of nAChR and the findings of interacting residues will assist in designing potential inhibitors as therapeutic targets.

  7. A G-Quadruplex-Containing RNA Activates Fluorescence in a GFP-Like Fluorophore

    PubMed Central

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A.

    2014-01-01

    Spinach is an in vitro selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence.Spinach is thus an RNA analog of GFP, and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2 and 2.4 Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially pre-formed binding site for the fluorophore.The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers. PMID:24952597

  8. Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites.

    PubMed

    Vukovic, Sinisa; Brennan, Paul E; Huggins, David J

    2016-09-01

    The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

  9. Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites

    NASA Astrophysics Data System (ADS)

    Vukovic, Sinisa; Brennan, Paul E.; Huggins, David J.

    2016-09-01

    The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

  10. Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.

    PubMed Central

    Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G

    1992-01-01

    opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590

  11. A molecular dynamics study of chloride binding by the cryptand SC24

    NASA Technical Reports Server (NTRS)

    Owenson, B.; MacElroy, R. D.; Pohorille, A.

    1988-01-01

    The capture of chloride from water by the tetraprotonated form of the spherical macrotricyclic molecule SC24 was studied using molecular dynamics simulation methods. This model ionophore represents a broad class of molecules which remove ions from water. Two binding sites for the chloride were found, one inside and one outside the ligand. These sites are separated by a potential energy barrier of approximately 20 kcal mol-1. The major contribution to this barrier comes from dehydration of the chloride. The large, unfavorable dehydration effect is compensated for by an increase in electrostatic attraction between the oppositely charged chloride and cryptand, and by energetically favorable rearrangements of water structure. Additional assistance in crossing the barrier and completing the dehydration of the ion is provided by the shift of three positively charged hydrogen atoms of the cryptand towards the chloride. This structural rigidity is partially responsible for its selectivity.

  12. Multitargeting by curcumin as revealed by molecular interaction studies

    PubMed Central

    Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

    2012-01-01

    Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

  13. Control of Recombination Directionality by the Listeria Phage A118 Protein Gp44 and the Coiled-Coil Motif of Its Serine Integrase.

    PubMed

    Mandali, Sridhar; Gupta, Kushol; Dawson, Anthony R; Van Duyne, Gregory D; Johnson, Reid C

    2017-06-01

    The serine integrase of phage A118 catalyzes integrative recombination between attP on the phage and a specific attB locus on the chromosome of Listeria monocytogenes , but it is unable to promote excisive recombination between the hybrid attL and attR sites found on the integrated prophage without assistance by a recombination directionality factor (RDF). We have identified and characterized the phage-encoded RDF Gp44, which activates the A118 integrase for excision and inhibits integration. Gp44 binds to the C-terminal DNA binding domain of integrase, and we have localized the primary binding site to be within the mobile coiled-coil (CC) motif but distinct from the distal tip of the CC that is required for recombination. This interaction is sufficient to inhibit integration, but a second interaction involving the N-terminal end of Gp44 is also required to activate excision. We provide evidence that these two contacts modulate the trajectory of the CC motifs as they extend out from the integrase core in a manner dependent upon the identities of the four att sites. Our results support a model whereby Gp44 shapes the Int-bound complexes to control which att sites can synapse and recombine. IMPORTANCE Serine integrases mediate directional recombination between bacteriophage and bacterial chromosomes. These highly regulated site-specific recombination reactions are integral to the life cycle of temperate phage and, in the case of Listeria monocytogenes lysogenized by A118 family phage, are an essential virulence determinant. Serine integrases are also utilized as tools for genetic engineering and synthetic biology because of their exquisite unidirectional control of the DNA exchange reaction. Here, we identify and characterize the recombination directionality factor (RDF) that activates excision and inhibits integration reactions by the phage A118 integrase. We provide evidence that the A118 RDF binds to and modulates the trajectory of the long coiled-coil motif that extends from the large carboxyl-terminal DNA binding domain and is postulated to control the early steps of recombination site synapsis. Copyright © 2017 American Society for Microbiology.

  14. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  15. Structural Basis for Antagonism by Suramin of Heparin Binding to Vaccinia Complement Protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganesh, Vannakambadi K.; Muthuvel, Suresh Kumar; Smith, Scott A.

    2010-07-19

    Suramin is a competitive inhibitor of heparin binding to many proteins, including viral envelope proteins, protein tyrosine phosphatases, and fibroblast growth factors (FGFs). It has been clinically evaluated as a potential therapeutic in treatment of cancers caused by unregulated angiogenesis, triggered by FGFs. Although it has shown clinical promise in treatment of several cancers, suramin has many undesirable side effects. There is currently no experimental structure that reveals the molecular interactions responsible for suramin inhibition of heparin binding, which could be of potential use in structure-assisted design of improved analogues of suramin. We report the structure of suramin, in complexmore » with the heparin-binding site of vaccinia virus complement control protein (VCP), which interacts with heparin in a geometrically similar manner to many FGFs. The larger than anticipated flexibility of suramin manifested in this structure, and other details of VCP-suramin interactions, might provide useful structural information for interpreting interactions of suramin with many proteins.« less

  16. Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

    PubMed Central

    Robinson, Clifford R.; Sligar, Stephen G.

    1998-01-01

    Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

  17. Structural insight into the role of Gln293Met mutation on the Peloruside A/Laulimalide association with αβ-tubulin from molecular dynamics simulations, binding free energy calculations and weak interactions analysis.

    PubMed

    Zúñiga, Matías A; Alderete, Joel B; Jaña, Gonzalo A; Jiménez, Verónica A

    2017-07-01

    Peloruside A (PLA) and Laulimalide (LAU) are novel microtubule-stabilizing agents with promising properties against different cancer types. These ligands share a non-taxoid binding site at the outer surface of β-tubulin and promote microtubule stabilization by bridging two adjacent αβ-tubulin dimers from parallel protofilaments. Recent site-directed mutagenesis experiments confirmed the existence of a unique β-tubulin site mutation (Gln293Met) that specifically increased the activity of PLA and caused resistance to LAU, without affecting the stability of microtubules in the absence of the ligands. In this work, fully atomistic molecular dynamics simulations were carried out to examine the PLA and LAU association with native and mutated αβ-tubulin in the search for structural and energetic evidence to explain the role of Gln293Met mutation on determining the activity of these ligands. Our results revealed that Gln293Met mutation induced the loss of relevant LAU-tubulin contacts but exerted negligible changes in the interaction networks responsible for PLA-tubulin association. Binding free energy calculations (MM/GBSA and MM/PBSA), and weak interaction analysis (aNCI) predicted an increased affinity for PLA, and a weakened association for LAU after mutation, thus suggesting that Gln293Met mutation exerts its action by a modulation of drug-tubulin interactions. These results are valuable to increase understanding about PLA and LAU activity and to assist the future design of novel agents targeting the PLA/LAU binding pocket.

  18. Structural insight into the role of Gln293Met mutation on the Peloruside A/Laulimalide association with αβ-tubulin from molecular dynamics simulations, binding free energy calculations and weak interactions analysis

    NASA Astrophysics Data System (ADS)

    Zúñiga, Matías A.; Alderete, Joel B.; Jaña, Gonzalo A.; Jiménez, Verónica A.

    2017-07-01

    Peloruside A (PLA) and Laulimalide (LAU) are novel microtubule-stabilizing agents with promising properties against different cancer types. These ligands share a non-taxoid binding site at the outer surface of β-tubulin and promote microtubule stabilization by bridging two adjacent αβ-tubulin dimers from parallel protofilaments. Recent site-directed mutagenesis experiments confirmed the existence of a unique β-tubulin site mutation (Gln293Met) that specifically increased the activity of PLA and caused resistance to LAU, without affecting the stability of microtubules in the absence of the ligands. In this work, fully atomistic molecular dynamics simulations were carried out to examine the PLA and LAU association with native and mutated αβ-tubulin in the search for structural and energetic evidence to explain the role of Gln293Met mutation on determining the activity of these ligands. Our results revealed that Gln293Met mutation induced the loss of relevant LAU-tubulin contacts but exerted negligible changes in the interaction networks responsible for PLA-tubulin association. Binding free energy calculations (MM/GBSA and MM/PBSA), and weak interaction analysis (aNCI) predicted an increased affinity for PLA, and a weakened association for LAU after mutation, thus suggesting that Gln293Met mutation exerts its action by a modulation of drug-tubulin interactions. These results are valuable to increase understanding about PLA and LAU activity and to assist the future design of novel agents targeting the PLA/LAU binding pocket.

  19. Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.

    Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

  20. Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

    DOE PAGES

    Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.; ...

    2017-11-30

    Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

  1. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore bindsmore » in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.« less

  2. Structural basis for Notch1 engagement of Delta-like 4

    DOE PAGES

    Luca, Vincent C.; Jude, Kevin M.; Pierce, Nathan W.; ...

    2015-02-20

    Notch receptors guide mammalian cell fate decisions by engaging the proteins Jagged and Delta-like (DLL). The 2.3 angstrom resolution crystal structure of the interacting regions of the Notch1-DLL4 complex reveals a two-site, antiparallel binding orientation assisted by Notch1 O-linked glycosylation. Notch1 epidermal growth factor–like repeats 11 and 12 interact with the DLL4 Delta/Serrate/Lag-2 (DSL) domain and module at the N-terminus of Notch ligands (MNNL) domains, respectively. Threonine and serine residues on Notch1 are functionalized with O-fucose and O-glucose, which act as surrogate amino acids by making specific, and essential, contacts to residues on DLL4. Lastly, the elucidation of a directmore » chemical role for O-glycans in Notch1 ligand engagement demonstrates how, by relying on posttranslational modifications of their ligand binding sites, Notch proteins have linked their functional capacity to developmentally regulated biosynthetic pathways.« less

  3. Structural basis for Notch1 engagement of Delta-like 4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luca, Vincent C.; Jude, Kevin M.; Pierce, Nathan W.

    Notch receptors guide mammalian cell fate decisions by engaging the proteins Jagged and Delta-like (DLL). The 2.3 angstrom resolution crystal structure of the interacting regions of the Notch1-DLL4 complex reveals a two-site, antiparallel binding orientation assisted by Notch1 O-linked glycosylation. Notch1 epidermal growth factor–like repeats 11 and 12 interact with the DLL4 Delta/Serrate/Lag-2 (DSL) domain and module at the N-terminus of Notch ligands (MNNL) domains, respectively. Threonine and serine residues on Notch1 are functionalized with O-fucose and O-glucose, which act as surrogate amino acids by making specific, and essential, contacts to residues on DLL4. Lastly, the elucidation of a directmore » chemical role for O-glycans in Notch1 ligand engagement demonstrates how, by relying on posttranslational modifications of their ligand binding sites, Notch proteins have linked their functional capacity to developmentally regulated biosynthetic pathways.« less

  4. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  5. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  6. Electrophilic assistance to the cleavage of an RNA model phopshodiester via specific and general base-catalyzed mechanisms.

    PubMed

    Corona-Martínez, David Octavio; Gomez-Tagle, Paola; Yatsimirsky, Anatoly K

    2012-10-19

    Kinetics of transesterification of the RNA model substrate 2-hydroxypropyl 4-nitrophenyl phosphate promoted by Mg(2+) and Ca(2+), the most common biological metals acting as cofactors for nuclease enzymes and ribozymes, as well as by Co(NH(3))(6)(3+), Co(en)(3)(3+), Li(+), and Na(+) cations, often employed as mechanistic probes, was studied in 80% v/v (50 mol %) aqueous DMSO, a medium that allows one to discriminate easily specific base (OH(-)-catalyzed) and general base (buffer-catalyzed) reaction paths. All cations assist the specific base reaction, but only Mg(2+) and Na(+) assist the general base reaction. For Mg(2+)-assisted reactions, the solvent deuterium isotope effects are 1.23 and 0.25 for general base and specific base mechanisms, respectively. Rate constants for Mg(2+)-assisted general base reactions measured with different bases fit the Brønsted correlation with a slope of 0.38, significantly lower than the slope for the unassisted general base reaction (0.77). Transition state binding constants for catalysts in the specific base reaction (K(‡)(OH)) both in aqueous DMSO and pure water correlate with their binding constants to 4-nitrophenyl phosphate dianion (K(NPP)) used as a minimalist transition state model. It was found that K(‡)(OH) ≈ K(NPP) for "protic" catalysts (Co(NH(3))(6)(3+), Co(en)(3)(3+), guanidinium), but K(‡)(OH) ≫ K(NPP) for Mg(2+) and Ca(2+) acting as Lewis acids. It appears from results of this study that Mg(2+) is unique in its ability to assist efficiently the general base-catalyzed transesterification often occurring in active sites of nuclease enzymes and ribozymes.

  7. Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity

    PubMed Central

    Song, Lingyun; Zhang, Zhancheng; Grasfeder, Linda L.; Boyle, Alan P.; Giresi, Paul G.; Lee, Bum-Kyu; Sheffield, Nathan C.; Gräf, Stefan; Huss, Mikael; Keefe, Damian; Liu, Zheng; London, Darin; McDaniell, Ryan M.; Shibata, Yoichiro; Showers, Kimberly A.; Simon, Jeremy M.; Vales, Teresa; Wang, Tianyuan; Winter, Deborah; Zhang, Zhuzhu; Clarke, Neil D.; Birney, Ewan; Iyer, Vishwanath R.; Crawford, Gregory E.; Lieb, Jason D.; Furey, Terrence S.

    2011-01-01

    The human body contains thousands of unique cell types, each with specialized functions. Cell identity is governed in large part by gene transcription programs, which are determined by regulatory elements encoded in DNA. To identify regulatory elements active in seven cell lines representative of diverse human cell types, we used DNase-seq and FAIRE-seq (Formaldehyde Assisted Isolation of Regulatory Elements) to map “open chromatin.” Over 870,000 DNaseI or FAIRE sites, which correspond tightly to nucleosome-depleted regions, were identified across the seven cell lines, covering nearly 9% of the genome. The combination of DNaseI and FAIRE is more effective than either assay alone in identifying likely regulatory elements, as judged by coincidence with transcription factor binding locations determined in the same cells. Open chromatin common to all seven cell types tended to be at or near transcription start sites and to be coincident with CTCF binding sites, while open chromatin sites found in only one cell type were typically located away from transcription start sites and contained DNA motifs recognized by regulators of cell-type identity. We show that open chromatin regions bound by CTCF are potent insulators. We identified clusters of open regulatory elements (COREs) that were physically near each other and whose appearance was coordinated among one or more cell types. Gene expression and RNA Pol II binding data support the hypothesis that COREs control gene activity required for the maintenance of cell-type identity. This publicly available atlas of regulatory elements may prove valuable in identifying noncoding DNA sequence variants that are causally linked to human disease. PMID:21750106

  8. Quantum Mechanics/Molecular Mechanics Modeling of Drug Metabolism: Mexiletine N-Hydroxylation by Cytochrome P450 1A2.

    PubMed

    Lonsdale, Richard; Fort, Rachel M; Rydberg, Patrik; Harvey, Jeremy N; Mulholland, Adrian J

    2016-06-20

    The mechanism of cytochrome P450(CYP)-catalyzed hydroxylation of primary amines is currently unclear and is relevant to drug metabolism; previous small model calculations have suggested two possible mechanisms: direct N-oxidation and H-abstraction/rebound. We have modeled the N-hydroxylation of (R)-mexiletine in CYP1A2 with hybrid quantum mechanics/molecular mechanics (QM/MM) methods, providing a more detailed and realistic model. Multiple reaction barriers have been calculated at the QM(B3LYP-D)/MM(CHARMM27) level for the direct N-oxidation and H-abstraction/rebound mechanisms. Our calculated barriers indicate that the direct N-oxidation mechanism is preferred and proceeds via the doublet spin state of Compound I. Molecular dynamics simulations indicate that the presence of an ordered water molecule in the active site assists in the binding of mexiletine in the active site, but this is not a prerequisite for reaction via either mechanism. Several active site residues play a role in the binding of mexiletine in the active site, including Thr124 and Phe226. This work reveals key details of the N-hydroxylation of mexiletine and further demonstrates that mechanistic studies using QM/MM methods are useful for understanding drug metabolism.

  9. New fluorescent reagents specific for Ca{sup 2+}-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ben-Hail, Danya; Lemelson, Daniela; Israelson, Adrian

    2012-09-14

    Highlights: Black-Right-Pointing-Pointer New reagents specifically inhibit the activity of Ca{sup 2+}-dependent proteins. Black-Right-Pointing-Pointer FITC-Ru and EITC-Ru allow for mechanism-independent probing of Ca{sup 2+}-binding proteins. Black-Right-Pointing-Pointer Changes in reagents fluorescence allow characterization of protein Ca{sup 2+}-binding properties. -- Abstract: Ca{sup 2+} carries information pivotal to cell life and death via its interactions with specific binding sites in a protein. We previously developed a novel photoreactive reagent, azido ruthenium (AzRu), which strongly inhibits Ca{sup 2+}-dependent activities. Here, we synthesized new fluorescent ruthenium-based reagents containing FITC or EITC, FITC-Ru and EITC-Ru. These reagents were purified, characterized and found to specifically interact with andmore » markedly inhibit Ca{sup 2+}-dependent activities but not the activity of Ca{sup 2+}-independent reactions. In contrast to many reagents that serve as probes for Ca{sup 2+}, FITC-Ru and EITC-Ru are the first fluorescent divalent cation analogs to be synthesized and characterized that specifically bind to Ca{sup 2+}-binding proteins and inhibit their activity. Such reagents will assist in characterizing Ca{sup 2+}-binding proteins, thereby facilitating better understanding of the function of Ca{sup 2+} as a key bio-regulator.« less

  10. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  11. Interplay of signal recognition particle and trigger factor at L23 near the nascent chain exit site on the Escherichia coli ribosome

    PubMed Central

    Ullers, Ronald S.; Houben, Edith N.G.; Raine, Amanda; ten Hagen-Jongman, Corinne M.; Ehrenberg, Måns; Brunner, Joseph; Oudega, Bauke; Harms, Nellie; Luirink, Joen

    2003-01-01

    As newly synthesized polypeptides emerge from the ribosome, they interact with chaperones and targeting factors that assist in folding and targeting to the proper location in the cell. In Escherichia coli, the chaperone trigger factor (TF) binds to nascent polypeptides early in biosynthesis facilitated by its affinity for the ribosomal proteins L23 and L29 that are situated around the nascent chain exit site on the ribosome. The targeting factor signal recognition particle (SRP) interacts specifically with the signal anchor (SA) sequence in nascent inner membrane proteins (IMPs). Here, we have used photocross-linking to map interactions of the SA sequence in a short, in vitro–synthesized, nascent IMP. Both TF and SRP were found to interact with the SA with partially overlapping binding specificity. In addition, extensive contacts with L23 and L29 were detected. Both purified TF and SRP could be cross-linked to L23 on nontranslating ribosomes with a competitive advantage for SRP. The results suggest a role for L23 in the targeting of IMPs as an attachment site for TF and SRP that is close to the emerging nascent chain. PMID:12756233

  12. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  13. Calcium-stimulated autophosphorylation site of plant chimeric calcium/calmodulin-dependent protein kinase

    NASA Technical Reports Server (NTRS)

    Sathyanarayanan, P. V.; Siems, W. F.; Jones, J. P.; Poovaiah, B. W.

    2001-01-01

    The existence of two molecular switches regulating plant chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK), namely the C-terminal visinin-like domain acting as Ca(2+)-sensitive molecular switch and calmodulin binding domain acting as Ca(2+)-stimulated autophosphorylation-sensitive molecular switch, has been described (Sathyanarayanan, P. V., Cremo, C. R., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 30417-30422). Here we report the identification of Ca(2+)-stimulated autophosphorylation site of CCaMK by matrix-assisted laser desorption ionization time of flight-mass spectrometry. Thr(267) was confirmed as the Ca(2+)-stimulated autophosphorylation site by post-source decay experiments and by site-directed mutagenesis. The purified T267A mutant form of CCaMK did not show Ca(2+)-stimulated autophosphorylation, autophosphorylation-dependent variable calmodulin affinity, or Ca(2+)/calmodulin stimulation of kinase activity. Sequence comparison of CCaMK from monocotyledonous plant (lily) and dicotyledonous plant (tobacco) suggests that the autophosphorylation site is conserved. This is the first identification of a phosphorylation site specifically responding to activation by second messenger system (Ca(2+) messenger system) in plants. Homology modeling of the kinase and calmodulin binding domain of CCaMK with the crystal structure of calcium/calmodulin-dependent protein kinase 1 suggests that the Ca(2+)-stimulated autophosphorylation site is located on the surface of the kinase and far from the catalytic site. Analysis of Ca(2+)-stimulated autophosphorylation with increasing concentration of CCaMK indicates the possibility that the Ca(2+)-stimulated phosphorylation occurs by an intermolecular mechanism.

  14. Characterization of a Gene Family Encoding SEA (Sea-urchin Sperm Protein, Enterokinase and Agrin)-Domain Proteins with Lectin-Like and Heme-Binding Properties from Schistosoma japonicum

    PubMed Central

    Mbanefo, Evaristus Chibunna; Kikuchi, Mihoko; Huy, Nguyen Tien; Shuaibu, Mohammed Nasir; Cherif, Mahamoud Sama; Yu, Chuanxin; Wakao, Masahiro; Suda, Yasuo; Hirayama, Kenji

    2014-01-01

    Background We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. Methodology/Principal Findings Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin)-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10−6 M) and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. Conclusions The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation), and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted. PMID:24416467

  15. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  16. De novo active sites for resurrected Precambrian enzymes

    NASA Astrophysics Data System (ADS)

    Risso, Valeria A.; Martinez-Rodriguez, Sergio; Candel, Adela M.; Krüger, Dennis M.; Pantoja-Uceda, David; Ortega-Muñoz, Mariano; Santoyo-Gonzalez, Francisco; Gaucher, Eric A.; Kamerlin, Shina C. L.; Bruix, Marta; Gavira, Jose A.; Sanchez-Ruiz, Jose M.

    2017-07-01

    Protein engineering studies often suggest the emergence of completely new enzyme functionalities to be highly improbable. However, enzymes likely catalysed many different reactions already in the last universal common ancestor. Mechanisms for the emergence of completely new active sites must therefore either plausibly exist or at least have existed at the primordial protein stage. Here, we use resurrected Precambrian proteins as scaffolds for protein engineering and demonstrate that a new active site can be generated through a single hydrophobic-to-ionizable amino acid replacement that generates a partially buried group with perturbed physico-chemical properties. We provide experimental and computational evidence that conformational flexibility can assist the emergence and subsequent evolution of new active sites by improving substrate and transition-state binding, through the sampling of many potentially productive conformations. Our results suggest a mechanism for the emergence of primordial enzymes and highlight the potential of ancestral reconstruction as a tool for protein engineering.

  17. Site-specific labeling of RNA at internal ribose hydroxyl groups: terbium-assisted deoxyribozymes at work.

    PubMed

    Büttner, Lea; Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

    2014-06-04

    A general and efficient single-step method was established for site-specific post-transcriptional labeling of RNA. Using Tb(3+) as accelerating cofactor for deoxyribozymes, various labeled guanosines were site-specifically attached to 2'-OH groups of internal adenosines in in vitro transcribed RNA. The DNA-catalyzed 2',5'-phosphodiester bond formation proceeded efficiently with fluorescent, spin-labeled, biotinylated, or cross-linker-modified guanosine triphosphates. The sequence context of the labeling site was systematically analyzed by mutating the nucleotides flanking the targeted adenosine. Labeling of adenosines in a purine-rich environment showed the fastest reactions and highest yields. Overall, practically useful yields >70% were obtained for 13 out of 16 possible nucleotide (nt) combinations. Using this approach, we demonstrate preparative labeling under mild conditions for up to ~160-nt-long RNAs, including spliceosomal U6 small nuclear RNA and a cyclic-di-AMP binding riboswitch RNA.

  18. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  19. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  20. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  1. Vesicular neurotransmitter transporters in Huntington's disease: initial observations and comparison with traditional synaptic markers.

    PubMed

    Suzuki, M; Desmond, T J; Albin, R L; Frey, K A

    2001-09-15

    Markers of identified neuronal populations have previously suggested selective degeneration of projection neurons in Huntington's disease (HD) striatum. Interpretations are, however, limited by effects of compensatory regulation and atrophy. Studies of the vesicular monoamine transporter type-2 (VMAT2) and of the vesicular acetylcholine transporter (VAChT) in experimental animals indicate that they are robust markers of presynaptic integrity and are not subject to regulation. We measured dopamine and acetylcholine vesicular transporters to characterize the selectivity of degeneration in HD striatum. Brains were obtained at autopsy from four HD patients and five controls. Autoradiography was used to quantify radioligand binding to VMAT2, VAChT, the dopamine plasmalemmal transporter (DAT), benzodiazepine (BZ) binding sites, and D2-type dopamine receptors. The activity of choline acetyltransferase (ChAT) was determined as an additional marker of cholinergic neurons. Autoradiograms were analyzed by video-assisted densitometry and assessment of atrophy was made from regional structural areas in the coronal projection. Striatal VMAT2, DAT, and VAChT concentrations were unchanged or increased, while D2 and BZ binding and ChAT activity were decreased in HD. After atrophy correction, all striatal binding sites were decreased. However, the decrease in ChAT activity was 3-fold greater than that of VAChT binding. In addition to degeneration of striatal projection neurons, there are losses of extrinsic nigrostriatal projections and of striatal cholinergic interneurons in HD on the basis of vesicular transporter measures. There is also markedly reduced expression of ChAT by surviving cholinergic striatal interneurons. Copyright 2001 Wiley-Liss, Inc.

  2. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade

    NASA Astrophysics Data System (ADS)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-01

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  3. Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade.

    PubMed

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-04-28

    The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

  4. [Derivative spectrophotometric and NMR spectroscopic study in pharmaceutical science].

    PubMed

    Kitamura, Keisuke

    2007-10-01

    This review starts with an introduction of derivative spectrophotometry followed by a description on the construction of a personal computer-assisted derivative spectrophotometric (DS) system. An acquisition system for inputting digitalized absorption spectra into personal computers and a BASIC program for calculating derivative spectra were developed. Then, applications of the system to drug analyses that are difficult with traditional absorption methods are described. Following this, studies on the interactions of drugs with biological macromolecules by the DS and NMR methods were discussed. An (1)H NMR study elucidated that the small unilamellar vesicle (SUV) has a single membrane made of a phosphatidylcholine bilayer, and that chlorpromazine interacts with both the outer and inner layers. (13)C NMR revealed a reduction of the dissociation constants of phenothiazine drugs due to their interaction with SUV. The partition coefficients of phenothiazine, benzodiazepine and steroid drugs in an SUV-water system and the effects of cholesterol or amino lipids content on these partition coefficients were examined by the DS method. The binding constants of phenothiazine drugs to bovine serum albumin (BSA) and the influence of Na(+), K(+), Cl(-), Br(-), and I(-) on these binding constants were determined by DS. It was found that I(-), Br(-), Cl(-) reduce the binding constants in this order, and that Na(+) and K(+) have no effect. A (19)F NMR study revealed that triflupromazine binds to BSA and human serum albumin in two regions including Site II with different populations, and that a nonsteroidal anti-inflammatory drug, niflumic acid, binds Sites Ia and Ib.

  5. Unique ATPase site architecture triggers cis-mediated synchronized ATP binding in heptameric AAA+-ATPase domain of flagellar regulatory protein FlrC.

    PubMed

    Dey, Sanjay; Biswas, Maitree; Sen, Udayaditya; Dasgupta, Jhimli

    2015-04-03

    Bacterial enhancer-binding proteins (bEBPs) oligomerize through AAA(+) domains and use ATP hydrolysis-driven energy to isomerize the RNA polymerase-σ(54) complex during transcriptional initiation. Here, we describe the first structure of the central AAA(+) domain of the flagellar regulatory protein FlrC (FlrC(C)), a bEBP that controls flagellar synthesis in Vibrio cholerae. Our results showed that FlrC(C) forms heptamer both in nucleotide (Nt)-free and -bound states without ATP-dependent subunit remodeling. Unlike the bEBPs such as NtrC1 or PspF, a novel cis-mediated "all or none" ATP binding occurs in the heptameric FlrC(C), because constriction at the ATPase site, caused by loop L3 and helix α7, restricts the proximity of the trans-protomer required for Nt binding. A unique "closed to open" movement of Walker A, assisted by trans-acting "Glu switch" Glu-286, facilitates ATP binding and hydrolysis. Fluorescence quenching and ATPase assays on FlrC(C) and mutants revealed that although Arg-349 of sensor II, positioned by trans-acting Glu-286 and Tyr-290, acts as a key residue to bind and hydrolyze ATP, Arg-319 of α7 anchors ribose and controls the rate of ATP hydrolysis by retarding the expulsion of ADP. Heptameric state of FlrC(C) is restored in solution even with the transition state mimicking ADP·AlF3. Structural results and pulldown assays indicated that L3 renders an in-built geometry to L1 and L2 causing σ(54)-FlrC(C) interaction independent of Nt binding. Collectively, our results underscore a novel mechanism of ATP binding and σ(54) interaction that strives to understand the transcriptional mechanism of the bEBPs, which probably interact directly with the RNA polymerase-σ(54) complex without DNA looping. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  7. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  8. Iron loading site on the Fe-S cluster assembly scaffold protein is distinct from the active site.

    PubMed

    Rodrigues, Andria V; Kandegedara, Ashoka; Rotondo, John A; Dancis, Andrew; Stemmler, Timothy L

    2015-06-01

    Iron-sulfur (Fe-S) cluster containing proteins are utilized in almost every biochemical pathway. The unique redox and coordination chemistry associated with the cofactor allows these proteins to participate in a diverse set of reactions, including electron transfer, enzyme catalysis, DNA synthesis and signaling within several pathways. Due to the high reactivity of the metal, it is not surprising that biological Fe-S cluster assembly is tightly regulated within cells. In yeast, the major assembly pathway for Fe-S clusters is the mitochondrial ISC pathway. Yeast Fe-S cluster assembly is accomplished using the scaffold protein (Isu1) as the molecular foundation, with assistance from the cysteine desulfurase (Nfs1) to provide sulfur, the accessory protein (Isd11) to regulate Nfs1 activity, the yeast frataxin homologue (Yfh1) to regulate Nfs1 activity and participate in Isu1 Fe loading possibly as a chaperone, and the ferredoxin (Yah1) to provide reducing equivalents for assembly. In this report, we utilize calorimetric and spectroscopic methods to provide molecular insight into how wt-Isu1 from S. cerevisiae becomes loaded with iron. Isothermal titration calorimetry and an iron competition binding assay were developed to characterize the energetics of protein Fe(II) binding. Differential scanning calorimetry was used to identify thermodynamic characteristics of the protein in the apo state or under iron loaded conditions. Finally, X-ray absorption spectroscopy was used to characterize the electronic and structural properties of Fe(II) bound to Isu1. Current data are compared to our previous characterization of the D37A Isu1 mutant, and these suggest that when Isu1 binds Fe(II) in a manner not perturbed by the D37A substitution, and that metal binding occurs at a site distinct from the cysteine rich active site in the protein.

  9. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  10. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  11. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  13. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  14. Response of SCP-2L domain of human MFE-2 to ligand removal: binding site closure and burial of peroxisomal targeting signal.

    PubMed

    Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H

    2002-10-11

    In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.

  15. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  16. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  17. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  18. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  19. Atomic and Molecular Adsorption on Cu(111)

    DOE PAGES

    Xu, Lang; Lin, Joshua; Bai, Yunhai; ...

    2018-05-15

    Here, due to the wide use of copper-based catalysts in industrial chemical processes, fundamental understanding of the interactions between copper surfaces and various reaction intermediates is highly desired. Here, we performed periodic, self-consistent density functional theory (DFT-GGA) calculations to study the adsorption of five atomic species (H, C, N, O, and S), seven molecular species (NH 3, CH 4, N 2, CO, HCN, NO, and HCOOH), and 13 molecular fragments (CH, CH 2, CH 3, NH, NH 2, OH, CN, COH, HCO, COOH, HCOO, NOH, and HNO) on the Cu(111) surface at a coverage of 0.25 monolayer. The preferred bindingmore » site, binding energy, and the corresponding surface deformation energy of each species were determined, as well as the estimated diffusion barrier and diffusion pathway. The binding strengths calculated using the PW91 functional decreased in the following order: CH > C > O > S > CN > NH > N > CH 2 > OH > HCOO > COH > H > NH 2 > NOH > COOH > HNO > HCO > CH 3 > NO > CO > NH 3 > HCOOH. No stable binding structures were observed for N 2, HCN, and CH 4. The adsorbate–surface and intramolecular vibrational modes of all the adsorbates at their preferred binding sites were deternined. Using the calculated adsorption energetics, potential energy surfaces were constructed for the direct decomposition of CO, CO 2, NO, N 2, NH 3, and CH 4 and the hydrogen-assisted decomposition of CO, CO 2, and NO.« less

  20. Atomic and Molecular Adsorption on Cu(111)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Lang; Lin, Joshua; Bai, Yunhai

    Here, due to the wide use of copper-based catalysts in industrial chemical processes, fundamental understanding of the interactions between copper surfaces and various reaction intermediates is highly desired. Here, we performed periodic, self-consistent density functional theory (DFT-GGA) calculations to study the adsorption of five atomic species (H, C, N, O, and S), seven molecular species (NH 3, CH 4, N 2, CO, HCN, NO, and HCOOH), and 13 molecular fragments (CH, CH 2, CH 3, NH, NH 2, OH, CN, COH, HCO, COOH, HCOO, NOH, and HNO) on the Cu(111) surface at a coverage of 0.25 monolayer. The preferred bindingmore » site, binding energy, and the corresponding surface deformation energy of each species were determined, as well as the estimated diffusion barrier and diffusion pathway. The binding strengths calculated using the PW91 functional decreased in the following order: CH > C > O > S > CN > NH > N > CH 2 > OH > HCOO > COH > H > NH 2 > NOH > COOH > HNO > HCO > CH 3 > NO > CO > NH 3 > HCOOH. No stable binding structures were observed for N 2, HCN, and CH 4. The adsorbate–surface and intramolecular vibrational modes of all the adsorbates at their preferred binding sites were deternined. Using the calculated adsorption energetics, potential energy surfaces were constructed for the direct decomposition of CO, CO 2, NO, N 2, NH 3, and CH 4 and the hydrogen-assisted decomposition of CO, CO 2, and NO.« less

  1. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  2. Application of computer-assisted molecular modeling for immunoassay of low molecular weight food contaminants: A review.

    PubMed

    Xu, Zhen-Lin; Shen, Yu-Dong; Beier, Ross C; Yang, Jin-Yi; Lei, Hong-Tao; Wang, Hong; Sun, Yuan-Ming

    2009-08-11

    Immunoassay for low molecular weight food contaminants, such as pesticides, veterinary drugs, and mycotoxins is now a well-established technique which meets the demand for a rapid, reliable, and cost-effective analytical method. However, due to limited understanding of the molecular structure of antibody binding sites and antigenic epitopes, as well as the intermolecular binding forces that come into play, the traditional 'trial and error' method used to develop antibodies still remains the method of choice. Therefore, development of enhanced immunochemical techniques for specific- and generic-assays, requires new approaches for antibody design that will improve affinity and specificity of the antibody in a more rapid and economic manner. Computer-assisted molecular modeling (CAMM) has been demonstrated to be a useful tool to help the immunochemist develop immunoassays. CAMM methods can be used to help direct improvements to important antibody features, and can provide insights into the effects of molecular structure on biological activity that are difficult or impossible to obtain in any other way. In this review, we briefly summarize applications of CAMM in immunoassay development, including assisting in hapten design, explaining cross-reactivity, modeling antibody-antigen interactions, and providing insights into the effects of the mouse body temperature on the three-dimensional conformation of a hapten during antibody production. The fundamentals and theory, programs and software, limitations, and prospects of CAMM in immunoassay development were also discussed.

  3. The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases*

    PubMed Central

    Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; Taylor, Alexander B.; Cabelli, Diane E.; Hart, P. John; Culotta, Valeria C.

    2016-01-01

    In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. Recently, we reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. Despite these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form of extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies. PMID:27535222

  4. The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases

    DOE PAGES

    Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; ...

    2016-08-17

    In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

  5. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  6. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  7. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Oxime amides as a novel zinc binding group in histone deacetylase inhibitors: synthesis, biological activity, and computational evaluation.

    PubMed

    Botta, Cinzia B; Cabri, Walter; Cini, Elena; De Cesare, Lucia; Fattorusso, Caterina; Giannini, Giuseppe; Persico, Marco; Petrella, Antonello; Rondinelli, Francesca; Rodriquez, Manuela; Russo, Adele; Taddei, Maurizio

    2011-04-14

    Several oxime containing molecules, characterized by a SAHA-like structure, were explored to select a potentially new biasing binding element for the zinc in HDAC catalytic site. All compounds were evaluated for their in vitro inhibitory activity against the 11 human HDACs isoforms. After identification of a "hit" molecule, a programmed variation at the cap group and at the linker was carried out in order to increase HDAC inhibition and/or paralogue selectivity. Some of the new derivatives showed increased activity against a number of HDAC isoforms, even if their overall activity range is still far from the inhibition values reported for SAHA. Moreover, different from what was reported for their hydroxamic acid analogues the new α-oxime amide derivatives do not select between class I and class II HDACs; rather they target specific isoforms in each class. These somehow contradictory results were finally rationalized by a computational assisted SAR, which gave us the chance to understand how the oxime derivatives interact with the catalytic site and justify the observed activity profile.

  9. Access and Binding of H2S to Hemeproteins: The Case of HbI of Lucina pectinata.

    PubMed

    Boubeta, Fernando M; Bari, Sara E; Estrin, Dario A; Boechi, Leonardo

    2016-09-15

    Hydrogen sulfide (H2S) was recently discovered as a gasotransmitter, capable of coordinating to the heme iron of hemeproteins. H2S is unique for its ability to render varying concentrations of the nucleophilic conjugate bases (HS(-) or S(2-)), either as free or bound species with expected outcomes on its further reactivity. There is no direct evidence about which species (H2S, HS(-), or S(2-)) coordinates to the iron. We performed computer simulations to address the migration and binding processes of H2S species to the hemoglobin I of Lucina pectinata, which exhibits the highest affinity for the substrate measured to date. We found that H2S is the most favorable species in the migration from the bulk to the active site, through an internal pathway of the protein. After the coordination of H2S, an array of clustered water molecules modifies the active site environment, and assists in the subsequent deprotonation of the ligand, forming Fe(III)-SH(-). The feasibility of the second deprotonation of the coordinated ligand is also discussed.

  10. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  11. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  12. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  13. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  14. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  15. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  16. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  17. Identification and Characterization of a Broadly Cross-Reactive HIV-1 Human Monoclonal Antibody That Binds to Both gp120 and gp41

    PubMed Central

    Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.

    2012-01-01

    Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187

  18. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  19. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  20. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  1. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  2. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  3. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  4. Dioxygen Binding in the Active Site of Histone Demethylase JMJD2A and the Role of the Protein Environment.

    PubMed

    Cortopassi, Wilian A; Simion, Robert; Honsby, Charles E; França, Tanos C C; Paton, Robert S

    2015-12-21

    JMJD2A catalyses the demethylation of di- and trimethylated lysine residues in histone tails and is a target for the development of new anticancer medicines. Mechanistic details of demethylation are yet to be elucidated and are important for the understanding of epigenetic processes. We have evaluated the initial step of histone demethylation by JMJD2A and demonstrate the dramatic effect of the protein environment upon oxygen binding using quantum mechanics/molecular mechanics (QM/MM) calculations. The changes in electronic structure have been studied for possible spin states and different conformations of O2 , using a combination of quantum and classical simulations. O2 binding to this histone demethylase is computed to occur preferentially as an end-on superoxo radical bound to a high-spin ferric centre, yielding an overall quintet ground state. The favourability of binding is strongly influenced by the surrounding protein: we have quantified this effect using an energy decomposition scheme into electrostatic and dispersion contributions. His182 and the methylated lysine assist while Glu184 and the oxoglutarate cofactor are deleterious for O2 binding. Charge separation in the superoxo-intermediate benefits from the electrostatic stabilization provided by the surrounding residues, stabilizing the binding process significantly. This work demonstrates the importance of the extended protein environment in oxygen binding, and the role of energy decomposition in understanding the physical origin of binding/recognition. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  6. Structural dynamics and quantum mechanical aspects of shikonin derivatives as CREBBP bromodomain inhibitors.

    PubMed

    Mitra, Sarmistha; Dash, Raju

    2018-05-04

    The Proteins involved in the chemical modification of lysine residues in histone, is currently being excessively focused as the therapeutic target for the treatment of cell related diseases like cancer. Among these proteins, the epigenetic reader, CREB-binding protein (CREBBP) bromodomain is one of the most prominent targets for effective anticancer drug design, which is responsible for the reorganization of acetylated histone lysine residues. Therefore, this study employed an integrative approach of structure based drug design, in combination with Molecular Dynamics (MD) and QM/MM study to identify as well as to describe the binding mechanism of two shikonin derivatives, acetylshikonin and propionylshikonin as inhibitors of CREBBP bromodomain. Here induced fit docking strategy was employed to explore the important intrinsic interactions of ligands with CREBBP bromodomain, consistently molecular dynamics simulation with two different methods and binding energy calculations by MM-GBSA and MM-PBSA were adopted to determine the stability of intermolecular interactions between protein and ligands. The results showed that both these derivatives made direct contacts with the important conserved residues of the active site, where propionylshikonin demonstrated stronger binding and stability than acetylshikonin, according to molecular dynamics simulation and binding free energy calculations. Further, QM/MM energy calculation was employed to study the chemical reactivity of the propionylshikonin and also to describe the mechanism of non bonded interactions between the propionylshikonin and CREBBP bromodomain. Though this study demands in vitro and in vivo experiments to evaluate the efficiency of the compound, these insights would assist to design more potent CREBBP bromodomain inhibitor, guiding the site of modification of propionylshikonin moiety for designing selective inhibitors. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Site-selective conjugation of an anticoagulant aptamer to recombinant albumins and maintenance of neonatal Fc receptor binding

    NASA Astrophysics Data System (ADS)

    Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia; Kuhlmann, Matthias; Cameron, Jason; Sørensen, Esben S.; Wengel, Jesper; Howard, Kenneth A.

    2017-05-01

    Aptamers are an attractive molecular medicine that offers high target specificity. Nucleic acid-based aptamers, however, are prone to nuclease degradation and rapid renal excretion that require blood circulatory half-life extension enabling technologies. The long circulatory half-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate linker, were successfully prepared and purified by high performance liquid chromatography as confirmed by gel electrophoresis band-shift analysis and matrix-assisted laser desorption/ionization time of flight. Minimal reduction (∼25%) in activity of WT-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer interferometry. Binding could be rescued by aptamer conjugation to recombinant albumin engineered for higher FcRn affinity (HB) that exhibited an 8-fold affinity compared to WT alone. This work describes a novel albumin-based aptamer delivery system whose hFcRn binding can be increased using a HB engineered albumin.

  8. Site-selective conjugation of an anticoagulant aptamer to recombinant albumins and maintenance of neonatal Fc receptor binding.

    PubMed

    Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia; Kuhlmann, Matthias; Cameron, Jason; Sørensen, Esben S; Wengel, Jesper; Howard, Kenneth A

    2017-05-19

    Aptamers are an attractive molecular medicine that offers high target specificity. Nucleic acid-based aptamers, however, are prone to nuclease degradation and rapid renal excretion that require blood circulatory half-life extension enabling technologies. The long circulatory half-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate linker, were successfully prepared and purified by high performance liquid chromatography as confirmed by gel electrophoresis band-shift analysis and matrix-assisted laser desorption/ionization time of flight. Minimal reduction (∼25%) in activity of WT-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer interferometry. Binding could be rescued by aptamer conjugation to recombinant albumin engineered for higher FcRn affinity (HB) that exhibited an 8-fold affinity compared to WT alone. This work describes a novel albumin-based aptamer delivery system whose hFcRn binding can be increased using a HB engineered albumin.

  9. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  10. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  11. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  12. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  13. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  14. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  15. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  16. Determination of pesticide epitopic density in protein immunoconjugates by electrospray mass spectrometry

    NASA Astrophysics Data System (ADS)

    Canosa, D.; Daniel, R.; Barceló, D.; Gelpí, E.; Le Goffic, F.; Abián, J.

    1997-01-01

    Several immunoconjugates of [beta]-lactoglobulin with different covalently bound pesticides (phenuron, chlortoluron, isoproturon, simazine, desethylatrazine, 2,4-dichlorophenoxyacetic acid) have been characterized by electrospray mass spectrometry (ESI-MS). The protein has 15 theoretical binding sites and the average number of pesticide molecules bound per protein ranged from two (phenuron) to 13 (2,4-dichlorophenoxyacetic acid). These results were compared with those obtained by a spectrophotometric method and by matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The pesticide density in the immunoconjugate is very dependent on the pesticide structure, indicating that steric hindrance could be one of the limiting factors of the coupling procedure. The favored binding positions have been determined in the case of chlortoluron and isoproturon by ESI-MS analysis of the peptides obtained after enzymatic digestion of the protein with trypsin.

  17. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  18. A competent catalytic active site is necessary for substrate induced dimer assembly in triosephosphate isomerase.

    PubMed

    Jimenez-Sandoval, Pedro; Vique-Sanchez, Jose Luis; Hidalgo, Marisol López; Velazquez-Juarez, Gilberto; Diaz-Quezada, Corina; Arroyo-Navarro, Luis Fernando; Moran, Gabriela Montero; Fattori, Juliana; Jessica Diaz-Salazar, A; Rudiño-Pinera, Enrique; Sotelo-Mundo, Rogerio; Figueira, Ana Carolina Migliorini; Lara-Gonzalez, Samuel; Benítez-Cardoza, Claudia G; Brieba, Luis G

    2017-11-01

    The protozoan parasite Trichomonas vaginalis contains two nearly identical triosephosphate isomerases (TvTIMs) that dissociate into stable monomers and dimerize upon substrate binding. Herein, we compare the role of the "ball and socket" and loop 3 interactions in substrate assisted dimer assembly in both TvTIMs. We found that point mutants at the "ball" are only 39 and 29-fold less catalytically active than their corresponding wild-type counterparts, whereas Δloop 3 deletions are 1502 and 9400-fold less active. Point and deletion mutants dissociate into stable monomers. However, point mutants assemble as catalytic competent dimers upon binding of the transition state substrate analog PGH, whereas loop 3 deletions remain monomeric. A comparison between crystal structures of point and loop 3 deletion monomeric mutants illustrates that the catalytic residues in point mutants and wild-type TvTIMs are maintained in the same orientation, whereas the catalytic residues in deletion mutants show an increase in thermal mobility and present structural disorder that may hamper their catalytic role. The high enzymatic activity present in monomeric point mutants correlates with the formation of dimeric TvTIMs upon substrate binding. In contrast, the low activity and lack of dimer assembly in deletion mutants suggests a role of loop 3 in promoting the formation of the active site as well as dimer assembly. Our results suggest that in TvTIMs the active site is assembled during dimerization and that the integrity of loop 3 and ball and socket residues is crucial to stabilize the dimer. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Diverse binding site structures revealed in homology models of polyreactive immunoglobulins

    NASA Astrophysics Data System (ADS)

    Ramsland, Paul A.; Guddat, Luke W.; Edmundson, Allen B.; Raison, Robert L.

    1997-09-01

    We describe here computer-assisted homology models of the combiningsite structure of three polyreactive immunoglobulins. Template-based modelsof Fv (VL-VH) fragments were derived forthe surface IgM expressed by the malignant CD5 positive B cells from threepatients with chronic lymphocytic leukaemia (CLL). The conserved frameworkregions were constructed using crystal coordinates taken from highlyhomologous human variable domain structures (Pot and Hil). Complementaritydetermining regions (CDRs) were predicted by grafting loops, taken fromknown immunoglobulin structures, onto the Fv framework models. The CDRtemplates were chosen, where possible, to be of the same length and of highresidue identity or similarity. LCDR1, 2 and 3 as well as HCDR1 and 2 forthe Fv were constructed using this strategy. For HCDR3 prediction, adatabase containing the Cartesian coordinates of 30 of these loops wascompiled from unliganded antibody X-ray crystallographic structures and anHCDR3 of the same length as that of the B CLL Fv was selected as a template.In one case (Yar), the resulting HCDR3 model gave unfavourable interactionswhen incorporated into the Fv model. This HCDR3 was therefore modelled usingan alternative strategy of construction of the loop stems, using apreviously described HCDR3 conformation (Pot), followed by chain closurewith a β-turn. The template models were subjected to positionalrefinement using energy minimisation and molecular dynamics simulations(X-PLOR). An electrostatic surface description (GRASP) did not reveal acommon structural feature within the binding sites of the three polyreactiveFv. Thus, polyreactive immunoglobulins may recognise similar and multipleantigens through a diverse array of binding site structures.

  20. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  1. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  2. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  3. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  4. 2D IR spectroscopy reveals the role of water in the binding of channel-blocking drugs to the influenza M2 channel.

    PubMed

    Ghosh, Ayanjeet; Wang, Jun; Moroz, Yurii S; Korendovych, Ivan V; Zanni, Martin; DeGrado, William F; Gai, Feng; Hochstrasser, Robin M

    2014-06-21

    Water is an integral part of the homotetrameric M2 proton channel of the influenza A virus, which not only assists proton conduction but could also play an important role in stabilizing channel-blocking drugs. Herein, we employ two dimensional infrared (2D IR) spectroscopy and site-specific IR probes, i.e., the amide I bands arising from isotopically labeled Ala30 and Gly34 residues, to probe how binding of either rimantadine or 7,7-spiran amine affects the water dynamics inside the M2 channel. Our results show, at neutral pH where the channel is non-conducting, that drug binding leads to a significant increase in the mobility of the channel water. A similar trend is also observed at pH 5.0 although the difference becomes smaller. Taken together, these results indicate that the channel water facilitates drug binding by increasing its entropy. Furthermore, the 2D IR spectral signatures obtained for both probes under different conditions collectively support a binding mechanism whereby amantadine-like drugs dock in the channel with their ammonium moiety pointing toward the histidine residues and interacting with a nearby water cluster, as predicted by molecular dynamics simulations. We believe these findings have important implications for designing new anti-influenza drugs.

  5. Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

    PubMed

    Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

    2003-03-01

    Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

  6. SdrF, a Staphylococcus epidermidis Surface Protein, Contributes to the Initiation of Ventricular Assist Device Driveline–Related Infections

    PubMed Central

    Arrecubieta, Carlos; Toba, Faustino A.; von Bayern, Manuel; Akashi, Hirokazu; Deng, Mario C.; Naka, Yoshifumi; Lowy, Franklin D.

    2009-01-01

    Staphylococcus epidermidis remains the predominant pathogen in prosthetic-device infections. Ventricular assist devices, a recently developed form of therapy for end-stage congestive heart failure, have had considerable success. However, infections, most often caused by Staphylococcus epidermidis, have limited their long-term use. The transcutaneous driveline entry site acts as a potential portal of entry for bacteria, allowing development of either localized or systemic infections. A novel in vitro binding assay using explanted drivelines obtained from patients undergoing transplantation and a heterologous lactococcal system of surface protein expression were used to identify S. epidermidis surface components involved in the pathogenesis of driveline infections. Of the four components tested, SdrF, SdrG, PIA, and GehD, SdrF was identified as the primary ligand. SdrF adherence was mediated via its B domain attaching to host collagen deposited on the surface of the driveline. Antibodies directed against SdrF reduced adherence of S. epidermidis to the drivelines. SdrF was also found to adhere with high affinity to Dacron, the hydrophobic polymeric outer surface of drivelines. Solid phase binding assays showed that SdrF was also able to adhere to other hydrophobic artificial materials such as polystyrene. A murine model of infection was developed and used to test the role of SdrF during in vivo driveline infection. SdrF alone was able to mediate bacterial adherence to implanted drivelines. Anti-SdrF antibodies reduced S. epidermidis colonization of implanted drivelines. SdrF appears to play a key role in the initiation of ventricular assist device driveline infections caused by S. epidermidis. This pluripotential adherence capacity provides a potential pathway to infection with SdrF-positive commensal staphylococci first adhering to the external Dacron-coated driveline at the transcutaneous entry site, then spreading along the collagen-coated internal portion of the driveline to establish a localized infection. This capacity may also have relevance for other prosthetic device–related infections. PMID:19412528

  7. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  8. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  9. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  10. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  11. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  13. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  14. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  15. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  16. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  17. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  19. Activation of the yeast Hippo pathway by phosphorylation-dependent assembly of signaling complexes.

    PubMed

    Rock, Jeremy M; Lim, Daniel; Stach, Lasse; Ogrodowicz, Roksana W; Keck, Jamie M; Jones, Michele H; Wong, Catherine C L; Yates, John R; Winey, Mark; Smerdon, Stephen J; Yaffe, Michael B; Amon, Angelika

    2013-05-17

    Scaffold-assisted signaling cascades guide cellular decision-making. In budding yeast, one such signal transduction pathway called the mitotic exit network (MEN) governs the transition from mitosis to the G1 phase of the cell cycle. The MEN is conserved and in metazoans is known as the Hippo tumor-suppressor pathway. We found that signaling through the MEN kinase cascade was mediated by an unusual two-step process. The MEN kinase Cdc15 first phosphorylated the scaffold Nud1. This created a phospho-docking site on Nud1, to which the effector kinase complex Dbf2-Mob1 bound through a phosphoserine-threonine binding domain, in order to be activated by Cdc15. This mechanism of pathway activation has implications for signal transmission through other kinase cascades and might represent a general principle in scaffold-assisted signaling.

  20. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  1. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  2. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  3. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  4. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  5. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  6. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  7. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  8. 13 CFR 121.703 - Are formal size determinations binding on parties?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... for the Small Business Innovation Research (sbir) Program § 121.703 Are formal size determinations... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Are formal size determinations binding on parties? 121.703 Section 121.703 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION...

  9. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  10. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  11. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  12. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  13. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  14. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  15. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  16. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  17. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  18. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  19. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  20. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  1. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  2. Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

    NASA Astrophysics Data System (ADS)

    Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

    2017-01-01

    Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

  3. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  4. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  5. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  6. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  7. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  8. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  9. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  10. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  11. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  12. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  13. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  14. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  15. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  16. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  17. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  18. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  19. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  20. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  1. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  2. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  3. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  4. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    PubMed Central

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  5. Understanding the Role of Metal Ions in RNA Folding and Function: Lessons from RNase P, a Ribonucleoprotein Enzyme

    NASA Astrophysics Data System (ADS)

    Harris, Michael E.; Christian, Eric L.

    There is a large and rapidly growing literature relating RNA function to metal ion identity and concentration; however, due to the complexity and large number of interactions it remains a significant experimental challenge to tie the interactions of individual ions to specific aspects of RNA function. Investigation of the ribonculeopro-tein enzyme RNase P function has assisted in defining characteristics of RNA—metal ion interactions and provided a useful model system for understanding RNA catalysis and ribonucleoprotein assembly. The goal of this chapter is to review progress in understanding the physical basis of functional metal ion interactions with P RNA and relate this progress to the development of our understanding of RNA metal ion interactions in general. The research results reviewed here encompass: (1) Determination of the contribution of divalent metal ion binding to specific aspects of enzyme function, (2) Identification of individual metal ion binding sites in P RNA and their contribution to function, and (3) The effect of protein binding on RNA—metal ion affinity.

  6. Calculating Water Thermodynamics in the Binding Site of Proteins - Applications of WaterMap to Drug Discovery.

    PubMed

    Cappel, Daniel; Sherman, Woody; Beuming, Thijs

    2017-01-01

    The ability to accurately characterize the solvation properties (water locations and thermodynamics) of biomolecules is of great importance to drug discovery. While crystallography, NMR, and other experimental techniques can assist in determining the structure of water networks in proteins and protein-ligand complexes, most water molecules are not fully resolved and accurately placed. Furthermore, understanding the energetic effects of solvation and desolvation on binding requires an analysis of the thermodynamic properties of solvent involved in the interaction between ligands and proteins. WaterMap is a molecular dynamics-based computational method that uses statistical mechanics to describe the thermodynamic properties (entropy, enthalpy, and free energy) of water molecules at the surface of proteins. This method can be used to assess the solvent contributions to ligand binding affinity and to guide lead optimization. In this review, we provide a comprehensive summary of published uses of WaterMap, including applications to lead optimization, virtual screening, selectivity analysis, ligand pose prediction, and druggability assessment. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Reverse spin-crossover and high-pressure kinetics of the heme iron center relevant for the operation of heme proteins under deep-sea conditions.

    PubMed

    Troeppner, Oliver; Lippert, Rainer; Shubina, Tatyana E; Zahl, Achim; Jux, Norbert; Ivanović-Burmazović, Ivana

    2014-10-20

    By design of a heme model complex with a binding pocket of appropriate size and flexibility, and by elucidating its kinetics and thermodynamics under elevated pressures, some of the pressure effects are demonstrated relevant for operation of heme-proteins under deep-sea conditions. Opposite from classical paradigms of the spin-crossover and reaction kinetics, a pressure increase can cause deceleration of the small-molecule binding to the vacant coordination site of the heme-center in a confined space and stabilize a high-spin state of its Fe center. This reverse high-pressure behavior can be achieved only if the volume changes related to the conformational transformation of the cavity can offset the volume changes caused by the substrate binding. It is speculated that based on these criteria nature could make a selection of structures of heme pockets that assist in reducing metabolic activity and enzymatic side reactions under extreme pressure conditions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  9. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  10. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  11. Coupling between Catalytic Loop Motions and Enzyme Global Dynamics

    PubMed Central

    Kurkcuoglu, Zeynep; Bakan, Ahmet; Kocaman, Duygu; Bahar, Ivet; Doruker, Pemra

    2012-01-01

    Catalytic loop motions facilitate substrate recognition and binding in many enzymes. While these motions appear to be highly flexible, their functional significance suggests that structure-encoded preferences may play a role in selecting particular mechanisms of motions. We performed an extensive study on a set of enzymes to assess whether the collective/global dynamics, as predicted by elastic network models (ENMs), facilitates or even defines the local motions undergone by functional loops. Our dataset includes a total of 117 crystal structures for ten enzymes of different sizes and oligomerization states. Each enzyme contains a specific functional/catalytic loop (10–21 residues long) that closes over the active site during catalysis. Principal component analysis (PCA) of the available crystal structures (including apo and ligand-bound forms) for each enzyme revealed the dominant conformational changes taking place in these loops upon substrate binding. These experimentally observed loop reconfigurations are shown to be predominantly driven by energetically favored modes of motion intrinsically accessible to the enzyme in the absence of its substrate. The analysis suggests that robust global modes cooperatively defined by the overall enzyme architecture also entail local components that assist in suitable opening/closure of the catalytic loop over the active site. PMID:23028297

  12. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  13. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  15. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  16. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  17. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  18. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  19. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  20. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  1. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  2. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  3. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  4. Structural basis for recognition of the T cell adaptor protein SLP-76 by the SH3 domain of phospholipase Cgamma1.

    PubMed

    Deng, Lu; Velikovsky, C Alejandro; Swaminathan, Chittoor P; Cho, Sangwoo; Mariuzza, Roy A

    2005-09-09

    The enzyme phospholipase Cgamma1 (PLCgamma1) is essential for T cell signaling and activation. Following T cell receptor ligation, PLCgamma1 interacts through its SH2 and SH3 domains with the adaptors LAT and SLP-76, respectively, to form a multiprotein signaling complex that leads to activation of PLCgamma1 by Syk tyrosine kinases. To identify the binding site for PLCgamma1 in SLP-76, we used isothermal titration calorimetry to measure affinities for the interaction of PLCgamma1-SH3 with a set of overlapping peptides spanning the central proline-rich region of SLP-76. PLCgamma1-SH3 bound with high specificity to the SLP-76 motif 186PPVPPQRP193, which represents the minimal binding site. To understand the basis for selective recognition, we determined the crystal structures of PLCgamma1-SH3 in free form, and bound to a 10-mer peptide containing this site, to resolutions of 1.60 A and 1.81 A, respectively. The structures reveal that several key contacting residues of the SH3 shift toward the SLP-76 peptide upon complex formation, optimizing the fit and strengthening hydrophobic interactions. Selectivity results mainly from strict shape complementarity between protein and peptide, rather than sequence-specific hydrogen bonding. In addition, Pro193 of SLP-76 assists in positioning Arg192 into the compass pocket of PLCgamma1-SH3, which coordinates the compass residue through an unusual aspartate. The PLCgamma1-SH3/SLP-76 structure provides insights into ligand binding by SH3 domains related to PLCgamma1-SH3, as well as into recognition by PLCgamma1 of signaling partners other than SLP-76.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna

    In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

  6. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  7. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  8. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  9. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  10. The DNA-bending protein HMGB1 is a cellular cofactor of Sleeping Beauty transposition.

    PubMed

    Zayed, Hatem; Izsvák, Zsuzsanna; Khare, Dheeraj; Heinemann, Udo; Ivics, Zoltán

    2003-05-01

    Sleeping Beauty (SB) is the most active Tc1/ mariner-type transposon in vertebrates. SB contains two transposase-binding sites (DRs) at the end of each terminal inverted repeat (IR), a feature termed the IR/DR structure. We investigated the involvement of cellular proteins in the regulation of SB transposition. Here, we establish that the DNA-bending, high-mobility group protein, HMGB1 is a host-encoded cofactor of SB transposition. Transposition was severely reduced in mouse cells deficient in HMGB1. This effect was rescued by transient over-expression of HMGB1, and was partially complemented by HMGB2, but not with the HMGA1 protein. Over-expression of HMGB1 in wild-type mouse cells enhanced transposition, indicating that HMGB1 can be a limiting factor of transposition. SB transposase was found to interact with HMGB1 in vivo, suggesting that the transposase may recruit HMGB1 to transposon DNA. HMGB1 stimulated preferential binding of the transposase to the DR further from the cleavage site, and promoted bending of DNA fragments containing the transposon IR. We propose that the role of HMGB1 is to ensure that transposase-transposon complexes are first formed at the internal DRs, and subsequently to promote juxtaposition of functional sites in transposon DNA, thereby assisting the formation of synaptic complexes.

  11. Role of tryptophan 95 in substrate specificity and structural stability of Sulfolobus solfataricus alcohol dehydrogenase.

    PubMed

    Pennacchio, Angela; Esposito, Luciana; Zagari, Adriana; Rossi, Mosè; Raia, Carlo A

    2009-09-01

    A mutant of the thermostable NAD(+)-dependent (S)-stereospecific alcohol dehydrogenase from Sulfolobus solfataricus (SsADH) which has a single substitution, Trp95Leu, located at the substrate binding pocket, was fully characterized to ascertain the role of Trp95 in discriminating between chiral secondary alcohols suggested by the wild-type SsADH crystallographic structure. The Trp95Leu mutant displays no apparent activity with short-chain primary and secondary alcohols and poor activity with aromatic substrates and coenzyme. Moreover, the Trp --> Leu substitution affects the structural stability of the archaeal ADH, decreasing its thermal stability without relevant changes in secondary structure. The double mutant Trp95Leu/Asn249Tyr was also purified to assist in crystallographic analysis. This mutant exhibits higher activity but decreased affinity toward aliphatic alcohols, aldehydes as well as NAD(+) and NADH compared to the wild-type enzyme. The crystal structure of the Trp95Leu/Asn249Tyr mutant apo form, determined at 2.0 A resolution, reveals a large local rearrangement of the substrate site with dramatic consequences. The Leu95 side-chain conformation points away from the catalytic metal center and the widening of the substrate site is partially counteracted by a concomitant change of Trp117 side chain conformation. Structural changes at the active site are consistent with the reduced activity on substrates and decreased coenzyme binding.

  12. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  13. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  14. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  15. VASP-E: Specificity Annotation with a Volumetric Analysis of Electrostatic Isopotentials

    PubMed Central

    Chen, Brian Y.

    2014-01-01

    Algorithms for comparing protein structure are frequently used for function annotation. By searching for subtle similarities among very different proteins, these algorithms can identify remote homologs with similar biological functions. In contrast, few comparison algorithms focus on specificity annotation, where the identification of subtle differences among very similar proteins can assist in finding small structural variations that create differences in binding specificity. Few specificity annotation methods consider electrostatic fields, which play a critical role in molecular recognition. To fill this gap, this paper describes VASP-E (Volumetric Analysis of Surface Properties with Electrostatics), a novel volumetric comparison tool based on the electrostatic comparison of protein-ligand and protein-protein binding sites. VASP-E exploits the central observation that three dimensional solids can be used to fully represent and compare both electrostatic isopotentials and molecular surfaces. With this integrated representation, VASP-E is able to dissect the electrostatic environments of protein-ligand and protein-protein binding interfaces, identifying individual amino acids that have an electrostatic influence on binding specificity. VASP-E was used to examine a nonredundant subset of the serine and cysteine proteases as well as the barnase-barstar and Rap1a-raf complexes. Based on amino acids established by various experimental studies to have an electrostatic influence on binding specificity, VASP-E identified electrostatically influential amino acids with 100% precision and 83.3% recall. We also show that VASP-E can accurately classify closely related ligand binding cavities into groups with different binding preferences. These results suggest that VASP-E should prove a useful tool for the characterization of specific binding and the engineering of binding preferences in proteins. PMID:25166865

  16. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  17. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  18. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  19. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  20. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  1. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  2. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  3. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  4. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. 2D IR spectroscopy reveals the role of water in the binding of channel-blocking drugs to the influenza M2 channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Ayanjeet, E-mail: ayanjeet@sas.upenn.edu, E-mail: gai@sas.upenn.edu; Gai, Feng, E-mail: ayanjeet@sas.upenn.edu, E-mail: gai@sas.upenn.edu; Hochstrasser, Robin M.

    Water is an integral part of the homotetrameric M2 proton channel of the influenza A virus, which not only assists proton conduction but could also play an important role in stabilizing channel-blocking drugs. Herein, we employ two dimensional infrared (2D IR) spectroscopy and site-specific IR probes, i.e., the amide I bands arising from isotopically labeled Ala30 and Gly34 residues, to probe how binding of either rimantadine or 7,7-spiran amine affects the water dynamics inside the M2 channel. Our results show, at neutral pH where the channel is non-conducting, that drug binding leads to a significant increase in the mobility ofmore » the channel water. A similar trend is also observed at pH 5.0 although the difference becomes smaller. Taken together, these results indicate that the channel water facilitates drug binding by increasing its entropy. Furthermore, the 2D IR spectral signatures obtained for both probes under different conditions collectively support a binding mechanism whereby amantadine-like drugs dock in the channel with their ammonium moiety pointing toward the histidine residues and interacting with a nearby water cluster, as predicted by molecular dynamics simulations. We believe these findings have important implications for designing new anti-influenza drugs.« less

  7. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  8. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  9. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  10. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  12. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  13. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  14. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  15. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  16. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  17. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  18. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  19. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  20. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  1. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  2. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  3. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  4. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  5. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  6. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  7. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  8. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  9. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  10. pH-Assisted control over the binding and relocation of an acridine guest between a macrocyclic nanocarrier and natural DNA.

    PubMed

    Sayed, Mhejabeen; Pal, Haridas

    2015-04-14

    The differential binding affinity of the hydroxypropyl-β-cyclodextrin (HPβCD) macrocycle, a drug delivery vehicle, towards the protonated and deprotonated forms of the well-known DNA binder and model anticancer drug acridine has been exploited as a strategy for dye-drug transportation and pH-responsive delivery to a natural DNA target. From pH-sensitive changes in the ground state absorption and steady-state fluorescence characteristics of the studied acridine dye-HPβCD-DNA ternary system and strongly supported by fluorescence lifetime, fluorescence anisotropy, Job's plots, (1)H NMR and circular dichroism results, it is revealed that in a moderately alkaline solution (pH ∼ 8.5), the dye can be predominantly bound to the HPβCD macrocycle and when the pH is lowered to a moderately acidic region (pH ∼ 4), the dye efficiently detaches from the HPβCD cavity and almost exclusively binds to DNA. In the present study we are thus able to construct a pH-sensitive supramolecular assembly where pH acts as a simple stimulus for controlled uptake and targeted release of the dye-drug. As pH is an essential and sensitive factor in various biological processes, a simple yet reliable pH-sensitive model such as is demonstrated here can have promising applications in the host-assisted delivery of prodrug to the target sites, such as cancer or tumour microenvironments, with an enhanced stability, bioavailability and activity, and also in the design of new fluorescent probes, sensors and smart materials for applications in nano-science.

  11. Human insulin analogues modified at the B26 site reveal a hormone conformation that is undetected in the receptor complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Žáková, Lenka; Kletvíková, Emília; Lepšík, Martin

    [AsnB26]- and [GlyB26]-insulin mutants attain a B26-turn like fold without assistance of chemical modifications. Their structures match the insulin receptor interface and expand the spectrum of insulin conformations. The structural characterization of the insulin–insulin receptor (IR) interaction still lacks the conformation of the crucial B21–B30 insulin region, which must be different from that in its storage forms to ensure effective receptor binding. Here, it is shown that insulin analogues modified by natural amino acids at the TyrB26 site can represent an active form of this hormone. In particular, [AsnB26]-insulin and [GlyB26]-insulin attain a B26-turn-like conformation that differs from that inmore » all known structures of the native hormone. It also matches the receptor interface, avoiding substantial steric clashes. This indicates that insulin may attain a B26-turn-like conformation upon IR binding. Moreover, there is an unexpected, but significant, binding specificity of the AsnB26 mutant for predominantly the metabolic B isoform of the receptor. As it is correlated with the B26 bend of the B-chain of the hormone, the structures of AsnB26 analogues may provide the first structural insight into the structural origins of differential insulin signalling through insulin receptor A and B isoforms.« less

  12. Extreme Entropy-Enthalpy Compensation in a Drug Resistant Variant of HIV-1 Protease

    PubMed Central

    King, Nancy M.; Prabu-Jeyabalan, Moses; Bandaranayake, Rajintha M.; Nalam, Madhavi N. L.; Nalivaika, Ellen A.; Özen, Ayşegül; Haliloglu, Türkan; Yılmaz, Neşe Kurt; Schiffer, Celia A.

    2012-01-01

    The development of HIV-1 protease inhibitors has been the historic paradigm of rational structure-based drug design, where structural and thermodynamic analyses have assisted in the discovery of novel inhibitors. While the total enthalpy and entropy change upon binding determine the affinity, often the thermodynamics are considered in terms of inhibitor properties only. In the current study, profound changes are observed in the binding thermodynamics of a drug resistant variant compared to wild-type HIV-1 protease, irrespective of the inhibitor bound. This variant (Flap+) has a combination of flap and active site mutations and exhibits extremely large entropy-enthalpy compensation compared to wild-type protease, 5–15 kcal/mol, while losing only 1–3 kcal/mol in total binding free energy for any of six FDA approved inhibitors. Although entropy-enthalpy compensation has been previously observed for a variety of systems, never have changes of this magnitude been reported. The co-crystal structures of Flap+ protease with four of the inhibitors were determined and compared with complexes of both the wildtype protease and another drug resistant variant that does not exhibit this energetic compensation. Structural changes conserved across the Flap+ complexes, which are more pronounced for the flaps covering the active site, likely contribute to the thermodynamic compensation. The finding that drug resistant mutations can profoundly modulate the relative thermodynamic properties of a therapeutic target independent of the inhibitor presents a new challenge for rational drug design. PMID:22712830

  13. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  14. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Secondary structure adventures with Carl Woese

    PubMed Central

    Noller, Harry F

    2014-01-01

    Not long after my arrival at UCSC as an assistant professor, I came across Carl Woese's paper “Molecular Mechanics of Translation: A Reciprocating Ratchet Mechanism.”1 In the days before the crystal structure of tRNA was known, Fuller and Hodgson2 had proposed two alternative conformations for its anticodon loop; one was stacked on the 3′ side (as later found in the crystal structure) and the other on the 5′ side. In an ingenious and elegant model, Woese proposed that the conformation of the loop flips between Fuller and Hodgson's 5′- and 3′-stacked forms during protein synthesis, changing the local direction of the mRNA such that the identities of the tRNA binding sites alternated between binding aminoacyl-tRNA and peptidyl-tRNA. The model predicted that there are no A and P sites, only two binding sites whose identities changed following translation of each codon, and that there would be no translocation of tRNAs in the usual sense—only binding and release. I met Carl in person the following year when he presented a seminar on his ratchet model in Santa Cruz. He was chatting in my colleague Ralph Hinegardner's office in what Carl termed a “Little Jack Horner appointment” (the visitor sits and listens to his host describing “What a good boy am I”). He was of compact stature, and bore a striking resemblance to Oskar Werner in Truffaut's film “Jules and Jim.” He projected the impression of a New-Age guru—a shiny black amulet suspended over the front of his black turtleneck sweater and a crown of prematurely white hair. Ralph asked me to explain to Carl what we were doing with ribosomes. I quickly summarized our early experiments that were pointing to a functional role for 16S rRNA. Carl regarded me silently, with a penetrating stare. He then turned to Ralph and said, in an ominous low voice, “I'm going to have some more tanks made as soon as I get back.” Carl's beautiful model was, unfortunately, wrong—it was simpler and more elegant than the complex mechanism that Nature actually uses. Unyielding, Carl railed against the A-site-P-site model at every opportunity,3,4 and although we ended up enjoying a long, intense, and fruitful collaboration, and became close, life-long friends, I finally gave up trying to describe to him our biochemical and crystallographic results on the A, P, and E sites. PMID:24637459

  16. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  17. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  18. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  19. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  1. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  2. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  3. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  4. Sterols regulate 3β-hydroxysterol Δ24-reductase (DHCR24) via dual sterol regulatory elements: cooperative induction of key enzymes in lipid synthesis by Sterol Regulatory Element Binding Proteins.

    PubMed

    Zerenturk, Eser J; Sharpe, Laura J; Brown, Andrew J

    2012-10-01

    3β-Hydroxysterol Δ24-reductase (DHCR24) catalyzes a final step in cholesterol synthesis, and has been ascribed diverse functions, such as being anti-apoptotic and anti-inflammatory. How this enzyme is regulated transcriptionally by sterols is currently unclear. Some studies have suggested that its expression is regulated by Sterol Regulatory Element Binding Proteins (SREBPs) while another suggests it is through the Liver X Receptor (LXR). However, these transcription factors have opposing effects on cellular sterol levels, so it is likely that one predominates. Here we establish that sterol regulation of DHCR24 occurs predominantly through SREBP-2, and identify the particular region of the DHCR24 promoter to which SREBP-2 binds. We demonstrate that sterol regulation is mediated by two sterol regulatory elements (SREs) in the promoter of the gene, assisted by two nearby NF-Y binding sites. Moreover, we present evidence that the dual SREs work cooperatively to regulate DHCR24 expression by comparison to two known SREBP target genes, the LDL receptor with one SRE, and farnesyl-diphosphate farnesyltransferase 1, with two SREs. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Molecular simulation assisted identification of Ca2+ binding residues in TMEM16A

    NASA Astrophysics Data System (ADS)

    Pang, Chun-Li; Yuan, Hong-Bo; Cao, Tian-Guang; Su, Ji-Guo; Chen, Ya-Fei; Liu, Hui; Yu, Hui; Zhang, Hai-Ling; Zhan, Yong; An, Hai-Long; Han, Yue-Bin

    2015-11-01

    Calcium-activated chloride channels (CaCCs) play vital roles in a variety of physiological processes. Transmembrane protein 16A (TMEM16A) has been confirmed as the molecular counterpart of CaCCs which greatly pushes the molecular insights of CaCCs forward. However, the detailed mechanism of Ca2+ binding and activating the channel is still obscure. Here, we utilized a combination of computational and electrophysiological approaches to discern the molecular mechanism by which Ca2+ regulates the gating of TMEM16A channels. The simulation results show that the first intracellular loop serves as a Ca2+ binding site including D439, E444 and E447. The experimental results indicate that a novel residue, E447, plays key role in Ca2+ binding. Compared with WT TMEM16A, E447Y produces a 30-fold increase in EC50 of Ca2+ activation and leads to a 100-fold increase in Ca2+ concentrations that is needed to fully activate the channel. The following steered molecular dynamic (SMD) simulation data suggests that the mutations at 447 reduce the Ca2+ dissociation energy. Our results indicated that both the electrical property and the size of the side-chain at residue 447 have significant effects on Ca2+ dependent gating of TMEM16A.

  6. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  7. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  8. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  9. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  10. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  11. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  12. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  13. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  14. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  15. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  16. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  17. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  18. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  19. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  20. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  1. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  2. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  3. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  4. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  5. Tryptophan 80 and leucine 143 are critical for the hydride transfer step of thymidylate synthase by controlling active site access.

    PubMed

    Fritz, Timothy A; Liu, Lu; Finer-Moore, Janet S; Stroud, Robert M

    2002-06-04

    Mutant forms of thymidylate synthase (TS) with substitutions at the conserved active site residue, Trp 80, are deficient in the hydride transfer step of the TS reaction. These mutants produce a beta-mercaptoethanol (beta-ME) adduct of the 2'-deoxyuridine-5'-monophosphate (dUMP) exocyclic methylene intermediate. Trp 80 has been proposed to assist hydride transfer by stabilizing a 5,6,7,8-tetrahydrofolate (THF) radical cation intermediate [Barrett, J. E., Lucero, C. M., and Schultz, P. G. (1999) J. Am. Chem. Soc. 121, 7965-7966.] formed after THF changes its binding from the cofactor pocket to a putative alternate site. To understand the molecular basis of hydride transfer deficiency in a mutant in which Trp 80 was changed to Gly, we determined the X-ray structures of this mutant Escherichia coli TS complexed with dUMP and the folate analogue 10-propargyl-5,8-dideazafolate (CB3717) and of the wild-type enzyme complexed with dUMP and THF. The mutant enzyme has a cavity in the active site continuous with bulk solvent. This cavity, sealed from bulk solvent in wild-type TS by Leu 143, would allow nucleophilic attack of beta-ME on the dUMP C5 exocyclic methylene. The structure of the wild-type enzyme/dUMP/THF complex shows that THF is bound in the cofactor binding pocket and is well positioned to transfer hydride to the dUMP exocyclic methylene. Together, these results suggest that THF does not reorient during hydride transfer and indicate that the role of Trp 80 may be to orient Leu 143 to shield the active site from bulk solvent and to optimally position the cofactor for hydride transfer.

  6. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  7. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  8. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  9. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  10. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  11. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  12. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  13. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  15. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  16. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  17. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  18. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  19. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  20. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  1. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  2. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  3. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  4. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  5. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  6. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  7. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  8. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  9. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  10. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  11. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  12. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  13. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  14. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  15. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  16. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  17. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  18. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  19. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  20. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  1. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  2. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  3. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  4. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  5. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  6. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  7. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  8. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  9. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  10. Structural Insights into the Atomistic Mechanisms of Action of Small Molecule Inhibitors Targeting the KCa3.1 Channel Pore

    PubMed Central

    Nguyen, Hai M.; Singh, Vikrant; Pressly, Brandon; Jenkins, David Paul

    2017-01-01

    The intermediate-conductance Ca2+-activated K+ channel (KCa3.1) constitutes an attractive pharmacological target for immunosuppression, fibroproliferative disorders, atherosclerosis, and stroke. However, there currently is no available crystal structure of this medically relevant channel that could be used for structure-assisted drug design. Using the Rosetta molecular modeling suite we generated a molecular model of the KCa3.1 pore and tested the model by first confirming previously mapped binding sites and visualizing the mechanism of TRAM-34 (1-[(2-chlorophenyl)diphenylmethyl]-1H-pyrazole), senicapoc (2,2-bis-(4-fluorophenyl)-2-phenylacetamide), and NS6180 (4-[[3-(trifluoromethyl)phenyl]methyl]-2H-1,4-benzothiazin-3(4H)-one) inhibition at the atomistic level. All three compounds block ion conduction directly by fully or partially occupying the site that would normally be occupied by K+ before it enters the selectivity filter. We then challenged the model to predict the receptor sites and mechanisms of action of the dihydropyridine nifedipine and an isosteric 4-phenyl-pyran. Rosetta predicted receptor sites for nifedipine in the fenestration region and for the 4-phenyl-pyran in the pore lumen, which could both be confirmed by site-directed mutagenesis and electrophysiology. While nifedipine is thus not a pore blocker and might be stabilizing the channel in a nonconducting conformation or interfere with gating, the 4-phenyl-pyran was found to be a classical pore blocker that directly inhibits ion conduction similar to the triarylmethanes TRAM-34 and senicapoc. The Rosetta KCa3.1 pore model explains the mechanism of action of several KCa3.1 blockers at the molecular level and could be used for structure-assisted drug design. PMID:28126850

  11. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  12. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  13. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  14. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  15. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  16. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  17. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  19. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  20. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  2. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  4. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  5. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  6. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  7. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  8. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  9. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  10. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  11. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  12. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  13. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  14. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  15. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  16. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  17. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  19. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  20. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  1. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  2. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    PubMed Central

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-01-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface. PMID:27353000

  3. Cargo binding promotes KDEL receptor clustering at the mammalian cell surface

    NASA Astrophysics Data System (ADS)

    Becker, Björn; Shaebani, M. Reza; Rammo, Domenik; Bubel, Tobias; Santen, Ludger; Schmitt, Manfred J.

    2016-06-01

    Transmembrane receptor clustering is a ubiquitous phenomenon in pro- and eukaryotic cells to physically sense receptor/ligand interactions and subsequently translate an exogenous signal into a cellular response. Despite that receptor cluster formation has been described for a wide variety of receptors, ranging from chemotactic receptors in bacteria to growth factor and neurotransmitter receptors in mammalian cells, a mechanistic understanding of the underlying molecular processes is still puzzling. In an attempt to fill this gap we followed a combined experimental and theoretical approach by dissecting and modulating cargo binding, internalization and cellular response mediated by KDEL receptors (KDELRs) at the mammalian cell surface after interaction with a model cargo/ligand. Using a fluorescent variant of ricin toxin A chain as KDELR-ligand (eGFP-RTAH/KDEL), we demonstrate that cargo binding induces dose-dependent receptor cluster formation at and subsequent internalization from the membrane which is associated and counteracted by anterograde and microtubule-assisted receptor transport to preferred docking sites at the plasma membrane. By means of analytical arguments and extensive numerical simulations we show that cargo-synchronized receptor transport from and to the membrane is causative for KDELR/cargo cluster formation at the mammalian cell surface.

  4. Human DNA ligase III recognizes DNA ends by dynamic switching between two DNA-bound states.

    PubMed

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A; Tomkinson, Alan E; Ellenberger, Tom

    2010-07-27

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a "jackknife model" in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.

  5. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  7. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  8. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  9. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  10. Copper Metallochaperones

    PubMed Central

    Robinson, Nigel J.; Winge, Dennis R.

    2014-01-01

    The current state of knowledge on how copper metallochaperones support the maturation of cuproproteins is reviewed. Copper is needed within mitochondria to supply the CuA and intramembrane CuB sites of cytochrome oxidase, within the trans-Golgi network to supply secreted cuproproteins and within the cytosol to supply superoxide dismutase 1 (Sod1). Subpopulations of copper-zinc superoxide dismutase also localize to mitochondria, the secretory system, the nucleus and, in plants, the chloroplast, which also requires copper for plastocyanin. Prokaryotic cuproproteins are found in the cell membrane and in the periplasm of gram-negative bacteria. Cu(I) and Cu(II) form tight complexes with organic molecules and drive redox chemistry, which unrestrained would be destructive. Copper metallochaperones assist copper in reaching vital destinations without inflicting damage or becoming trapped in adventitious binding sites. Copper ions are specifically released from copper metallochaperones upon contact with their cognate cuproproteins and metal transfer is thought to proceed by ligand substitution. PMID:20205585

  11. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  12. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  13. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  14. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  15. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  16. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  17. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  18. Specific binding of (/sup 3/H-Tyr8)physalaemin to rat submaxillary gland substance P receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bahouth, S.W.; Lazaro, D.M.; Brundish, D.E.

    1985-01-01

    (/sup 3/H)Physalaemin ((/sup 3/H)PHY) binds to a single class of noninteracting sites on rat submaxillary gland membranes suspended in high ionic strength media with a KD of 2.7 nM, a Bmax of 240 fmol/mg of protein, and low nonspecific binding. The relative potencies of substance P (SP) and its fragments in competing with (/sup 3/H)PHY correlate with their relative salivation potencies. This indicates that (/sup 3/H)PHY interacts with a physiologically relevant SP receptor. In low ionic strength media, the KD of (/sup 3/H)PHY does not change, but SP and some of its fragments are more potent than PHY in competingmore » with (/sup 3/H) PHY. Computer-assisted analysis of (/sup 3/H)PHY and (/sup 3/H)SP binding in high and low ionic strength media demonstrated that both peptides are equipotent in high ionic strength but that the affinity of SP increases by 70-fold in low ionic strength. The SP fragments that contain a basic residue in positions 1 and/or 3 also display an increased affinity in low ionic strength. These findings document that (/sup 3/H)PHY binding in high ionic strength (mu . 0.6) accurately reflects the pharmacological potencies of agonists on the SP-P receptor. The binding of (/sup 3/H)PHY, like that of (/sup 3/H)SP, increases by the addition of divalent cations (Mg2+ greater than Ca2+ greater than Mn2+). Guanine nucleotides decrease (/sup 3/H)PHY binding by decreasing the Bmax to the same level (160 fmol/mg of protein), in the presence or absence of Mg2+.« less

  19. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  20. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  1. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  2. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  4. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  5. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  6. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  7. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  8. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  9. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  10. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  11. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  12. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  13. Continuous Catalytic Production of Methyl Acrylates from Unsaturated Alcohols by Gold: The Strong Effect of C=C Unsaturation on Reaction Selectivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zugic, Branko; Karakalos, Stavros; Stowers, Kara J.

    2016-03-04

    Here we demonstrate the gas-phase catalytic production of methyl acrylates by oxygen-assisted coupling of methanol with the unsaturated alcohols allyl alcohol and methylallyl alcohol over nanoporous gold (npAu) at atmospheric pressure. Analogous investigations on O-activated Au(110) exhibit the same pattern of reactivity and are used to establish that the competition between methoxy and allyloxy (or methallyloxy) reaction intermediates for adsorption sites, mediated by the reactants themselves, determines the selectivity of reaction. Our results clearly show that the C=C bond substantially increases the binding efficacy of the allyloxy (or methallyloxy), thus requiring extremely high methanol mole fractions (>0.99) in order tomore » achieve comparable surface concentrations of methoxy and produce optimum yields of either methacrylate or methyl methacrylate. Allyloxy and methallyloxy were favored by factors of ~100 and ~450, respectively, vs methoxy. These values are more than 1 order of magnitude greater than those measured for competitive binding of ethoxy and 1-butoxy vs methoxy, demonstrating the strong effect of the carbon–carbon bond unsaturation. The 4.5-fold increase due to the addition of the methyl group in methylallyl alcohol vs allyl alcohol indicates the significant effect of the additional van der Waals interactions between the methyl group and the surface. Gas-phase acidity is also shown to be a good qualitative indicator for the relative binding strength of the alkoxides. This work provides insight into the control of reaction selectivity for coupling reactions and demonstrates the value of fundamental studies on single crystals for establishing key principles governing reaction selectivity. Notably, these oxygen-assisted coupling reactions occur without oxidation of the C=C bond.« less

  14. Continuous Catalytic Production of Methyl Acrylates from Unsaturated Alcohols by Gold: The Strong Effect of C=C Unsaturation on Reaction Selectivity

    DOE PAGES

    Zugic, Branko; Karakalos, Stavros; Stowers, Kara J.; ...

    2016-02-02

    We demonstrate the gas-phase catalytic production of methyl acrylates by oxygen-assisted coupling of methanol with the unsaturated alcohols allyl alcohol and methylallyl alcohol over nanoporous gold (npAu) at atmospheric pressure. Analogous investigations on O-activated Au(110) exhibit the same pattern of reactivity and are used to establish that the competition between methoxy and allyloxy (or methallyloxy) reaction intermediates for adsorption sites, mediated by the reactants themselves, determines the selectivity of reaction. These results clearly show that the C=C bond substantially increases the binding efficacy of the allyloxy (or methallyloxy), thus requiring extremely high methanol mole fractions (>0.99) in order to achievemore » comparable surface concentrations of methoxy and produce optimum yields of either methacrylate or methyl methacrylate. Allyloxy and methallyloxy were favored by factors of ~100 and ~450, respectively, vs methoxy. These values are more than 1 order of magnitude greater than those measured for competitive binding of ethoxy and 1-butoxy vs methoxy, demonstrating the strong effect of the carbon–carbon bond unsaturation. The 4.5-fold increase due to the addition of the methyl group in methylallyl alcohol vs allyl alcohol indicates the significant effect of the additional van der Waals interactions between the methyl group and the surface. Gas-phase acidity is also shown to be a good qualitative indicator for the relative binding strength of the alkoxides. This work then provides insight into the control of reaction selectivity for coupling reactions and demonstrates the value of fundamental studies on single crystals for establishing key principles governing reaction selectivity. Notably, these oxygen-assisted coupling reactions occur without oxidation of the C=C bond.« less

  15. Crystal Structure of a Phosphorylation-coupled Saccharide Transporter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Y Cao; X Jin; E Levin

    Saccharides have a central role in the nutrition of all living organisms. Whereas several saccharide uptake systems are shared between the different phylogenetic kingdoms, the phosphoenolpyruvate-dependent phosphotransferase system exists almost exclusively in bacteria. This multi-component system includes an integral membrane protein EIIC that transports saccharides and assists in their phosphorylation. Here we present the crystal structure of an EIIC from Bacillus cereus that transports diacetylchitobiose. The EIIC is a homodimer, with an expansive interface formed between the amino-terminal halves of the two protomers. The carboxy-terminal half of each protomer has a large binding pocket that contains a diacetylchitobiose, which ismore » occluded from both sides of the membrane with its site of phosphorylation near the conserved His250 and Glu334 residues. The structure shows the architecture of this important class of transporters, identifies the determinants of substrate binding and phosphorylation, and provides a framework for understanding the mechanism of sugar translocation.« less

  16. SARS-unique fold in the Rousettus bat coronavirus HKU9.

    PubMed

    Hammond, Robert G; Tan, Xuan; Johnson, Margaret A

    2017-09-01

    The coronavirus nonstructural protein 3 (nsp3) is a multifunctional protein that comprises multiple structural domains. This protein assists viral polyprotein cleavage, host immune interference, and may play other roles in genome replication or transcription. Here, we report the solution NMR structure of a protein from the "SARS-unique region" of the bat coronavirus HKU9. The protein contains a frataxin fold or double-wing motif, which is an α + β fold that is associated with protein/protein interactions, DNA binding, and metal ion binding. High structural similarity to the human severe acute respiratory syndrome (SARS) coronavirus nsp3 is present. A possible functional site that is conserved among some betacoronaviruses has been identified using bioinformatics and biochemical analyses. This structure provides strong experimental support for the recent proposal advanced by us and others that the "SARS-unique" region is not unique to the human SARS virus, but is conserved among several different phylogenetic groups of coronaviruses and provides essential functions. © 2017 The Protein Society.

  17. Structural insights into the cofactor-assisted substrate recognition of yeast methylglyoxal/isovaleraldehyde reductase Gre2.

    PubMed

    Guo, Peng-Chao; Bao, Zhang-Zhi; Ma, Xiao-Xiao; Xia, Qingyou; Li, Wei-Fang

    2014-09-01

    Saccharomyces cerevisiae Gre2 (EC1.1.1.283) serves as a versatile enzyme that catalyzes the stereoselective reduction of a broad range of substrates including aliphatic and aromatic ketones, diketones, as well as aldehydes, using NADPH as the cofactor. Here we present the crystal structures of Gre2 from S. cerevisiae in an apo-form at 2.00Å and NADPH-complexed form at 2.40Å resolution. Gre2 forms a homodimer, each subunit of which contains an N-terminal Rossmann-fold domain and a variable C-terminal domain, which participates in substrate recognition. The induced fit upon binding to the cofactor NADPH makes the two domains shift toward each other, producing an interdomain cleft that better fits the substrate. Computational simulation combined with site-directed mutagenesis and enzymatic activity analysis enabled us to define a potential substrate-binding pocket that determines the stringent substrate stereoselectivity for catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  19. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  20. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  1. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  2. Two classes of binding sites for [3H]substance P in rat cerebral cortex.

    PubMed

    Geraghty, D P; Burcher, E

    1993-01-22

    The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  4. Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

    PubMed Central

    Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

    2011-01-01

    Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

  5. Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

    PubMed Central

    Meng, Xiangzhi; Leman, Michael; Xiang, Yan

    2007-01-01

    Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

  6. Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

    PubMed

    Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

    2018-05-16

    Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

  7. Integration of tools for binding archetypes to SNOMED CT.

    PubMed

    Sundvall, Erik; Qamar, Rahil; Nyström, Mikael; Forss, Mattias; Petersson, Håkan; Karlsson, Daniel; Ahlfeldt, Hans; Rector, Alan

    2008-10-27

    The Archetype formalism and the associated Archetype Definition Language have been proposed as an ISO standard for specifying models of components of electronic healthcare records as a means of achieving interoperability between clinical systems. This paper presents an archetype editor with support for manual or semi-automatic creation of bindings between archetypes and terminology systems. Lexical and semantic methods are applied in order to obtain automatic mapping suggestions. Information visualisation methods are also used to assist the user in exploration and selection of mappings. An integrated tool for archetype authoring, semi-automatic SNOMED CT terminology binding assistance and terminology visualization was created and released as open source. Finding the right terms to bind is a difficult task but the effort to achieve terminology bindings may be reduced with the help of the described approach. The methods and tools presented are general, but here only bindings between SNOMED CT and archetypes based on the openEHR reference model are presented in detail.

  8. Integration of tools for binding archetypes to SNOMED CT

    PubMed Central

    Sundvall, Erik; Qamar, Rahil; Nyström, Mikael; Forss, Mattias; Petersson, Håkan; Karlsson, Daniel; Åhlfeldt, Hans; Rector, Alan

    2008-01-01

    Background The Archetype formalism and the associated Archetype Definition Language have been proposed as an ISO standard for specifying models of components of electronic healthcare records as a means of achieving interoperability between clinical systems. This paper presents an archetype editor with support for manual or semi-automatic creation of bindings between archetypes and terminology systems. Methods Lexical and semantic methods are applied in order to obtain automatic mapping suggestions. Information visualisation methods are also used to assist the user in exploration and selection of mappings. Results An integrated tool for archetype authoring, semi-automatic SNOMED CT terminology binding assistance and terminology visualization was created and released as open source. Conclusion Finding the right terms to bind is a difficult task but the effort to achieve terminology bindings may be reduced with the help of the described approach. The methods and tools presented are general, but here only bindings between SNOMED CT and archetypes based on the openEHR reference model are presented in detail. PMID:19007444

  9. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  10. Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

    NASA Astrophysics Data System (ADS)

    Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

    1986-07-01

    The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

  11. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  12. Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

    PubMed

    Fehr, Marcus; Wolf, Antje; Stammler, Gerd

    2016-03-01

    Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

  13. Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

    NASA Astrophysics Data System (ADS)

    Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

    1985-05-01

    The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

  14. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  15. Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

    PubMed

    Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

    1997-10-28

    Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

  16. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  17. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  18. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

    PubMed Central

    Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

  19. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

    PubMed

    Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

  20. The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

  1. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  2. Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

    PubMed Central

    Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

    2018-01-01

    Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

  3. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.

    Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less

  5. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    PubMed

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  6. 75 FR 9189 - Office of Special Education and Rehabilitative Services; Overview Information; Assistive...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-01

    ... Public Internet Site; Notice Inviting Applications for New Awards for Fiscal Year (FY) 2010 Catalog of... assistive technology public Internet site to improve awareness of and access to assistive technology (AT...: National Assistive Technology Public Internet Site. Under this priority, the Department will support an...

  7. The D-galactose specific lectin of field bean (Dolichos lablab) seed binds sugars with extreme negative cooperativity and half-of-the-sites binding.

    PubMed

    Rao, Devavratha H; Gowda, Lalitha R

    2012-08-15

    The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

    PubMed Central

    Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

    2011-01-01

    Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

  9. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  10. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Discovery of a small-molecule HIV-1 integrase inhibitor-binding site | Center for Cancer Research

    Cancer.gov

    The lowest energy-binding conformation of an inhibitor bound to the dimeric interface of HIV-1 integrase core domain. The yellow region represents a unique allosteric binding site identified by affinity labeling and mass spectrometry and validated through mutagenesis. This site can provide a potential platform for the rational design of inhibitors selective for disruption of

  12. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  13. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  14. Non-competitive inhibition by active site binders.

    PubMed

    Blat, Yuval

    2010-06-01

    Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.

  15. PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

    PubMed Central

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

  16. A Bioinformatics Approach to the Identification of Variants Associated with Type 1 and Type 2 Diabetes Mellitus that Reside in Functionally Validated miRNAs Binding Sites.

    PubMed

    Ghaedi, Hamid; Bastami, Milad; Jahani, Mohammad Mehdi; Alipoor, Behnam; Tabasinezhad, Maryam; Ghaderi, Omar; Nariman-Saleh-Fam, Ziba; Mirfakhraie, Reza; Movafagh, Abolfazl; Omrani, Mir Davood; Masotti, Andrea

    2016-06-01

    The present work is aimed at finding variants associated with Type 1 and Type 2 diabetes mellitus (DM) that reside in functionally validated miRNAs binding sites and that can have a functional role in determining diabetes and related pathologies. Using bioinformatics analyses we obtained a database of validated polymorphic miRNA binding sites which has been intersected with genes related to DM or to variants associated and/or in linkage disequilibrium (LD) with it and is reported in genome-wide association studies (GWAS). The workflow we followed allowed us to find variants associated with DM that also reside in functional miRNA binding sites. These data have been demonstrated to have a functional role by impairing the functions of genes implicated in biological processes linked to DM. In conclusion, our work emphasized the importance of SNPs located in miRNA binding sites. The results discussed in this work may constitute the basis of further works aimed at finding functional candidates and variants affecting protein structure and function, transcription factor binding sites, and non-coding epigenetic variants, contributing to widen the knowledge about the pathogenesis of this important disease.

  17. The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

    DOE PAGES

    Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

    2017-06-24

    In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

  18. Unorthodox Acetylcholine Binding Sites Formed by α5 and β3 Accessory Subunits in α4β2* Nicotinic Acetylcholine Receptors.

    PubMed

    Jain, Akansha; Kuryatov, Alexander; Wang, Jingyi; Kamenecka, Theodore M; Lindstrom, Jon

    2016-11-04

    All nicotinic acetylcholine receptors (nAChRs) evolved from homomeric nAChRs in which all five subunits are involved in forming acetylcholine (ACh) binding sites at their interfaces. Heteromeric α4β2* nAChRs typically have two ACh binding sites at α4/β2 interfaces and a fifth accessory subunit surrounding the central cation channel. β2 accessory subunits do not form ACh binding sites, but α4 accessory subunits do at the α4/α4 interface in (α4β2) 2 α4 nAChRs. α5 and β3 are closely related subunits that had been thought to act only as accessory subunits and not take part in forming ACh binding sites. The effect of agonists at various subunit interfaces was determined by blocking homologous sites at these interfaces using the thioreactive agent 2-((trimethylammonium)ethyl) methanethiosulfonate (MTSET). We found that α5/α4 and β3/α4 interfaces formed ACh binding sites in (α4β2) 2 α5 and (α4β2) 2 β3 nAChRs. The α4/α5 interface in (β2α4) 2 α5 nAChRs also formed an ACh binding site. Blocking of these sites with MTSET reduced the maximal ACh evoked responses of these nAChRs by 30-50%. However, site-selective agonists NS9283 (for the α4/α4 site) and sazetidine-A (for the α4/β2 site) did not act on the ACh sites formed by the α5/α4 or β3/α4 interfaces. This suggests that unorthodox sites formed by α5 and β3 subunits have unique ligand selectivity. Agonists or antagonists for these unorthodox sites might be selective and effective drugs for modulating nAChR function to treat nicotine addiction and other disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  20. Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

    PubMed Central

    Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

    1996-01-01

    Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

  1. Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

    PubMed

    Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

    2017-05-05

    The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

  2. Predicting Displaceable Water Sites Using Mixed-Solvent Molecular Dynamics.

    PubMed

    Graham, Sarah E; Smith, Richard D; Carlson, Heather A

    2018-02-26

    Water molecules are an important factor in protein-ligand binding. Upon binding of a ligand with a protein's surface, waters can either be displaced by the ligand or may be conserved and possibly bridge interactions between the protein and ligand. Depending on the specific interactions made by the ligand, displacing waters can yield a gain in binding affinity. The extent to which binding affinity may increase is difficult to predict, as the favorable displacement of a water molecule is dependent on the site-specific interactions made by the water and the potential ligand. Several methods have been developed to predict the location of water sites on a protein's surface, but the majority of methods are not able to take into account both protein dynamics and the interactions made by specific functional groups. Mixed-solvent molecular dynamics (MixMD) is a cosolvent simulation technique that explicitly accounts for the interaction of both water and small molecule probes with a protein's surface, allowing for their direct competition. This method has previously been shown to identify both active and allosteric sites on a protein's surface. Using a test set of eight systems, we have developed a method using MixMD to identify conserved and displaceable water sites. Conserved sites can be determined by an occupancy-based metric to identify sites which are consistently occupied by water even in the presence of probe molecules. Conversely, displaceable water sites can be found by considering the sites which preferentially bind probe molecules. Furthermore, the inclusion of six probe types allows the MixMD method to predict which functional groups are capable of displacing which water sites. The MixMD method consistently identifies sites which are likely to be nondisplaceable and predicts the favorable displacement of water sites that are known to be displaced upon ligand binding.

  3. CD/MCD/VTVH-MCD Studies of Escherichia coli Bacterioferritin Support a Binuclear Iron Cofactor Site.

    PubMed

    Kwak, Yeonju; Schwartz, Jennifer K; Huang, Victor W; Boice, Emily; Kurtz, Donald M; Solomon, Edward I

    2015-12-01

    Ferritins and bacterioferritins (Bfrs) utilize a binuclear non-heme iron binding site to catalyze oxidation of Fe(II), leading to formation of an iron mineral core within a protein shell. Unlike ferritins, in which the diiron site binds Fe(II) as a substrate, which then autoxidizes and migrates to the mineral core, the diiron site in Bfr has a 2-His/4-carboxylate ligand set that is commonly found in diiron cofactor enzymes. Bfrs could, therefore, utilize the diiron site as a cofactor rather than for substrate iron binding. In this study, we applied circular dichroism (CD), magnetic CD (MCD), and variable-temperature, variable-field MCD (VTVH-MCD) spectroscopies to define the geometric and electronic structures of the biferrous active site in Escherichia coli Bfr. For these studies, we used an engineered M52L variant, which is known to eliminate binding of a heme cofactor but to have very minor effects on either iron oxidation or mineral core formation. We also examined an H46A/D50A/M52L Bfr variant, which additionally disrupts a previously observed mononuclear non-heme iron binding site inside the protein shell. The spectral analyses define a binuclear and an additional mononuclear ferrous site. The biferrous site shows two different five-coordinate centers. After O2 oxidation and re-reduction, only the mononuclear ferrous signal is eliminated. The retention of the biferrous but not the mononuclear ferrous site upon O2 cycling supports a mechanism in which the binuclear site acts as a cofactor for the O2 reaction, while the mononuclear site binds the substrate Fe(II) that, after its oxidation to Fe(III), migrates to the mineral core.

  4. Interaction of D-LSD with binding sites in brain: a study in vivo and in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ebersole, B.L.J.

    The localization of (/sup 3/H)-d-lysergic acid diethylamide ((/sup 3/H)LSD) binding sites in the mouse brain was compared in vivo and in vitro. Radioautography of brain sections incubated with (/sup 3/H)LSD in vitro revealed substantial specific (/sup 3/H)LSD binding in cortical layers III-IV and areas CA1 and dentate gyrus in hippocampus. In contrast, in brain sections from animals that received (/sup 3/H)LSD in vivo, binding in hippocampus was scant and diffuse, although the pattern of labeling in cortex was similar to that seen in vitro. The low specific binding in hippocampus relative to cortex was confirmed by homogenate filtration studies ofmore » brain areas from mice that received injections of (/sup 3/H)LSD. Time-course studies established that peak specific binding at ten minutes was the same in cortex and hippocampus. At all times, binding in hippocampus was about one-third of that in cortex; in contrast, the concentration of free (/sup 3/H)LSD did not vary between regions. This finding was unexpected, because binding studies in vitro in membrane preparations indicated that the density and affinity of (/sup 3/H)LSD binding sites were similar in both brain regions. Saturation binding studies in vivo showed that the lower amount of (/sup 3/H)LSD binding in hippocampus was attributable to a lower density of sites labeled by (/sup 3/H)LSD. The pharmacological identify of (/sub 3/H)LSD binding sites in vivo may be relevant to the hallucinogenic properties of LSD and of other related hallucinogens.« less

  5. Insights into the binding behavior of native and non-native cytochromes to photosystem I from Thermosynechococcus elongatus.

    PubMed

    Kölsch, Adrian; Hejazi, Mahdi; Stieger, Kai R; Feifel, Sven C; Kern, Jan F; Müh, Frank; Lisdat, Fred; Lokstein, Heiko; Zouni, Athina

    2018-06-08

    The binding of photosystem I (PS I) from Thermosynechococcus elongatus to the native cytochrome (cyt) c 6 and cyt c from horse heart (cyt c HH ) was analyzed by oxygen consumption measurements, isothermal titration calorimetry (ITC), and rigid body docking combined with electrostatic computations of binding energies. Although PS I has a higher affinity for cyt c HH than for cyt c 6 , the influence of ionic strength and pH on binding is different in the two cases. ITC and theoretical computations revealed the existence of unspecific binding sites for cyt c HH besides one specific binding site close to P 700 Binding to PS I was found to be the same for reduced and oxidized cyt c HH Based on this information, suitable conditions for cocrystallization of cyt c HH with PS I were found, resulting in crystals with a PS I:cyt c HH ratio of 1:1. A crystal structure at 3.4-Å resolution was obtained, but cyt c HH cannot be identified in the electron density map because of unspecific binding sites and/or high flexibility at the specific binding site. Modeling the binding of cyt c 6 to PS I revealed a specific binding site where the distance and orientation of cyt c 6 relative to P 700 are comparable with cyt c 2 from purple bacteria relative to P 870 This work provides new insights into the binding modes of different cytochromes to PS I, thus facilitating steps toward solving the PS I-cyt c costructure and a more detailed understanding of natural electron transport processes.

  6. Cooperative binding modes of Cu(II) in prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Chisnell, Robin; Lu, Wenchang; Bernholc, Jerry

    2007-03-01

    The misfolding of the prion protein, PrP, is responsible for a group of neurodegenerative diseases including mad cow disease and Creutzfeldt-Jakob disease. It is known that the PrP can efficiently bind copper ions; four high-affinity binding sites located in the octarepeat region of PrP are now well known. Recent experiments suggest that at low copper concentrations new binding modes, in which one copper ion is shared between two or more binding sites, are possible. Using our hybrid Thomas-Fermi/DFT computational scheme, which is well suited for simulations of biomolecules in solution, we investigate the geometries and energetics of two, three and four binding sites cooperatively binding one copper ion. These geometries are then used as inputs for classical molecular dynamics simulations. We find that copper binding affects the secondary structure of the PrP and that it stabilizes the unstructured (unfolded) part of the protein.

  7. Quantitative autoradiography of muscarinic and benzodiazepine receptors in the forebrain of the turtle, Pseudemys scripta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlegel, J.R.; Kriegstein, A.R.

    1987-11-22

    The distribution of muscarinic and benzodiazepine receptors was investigated in the turtle forebrain by the technique of in vitro receptor autoradiography. Muscarinic binding sites were labeled with 1 nM /sup 3/H-quinuclidinyl benzilate (/sup 3/H-QNB), and benzodiazepine sites were demonstrated with the aid of 1 nM /sup 3/H-flunitrazepam (/sup 3/H-FLU). Autoradiograms generated on /sup 3/H-Ultrofilm apposed to tissue slices revealed regionally specific distributions of muscarinic and benzodiazepine binding sites that are comparable with those for mammalian brain. Dense benzodiazepine binding was found in the anterior olfactory nucleus, the lateral and dorsal cortices, and the dorsal ventricular ridge (DVR), a structure withmore » no clear mammalian homologue. Muscarinic binding sites were most dense in the striatum, accumbens, DVR, lateral geniculate, and the anterior olfactory nucleus. Cortical binding sites were studied in greater detail by quantitative analysis of autoradiograms generated by using emulsion-coated coverslips. Laminar gradients of binding were observed that were specific for each radioligand; /sup 3/H-QNB sites were most dense in the inner molecular layer in all cortical regions, whereas /sup 3/H-FLU binding was generally most concentrated in the outer molecular layer and was least dense through all layers in the dorsomedial cortex. Because pyramidal cells are arranged in register in turtle cortex, the laminar patterns of receptor binding may reflect different receptor density gradients along pyramidal cell dendrites.« less

  8. DNA Damage: Quantum Mechanics/Molecular Mechanics Study on the Oxygen Binding and Substrate Hydroxylation Step in AlkB Repair Enzymes

    PubMed Central

    Quesne, Matthew G; Latifi, Reza; Gonzalez-Ovalle, Luis E; Kumar, Devesh; de Visser, Sam P

    2014-01-01

    AlkB repair enzymes are important nonheme iron enzymes that catalyse the demethylation of alkylated DNA bases in humans, which is a vital reaction in the body that heals externally damaged DNA bases. Its mechanism is currently controversial and in order to resolve the catalytic mechanism of these enzymes, a quantum mechanics/molecular mechanics (QM/MM) study was performed on the demethylation of the N1-methyladenine fragment by AlkB repair enzymes. Firstly, the initial modelling identified the oxygen binding site of the enzyme. Secondly, the oxygen activation mechanism was investigated and a novel pathway was found, whereby the catalytically active iron(IV)–oxo intermediate in the catalytic cycle undergoes an initial isomerisation assisted by an Arg residue in the substrate binding pocket, which then brings the oxo group in close contact with the methyl group of the alkylated DNA base. This enables a subsequent rate-determining hydrogen-atom abstraction on competitive σ-and π-pathways on a quintet spin-state surface. These findings give evidence of different locations of the oxygen and substrate binding channels in the enzyme and the origin of the separation of the oxygen-bound intermediates in the catalytic cycle from substrate. Our studies are compared with small model complexes and the effect of protein and environment on the kinetics and mechanism is explained. PMID:24339041

  9. Location dependent coordination chemistry and MRI relaxivity, in de novo designed lanthanide coiled coils† †Electronic supplementary information (ESI) available: Methods, peptide characterization data including mass spectrometry and analytical HPLC, sedimentation equilibrium data, circular dichroism, luminescence, and NMR data. See DOI: 10.1039/c5sc04101e

    PubMed Central

    Berwick, Matthew R.; Slope, Louise N.; Smith, Caitlin F.; King, Siobhan M.; Newton, Sarah L.; Gillis, Richard B.; Adams, Gary G.; Rowe, Arthur J.; Harding, Stephen E.; Britton, Melanie M.

    2016-01-01

    Herein, we establish for the first time the design principles for lanthanide coordination within coiled coils, and the important consequences of binding site translation. By interrogating design requirements and by systematically translating binding site residues, one can influence coiled coil stability and more importantly, the lanthanide coordination chemistry. A 10 Å binding site translation along a coiled coil, transforms a coordinatively saturated Tb(Asp)3(Asn)3 site into one in which three exogenous water molecules are coordinated, and in which the Asn layer is no longer essential for binding, Tb(Asp)3(H2O)3. This has a profound impact on the relaxivity of the analogous Gd(iii) coiled coil, with more than a four-fold increase in the transverse relaxivity (21 to 89 mM–1 s–1), by bringing into play, in addition to the outer sphere mechanism present for all Gd(iii) coiled coils, an inner sphere mechanism. Not only do these findings warrant further investigation for possible exploitation as MRI contrast agents, but understanding the impact of binding site translation on coordination chemistry has important repercussions for metal binding site design, taking us an important step closer to the predictable and truly de novo design of metal binding sites, for new functional applications. PMID:29899946

  10. Substance P receptor binding sites are expressed by glia in vivo after neuronal injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mantyh, P.W.; Johnson, D.J.; Boehmer, C.G.

    1989-07-01

    In vitro studies have demonstrated that glia can express functional receptors for a variety of neurotransmitters. To determine whether similar neurotransmitter receptors are also expressed by glia in vivo, the authors examined the glial scar in the transected optic nerve of the albino rabbit by quantitative receptor autoradiography. Receptor binding sites for radiolabeled calcitonin gene-related peptide, cholecystokinin, galanin, glutamate, somatostatin, substance P, and vasoactive intestinal peptide were examined. Specific receptor binding sites for each of these neurotransmitters were identified in the rabbit forebrain but were not detected in the normal optic nerve or tract. In the transected optic nerve andmore » tract, only receptor binding sites for substance P were expressed at detectable levels. The density of substance P receptor binding sites observed in this glial scar is among the highest observed in the rabbit forebrain. Ligand displacement and saturation experiments indicate that the substance P receptor binding site expressed by the glial scar has pharmacological characteristics similar to those of substance P receptors in the rabbit striatum, rat brain, and rat and canine gut. The present study demonstrates that glial cells in vivo express high concentrations of substance P receptor binding sites after transection of retinal ganglion cell axons. Because substance P has been shown to regulate inflammatory and immune responses in peripheral tissues, substance P may also, by analogy, be involved in regulating the glial response to injury in the central nervous system.« less

  11. Investigation of copper(II) binding to the protein precursor of Non-Amyloid-Beta Component of Alzheimer Disease Amyloid Plaque

    NASA Astrophysics Data System (ADS)

    Rose, Francis; Hodak, Miroslav; Bernholc, Jerry

    2007-03-01

    The Non-Amyloid-Beta Component Precursor (NACP) is a natively unfolded synaptic protein that is implicated in Alzheimers and Parkinsons diseases. Its aggregation into fibrillar structures is accelerated by the binding of copper(II). Experimental studies suggest that the dominant copper binding site is located at the histidine residue in NACP. Based on this evidence we assembled a model fragment of the binding site and used DFT to analyze the conformational details of the most probable binding motifs. We investigated the overall conformational effects with classical MD by constraining the copper binding site to the most energetically favorable geometry obtained from the DFT calculations. These results are compared and contrasted with those of the unbound NACP.

  12. Effect of antemortem and postmortem factors on ( sup 3 H)MK-801 binding in the human brain: Transient elevation during early childhood

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kornhuber, J.; Mack-Burkhardt, F.; Konradi, C.

    1989-01-01

    The effect of a number of antemortem and postmortem factors on ({sup 3}H)MK-801 binding was investigated under equilibrium conditions in the frontal cortex of human brains of 38 controls. Binding values transiently increased during the early postnatal period reaching a maximum at the age of about 2 years. After age 10 years ({sup 3}H)MK-801 binding sites disappeared at 5.7% per decade. The storage time of brain tissue had a reducing effect on these binding sites. There was no effect of gender, brain weight or postmortem time interval and the binding sites were bilaterally symmetrically distributed in the frontal cortex.

  13. Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

    PubMed

    Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

    2003-08-01

    Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

  14. Down-regulation of sup 3 H-imipramine binding sites in rat cerebral cortex prenatal exposure to antidepressants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montero, D.; de Ceballos, M.L.; Del Rio, J.

    1990-01-01

    Several antidepressant drugs were given to pregnant rats in the last 15 days of gestation and {sup 3}H-imipramine binding ({sup 3}H-IMI) was subsequently measured in the cerebral cortex of the offspring. The selective serotonin (5-HT) uptake blockers chlorimipramine and fluoxetine as well as the selective monoamine oxidase (MAO) inhibitors clorgyline and deprenyl induced, after prenatal exposure, a down-regulation of {sup 3}H-IMI binding sites at postnatal day 25. The density of these binding sites was still reduced at postnatal day 90 in rats exposed in utero to the MAO inhibitors. The antidepressants desipramine and nomifensine were ineffective in this respect. Aftermore » chronic treatment of adult animals, only chlorimipramine was able to down-regulate the {sup 3}H-IMI binding sites. Consequently, prenatal exposure of rats to different antidepressant drugs affecting predominantly the 5-HT systems induces more marked and long-lasting effects on cortical {sup 3}H-IMI binding sites. The results suggest that the developing brain is more susceptible to the actions of antidepressants.« less

  15. Photoactivable antibody binding protein: site-selective and covalent coupling of antibody.

    PubMed

    Jung, Yongwon; Lee, Jeong Min; Kim, Jung-won; Yoon, Jeongwon; Cho, Hyunmin; Chung, Bong Hyun

    2009-02-01

    Here we report new photoactivable antibody binding proteins, which site-selectively capture antibodies and form covalent conjugates with captured antibodies upon irradiation. The proteins allow the site-selective tagging and/or immobilization of antibodies with a highly preferred orientation and omit the need for prior antibody modifications. The minimal Fc-binding domain of protein G, a widely used antibody binding protein, was genetically and chemically engineered to contain a site-specific photo cross-linker, benzophenone. In addition, the domain was further mutated to have an enhanced Fc-targeting ability. This small engineered protein was successfully cross-linked only to the Fc region of the antibody without any nonspecific reactivity. SPR analysis indicated that antibodies can be site-selectively biotinylated through the present photoactivable protein. Furthermore, the system enabled light-induced covalent immobilization of antibodies directly on various solid surfaces, such as those of glass slides, gold chips, and small particles. Antibody coupling via photoactivable antibody binding proteins overcomes several limitations of conventional approaches, such as random chemical reactions or reversible protein binding, and offers a versatile tool for the field of immunosensors.

  16. Estrogen Receptor β and Its Domains Interact with Casein Kinase 2, Phosphokinase C, and N-Myristoylation Sites of Mitochondrial and Nuclear Proteins in Mouse Brain*

    PubMed Central

    Paramanik, Vijay; Thakur, Mahendra Kumar

    2012-01-01

    The localization of estrogen receptor (ER)β in mitochondria suggests ERβ-dependent regulation of genes, which is poorly understood. Here, we analyzed the ERβ interacting mitochondrial as well as nuclear proteins in mouse brain using pull-down assay and matrix-assisted laser desorption ionization mass spectroscopy (MALDI-MS). In the case of mitochondria, ERβ interacted with six proteins of 35–152 kDa, its transactivation domain (TAD) interacted with four proteins of 37–172 kDa, and ligand binding domain (LBD) interacted with six proteins of 37–161 kDa. On the other hand, in nuclei, ERβ interacted with seven proteins of 30–203 kDa, TAD with ten proteins of 31–160 kDa, and LBD with fourteen proteins of 42–179 kDa. For further identification, these proteins were cleaved by trypsin into peptides and analyzed by MALDI-MS using mascot search engine, immunoprecipitation, immunoblotting, and far-Western blotting. To find the consensus binding motifs in interacting proteins, their unique tryptic peptides were analyzed by the motif scan software. All the interacting proteins were found to contain casein kinase (CK) 2, phosphokinase (PK)C phosphorylation, and N-myristoylation sites. These were further confirmed by peptide pull-down assays using specific mutations in the interacting sites. Thus, the present findings provide evidence for the interaction of ERβ with specific mitochondrial and nuclear proteins through consensus CK2, PKC phosphorylation, and N-myristoylation sites, and may represent an essential step toward designing selective ER modulators for regulating estrogen-mediated signaling. PMID:22566700

  17. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  18. The allosteric citalopram binding site differentially interferes with neuronal firing rate and SERT trafficking in serotonergic neurons.

    PubMed

    Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten

    2016-11-01

    Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

  19. Nickel binding to NikA: an additional binding site reconciles spectroscopy, calorimetry and crystallography.

    PubMed

    Addy, Christine; Ohara, Masato; Kawai, Fumihiro; Kidera, Akinori; Ikeguchi, Mitsunori; Fuchigami, Sotaro; Osawa, Masanori; Shimada, Ichio; Park, Sam-Yong; Tame, Jeremy R H; Heddle, Jonathan G

    2007-02-01

    Intracellular nickel is required by Escherichia coli as a cofactor for a number of enzymes and is necessary for anaerobic respiration. However, high concentrations of nickel are toxic, so both import and export systems have evolved to control the cellular level of the metal. The nik operon in E. coli encodes a nickel-uptake system that includes the periplasmic nickel-binding protein NikA. The crystal structures of wild-type NikA both bound to nickel and in the apo form have been solved previously. The liganded structure appeared to show an unusual interaction between the nickel and the protein in which no direct bonds are formed. The highly unusual nickel coordination suggested by the crystal structure contrasted strongly with earlier X-ray spectroscopic studies. The known nickel-binding site has been probed by extensive mutagenesis and isothermal titration calorimetry and it has been found that even large numbers of disruptive mutations appear to have little effect on the nickel affinity. The crystal structure of a binding-site mutant with nickel bound has been solved and it is found that nickel is bound to two histidine residues at a position distant from the previously characterized binding site. This novel site immediately resolves the conflict between the crystal structures and other biophysical analyses. The physiological relevance of the two binding sites is discussed.

  20. Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

    PubMed Central

    Cherepanov, A V; de Vries, S

    2001-01-01

    The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

  1. Reversible binding kinetics of a cytoskeletal protein at the erythrocyte submembrane.

    PubMed Central

    Stout, A. L.; Axelrod, D.

    1994-01-01

    Reversible binding among components of the cellular submembrane cytoskeleton and reversible binding of some of these components with the plasma membrane likely play a role in nonelastic morphological changes and mechanoplastic properties of cells. However, relatively few studies have been devoted to investigating directly the kinetic aspects of the interactions of individual components of the membrane skeleton with the membrane. The experiments described here investigated whether one component of the erythrocyte membrane cytoskeleton, protein 4.1, binds to its sites on the membrane reversibly and if so, whether the different 4.1-binding sites display distinct kinetic behavior. Protein 4.1 is known to stabilize the membrane and to mediate the attachment of spectrin filaments to the membrane. Protein 4.1 previously has been shown to bind to integral membrane proteins band 3, glycophorin C, and to negatively charged phospholipids. To examine the kinetic rates of dissociation of carboxymethyl fluorescein-labeled 4.1 (CF-4.1) to the cytofacial surface of erythrocyte membrane, a special preparation of hemolyzed erythrocyte ghosts was used, in which the ghosts became flattened on a glass surface and exposed their cytofacial surfaces to the solution through a membrane rip in a distinctive characteristic pattern. This preparation was examined by the microscopy technique of total internal reflection/fluorescence recovery after photobleaching (TIR/FRAP). Four different treatments were employed to help identify which membrane binding sites gave rise to the multiplicity of observed kinetic rates. The first treatment, the control, stripped off the native spectrin, actin, 4.1, and ankyrin. About 60% of the CF-4.1 bound to this control binded irreversibly (dissociation time > 20 min), but the remaining approximately 40% binded reversibly with a range of residency times averaging approximately 3 s. The second treatment subjected these stripped membranes to trypsin, which presumably removed most of the band 3. CF-4.1 binded significantly less to these trypsinized membranes and most of the decrease was a loss of the irreversibly binding sites. The third treatment simply preserved the native 4.1 and ankyrin. CF-4.1 binded less to this sample too, and the loss involved both the irreversible and reversible sites. The fourth treatment blocked the gycophorin C sites on the native 4.1-stripped membranes with an antibody. CF-4.1 again binded less to this sample than to a nonimmune serum control, and almost all of the decrease is a loss of irreversible sites. These rest suggest that 1) protein 4.1 binds to membrane or submembrane sites at least in part reversibly ; 2) the most reversible sites are probably not proteinaceous and not glycophorin C, but possibly are phospholipids (especially phosphatidylserine); and 3) TIWRFRAP can successfully examine the fast reversible dynamics of cytoskeletal components binding to biological membranes. Images FIGURE 2 FIGURE 3 FIGURE 4 PMID:7811947

  2. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  3. New Synthesis and Tritium Labeling of a Selective Ligand for Studying High-affinity γ-Hydroxybutyrate (GHB) Binding Sites

    PubMed Central

    Vogensen, Stine B.; Marek, Aleš; Bay, Tina; Wellendorph, Petrine; Kehler, Jan; Bundgaard, Christoffer; Frølund, Bente; Pedersen, Martin H.F.; Clausen, Rasmus P.

    2013-01-01

    3-Hydroxycyclopent-1-enecarboxylic acid (HOCPCA, 1) is a potent ligand for the high-affinity GHB binding sites in the CNS. An improved synthesis of 1 together with a very efficient synthesis of [3H]-1 is described. The radiosynthesis employs in situ generated lithium trimethoxyborotritide. Screening of 1 against different CNS targets establishes a high selectivity and we demonstrate in vivo brain penetration. In vitro characterization of [3H]-1 binding shows high specificity to the high-affinity GHB binding sites. PMID:24053696

  4. Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.

    PubMed

    Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F

    2014-12-16

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

  5. Activation of Phenylalanine Hydroxylase by Phenylalanine Does Not Require Binding in the Active Site

    PubMed Central

    2015-01-01

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein’s regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The kcat/Kphe value is down 104 for the mutant enzyme, and the Km value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain. PMID:25453233

  6. Plant cell pH-static circuit mediated by fusicoccin-binding proteins.

    PubMed

    Drabkin, A V; Trofimova, M S; Smolenskaya, I N; Klychnikov, O I; Chelysheva, V V; Babakov, A V

    1997-03-24

    On sugar beet protoplasts that carry two types of fusicoccin-binding sites, a pH downshift in a physiological range (7.0-6.6) markedly enhanced the efficiency of fusicoccin (FC) binding, mainly owing to increased avidity of low-affinity FC-binding sites. This may allow the FC-binding proteins to act as pH-sensitive modulators of cell activity, for instance, via plasma membrane H+-ATPase or potassium channels.

  7. Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

    PubMed

    Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

    2018-03-28

    Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

  8. The crystal structures of the psychrophilic subtilisin S41 and the mesophilic subtilisin Sph reveal the same calcium-loaded state.

    PubMed

    Almog, Orna; González, Ana; Godin, Noa; de Leeuw, Marina; Mekel, Marlene J; Klein, Daniela; Braun, Sergei; Shoham, Gil; Walter, Richard L

    2009-02-01

    We determine and compare the crystal structure of two proteases belonging to the subtilisin superfamily: S41, a cold-adapted serine protease produced by Antarctic bacilli, at 1.4 A resolution and Sph, a mesophilic serine protease produced by Bacillus sphaericus, at 0.8 A resolution. The purpose of this comparison was to find out whether multiple calcium ion binding is a molecular factor responsible for the adaptation of S41 to extreme low temperatures. We find that these two subtilisins have the same subtilisin fold with a root mean square between the two structures of 0.54 A. The final models for S41 and Sph include a calcium-loaded state of five ions bound to each of these two subtilisin molecules. None of these calcium-binding sites correlate with the high affinity known binding site (site A) found for other subtilisins. Structural analysis of the five calcium-binding sites found in these two crystal structures indicate that three of the binding sites have two side chains of an acidic residue coordinating the calcium ion, whereas the other two binding sites have either a main-chain carbonyl, or only one acidic residue side chain coordinating the calcium ion. Thus, we conclude that three of the sites are of high affinity toward calcium ions, whereas the other two are of low affinity. Because Sph is a mesophilic subtilisin and S41 is a psychrophilic subtilisin, but both crystal structures were found to bind five calcium ions, we suggest that multiple calcium ion binding is not responsible for the adaptation of S41 to low temperatures. Copyright 2008 Wiley-Liss, Inc.

  9. CheckMyMetal: a macromolecular metal-binding validation tool

    PubMed Central

    Porebski, Przemyslaw J.

    2017-01-01

    Metals are essential in many biological processes, and metal ions are modeled in roughly 40% of the macromolecular structures in the Protein Data Bank (PDB). However, a significant fraction of these structures contain poorly modeled metal-binding sites. CheckMyMetal (CMM) is an easy-to-use metal-binding site validation server for macromolecules that is freely available at http://csgid.org/csgid/metal_sites. The CMM server can detect incorrect metal assignments as well as geometrical and other irregularities in the metal-binding sites. Guidelines for metal-site modeling and validation in macromolecules are illustrated by several practical examples grouped by the type of metal. These examples show CMM users (and crystallographers in general) problems they may encounter during the modeling of a specific metal ion. PMID:28291757

  10. Botulinum neurotoxin serotype C associates with dual ganglioside receptors to facilitate cell entry.

    PubMed

    Karalewitz, Andrew P-A; Fu, Zhuji; Baldwin, Michael R; Kim, Jung-Ja P; Barbieri, Joseph T

    2012-11-23

    How botulinum neurotoxin serotype C (BoNT/C) enters neurons is unclear. BoNT/C utilizes dual gangliosides as host cell receptors. BoNT/C accesses gangliosides on the plasma membrane. Plasma membrane accessibility of the dual ganglioside receptors suggests synaptic vesicle exocytosis may not be necessary to expose BoNT/C receptors. Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A-G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission.

  11. Elucidation of the binding sites of sodium dodecyl sulfate to β-lactoglobulin using hydrogen/deuterium exchange mass spectrometry combined with docking simulation.

    PubMed

    Hu, Wenbing; Liu, Jianan; Luo, Qun; Han, Yumiao; Wu, Kui; Lv, Shuang; Xiong, Shaoxiang; Wang, Fuyi

    2011-05-30

    Hydrogen/deuterium exchange mass spectrometry (H/DX MS) has become a powerful tool to investigate protein-protein and protein-ligand interactions, but it is still challenging to localize the interaction regions/sites of ligands with pepsin-resistant proteins such as lipocalins. β-Lactoglobulin (BLG), a member of the lipocalin family, can bind a variety of small hydrophobic molecules including retinols, retinoic acids, and long linear fatty acids. However, whether the binding site of linear molecules locates in the external groove or internal cavity of BLG is controversial. In this study we used H/DX MS combined with docking simulation to localize the interaction sites of a tested ligand, sodium dodecyl sulfate (SDS), binding to BLG. H/DX MS results indicated that SDS can bind to both the external and the internal sites in BLG. However, neither of the sites is saturated with SDS, allowing a dynamic ligand exchange to occur between the sites at equilibrium state. Docking studies revealed that SDS forms H-bonds with Lys69 in the internal site and Lys138 and Lys141 in the external site in BLG via the sulfate group, and interacts with the hydrophobic residues valine, leucine, isoleucine and methionine within both of the sites via its hydrocarbon tail, stabilizing the BLG-SDS complex. Copyright © 2011 John Wiley & Sons, Ltd.

  12. The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

    PubMed

    Wang, Jinling; de Montellano, Paul R Ortiz

    2003-05-30

    Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

  13. Structural basis for cargo binding and autoinhibition of Bicaudal-D1 by a parallel coiled-coil with homotypic registry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terawaki, Shin-ichi, E-mail: terawaki@gunma-u.ac.jp; SPring-8 Center, RIKEN, 1-1-1 Koto, Sayo-cho, Sayo-gun, Hyogo 679-5148; Yoshikane, Asuka

    Bicaudal-D1 (BICD1) is an α-helical coiled-coil protein mediating the attachment of specific cargo to cytoplasmic dynein. It plays an essential role in minus end-directed intracellular transport along microtubules. The third C-terminal coiled-coil region of BICD1 (BICD1 CC3) has an important role in cargo sorting, including intracellular vesicles associating with the small GTPase Rab6 and the nuclear pore complex Ran binding protein 2 (RanBP2), and inhibiting the association with cytoplasmic dynein by binding to the first N-terminal coiled-coil region (CC1). The crystal structure of BICD1 CC3 revealed a parallel homodimeric coiled-coil with asymmetry and complementary knobs-into-holes interactions, differing from Drosophila BicDmore » CC3. Furthermore, our binding study indicated that BICD1 CC3 possesses a binding surface for two distinct cargos, Rab6 and RanBP2, and that the CC1-binding site overlaps with the Rab6-binding site. These findings suggest a molecular basis for cargo recognition and autoinhibition of BICD proteins during dynein-dependent intracellular retrograde transport. - Highlights: • BICD1 CC3 is a parallel homodimeric coiled-coil with axial asymmetry. • The coiled-coil packing of BICD1 CC3 is adapted to the equivalent heptad position. • BICD1 CC3 has distinct binding sites for two classes of cargo, Rab6 and RanBP2. • The CC1-binding site of BICD1 CC3 overlaps with the Rab6-binding site.« less

  14. Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

    PubMed

    Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

    2009-04-01

    Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

  15. Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites.

    PubMed

    Chen, Baoyu; Chou, Hui-Ting; Brautigam, Chad A; Xing, Wenmin; Yang, Sheng; Henry, Lisa; Doolittle, Lynda K; Walz, Thomas; Rosen, Michael K

    2017-09-26

    The Rho GTPase Rac1 activates the WAVE regulatory complex (WRC) to drive Arp2/3 complex-mediated actin polymerization, which underpins diverse cellular processes. Here we report the structure of a WRC-Rac1 complex determined by cryo-electron microscopy. Surprisingly, Rac1 is not located at the binding site on the Sra1 subunit of the WRC previously identified by mutagenesis and biochemical data. Rather, it binds to a distinct, conserved site on the opposite end of Sra1. Biophysical and biochemical data on WRC mutants confirm that Rac1 binds to both sites, with the newly identified site having higher affinity and both sites required for WRC activation. Our data reveal that the WRC is activated by simultaneous engagement of two Rac1 molecules, suggesting a mechanism by which cells may sense the density of active Rac1 at membranes to precisely control actin assembly.

  16. A sarcoidosis clinician's perspective of MHC functional elements outside the antigen binding site.

    PubMed

    Judson, Marc A

    2018-05-30

    Sarcoidosis is a multisystem granulomatous disease of unknown cause. Evidence supports an integral role for interactions at the MHC binding site in the development of sarcoidosis. However, despite this evidence, there are clinical data that suggest that additional mechanisms are involved in the immunopathogenesis of this disease. This manuscript provides a brief clinical description of sarcoidosis, and a clinician's perspective of the immunopathogenesis of sarcoidosis in terms of the MHC binding site, MHC functional elements beyond the binding site, and other possible alternative mechanisms. Input from clinicians will be essential in establishing the immunologic cause of sarcoidosis as a detailed phenotypic characterization of disease will be required. Copyright © 2018. Published by Elsevier Inc.

  17. Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

    PubMed

    Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

    2015-09-10

    The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

  18. Copper attachment to a non-octarepeat site in prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Bernholc, Jerry

    2010-03-01

    Prion protein, PrP, plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The PrP is known to efficiently bind copper ions and this ability has been linked to its function. PrP contains up to six binding sites, four of which are located in the so-called octarepeat region and are now well known. The binding sites outside this region are still largely undetermined, despite evidence of their relevance to prion diseases. Using a hybrid DFT/DFT, which combines Kohn-Sham DFT with orbital-free DFT to achieve accurate and efficient description of solvent effects in ab initio calculations, we have investigated copper attachment to the sequence GGGTH, which represents the copper binding site located at His96. We have considered both NNNN and NNNO types of copper coordination, as suggested by experiments. Our calculations have determined the geometry of copper attachment site and its energetics. Comparison to the already known binding sites provides insight into the process of copper uptake in PrP.

  19. Mechanism of pathogen recognition by human dectin-2.

    PubMed

    Feinberg, Hadar; Jégouzo, Sabine A F; Rex, Maximus J; Drickamer, Kurt; Weis, William I; Taylor, Maureen E

    2017-08-11

    Dectin-2, a C-type lectin on macrophages and other cells of the innate immune system, functions in response to pathogens, particularly fungi. The carbohydrate-recognition domain (CRD) in dectin-2 is linked to a transmembrane sequence that interacts with the common Fc receptor γ subunit to initiate immune signaling. The molecular mechanism by which dectin-2 selectively binds to pathogens has been investigated by characterizing the CRD expressed in a bacterial system. Competition binding studies indicated that the CRD binds to monosaccharides with modest affinity and that affinity was greatly enhanced for mannose-linked α1-2 or α1-4 to a second mannose residue. Glycan array analysis confirmed selective binding of the CRD to glycans that contain Manα1-2Man epitopes. Crystals of the CRD in complex with a mammalian-type high-mannose Man 9 GlcNAc 2 oligosaccharide exhibited interaction with Manα1-2Man on two different termini of the glycan, with the reducing-end mannose residue ligated to Ca 2+ in a primary binding site and the nonreducing terminal mannose residue occupying an adjacent secondary site. Comparison of the binding sites in DC-SIGN and langerin, two other pathogen-binding receptors of the innate immune system, revealed why these two binding sites accommodate only terminal Manα1-2Man structures, whereas dectin-2 can bind Manα1-2Man in internal positions in mannans and other polysaccharides. The specificity and geometry of the dectin-2-binding site provide the molecular mechanism for binding of dectin-2 to fungal mannans and also to bacterial lipopolysaccharides, capsular polysaccharides, and lipoarabinomannans that contain the Manα1-2Man disaccharide unit. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

Top