cea-kil operon of the ColE1 plasmid.

PubMed Central

Sabik, J F; Suit, J L; Luria, S E

1983-01-01

We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

A multimodality imaging-compatible insertion robot with a respiratory motion calibration module designed for ablation of liver tumors: a preclinical study.

PubMed

Li, Dongrui; Cheng, Zhigang; Chen, Gang; Liu, Fangyi; Wu, Wenbo; Yu, Jie; Gu, Ying; Liu, Fengyong; Ren, Chao; Liang, Ping

2018-04-03

To test the accuracy and efficacy of the multimodality imaging-compatible insertion robot with a respiratory motion calibration module designed for ablation of liver tumors in phantom and animal models. To evaluate and compare the influences of intervention experience on robot-assisted and ultrasound-controlled ablation procedures. Accuracy tests on rigid body/phantom model with a respiratory movement simulation device and microwave ablation tests on porcine liver tumor/rabbit liver cancer were performed with the robot we designed or with the traditional ultrasound-guidance by physicians with or without intervention experience. In the accuracy tests performed by the physicians without intervention experience, the insertion accuracy and efficiency of robot-assisted group was higher than those of ultrasound-guided group with statistically significant differences. In the microwave ablation tests performed by the physicians without intervention experience, better complete ablation rate was achieved when applying the robot. In the microwave ablation tests performed by the physicians with intervention experience, there was no statistically significant difference of the insertion number and total ablation time between the robot-assisted group and the ultrasound-controlled group. The evaluation by the NASA-TLX suggested that the robot-assisted insertion and microwave ablation process performed by physicians with or without experience were more comfortable. The multimodality imaging-compatible insertion robot with a respiratory motion calibration module designed for ablation of liver tumors could increase the insertion accuracy and ablation efficacy, and minimize the influence of the physicians' experience. The ablation procedure could be more comfortable with less stress with the application of the robot.

Gene and enhancer trap tagging of vascular-expressed genes in poplar trees

Treesearch

Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan

2004-01-01

We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...

Automatic Multiple-Needle Surgical Planning of Robotic-Assisted Microwave Coagulation in Large Liver Tumor Therapy

PubMed Central

Liu, Shaoli; Xia, Zeyang; Liu, Jianhua; Xu, Jing; Ren, He; Lu, Tong; Yang, Xiangdong

2016-01-01

The “robotic-assisted liver tumor coagulation therapy” (RALTCT) system is a promising candidate for large liver tumor treatment in terms of accuracy and speed. A prerequisite for effective therapy is accurate surgical planning. However, it is difficult for the surgeon to perform surgical planning manually due to the difficulties associated with robot-assisted large liver tumor therapy. These main difficulties include the following aspects: (1) multiple needles are needed to destroy the entire tumor, (2) the insertion trajectories of the needles should avoid the ribs, blood vessels, and other tissues and organs in the abdominal cavity, (3) the placement of multiple needles should avoid interference with each other, (4) an inserted needle will cause some deformation of liver, which will result in changes in subsequently inserted needles’ operating environment, and (5) the multiple needle-insertion trajectories should be consistent with the needle-driven robot’s movement characteristics. Thus, an effective multiple-needle surgical planning procedure is needed. To overcome these problems, we present an automatic multiple-needle surgical planning of optimal insertion trajectories to the targets, based on a mathematical description of all relevant structure surfaces. The method determines the analytical expression of boundaries of every needle “collision-free reachable workspace” (CFRW), which are the feasible insertion zones based on several constraints. Then, the optimal needle insertion trajectory within the optimization criteria will be chosen in the needle CFRW automatically. Also, the results can be visualized with our navigation system. In the simulation experiment, three needle-insertion trajectories were obtained successfully. In the in vitro experiment, the robot successfully achieved insertion of multiple needles. The proposed automatic multiple-needle surgical planning can improve the efficiency and safety of robot-assisted large liver tumor therapy, significantly reduce the surgeon’s workload, and is especially helpful for an inexperienced surgeon. The methodology should be easy to adapt in other body parts. PMID:26982341

App-assisted external ventricular drain insertion.

PubMed

Eftekhar, Behzad

2016-09-01

The freehand technique for insertion of an external ventricular drain (EVD) is based on fixed anatomical landmarks and does not take individual variations into consideration. A patient-tailored approach based on augmented-reality techniques using devices such as smartphones can address this shortcoming. The Sina neurosurgical assist (Sina) is an Android mobile device application (app) that was designed and developed to be used as a simple intraoperative neurosurgical planning aid. It overlaps the patient's images from previously performed CT or MRI studies on the image seen through the device camera. The device is held by an assistant who aligns the images and provides information about the relative position of the target and EVD to the surgeon who is performing EVD insertion. This app can be used to provide guidance and continuous monitoring during EVD placement. The author describes the technique of Sina-assisted EVD insertion into the frontal horn of the lateral ventricle and reports on its clinical application in 5 cases as well as the results of ex vivo studies of ease of use and precision. The technique has potential for further development and use with other augmented-reality devices.

A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.

PubMed

Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui

2009-04-01

Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.

Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat

PubMed Central

Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

2013-01-01

Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. PMID:23855320

Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat.

PubMed

Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

2013-10-01

Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. © 2013 Ben-Gurion University The Plant Journal © 2013 John Wiley & Sons Ltd.

Peripheral venous catheter insertion simulation training: A randomized controlled trial comparing performance after instructor-led teaching versus peer-assisted learning.

PubMed

Pelloux, Sophie; Grégoire, Arnaud; Kirmizigul, Patrice; Maillot, Sandrine; Bui-Xuan, Bernard; Llorca, Guy; Boet, Sylvain; Lehot, Jean-Jacques; Rimmelé, Thomas

2017-12-01

Peripheral venous catheter insertion is a procedural skill that every medical student should master. Training is often limited to a small number of students and is poorly evaluated. The objective of this study was to evaluate the performance of peer-assisted learning in comparison to instructor-led teaching for peripheral venous catheter insertion training. Students were randomized to the control group attending a traditional instructor-led training session (slideshow and demonstration by an anesthetist instructor, followed by training on a procedural simulator) or to the test group attending a peer-assisted training session (slideshow and demonstration video-recorded by the same instructor, followed by training on a procedural simulator). The primary endpoint was the performance of peripheral venous catheter insertion, assessed on procedural simulator one week later by blinded experts using a standardized 20-item grid. Students self-evaluated their confidence levels using a numeric 10-point scale. Eighty-six students were included, 73 of whom attended the assessment session. The median performance score was 12/20 [8-15] in the instructor-led teaching group versus 13/20 [11-15] in the peer-assisted learning group (P=0.430). Confidence levels improved significantly after the assessment session and were significantly higher in the peer-assisted learning group (7.6/10 [7.0-8.0] versus 7.0/10 [5.0-8.0], P=0.026). Peer-assisted learning is effective for peripheral venous catheter insertion training and can be as effective as instructor-led teaching. Given the large number of students to train, this finding is important for optimizing the cost-effectiveness of peripheral venous catheter insertion training. Copyright © 2017 Société française d’anesthésie et de réanimation (Sfar). Published by Elsevier Masson SAS. All rights reserved.

Clostridium perfringens Enterotoxin: Action, Genetics, and Translational Applications

PubMed Central

Freedman, John C.; Shrestha, Archana; McClane, Bruce A.

2016-01-01

Clostridium perfringens enterotoxin (CPE) is responsible for causing the gastrointestinal symptoms of several C. perfringens food- and nonfood-borne human gastrointestinal diseases. The enterotoxin gene (cpe) is located on either the chromosome (for most C. perfringens type A food poisoning strains) or large conjugative plasmids (for the remaining type A food poisoning and most, if not all, other CPE-producing strains). In all CPE-positive strains, the cpe gene is strongly associated with insertion sequences that may help to assist its mobilization and spread. During disease, CPE is produced when C. perfringens sporulates in the intestines, a process involving several sporulation-specific alternative sigma factors. The action of CPE starts with its binding to claudin receptors to form a small complex; those small complexes then oligomerize to create a hexameric prepore on the membrane surface. Beta hairpin loops from the CPE molecules in the prepore assemble into a beta barrel that inserts into the membrane to form an active pore that enhances calcium influx, causing cell death. This cell death results in intestinal damage that causes fluid and electrolyte loss. CPE is now being explored for translational applications including cancer therapy/diagnosis, drug delivery, and vaccination. PMID:26999202

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1)

PubMed Central

Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang

2015-01-01

Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897

De novo insertion of an intron into the mammalian sex determining gene, SRY

PubMed Central

O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall

1998-01-01

Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071

CRISPR-Cas9D10A Nickase-Assisted Genome Editing in Lactobacillus casei

PubMed Central

Song, Xin; Huang, He; Xiong, Zhiqiang

2017-01-01

ABSTRACT Lactobacillus casei has drawn increasing attention as a health-promoting probiotic, while effective genetic manipulation tools are often not available, e.g., the single-gene knockout in L. casei still depends on the classic homologous recombination-dependent double-crossover strategy, which is quite labor-intensive and time-consuming. In the present study, a rapid and precise genome editing plasmid, pLCNICK, was established for L. casei genome engineering based on CRISPR-Cas9D10A. In addition to the P23-Cas9D10A and Pldh-sgRNA (single guide RNA) expression cassettes, pLCNICK includes the homologous arms of the target gene as repair templates. The ability and efficiency of chromosomal engineering using pLCNICK were evaluated by in-frame deletions of four independent genes and chromosomal insertion of an enhanced green fluorescent protein (eGFP) expression cassette at the LC2W_1628 locus. The efficiencies associated with in-frame deletions and chromosomal insertion is 25 to 62%. pLCNICK has been proved to be an effective, rapid, and precise tool for genome editing in L. casei, and its potential application in other lactic acid bacteria (LAB) is also discussed in this study. IMPORTANCE The lack of efficient genetic tools has limited the investigation and biotechnological application of many LAB. The CRISPR-Cas9D10A nickase-based genome editing in Lactobacillus casei, an important food industrial microorganism, was demonstrated in this study. This genetic tool allows efficient single-gene deletion and insertion to be accomplished by one-step transformation, and the cycle time is reduced to 9 days. It facilitates a rapid and precise chromosomal manipulation in L. casei and overcomes some limitations of previous methods. This editing system can serve as a basic technological platform and offers the possibility to start a comprehensive investigation on L. casei. As a broad-host-range plasmid, pLCNICK has the potential to be adapted to other Lactobacillus species for genome editing. PMID:28864652

Compiler-assisted static checkpoint insertion

NASA Technical Reports Server (NTRS)

Long, Junsheng; Fuchs, W. K.; Abraham, Jacob A.

1992-01-01

This paper describes a compiler-assisted approach for static checkpoint insertion. Instead of fixing the checkpoint location before program execution, a compiler enhanced polling mechanism is utilized to maintain both the desired checkpoint intervals and reproducible checkpoint 1ocations. The technique has been implemented in a GNU CC compiler for Sun 3 and Sun 4 (Sparc) processors. Experiments demonstrate that the approach provides for stable checkpoint intervals and reproducible checkpoint placements with performance overhead comparable to a previously presented compiler assisted dynamic scheme (CATCH) utilizing the system clock.

Thermal Assisted In Vivo Gene Electrotransfer

PubMed Central

Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

2016-01-01

Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses

PubMed Central

Baker, Oliver; Gupta, Ashish; Obst, Mandy; Zhang, Youming; Anastassiadis, Konstantinos; Fu, Jun; Stewart, A. Francis

2016-01-01

A fluent method for gene targeting to establish protein tagged and ligand inducible conditional loss-of-function alleles is described. We couple new recombineering applications for one-step cloning of gRNA oligonucleotides and rapid generation of short-arm (~1 kb) targeting constructs with the power of Cas9-assisted targeting to establish protein tagged alleles in embryonic stem cells at high efficiency. RAC (Recombineering And Cas9)-tagging with Venus, BirM, APEX2 and the auxin degron is facilitated by a recombineering-ready plasmid series that permits the reuse of gene-specific reagents to insert different tags. Here we focus on protein tagging with the auxin degron because it is a ligand-regulated loss-of-function strategy that is rapid and reversible. Furthermore it includes the additional challenge of biallelic targeting. Despite high frequencies of monoallelic RAC-targeting, we found that simultaneous biallelic targeting benefits from long-arm (>4 kb) targeting constructs. Consequently an updated recombineering pipeline for fluent generation of long arm targeting constructs is also presented. PMID:27216209

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

The Essential Genome of Escherichia coli K-12.

PubMed

Goodall, Emily C A; Robinson, Ashley; Johnston, Iain G; Jabbari, Sara; Turner, Keith A; Cunningham, Adam F; Lund, Peter A; Cole, Jeffrey A; Henderson, Ian R

2018-02-20

Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. IMPORTANCE Incentives to define lists of genes that are essential for bacterial survival include the identification of potential targets for antibacterial drug development, genes required for rapid growth for exploitation in biotechnology, and discovery of new biochemical pathways. To identify essential genes in Escherichia coli , we constructed a transposon mutant library of unprecedented density. Initial automated analysis of the resulting data revealed many discrepancies compared to the literature. We now report more extensive statistical analysis supported by both literature searches and detailed inspection of high-density TraDIS sequencing data for each putative essential gene for the E. coli model laboratory organism. This paper is important because it provides a better understanding of the essential genes of E. coli , reveals the limitations of relying on automated analysis alone, and provides a new standard for the analysis of TraDIS data. Copyright © 2018 Goodall et al.

Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

PubMed

Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

2015-02-01

To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

MMTV insertional mutagenesis identifies genes, gene families and pathways involved in mammary cancer.

PubMed

Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John

2007-06-01

We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Establishment of an Arbitrary PCR for Rapid Identification of Tn917 Insertion Sites in Staphylococcus epidermidis: Characterization of Biofilm-Negative and Nonmucoid Mutants

PubMed Central

Knobloch, Johannes K.-M.; Nedelmann, Max; Kiel, Kathrin; Bartscht, Katrin; Horstkotte, Matthias A.; Dobinsky, Sabine; Rohde, Holger; Mack, Dietrich

2003-01-01

Transposon mutagenesis with the Enterococcus faecalis transposon Tn917 is a genetic approach frequently used to identify genes related with specific phenotypes in gram-positive bacteria. We established an arbitrary PCR for the rapid and easy identification of Tn917 insertion sites in Staphylococcus epidermidis with six independent, well-characterized biofilm-negative Tn917 transposon mutants, which were clustered in the icaADBC gene locus or harbor Tn917 in the regulatory gene rsbU. For all six of these mutants, short chromosomal DNA fragments flanking both transposon ends could be amplified. All fragments were sufficient to correctly identify the Tn917 insertion sites in the published S. epidermidis genomes. By using this technique, the Tn917 insertion sites of three not-yet-characterized biofilm-negative or nonmucoid mutants were identified. In the biofilm-negative and nonmucoid mutant M12, Tn917 is inserted into a gene homologous to the regulatory gene purR of Bacillus subtilis and Staphylococcus aureus. The Tn917 insertions of the nonmucoid but biofilm-positive mutants M16 and M20 are located in genes homologous to components of the phosphoenolpyruvate-sugar phosphotransferase system (PTS) of B. subtilis, S. aureus, and Staphylococcus carnosus, indicating an influence of the PTS on the mucoid phenotype in S. epidermidis. PMID:14532029

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

NASA Technical Reports Server (NTRS)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

[The Russian gene pool: gene geography of Alu-insertions (ACE, APOA1, B65, PV92 TPA25)].

PubMed

Solov'eva, D S; Balanovskaia, E V; Kuznetsova, M A; Vasinskaia, O A; Frolova, S A; Pocheshkhova, E A; Evseeva, I V; Boldyreva, M N; Balanovskiĭ, O P

2010-01-01

The analysis of five Alu insertion loci (ACE, AP4OA1, B65, PV92, TPA25) has been carried out for the first time in 10 Russian populations (1088 individuals), covered all parts of historical area of the Russian ethnos. Depending on locus, Russian populations exhibit similarity with their western (European populations) or with the eastern (populations of the Ural region) neighbors. Considering frequencies of the studied Alu-insertions, Russian gene pool exhibits low variation: average difference between populations is d = 0.007, whereas on classical markers, mtDNA and Y chromosome heterogeneity of Russian gene pool is essentially higher (0.013, 0.033 and 0.142 respectively). Therefore, this set of five Alu insertions has lower variability on the intra-ethnic level. However in inter-ethnic comparisons the clear pattern was obtained: 13 Eastern European ethnic groups formed three clusters, according with their historical and geographical position--East Slavic, Caucasian and South Ural clusters. The obtained data confirms efficiency of using Alu insertions for studying genetic differentiation and history of a gene pool of the Eastern European populations.

Zinc-finger nuclease-mediated targeted insertion of reporter genes for quantitative imaging of gene expression in sea urchin embryos

PubMed Central

Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi

2012-01-01

To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830

From the Cover: Understanding nature's design for a nanosyringe

NASA Astrophysics Data System (ADS)

Lopez, Carlos F.; Nielsen, Steve O.; Moore, Preston B.; Klein, Michael L.

2004-03-01

Synthetic and natural peptide assemblies can possess transport or conductance activity across biomembranes through the formation of nanopores. The fundamental mechanisms of membrane insertion necessary for antimicrobial or synthetic pore formation are poorly understood. We observe a lipid-assisted mechanism for passive insertion into a model membrane from molecular dynamics simulations. The assembly used in the study, a generic nanotube functionalized with hydrophilic termini, is assisted in crossing the membrane core by transleaflet lipid flips. Lipid tails occlude a purely hydrophobic nanotube. The observed insertion mechanism requirements for hydrophobic-hydrophilic matching have implications for the design of synthetic channels and antibiotics.

The effect of augmented reality training on percutaneous needle placement in spinal facet joint injections.

PubMed

Yeo, Caitlin T; Ungi, Tamas; U-Thainual, Paweena; Lasso, Andras; McGraw, Robert C; Fichtinger, Gabor

2011-07-01

The purpose of this study was to determine if augmented reality image overlay and laser guidance systems can assist medical trainees in learning the correct placement of a needle for percutaneous facet joint injection. The Perk Station training suite was used to conduct and record the needle insertion procedures. A total of 40 volunteers were randomized into two groups of 20. 1) The Overlay group received a training session that consisted of four insertions with image and laser guidance, followed by two insertions with laser overlay only. 2) The Control group received a training session of six classical freehand insertions. Both groups then conducted two freehand insertions. The movement of the needle was tracked during the series of insertions. The final insertion procedure was assessed to determine if there was a benefit to the overlay method compared to the freehand insertions. The Overlay group had a better success rate (83.3% versus 68.4%, p=0.002), and potential for less tissue damage as measured by the amount of needle movement inside the phantom (3077.6 mm(2) versus 5607.9 mm(2) , p =0.01). These results suggest that an augmented reality overlay guidance system can assist medical trainees in acquiring technical competence in a percutaneous needle insertion procedure. © 2011 IEEE

Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside.

PubMed

Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio

2017-05-30

Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Assisted care as a baseline patient risk characteristic affecting the outcome of transcatheter aortic valve insertion.

PubMed

Traynor, Megan M; Greason, Kevin L; Nkomo, Vuyisile T; Pochettino, Alberto; Holmes, David R; Rihal, Charanjit S; Reeder, Guy S; Bresnahan, John F; Mathew, Verghese

2017-06-01

Objective measures of frailty have not been well defined as risk factors for a poor outcome after transcatheter aortic valve insertion. We hypothesized that assisted care as a baseline patient characteristic was a simple objective measure of frailty. We reviewed our experience to assess for an association between assisted care and outcome of operation. We retrospectively reviewed the records of 597 patients operated with transcatheter aortic valve insertion from November 2008 through July 2015. The study cohort included patients with a dichotomous baseline characteristic of receiving assisted care (AC group, n = 60, 10.1%) or not receiving assisted care (NC group, n = 537, 89.9%). The endpoints of the study were operative stroke/death and 1-year survival. The age of the patients was 80.6 ± 9.0 years, male sex was present in 349 (58.5%), and STS predicted risk of mortality was 9.2 ± 6.2%. Alternate access was used in 26 (43.3%) patients in the AC care group and in 220 (41.0%) in the NC group (P = 0.724). Operative stroke/death occurred in 4 (6.7%) patients in the AC group and in 25 (4.7%) in the NC group (P = 0.492). Mortality at 1 year in the AC group was 14.8 ± 5.2% and in the NC group was 12.9 ± 1.7%; (P = 0. 250). Assisted care as a baseline patient characteristic does not result in increased operative stroke/death or 1-year mortality in patients following transcatheter aortic valve insertion. Assisted care should not by itself preclude operation. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

PubMed

Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

2011-04-01

Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

Effects of insertion sites in a Newcastle disease virus vector on foreign gene expression through an internal ribosomal entry site

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Force Modeling, Identification, and Feedback Control of Robot-Assisted Needle Insertion: A Survey of the Literature

PubMed Central

Xie, Yu; Liu, Shuang; Sun, Dong

2018-01-01

Robot-assisted surgery is of growing interest in the surgical and engineering communities. The use of robots allows surgery to be performed with precision using smaller instruments and incisions, resulting in shorter healing times. However, using current technology, an operator cannot directly feel the operation because the surgeon-instrument and instrument-tissue interaction force feedbacks are lost during needle insertion. Advancements in force feedback and control not only help reduce tissue deformation and needle deflection but also provide the surgeon with better control over the surgical instruments. The goal of this review is to summarize the key components surrounding the force feedback and control during robot-assisted needle insertion. The literature search was conducted during the middle months of 2017 using mainstream academic search engines with a combination of keywords relevant to the field. In total, 166 articles with valuable contents were analyzed and grouped into five related topics. This survey systemically summarizes the state-of-the-art force control technologies for robot-assisted needle insertion, such as force modeling, measurement, the factors that influence the interaction force, parameter identification, and force control algorithms. All studies show force control is still at its initial stage. The influence factors, needle deflection or planning remain open for investigation in future. PMID:29439539

Force Modeling, Identification, and Feedback Control of Robot-Assisted Needle Insertion: A Survey of the Literature.

PubMed

Yang, Chongjun; Xie, Yu; Liu, Shuang; Sun, Dong

2018-02-12

Robot-assisted surgery is of growing interest in the surgical and engineering communities. The use of robots allows surgery to be performed with precision using smaller instruments and incisions, resulting in shorter healing times. However, using current technology, an operator cannot directly feel the operation because the surgeon-instrument and instrument-tissue interaction force feedbacks are lost during needle insertion. Advancements in force feedback and control not only help reduce tissue deformation and needle deflection but also provide the surgeon with better control over the surgical instruments. The goal of this review is to summarize the key components surrounding the force feedback and control during robot-assisted needle insertion. The literature search was conducted during the middle months of 2017 using mainstream academic search engines with a combination of keywords relevant to the field. In total, 166 articles with valuable contents were analyzed and grouped into five related topics. This survey systemically summarizes the state-of-the-art force control technologies for robot-assisted needle insertion, such as force modeling, measurement, the factors that influence the interaction force, parameter identification, and force control algorithms. All studies show force control is still at its initial stage. The influence factors, needle deflection or planning remain open for investigation in future.

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

PubMed

Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

2014-01-01

The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Comparison of computer assisted surgery with conventional technique for treatment of abaxial distal phalanx fractures in horses: an in vitro study.

PubMed

Rossol, Melanie; Gygax, Diego; Andritzky-Waas, Juliane; Zheng, Guoyan; Lischer, Christoph J; Zhang, Xuan; Auer, Joerg A

2008-01-01

To (1) evaluate and compare computer-assisted surgery (CAS) with conventional screw insertion (conventional osteosynthesis [COS]) for treatment of equine abaxial distal phalanx fractures; (2) compare planned screw position with actual postoperative position; and (3) determine preferred screw insertion direction. Experimental study. Cadaveric equine limbs (n=32). In 8 specimens each, a 4.5 mm cortex bone screw was inserted in lag fashion in dorsopalmar (plantar) direction using CAS or COS. In 2 other groups of 8, the screws were inserted in opposite direction. Precision of CAS was determined by comparison of planned and actual screw position. Preferred screw direction was also assessed for CAS and COS. In 4 of 6 direct comparisons, screw positioning was significantly better with CAS. Results of precision analysis for screw position were similar to studies published in human medicine. None of evaluated criteria identified a preferred direction for screw insertion. For abaxial fractures of the distal phalanx, superior precision in screw position is achieved with CAS technique compared with COS technique. Abaxial fractures of the distal phalanx lend themselves to computer-assisted implantation of 1 screw in a dorsopalmar (plantar) direction. Because of the complex anatomic relationships, and our results, we discourage use of COS technique for repair of this fracture type.

Global mapping of transposon location.

PubMed

Gabriel, Abram; Dapprich, Johannes; Kunkel, Mark; Gresham, David; Pratt, Stephen C; Dunham, Maitreya J

2006-12-15

Transposable genetic elements are ubiquitous, yet their presence or absence at any given position within a genome can vary between individual cells, tissues, or strains. Transposable elements have profound impacts on host genomes by altering gene expression, assisting in genomic rearrangements, causing insertional mutations, and serving as sources of phenotypic variation. Characterizing a genome's full complement of transposons requires whole genome sequencing, precluding simple studies of the impact of transposition on interindividual variation. Here, we describe a global mapping approach for identifying transposon locations in any genome, using a combination of transposon-specific DNA extraction and microarray-based comparative hybridization analysis. We use this approach to map the repertoire of endogenous transposons in different laboratory strains of Saccharomyces cerevisiae and demonstrate that transposons are a source of extensive genomic variation. We also apply this method to mapping bacterial transposon insertion sites in a yeast genomic library. This unique whole genome view of transposon location will facilitate our exploration of transposon dynamics, as well as defining bases for individual differences and adaptive potential.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Influence of insertion site of the avian influenza virus haemagglutinin (HA) gene within the Newcastle disease virus genome on HA expression.

PubMed

Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela

2011-02-01

Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.

Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

PubMed Central

Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

2013-01-01

Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development

NASA Technical Reports Server (NTRS)

Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.

2003-01-01

BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.

Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

PubMed

Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

2007-07-01

A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

Operational Definitions of Labor and Delivery Nursing Activities.

DTIC Science & Technology

1987-07-01

assess and record fetal heart rate. (S 2406 r) ZO!3 FETAL ELECTRODE INSERTION (RN): position patient, insert fetal electrode, secure monitor leads...to leg plate to patient’s lower extremity, connect, assess and record fetal heart rate. (S2405r) Z014 FETAL ELECTRODE INSERTION/INTRAUTERINE CATHETER...INSERTION, ASSIST: position patient for procedure, secure monitor Teads to patient’s lower extremity, assess and record fetal heart tones. Set up

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

PubMed

Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

2015-01-01

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum

PubMed Central

Jiang, Yu; Qian, Fenghui; Yang, Junjie; Liu, Yingmiao; Dong, Feng; Xu, Chongmao; Sun, Bingbing; Chen, Biao; Xu, Xiaoshu; Li, Yan; Wang, Renxiao; Yang, Sheng

2017-01-01

Corynebacterium glutamicum is an important industrial metabolite producer that is difficult to genetically engineer. Although the Streptococcus pyogenes (Sp) CRISPR-Cas9 system has been adapted for genome editing of multiple bacteria, it cannot be introduced into C. glutamicum. Here we report a Francisella novicida (Fn) CRISPR-Cpf1-based genome-editing method for C. glutamicum. CRISPR-Cpf1, combined with single-stranded DNA (ssDNA) recombineering, precisely introduces small changes into the bacterial genome at efficiencies of 86–100%. Large gene deletions and insertions are also obtained using an all-in-one plasmid consisting of FnCpf1, CRISPR RNA, and homologous arms. The two CRISPR-Cpf1-assisted systems enable N iterative rounds of genome editing in 3N+4 or 3N+2 days. A proof-of-concept, codon saturation mutagenesis at G149 of γ-glutamyl kinase relieves L-proline inhibition using Cpf1-assisted ssDNA recombineering. Thus, CRISPR-Cpf1-based genome editing provides a highly efficient tool for genetic engineering of Corynebacterium and other bacteria that cannot utilize the Sp CRISPR-Cas9 system. PMID:28469274

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

A Genetic Interaction Screen for Breast Cancer Progression Driver Genes

DTIC Science & Technology

2013-06-01

analysis of genetic alterations in human breast cancers has revealed that individual tumors accumulate mutations in approximately ninety different genes ...cancer. We performed a screen to test the roles of seventy breast cancer mutated genes in mouse mammary tumorigenesis using the MMTV-PyVT mouse breast...cancer model and piggyBac insertional mutation strains. We found that insertional mutations in 23 genes altered the onset of tumor formation and four

Tn5099, a xylE promoter probe transposon for Streptomyces spp.

PubMed Central

Hahn, D R; Solenberg, P J; Baltz, R H

1991-01-01

Tn5099, a promoter probe transposon for Streptomyces spp., was constructed by inserting a promoterless xylE gene and a hygromycin resistance gene into IS493. Tn5099 transposed into different sites in the Streptomyces griseofuscus genome, and the xylE reporter gene was expressed in some of the transposition mutants. Strains containing Tn5099 insertions that gave regulated expression of the xylE gene were identified. Images PMID:1653213

Cloning and expression in Escherichia coli of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A

1987-01-15

The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

Gene-specific cell labeling using MiMIC transposons

PubMed Central

Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

2015-01-01

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

PubMed Central

Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

2011-01-01

We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2009-12-15

Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs

PubMed Central

Sinha, Rahul; Goyal, Pankaj; Grapputo, Alessandro

2011-01-01

Background Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s) remain obscure. Largely, gene structures of melanocortin (MC) receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. Methodology/Principal Findings We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s), respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. Conclusions/Significance The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent repair processes to gain back normal functionality. PMID:21850219

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Evidence for a Retroviral Insertion in TRPM1 as the Cause of Congenital Stationary Night Blindness and Leopard Complex Spotting in the Horse

PubMed Central

Bellone, Rebecca R.; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L.; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J.; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L. A.; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A.

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ2=1022.00, p<<0.0005), and CSNB, testing 43 horses (χ2=43, p<<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder. PMID:24167615

Evidence for a retroviral insertion in TRPM1 as the cause of congenital stationary night blindness and leopard complex spotting in the horse.

PubMed

Bellone, Rebecca R; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L A; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A

2013-01-01

Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ(2)=1022.00, p<0.0005), and CSNB, testing 43 horses (χ(2)=43, p<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder.

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene.

PubMed

Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

2016-09-02

The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.

The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

PubMed

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

2007-03-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

Hand gesture guided robot-assisted surgery based on a direct augmented reality interface.

PubMed

Wen, Rong; Tay, Wei-Liang; Nguyen, Binh P; Chng, Chin-Boon; Chui, Chee-Kong

2014-09-01

Radiofrequency (RF) ablation is a good alternative to hepatic resection for treatment of liver tumors. However, accurate needle insertion requires precise hand-eye coordination and is also affected by the difficulty of RF needle navigation. This paper proposes a cooperative surgical robot system, guided by hand gestures and supported by an augmented reality (AR)-based surgical field, for robot-assisted percutaneous treatment. It establishes a robot-assisted natural AR guidance mechanism that incorporates the advantages of the following three aspects: AR visual guidance information, surgeon's experiences and accuracy of robotic surgery. A projector-based AR environment is directly overlaid on a patient to display preoperative and intraoperative information, while a mobile surgical robot system implements specified RF needle insertion plans. Natural hand gestures are used as an intuitive and robust method to interact with both the AR system and surgical robot. The proposed system was evaluated on a mannequin model. Experimental results demonstrated that hand gesture guidance was able to effectively guide the surgical robot, and the robot-assisted implementation was found to improve the accuracy of needle insertion. This human-robot cooperative mechanism is a promising approach for precise transcutaneous ablation therapy. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.

PubMed

Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H

2012-08-01

Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.

IS1598 (IsPg4) distributed to abscess-forming strains of Porphyromonas gingivalis may enhance virulence through upregulation of nrdD-like gene expression.

PubMed

Sonoi, Norihiro; Maeda, Hiroshi; Murauchi, Toshimitsu; Yamamoto, Tadashi; Omori, Kazuhiro; Kokeguchi, Susumu; Naruishi, Koji; Takashiba, Shogo

2018-01-01

An insertion sequence, IS1598 (IsPg4) has been found in virulent strains of Porphyromonas gingivalis in a murine abscess model. The present study was performed to investigate the effects of genetic rearrangements by IS1598 on the phenotypic characteristics of the virulent strains. For this purpose, we searched for a common insertion site of IS1598 among the virulent strains. Through cloning and database search, a common insertion site was identified beside an nrdD-like gene in the virulent FDC 381, W83 and W50 strains. In this region, predicted promoters of the nrdD-like gene and IS1598 are located in tandem, and accumulation of nrdD-like gene mRNA was 5-fold higher in virulent strains (W83, W50, FDC 381) than avirulent strains (ATCC33277, SU63, SUNY1021, ESO59 without IS1598). The role of the nrdD-like gene in virulence of P. gingivalis was investigated by constructing a nrdD-deficient mutant. In the murine abscess model, the parental W83 strain produced necrotic abscesses, while the nrdD-deficient mutant had almost lost this ability. Insertion of IS1598 into the nrdD-like gene promoter region may be related to the phenotypic differences in virulence among P. gingivalis strains through upregulation of the expression of this gene.

Gene-specific cell labeling using MiMIC transposons.

PubMed

Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

2015-04-30

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.

PubMed

Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang

2015-10-01

The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2010-12-01

We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

NASA Astrophysics Data System (ADS)

Panicali, Dennis; Paoletti, Enzo

1982-08-01

We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

PubMed

Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

2016-11-04

Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types, duplication ages and co-expression consequences.

The loss-of-allele assay for ES cell screening and mouse genotyping.

PubMed

Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

2010-01-01

Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.

PubMed

Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu

2017-11-14

Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.

A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice

PubMed Central

Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.

2013-01-01

Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Contribution of transposable elements in the plant's genome.

PubMed

Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

2018-07-30

Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

The development of a cisgenic apple plant.

PubMed

Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare

2011-07-20

Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.

Genes and Gene Therapy

MedlinePlus

... a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells

PubMed Central

Bressan, Raul Bardini; Dewari, Pooran Singh; Kalantzaki, Maria; Gangoso, Ester; Matjusaitis, Mantas; Garcia-Diaz, Claudia; Blin, Carla; Grant, Vivien; Bulstrode, Harry; Gogolok, Sabine; Skarnes, William C.

2017-01-01

Mammalian neural stem cell (NSC) lines provide a tractable model for discovery across stem cell and developmental biology, regenerative medicine and neuroscience. They can be derived from foetal or adult germinal tissues and continuously propagated in vitro as adherent monolayers. NSCs are clonally expandable, genetically stable, and easily transfectable – experimental attributes compatible with targeted genetic manipulations. However, gene targeting, which is crucial for functional studies of embryonic stem cells, has not been exploited to date in NSC lines. Here, we deploy CRISPR/Cas9 technology to demonstrate a variety of sophisticated genetic modifications via gene targeting in both mouse and human NSC lines, including: (1) efficient targeted transgene insertion at safe harbour loci (Rosa26 and AAVS1); (2) biallelic knockout of neurodevelopmental transcription factor genes; (3) simple knock-in of epitope tags and fluorescent reporters (e.g. Sox2-V5 and Sox2-mCherry); and (4) engineering of glioma mutations (TP53 deletion; H3F3A point mutations). These resources and optimised methods enable facile and scalable genome editing in mammalian NSCs, providing significant new opportunities for functional genetic analysis. PMID:28096221

Expression and Bioinformatics Analysis of Pectate Lyase Gene from Bacillus subtilis521

NASA Astrophysics Data System (ADS)

Xiao, Jing; Lu, Fu-Ping; Li, Yu; Li, Jin-Ting

In order to exploit new genetic resources, Pectate lyase(PEL) gene was amplified by PCR using the genome DNA from an alkaline Bacillus subtilis521. The PCR product was inserted into pET22b(+) vector. The recombinant plasmids were cloned in E.coli DH5α and then expressed in E.coli BL21. When cultured in the optimized medium, the positive clones E.coli BL21(pET22b(+)pel)showed intracellular pectate lyase activity of 90.0 U/mL. It was indicated that we had obtained the correct PEL gene. The pel has an open reading frame of 1263 nucleotides and codes for a product of 420 amino acids with a calculated molecular mass of 45.5 kD. Based on computer assisted analysis, a signal peptides and two conserved domains were revealed. The sequence analysis for PEL showed that it shares 26-82% homology with other strains in GenBank. In addition, the advanced structure of PEL were also predicted and analysed. This study will help to the experimental design of PEL fermentation and production purification and enzyme evolution.

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

7 CFR Exhibit B-1 to Subpart I of... - Instructions for Preparation of Evaluation Report of Self-Help Technical Assistance Grants

Code of Federal Regulations, 2011 CFR

2011-01-01

.... Insert the number of equivalent units (EU) completed the first/second/third month of the quarter using steps 1, 2, and 3 of exhibit B-3. 8. Insert the number of EU's completed the second month of the quarter by using steps 1, 2, and 3 of exhibit B-3. 9. Insert the number of EU's completed the third month of...

7 CFR Exhibit B-1 to Subpart I of... - Instructions for Preparation of Evaluation Report of Self-Help Technical Assistance Grants

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Insert the number of equivalent units (EU) completed the first/second/third month of the quarter using steps 1, 2, and 3 of exhibit B-3. 8. Insert the number of EU's completed the second month of the quarter by using steps 1, 2, and 3 of exhibit B-3. 9. Insert the number of EU's completed the third month of...

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Final incision size after cataract surgery with toric intraocular lens implantation using 2 techniques.

PubMed

Guarnieri, Adriano; Moreno-Montañés, Javier; Sabater, Alfonso L; Gosende-Chico, Inmaculada; Bonet-Farriol, Elvira

2013-11-01

To analyze the changes in incision sizes after implantation of a toric intraocular lens (IOL) using 2 methods. Department of Ophthalmology, Clínica Universidad de Navarra, Pamplona, Spain. Prospective case series. Coaxial phacoemulsification and IOL implantation through a 2.2 mm clear corneal incision using a cartridge injector were performed. Wound-assisted or cartridge-insertion techniques were used to implant the IOLs. The results were analyzed according to IOL spherical and cylindrical powers. Corneal hysteresis (CH) and the corneal resistance factor (CRF) were measured and evaluated based on the changes in incision size. Incision size increased in 30 (41.7%) of 72 eyes in the wound-assisted group and 71 (98.6%) of 72 eyes in the cartridge-insertion group. The mean incision size after IOL implantation was 2.27 mm ± 0.06 (SD) and 2.37 ± 0.05 mm, respectively (P<.01). The final incision size and IOL spherical power in the wound-assisted technique group (P=.02) and the cartridge-insertion technique group (P=.03) were correlated significantly; IOL toricity was not (P=.19 and P=.28, respectively). The CH and CRF values were not correlated with the final incision size. The final incision size and the changes in incision size after IOL implantation were greater with the cartridge-insertion technique than with the wound-assisted technique. The increase was related to IOL spherical power in both groups but not to IOL toricity. Corneal biomechanical properties were not correlated with the final incision size. Copyright © 2013 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

PubMed

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Recombining overlapping BACs into a single larger BAC.

PubMed

Kotzamanis, George; Huxley, Clare

2004-01-06

BAC clones containing entire mammalian genes including all the transcribed region and long range controlling elements are very useful for functional analysis. Sequenced BACs are available for most of the human and mouse genomes and in many cases these contain intact genes. However, large genes often span more than one BAC, and single BACs covering the entire region of interest are not available. Here we describe a system for linking two or more overlapping BACs into a single clone by homologous recombination. The method was used to link a 61-kb insert carrying the final 5 exons of the human CFTR gene onto a 160-kb BAC carrying the first 22 exons. Two rounds of homologous recombination were carried out in the EL350 strain of bacteria which can be induced for the Red genes. In the first round, the inserts of the two overlapping BACs were subcloned into modified BAC vectors using homologous recombination. In the second round, the BAC to be added was linearised with the very rare-cutting enzyme I-PpoI and electroporated into recombination efficient EL350 bacteria carrying the other BAC. Recombined BACs were identified by antibiotic selection and PCR screening and 10% of clones contained the correctly recombined 220-kb BAC. The system can be used to link the inserts from any overlapping BAC or PAC clones. The original orientation of the inserts is not important and desired regions of the inserts can be selected. The size limit for the fragments recombined may be larger than the 61 kb used here and multiple BACs in a contig could be combined by alternating use of the two pBACLink vectors. This system should be of use to many investigators wishing to carry out functional analysis on large mammalian genes which are not available in single BAC clones.

The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

PubMed Central

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

2007-01-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

Negative regulatory loci coupling flagellin synthesis to flagellar assembly in Salmonella typhimurium.

PubMed Central

Gillen, K L; Hughes, K T

1991-01-01

The complex regulation of flagellin gene expression in Salmonella typhimurium was characterized in vivo by using lac transcriptional fusions to the two flagellin structural genes (fliC [H1] and fljB [H2]). Phase variation was measured as the rate of switching of flagellin gene expression. Switching frequencies varied from 1/500 per cell per generation to 1/10,000 per cell per generation depending on the particular insertion and the direction of switching. There is a 4- to 20-fold bias in favor of switching from the fljB(On) to the fljB(Off) orientation. Random Tn10dTc insertions were isolated which failed to express flagellin. While most of these insertions mapped to loci known to be required for flagellin expression, several new loci were identified. The presence of functional copies of all of the genes responsible for complete flagellar assembly, except the hook-associated proteins (flgK, flgL, and fliD gene products), were required for expression of the fliC or fljB flagellin genes. Two novel loci involved in negative regulation of fliC and fljB in fla mutant backgrounds were identified. One of these loci, designated the flgR locus, mapped to the flg operon at 23 min on the Salmonella linkage map. An flgR insertion mutation resulted in relief of repression of the fliC and fljB genes in all fla mutant backgrounds except for mutants in the positive regulatory loci (flhC, flhD, and fliA genes). PMID:1848842

77 FR 31910 - Request for Comments of a Previously Approved Information Collection

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-30

... assist wheelchair users and other persons with limited mobility in entering and leaving a vehicle. FMVSS... certification on the owner's manual insert, the installation instructions and the lift operating instruction... insert that is placed in the vehicle owner's manual, installation instructions and one or two labels that...

Are computer numerical control (CNC)-manufactured patient-specific metal templates available for posterior thoracic pedicle screw insertion? Feasibility and accuracy evaluation.

PubMed

Kong, Xiangxue; Tang, Lei; Ye, Qiang; Huang, Wenhua; Li, Jianyi

2017-11-01

Accurate and safe posterior thoracic pedicle insertion (PTPI) remains a challenge. Patient-specific drill templates (PDTs) created by rapid prototyping (RP) can assist in posterior thoracic pedicle insertion, but pose biocompatibility risks. The aims of this study were to develop alternative PDTs with computer numerical control (CNC) and assess their feasibility and accuracy in assisting PTPI. Preoperative CT images of 31 cadaveric thoracic vertebras were obtained and then the optimal pedicle screw trajectories were planned. The PDTs with optimal screw trajectories were randomly assigned to be designed and manufactured by CNC or RP in each vertebra. With the guide of the CNC- or RP-manufactured PDTs, the appropriate screws were inserted into the pedicles. Postoperative CT scans were performed to analyze any deviations at entry point and midpoint of the pedicles. The CNC group was found to be significant manufacture-time-shortening, and cost-decreasing, when compared with the RP group (P < 0.01). The PDTs fitted the vertebral laminates well while all screws were being inserted into the pedicles. There were no significant differences in absolute deviations at entry point and midpoint of the pedicle on either axial or sagittal planes (P > 0.05). The screw positions were grade 0 in 90.3% and grade 1 in 9.7% of the cases in the CNC group and grade 0 in 93.5% and grade 1 in 6.5% of the cases in the RP group (P = 0.641). CNC-manufactured PDTs are viable for assisting in PTPI with good feasibility and accuracy.

A single gene mutation that increases maize seed weight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giroux, M.J.; Shaw, J.; Hannah, L.C.

1996-06-11

The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less

Identification of a two-component signal transduction system involved in fimbriation of Porphyromonas gingivalis.

PubMed

Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F

2000-01-01

Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.

Evaluating Risks of Insertional Mutagenesis by DNA Transposons in Gene Therapy

PubMed Central

Hackett, Perry B.; Largaespada, David A.; Switzer, Kirsten C.; Cooper, Laurence J.N.

2013-01-01

Investigational therapy can be successfully undertaken using viral- and non-viral-mediated ex vivo gene transfer. Indeed, recent clinical trials have established the potential for genetically modified T cells to improve and restore health. Recently the Sleeping Beauty (SB) transposon/transposase system has been applied in clinical trials to stably insert a chimeric antigen receptor (CAR) to redirect T-cell specificity. We discuss the context in which the SB system can be harnessed for gene therapy and describe the human application of SB-modified CAR+ T cells. We have focused on theoretical issues relating to insertional mutagenesis in the context of human genomes that are naturally subjected to remobilization of transposons and the experimental evidence over the last decade of employing SB transposons for defining genes that induce cancer. These findings are put into the context of the use of SB transposons in the treatment of human disease. PMID:23313630

The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site.

PubMed Central

Pelet, T; Curran, J; Kolakofsky, D

1991-01-01

The P gene of bovine parainfluenza virus 3 (bPIV3) contains two downstream overlapping ORFs, called V and D. By comparison with the mRNA editing sites of other paramyxoviruses, two editing sites were predicted for bPIV3; site a to express the D protein, and site b to express the V protein. Examination of the bPIV3 mRNAs, however, indicates that site b is non-functional whereas site a operates frequently. Insertions at site a give rise to both V and D protein mRNAs, because a very broad distribution of Gs is added when insertions occur. This broad distribution is very different from the editing sites of Sendai virus or SV5, where predominantly one form of edited mRNA containing either a one or two G insertion respectively is created, to access the single overlapping ORF of these viruses. A model is proposed to explain how paramyxoviruses control the range of G insertions on that fraction of the mRNAs where insertions occur. The bPIV3 P gene is unique as far as we know, in that a sizeable portion of the gene expresses all 3 reading frames as protein. bPIV3 apparently does this from a single editing site by removing the constraints which control the number of slippage rounds which take place. Images PMID:1846805

An investigation into the association between HLA-G 14 bp insertion/deletion polymorphism and multiple sclerosis susceptibility.

PubMed

Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud

2016-01-15

Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene

PubMed Central

Yang, Qing; Zhang, Sihuan; Liu, Liangliang; Cao, Xiukai; Lei, Chuzhao; Qi, Xinglei; Lin, Fengpeng; Qu, Weidong; Qi, Xingshan; Liu, Jiming; Wang, Rongmin; Chen, Hong; Lan, Xianyong

2016-01-01

ABSTRACT The detection method based on the mathematical expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle. PMID:27580010

Effects of Hematopoietic Lineage and Precursor Age on CML Disease Progression

DTIC Science & Technology

2007-03-01

ABL gene was inserted is bi-cistronic and contains the gene encoding green fluorescence protein (GFP) in addition to BCR-ABL, we were able to assess...ribosome entry site (IRES) enhanced green fluorescent protein (EGFP) or 5’ LTR-driven IRES EGFP for 24-36 hours; We received the BCR-ABL construct...from our collaborator, Dr. Owen Witte. This gene was then inserted into a murine retrovirus. We then prepared stocks of retrovirus to be used for

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Utilization of next generation sequencing for analyzing transgenic insertions in plum

USDA-ARS?s Scientific Manuscript database

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

Using Phage Display to Create Recombinant Antibodies.

PubMed

Dasch, James R; Dasch, Amy L

2017-09-01

A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.

A natural allele of Nxf1/TAP supresses retrovirus insertional mutations

PubMed Central

Floyd, Jennifer A.; Gold, David A.; Concepcion, Dorothy; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth; Chen, Dan; Ward, Erica J.; Chinn, Steven B.; Friedman, Rick A.; Yu, Hon-Tsen; Moriwaki, Kazuo; Shiroishi, Toshihiko; Hamilton, Bruce A.

2009-01-01

Endogenous retroviruses have shaped the evolution of mammalian genomes. Host genes that control the effects of retrovirus insertions are therefore of great interest. The Modifier-of-vibrator-1 locus controls level of correctly processed mRNA from genes mutated by endogenous retrovirus insertions into introns, including the pitpnvb tremor mutation and the Eya1BOR model of human branchiootorenal syndrome. Positional complementation cloning identifies Mvb1 as the nuclear export factor Nxf1, providing an unexpected link between mRNA export receptor and pre-mRNA processing. Population structure of the suppressing allele in wild M. m. castaneus suggests selective advantage. A congenic Mvb1CAST allele is a useful tool for modifying gene expression from existing mutations and could be used to manipulate engineered mutations containing retroviral elements. PMID:14517553

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

An EAV-HP Insertion in 5′ Flanking Region of SLCO1B3 Causes Blue Eggshell in the Chicken

PubMed Central

Yang, Xiaolin; Li, Guangqi; Zhang, Yuanyuan; Li, Junying; Wang, Xiaotong; Bai, Jirong; Xu, Guiyun; Deng, Xuemei; Yang, Ning; Wu, Changxin

2013-01-01

The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland) of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N). SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP) family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5′ flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary example at the molecular level. PMID:23359636

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers.

PubMed

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-12-01

The ornamental peach cultivar 'Hongbaihuatao (HBH)' can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene-regulator involved in anthocyanin transport (Riant)-which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Dictyostelium mobile elements: strategies to amplify in a compact genome.

PubMed

Winckler, T; Dingermann, T; Glöckner, G

2002-12-01

Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.

Patient burden and patient preference: comparing magnetic resonance enteroclysis, capsule endoscopy and balloon-assisted enteroscopy.

PubMed

Wiarda, Bart M; Stolk, Mark; Heine, Dimitri G N; Mensink, Peter; Thieme, Mai E; Kuipers, Ernst J; Stoker, Jaap

2013-03-01

We aimed to prospectively determine patient burden and patient preference for magnetic resonance enteroclysis, capsule endoscopy and balloon-assisted enteroscopy in patients with suspected or known Crohn's disease (CD) or occult gastrointestinal bleeding (OGIB).  Consecutive consenting patients with CD or OGIB underwent magnetic resonance enteroclysis, capsule endoscopy and balloon-assisted enteroscopy. Capsule endoscopy was only performed if magnetic resonance enteroclysis showed no high-grade small bowel stenosis. Patient preference and burden was evaluated by means of standardized questionnaires at five moments in time. From January 2007 until March 2009, 76 patients were included (M/F 31/45; mean age 46.9 years; range 20.0-78.4 years): 38 patients with OGIB and 38 with suspected or known CD. Seventeen patients did not undergo capsule endoscopy because of high-grade stenosis. Ninety-five percent (344/363) of the questionnaires were suitable for evaluation. Capsule endoscopy was significantly favored over magnetic resonance enteroclysis and balloon-assisted enteroscopy with respect to bowel preparation, swallowing of the capsule (compared to insertion of the tube/scope), burden of the entire examination, duration and accordance with the pre-study information. Capsule endoscopy and magnetic resonance enteroclysis were significantly preferred over balloon-assisted enteroscopy for clarity of explanation of the examination, and magnetic resonance enteroclysis was significantly preferred over balloon-assisted enteroscopy for bowel preparation, painfulness and burden of the entire examination. Balloon-assisted enteroscopy was significantly favored over magnetic resonance enteroclysis for insertion of the scope and procedure duration. Pre- and post-study the order of preference was capsule endoscopy, magnetic resonance enteroclysis and balloon-assisted enteroscopy. Capsule endoscopy was preferred to magnetic resonance enteroclysis and balloon-assisted enteroscopy; it also had the lowest burden. Magnetic resonance enteroclysis was preferred over balloon-assisted enteroscopy for clarity of explanation of the examination, bowel preparation, painfulness and burden of the entire examination, and balloon-assisted enteroscopy over magnetic resonance enteroclysis for scope insertion and study duration. © 2012 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

Improving Robotic Operator Performance Using Augmented Reality

NASA Technical Reports Server (NTRS)

Maida, James C.; Bowen, Charles K.; Pace, John W.

2007-01-01

The Special Purpose Dexterous Manipulator (SPDM) is a two-armed robot that functions as an extension to the end effector of the Space Station Robotics Manipulator System (SSRMS), currently in use on the International Space Station (ISS). Crew training for the SPDM is accomplished using a robotic hardware simulator, which performs most of SPDM functions under normal static Earth gravitational forces. Both the simulator and SPDM are controlled from a standard robotic workstation using a laptop for the user interface and three monitors for camera views. Most operations anticipated for the SPDM involve the manipulation, insertion, and removal of any of several types of Orbital Replaceable Unit (ORU), modules which control various ISS functions. Alignment tolerances for insertion of the ORU into its receptacle are 0.25 inch and 0.5 degree from nominal values. The pre-insertion alignment task must be performed within these tolerances by using available video camera views of the intrinsic features of the ORU and receptacle, without special registration markings. Since optimum camera views may not be available, and dynamic orbital lighting conditions may limit periods of viewing, a successful ORU insertion operation may require an extended period of time. This study explored the feasibility of using augmented reality (AR) to assist SPDM operations. Geometric graphical symbols were overlaid on one of the workstation monitors to afford cues to assist the operator in attaining adequate pre-insertion ORU alignment. Twelve skilled subjects performed eight ORU insertion tasks using the simulator with and without the AR symbols in a repeated measures experimental design. Results indicated that using the AR symbols reduced pre-insertion alignment error for all subjects and reduced the time to complete pre-insertion alignment for most subjects.

Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes.

PubMed

Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi

2017-04-07

The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.

PubMed

Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-06-01

Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.

Unusual Properties of Regulatory DNA from the Drosophila Engrailed Gene: Three ``pairing-Sensitive'' Sites within a 1.6-Kb Region

PubMed Central

Kassis, J. A.

1994-01-01

We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412

Gene conversion as a mechanism for divergence of a chloroplast tRNA gene inserted in the mitochondrial genome of Brassica oleracea.

PubMed Central

Dron, M; Hartmann, C; Rode, A; Sevignac, M

1985-01-01

We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

A Look to Future Directions in Gene Therapy Research for Monogenic Diseases

PubMed Central

Porteus, Matthew H; Connelly, Jon P; Pruett, Shondra M

2006-01-01

The concept of gene therapy has long appealed to biomedical researchers and clinicians because it promised to treat certain diseases at their origins. In the last several years, there have been several trials in which patients have benefited from gene therapy protocols. This progress, however, has revealed important problems, including the problem of insertional oncogenesis. In this review, which focuses on monogenic diseases, we discuss the problem of insertional oncogenesis and identify areas for future research, such as developing more quantitative assays for risk and efficacy, and ways of minimizing the genotoxic effects of gene therapy protocols, which will be important if gene therapy is to fulfill its conceptual promise. PMID:17009872

Identification of the novel lincosamide resistance gene lnu(E) truncated by ISEnfa5-cfr-ISEnfa5 insertion in Streptococcus suis: de novo synthesis and confirmation of functional activity in Staphylococcus aureus.

PubMed

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong; Schwarz, Stefan; Wang, Yang

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin.

Identification of the Novel Lincosamide Resistance Gene lnu(E) Truncated by ISEnfa5-cfr-ISEnfa5 Insertion in Streptococcus suis: De Novo Synthesis and Confirmation of Functional Activity in Staphylococcus aureus

PubMed Central

Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong

2014-01-01

The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin. PMID:24366733

Pedicle Screw Insertion Accuracy Using O-Arm, Robotic Guidance, or Freehand Technique: A Comparative Study.

PubMed

Laudato, Pietro Aniello; Pierzchala, Katarzyna; Schizas, Constantin

2018-03-15

A retrospective radiological study. The aim of this study was to evaluate the accuracy of pedicle screw insertion using O-Arm navigation, robotic assistance, or a freehand fluoroscopic technique. Pedicle screw insertion using either "O-Arm" navigation or robotic devices is gaining popularity. Although several studies are available evaluating each of those techniques separately, no direct comparison has been attempted. Eighty-four patients undergoing implantation of 569 lumbar and thoracic screws were divided into three groups. Eleven patients (64 screws) had screws inserted using robotic assistance, 25 patients (191 screws) using the O-arm, while 48 patients (314 screws) had screws inserted using lateral fluoroscopy in a freehand technique. A single experienced spine surgeon assisted by a spinal fellow performed all procedures. Screw placement accuracy was assessed by two independent observers on postoperative computed tomography (CTs) according to the A to D Rampersaud criteria. No statistically significant difference was noted between the three groups. About 70.4% of screws in the freehand group, 69.6% in the O arm group, and 78.8% in the robotic group were placed completely within the pedicle margins (grade A) (P > 0.05). About 6.4% of screws were considered misplaced (grades C&D) in the freehand group, 4.2% in the O-arm group, and 4.7% in the robotic group (P > 0.05). The spinal fellow inserted screws with the same accuracy as the senior surgeon (P > 0.05). The advent of new technologies does not appear to alter accuracy of screw placement in our setting. Under supervision, spinal fellows might perform equally well to experienced surgeons using new tools. The lack of difference in accuracy does not imply that the above-mentioned techniques have no added advantages. Other issues, such as surgeon/patient radiation, fiddle factor, teaching suitability, etc., outside the scope of our present study, need further assessment. 3.

Analysis of the K1 capsule biosynthesis genes of Escherichia coli: definition of three functional regions for capsule production.

PubMed

Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N

1987-06-01

Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

A novel method for percutaneous insertion of a right ventricular assist device.

PubMed

Avgerinos, Dimitrios V; DeBois, William; Mongero, Linda; Krieger, Karl; Salemi, Arash

2013-06-01

Right heart failure is a rare but often fatal complication both in the pre- and postoperative setting. Right heart support with a ventricular assist device inserted in the operating room through median sternotomy can be a time-consuming procedure that requires a reoperation for removal. In cases of urgent need of right heart support, a percutaneous technique option may be of benefit. We present our initial experience with a percutaneously inserted right ventricular assist device (RVAD) in an elderly patient with severe right heart failure. An 81-year-old female patient underwent combined aortic and mitral valve replacement at our institution. During the first postoperative evening, the patient sustained sudden cardiovascular collapse and a bedside transesophageal echocardiogram revealed severe right heart failure. A coronary angiogram showed thrombosis of the right coronary artery, which was cleared with a suction device. As a result of the patient's critical condition, it was decided that an RVAD was needed as a bridge to recovery. The patient's condition improved significantly almost immediately. Her right heart function recovered over the next few days and the RVAD was removed at the bedside. She made a complete recovery and was discharged home. This patient is a prime example that a totally RVAD can be inserted in urgent situations easily and safely under fluoroscopic and echocardiographic guidance. More clinical experience with percutaneous RVADs is required to establish this technique as an alternative equivalent to the traditional open method. Right heart failure complicates many heart diseases both in the pre- and the postoperative setting. In cases of urgent need of right heart support, a percutaneous technique of a RVAD is needed for a successful outcome. We present our initial experience with a percutaneously inserted RVAD in an elderly patient with severe postoperative right heart failure.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Structure and expression of the attacin genes in Hyalophora cecropia.

PubMed

Sun, S C; Lindström, I; Lee, J Y; Faye, I

1991-02-26

To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.

[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].

PubMed

Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong

2003-12-01

To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.

Dissection of Insertion–Deletion Variants within Differentially Expressed Genes Involved in Wood Formation in Populus

PubMed Central

Gong, Chenrui; Du, Qingzhang; Xie, Jianbo; Quan, Mingyang; Chen, Beibei; Zhang, Deqiang

2018-01-01

Short insertions and deletions (InDels) are one of the major genetic variants and are distributed widely across the genome; however, few investigations of InDels have been conducted in long-lived perennial plants. Here, we employed a combination of RNA-seq and population resequencing to identify InDels within differentially expressed (DE) genes underlying wood formation in a natural population of Populus tomentosa (435 individuals) and utilized InDel-based association mapping to detect the causal variants under additive, dominance, and epistasis underlying growth and wood properties. In the present paper, 5,482 InDels detected from 629 DE genes showed uneven distributions throughout all 19 chromosomes, and 95.9% of these loci were diallelic InDels. Seventy-four InDels (positive false discovery rate q ≤ 0.10) from 68 genes exhibited significant additive/dominant effects on 10 growth and wood-properties, with an average of 14.7% phenotypic variance explained. Potential pleiotropy was observed in one-third of the InDels (representing 24 genes). Seven genes exhibited significantly differential expression among the genotypic classes of associated InDels, indicating possible important roles for these InDels. Epistasis analysis showed that overlapping interacting genes formed unique interconnected networks for each trait, supporting the putative biochemical links that control quantitative traits. Therefore, the identification and utilization of InDels in trees will be recognized as an effective marker system for molecular marker-assisted breeding applications, and further facilitate our understanding of quantitative genomics. PMID:29403506

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

PubMed

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Construction of Signature-tagged Mutant Library in Mesorhizobium loti as a Powerful Tool for Functional Genomics

PubMed Central

Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei

2008-01-01

Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183

The use of endoillumination probe-assisted Descemet membrane endothelial keratoplasty for bullous keratopathy secondary to argon laser iridotomy

PubMed Central

Kobayashi, Akira; Yokogawa, Hideaki; Yamazaki, Natsuko; Masaki, Toshinori; Sugiyama, Kazuhisa

2015-01-01

Purpose To report the first case of Descemet membrane endothelial keratoplasty (DMEK) for bullous keratopathy (BK) secondary to argon laser iridotomy (ALI). Patient A 71-year-old woman presented with decreased visual acuity in her right eye due to BK secondary to ALI that was performed 10 years prior. Results Phacosurgery was performed first, followed by successful DMEK 4 months later. A DMEK shooter was used for donor insertion, which allowed for a stable anterior chamber during donor insertion, even when the anterior chamber was quite shallow. Also, removal of edematous epithelial cells and endoillumination probe-assisted DMEK was quite useful to visualize DMEK graft on the background of the dark brown iris seen in Asian eyes. The patient’s best corrected visual acuity rapidly increased from 20/200 to 25/20 after 1 month, with complete resolution of corneal edema. Conclusion We reported the first successful DMEK case for BK secondary to ALI. The use of a DMEK shooter for donor insertion and endoillumination assistance to visualize the DMEK graft was a useful technique for BK secondary to ALI. PMID:25609910

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

[Mutants of bacterium Azospirillum brasilense Sp245 with Omegon insertion in mmsB or fabG genes of lipid metabolism are defective in motility and flagellation].

PubMed

Kovtunov, E A; Shelud'ko, A V; Chernyshova, M P; Petrova, L P; Katsy, E I

2013-11-01

Bacteria Azospirillum brasilense have mixed flagellation: in addition to the polar flagellum, numerous lateral flagella are formed in their cells on medium with increased density. Flagella determine the active swimming and swarming capacities of azospirilla. Using A. brasilense Sp245 as an example, we showed that the Omegon-Km artificial transposon insertion into the chromosomal gene for 3-hydroxyisobutyrate dehydrogenase (mmsB) was concurrent with the appearance of significant defects in the formation of polar flagella and with the paralysis of lateral flagella. The Sp245 mutant with the Omegon insertion into the plasmid AZOBR_p1-borne gene for 3-oxoacyl-[acyl-carrier protein]-reductase (fabG) showed the complete loss of flagella and the swarming capacity, as well as significant defects in polar flagellar assembly (though some cells are still motile in liquid medium). The viability of the A. brasilense Sp245 mutants with the Omegon insertion into the mmsB or fabG gene was not reduced. No considerable differences in the fatty acid composition of whole cell lipid extracts were found for the A. brasilense Sp245 strain and its mmsB and fabG mutants.

Construction and characterization of a recombinant invertebrate iridovirus.

PubMed

Ozgen, Arzu; Muratoglu, Hacer; Demirbag, Zihni; Vlak, Just M; van Oers, Monique M; Nalcacioglu, Remziye

2014-08-30

Chilo iridescent virus (CIV), officially named Insect iridescent virus 6 (IIV6), is the type species of the genus Iridovirus (family Iridoviridae). In this paper we constructed a recombinant CIV, encoding the green fluorescent protein (GFP). This recombinant can be used to investigate viral replication dynamics. We showed that homologous recombination is a valid method to make CIV gene knockouts and to insert foreign genes. The CIV 157L gene, putatively encoding a non-functional inhibitor of apoptosis (IAP), was chosen as target for foreign gene insertion. The gfp open reading frame preceded by the viral mcp promoter was inserted into the 157L locus by homologous recombination in Anthonomus grandis BRL-AG-3A cells. Recombinant virus (rCIV-Δ157L-gfp) was purified by successive rounds of plaque purification. All plaques produced by the purified recombinant virus emitted green fluorescence due to the presence of GFP. One-step growth curves for recombinant and wild-type CIV were similar and the recombinant was fully infectious in vivo. Hence, CIV157L can be inactivated without altering the replication kinetics of the virus. Consequently, the CIV 157L locus can be used as a site for insertion of foreign DNA, e.g. to modify viral properties for insect biocontrol. Copyright © 2014 Elsevier B.V. All rights reserved.

A RecET-assisted CRISPR-Cas9 genome editing in Corynebacterium glutamicum.

PubMed

Wang, Bo; Hu, Qitiao; Zhang, Yu; Shi, Ruilin; Chai, Xin; Liu, Zhe; Shang, Xiuling; Zhang, Yun; Wen, Tingyi

2018-04-23

Extensive modification of genome is an efficient manner to regulate the metabolic network for producing target metabolites or non-native products using Corynebacterium glutamicum as a cell factory. Genome editing approaches by means of homologous recombination and counter-selection markers are laborious and time consuming due to multiple round manipulations and low editing efficiencies. The current two-plasmid-based CRISPR-Cas9 editing methods generate false positives due to the potential instability of Cas9 on the plasmid, and require a high transformation efficiency for co-occurrence of two plasmids transformation. Here, we developed a RecET-assisted CRISPR-Cas9 genome editing method using a chromosome-borne Cas9-RecET and a single plasmid harboring sgRNA and repair templates. The inducible expression of chromosomal RecET promoted the frequencies of homologous recombination, and increased the efficiency for gene deletion. Due to the high transformation efficiency of a single plasmid, this method enabled 10- and 20-kb region deletion, 2.5-, 5.7- and 7.5-kb expression cassette insertion and precise site-specific mutation, suggesting a versatility of this method. Deletion of argR and farR regulators as well as site-directed mutation of argB and pgi genes generated the mutant capable of accumulating L-arginine, indicating the stability of chromosome-borne Cas9 for iterative genome editing. Using this method, the model-predicted target genes were modified to redirect metabolic flux towards 1,2-propanediol biosynthetic pathway. The final engineered strain produced 6.75 ± 0.46 g/L of 1,2-propanediol that is the highest titer reported in C. glutamicum. Furthermore, this method is available for Corynebacterium pekinense 1.563, suggesting its universal applicability in other Corynebacterium species. The RecET-assisted CRISPR-Cas9 genome editing method will facilitate engineering of metabolic networks for the synthesis of interested bio-based products from renewable biomass using Corynebacterium species as cell factories.

[Analysis of Alu-insertion polymorphism in three subethnic groups of Kalmyks].

PubMed

Khusainova, R I; Balinova, N V; Kutuev, I A; Spitsina, N Kh; Akhmetova, V L; Valiev, R R; Spitsyn, V A; Khusnutdinova, E K

2009-03-01

Eight Alu insertions at the NBC27, TPA25, NBC148, NBC123, ACE, APOA1, NBC51, and PV92 locus were examined in three subethnic groups of Kalmyks (Torgouds, Derbets, and Buzava). In general, the pattern of allele frequencies in Kalmyks was consistent with that in Asian populations of the world, and was similar to the Alu insertion frequencies pattern in Turkic populations of the Volga--Ural region and Central Asia. Pairwise comparisons of three subpopulations of Kalmyks with respect to the frequency distributions of eight Alu insertions revealed the differences between the groups examined. The coefficient of gene differentiation, F(st), constituted 1.37%, pointing to the common origin of the groups of interest, as well as to the uniformity of the gene pools of subethnic groups of Kalmyks examined.

Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

PubMed Central

Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

1995-01-01

A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

PubMed Central

Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

2015-01-01

ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

PubMed

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster

PubMed Central

Lin, Chun-Chieh; Potter, Christopher J.

2016-01-01

Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272

Identification of Novel Virulence Determinants in Mycobacterium paratuberculosis by Screening a Library of Insertional Mutants†

PubMed Central

Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.

2006-01-01

Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754

A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers

PubMed Central

Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng

2015-01-01

The ornamental peach cultivar ‘Hongbaihuatao (HBH)’ can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene—regulator involved in anthocyanin transport (Riant)—which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. PMID:26357885

Disease resistance breeding in rose: current status and potential of biotechnological tools.

PubMed

Debener, Thomas; Byrne, David H

2014-11-01

The cultivated rose is a multispecies complex for which a high level of disease protection is needed due to the low tolerance of blemishes in ornamental plants. The most important fungal diseases are black spot, powdery mildew, botrytis and downy mildew. Rose rosette, a lethal viral pathogen, is emerging as a devastating disease in North America. Currently rose breeders use a recurrent phenotypic selection approach and perform selection for disease resistance for most pathogen issues in a 2-3 year field trial. Marker assisted selection could accelerate this breeding process. Thus far markers have been identified for resistance to black spot (Rdrs) and powdery mildew and with the ability of genotyping by sequencing to generate 1000s of markers our ability to identify markers useful in plant improvement should increase exponentially. Transgenic rose lines with various fungal resistance genes inserted have shown limited success and RNAi technology has potential to provide virus resistance. Roses, as do other plants, have sequences homologous to characterized R-genes in their genomes, some which have been related to specific disease resistance. With improving next generation sequencing technology, our ability to do genomic and transcriptomic studies of the resistance related genes in both the rose and the pathogens to reveal novel gene targets to develop resistant roses will accelerate. Finally, the development of designer nucleases opens up a potentially non-GMO approach to directly modify a rose's DNA to create a disease resistant rose. Although there is much potential, at present rose breeders are not using marker assisted breeding primarily because a good suite of marker/trait associations (MTA) that would ensure a path to stable disease resistance is not available. As our genomic analytical tools improve, so will our ability to identify useful genes and linked markers. Once these MTAs are available, it will be the cost savings, both in time and money, that will convince the breeders to use the technology. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A Trimeric Lipoprotein Assists in Trimeric Autotransporter Biogenesis in Enterobacteria*

PubMed Central

Grin, Iwan; Hartmann, Marcus D.; Sauer, Guido; Hernandez Alvarez, Birte; Schütz, Monika; Wagner, Samuel; Madlung, Johannes; Macek, Boris; Felipe-Lopez, Alfonso; Hensel, Michael; Lupas, Andrei; Linke, Dirk

2014-01-01

Trimeric autotransporter adhesins (TAAs) are important virulence factors of many Gram-negative bacterial pathogens. TAAs form fibrous, adhesive structures on the bacterial cell surface. Their N-terminal extracellular domains are exported through a C-terminal membrane pore; the insertion of the pore domain into the bacterial outer membrane follows the rules of β-barrel transmembrane protein biogenesis and is dependent on the essential Bam complex. We have recently described the full fiber structure of SadA, a TAA of unknown function in Salmonella and other enterobacteria. In this work, we describe the structure and function of SadB, a small inner membrane lipoprotein. The sadB gene is located in an operon with sadA; orthologous operons are only found in enterobacteria, whereas other TAAs are not typically associated with lipoproteins. Strikingly, SadB is also a trimer, and its co-expression with SadA has a direct influence on SadA structural integrity. This is the first report of a specific export factor of a TAA, suggesting that at least in some cases TAA autotransport is assisted by additional periplasmic proteins. PMID:24369174

Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

PubMed Central

Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

2016-01-01

Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

PubMed

Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

2016-10-25

Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

DoD Civilian Drug Abuse Testing Program

DTIC Science & Technology

1988-08-23

employee assistance programs ( EAPs ). DoD Components must obtain approval of the ASD(HA) for specimen collection and laboratory testing... Employee . A DoD employee paid from appropriated funds. 2. Employee Assistance Programs ( EAPs ). DoD Component-based counseling programs that offer...Renumber Ś." to ř." Subparagraph E.5.a.(2), line 1. After "(2)" insert " Employee Assistance Programs " and enclose "

Prospective short-term feasibility study of perioperative suprapubic catheters in laparoscopic colectomy.

PubMed

Nagao, Sayaka; Saida, Yoshihisa; Enomoto, Toshiyuki; Takahashi, Asako; Higuchi, Tadashi; Moriyama, Hodaka; Niituma, Toru; Watanabe, Manabu; Asai, Koji; Kusachi, Shinya

2018-05-16

Here we report a prospective study on whether a temporary suprapubic catheter (SPC) can be safely inserted as a substitute for transurethral balloon catheterization during laparoscopy-assisted colectomy. Our subjects included 52 cases who gave informed consent to have an SPC inserted. These subjects were selected from cases who underwent laparoscopy-assisted surgery for primary colorectal cancer from October 2014 to August 2015. An SPC was inserted into 45 of the original 52 cases. The median surgical duration was 220 min (range, 11-438 min), and the SPC insertion was performed at a median of 133 min (range, 9-384 min) after the start of surgery. Insertion required a median duration of 116 s. In one case (2.2%), the bladder was perforated by the paracentesis needle, and in two cases (4.4%), hematuria was observed at the time of insertion; however, surgery was completed without any incident in these three cases. Six of the remaining 42 cases (13.3%) demonstrated neither micturition desire nor independent urination on the day the catheter was clamped. In these cases, the clamp was released two to four times, and draining of an average of 586-mL urine, micturition desire, and independent urination were confirmed 2-4 days later. Transurethral balloon catheterization is a simple procedure that is commonly used on surgical patients, but it can cause pain, discomfort, and infection. In contrast, SPC insertion is a procedure that avoids crossing the urethra and its associated disadvantages. Here we were able to demonstrate that the procedure can be safely used in laparoscopic surgery patients. © 2018 Japan Society for Endoscopic Surgery, Asia Endosurgery Task Force and John Wiley & Sons Australia, Ltd.

Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omel`yanchuk, L.V.

1995-12-01

A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

The pht4;1-3 mutant line contains a loss of function allele in the Fatty Acid Desaturase 7 gene caused by a remnant inactivated selection marker-a cautionary tale.

PubMed

Nilsson, Anders K; Andersson, Mats X

2017-01-01

A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.

Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

PubMed Central

Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541

Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

PubMed

Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

2004-04-01

The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

DOE final report 100608.doc

DOE Office of Scientific and Technical Information (OSTI.GOV)

Golden, Susan S

2008-10-16

The aim of this project was to inactivate each locus of the genome of the cyanobacterium Synechococcus elongatus PCC 7942 and screen resulting mutants for altered circadian phenotypes. The immediate goal was to identify all open reading frames (ORFs) that contribute to circadian timing. An additional result was to create a complete archived set of mutagenesis templates, of great utility for the wider research community, that will allow inactivation of any given locus in the genome of S. elongatus. Clones that carry segments of the S. elongatus genome were saturated with transposon insertions in vitro. We completed saturation mutagenesis ofmore » the chromosome (~2800 ORFs). The positions of insertions were sequenced for 17,767 mutagenized clones. Each individual insertion into the S. elongatus DNA in a cosmid or plasmid is a substrate for mutagenesis of the genome via homologous recombination. Because the complete insertion mutation clone set is 5-7 fold redundant, we produced a streamlined set of clones that contains one insertion mutation per locus in the genome, a unigene set. All clones are archived as Escherichia coli stocks frozen in glycerol in 96-well plates at -85ºC and as replicas of these plates on Whatman CloneSaver cards. Each of the mutagenesis substrates from the unigene set has been recombined into the chromosome of wild-type S. elongatus and these cyanobacterial mutants have been archived at -85ºC as well. S. elongatus insertion mutants defective for than 1400 independent genes have screened in luciferase reporter gene backgrounds to evaluate the effect of each mutation on circadian rhythms of gene expression. For the first 700 genes tested, mutagenesis of 71 different ORFs resulted in circadian phenotypes. The mutagenesis project also created insertion mutations in the endogenous large plasmid of S. elongatus, pANL. The sequence of pANL revealed two potential addiction cassettes that appear to account for selection for plasmid persistence. Genetic experiments confirmed that these regions are present on all sub-sets of the plasmid that can replace wild-type pANL. Analysis of mutants defective in each of the remaining ~1400 genes for defects in circadian rhythms will be completed with support from another agency as part of a larger project on circadian rhythms in this cyanobacterium.« less

Coaxial needle insertion assistant with enhanced force feedback.

PubMed

De Lorenzo, Danilo; Koseki, Yoshihiko; De Momi, Elena; Chinzei, Kiyoyuki; Okamura, Allison M

2013-02-01

Many medical procedures involving needle insertion into soft tissues, such as anesthesia, biopsy, brachytherapy, and placement of electrodes, are performed without image guidance. In such procedures, haptic detection of changing tissue properties at different depths during needle insertion is important for needle localization and detection of subsurface structures. However, changes in tissue mechanical properties deep inside the tissue are difficult for human operators to sense, because the relatively large friction force between the needle shaft and the surrounding tissue masks the smaller tip forces. A novel robotic coaxial needle insertion assistant, which enhances operator force perception, is presented. This one-degree-of-freedom cable-driven robot provides to the operator a scaled version of the force applied by the needle tip to the tissue, using a novel design and sensors that separate the needle tip force from the shaft friction force. The ability of human operators to use the robot to detect membranes embedded in artificial soft tissue was tested under the conditions of 1) tip force and shaft force feedback, and 2) tip force only feedback. The ratio of successful to unsuccessful membrane detections was significantly higher (up to 50%) when only the needle tip force was provided to the user.

Clostridium perfringens type A–E toxin plasmids

PubMed Central

Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

2014-01-01

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

Master-slave robotic system for needle indentation and insertion.

PubMed

Shin, Jaehyun; Zhong, Yongmin; Gu, Chengfan

2017-12-01

Bilateral control of a master-slave robotic system is a challenging issue in robotic-assisted minimally invasive surgery. It requires the knowledge on contact interaction between a surgical (slave) robot and soft tissues. This paper presents a master-slave robotic system for needle indentation and insertion. This master-slave robotic system is able to characterize the contact interaction between the robotic needle and soft tissues. A bilateral controller is implemented using a linear motor for robotic needle indentation and insertion. A new nonlinear state observer is developed to online monitor the contact interaction with soft tissues. Experimental results demonstrate the efficacy of the proposed master-slave robotic system for robotic needle indentation and needle insertion.

A virus vector based on Canine Herpesvirus for vaccine applications in canids.

PubMed

Strive, T; Hardy, C M; Wright, J; Reubel, G H

2007-01-31

Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions

PubMed Central

Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.

1992-01-01

The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389

[Gross characteristics of placentas from an assisted reproduction program].

PubMed

Tabs, Dunja; Vejnović, Tihomir; Lalosević, Dusan; Radunović, Nebojsa

2006-01-01

Even though placentas from assisted reproduction programs often differ from placentas of women who conceived naturally, they are rarely examined. The aim of our investigation was to determine some gross characteristics of placentas of women who conceived with assisted reproduction. We examined 30 placentas from an assisted reproduction program (20 from in vitro fertilization and 10 from intrauterine insemination) and 30 placentas of women who conceived naturally. All women were age matched. All the women were at term. The mean weight of placentas from assisted reproduction program was 573 g and of those after natural conception--582.67g. The mean length of the umbilical cords was 64.3cm after assisted reproduction and 66.3cm after natural conception. The mean placenta thickness after assisted reproduction was 2,22 cm and after natural conception 2.28 cm. Eight placentas of the study group had a marginal insertion of the umbilical cord, which lead to a statistically significant difference when compared to placentas of women who conceived naturally: chi-square = 7.07; p>0.01. Marginal cord insertion into the placenta after assisted reproduction is also often described in the literature (as a possible "consequence" of embryo-transfer). There were no statistically significant differences in the mean weight and dimensions of placentas, length of the umbilical cord, gross pathological features of placentas and cords, mean birth weight of babies and placental/fetal ratios between women from assisted reproduction program and those who conceived naturally.

Problems associated with gene transfer and opportunities for microgravity environments

NASA Astrophysics Data System (ADS)

Tennessen, Daniel J.

1997-01-01

The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.

Comparison of static and dynamic computer-assisted guidance methods in implantology.

PubMed

Mischkowski, R A; Zinser, M J; Neugebauer, J; Kübler, A C; Zöller, J E

2006-01-01

The planning of dental implant position and its transfer to the operation site can be considered as one of the most important factors for the long-term success of implant-supported prosthetic and epithetic restorations. This study compares computer-assisted fabricated surgical templates as the static method with intro-operative image guided navigation as the dynamic method for transfer of three-dimensional pre-operative planning. For the static method, the systems Med3D, coDiagnostix/ gonyX, and SimPlant were used. For the dynamic method, the systems RoboDent und VectorVision2 were applied. A total of 746 implants were inserted between August 1999 and December 2005 in 206 patients. The static approach was used most frequently, accounting for 611 fixtures in 168 patients. The failure ratios within the first 6 months were 1.31% in the statically controlled insertion group compared to 2.96% in the dynamically controlled insertion group. Complications related to an incorrect position of the implants have not been observed so far in either group. All computer-assisted methods included in this study were successfully applied in a clinical setting after a certain start-up period. The indications for application of computer-assisted methods in implantology are currently given in difficult anatomical situations. Due to uncomplicated handling and low resource demands, the static template technique can be recommended as the method of choice for the majority of all cases falling into this category.

Application of plantar pressure assessment in footwear and insert design.

PubMed

Mueller, M J

1999-12-01

This clinical perspective describes the application of plantar pressure assessment in footwear and insert design. First, the rationale and evidence for using pressure assessment to assist in the design of footwear for patients with diabetes is described. I discuss 2 important measures obtained from pressure assessment: peak pressure, because it represents the magnitude of potential mechanical stresses that can contribute to skin breakdown, and contact area, because this identifies the treatment areas. Using measures obtained from pressure assessment, guidelines are presented to maximize contact area of the insert to the foot and reduce highest peak pressures on the skin, with the goal of preventing skin breakdown. Second, a rationale and guidelines are presented for the application of plantar pressure assessment in the evaluation and design of footwear for people without impairments (i.e., the general public). Finally, future applications of pressure assessment to improve the design and fit of shoes are discussed. Benefits and limitations of using pressure assessment to assist in footwear design are addressed throughout.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

PubMed

Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

2015-06-01

Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

Evolutionary genomics: transdomain gene transfers.

PubMed

Bordenstein, Seth R

2007-11-06

Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum.

PubMed

McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W

2018-04-01

Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum

PubMed Central

McCarthy, Alex J.

2018-01-01

ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415

[Sniffing Position and i-gel Rotation Approach for i-gel Insertion under General Anesthesia].

PubMed

Takahashi, Yoshihiro; Murashima, Koji; Kayashima, Kenji

2016-04-01

Insertion assistance techniques, such as the sniffing position (SP) and i-gel? rotation approach (RA), are recommended in the i-gel supraglottic airway device insertion manual. The usefulness of these techniques was evaluated, in this study, under general anesthesia. In 50 adult patients, the i-gel was inserted with the patient in the mild-SP with 5 degrees head extention at first attempt. When resistance was encountered during insertion or airway patency was not obtained after insertion, the i-gel was re-inserted with the patient in the full-SP with maximum head extention during second attempt. When re-insertion failed, the i-gel was inserted with the patient in the full-SP and by using the i-gel RA during third attempt. Airway patency was established in the mild-SP in 36 of 50 patients, in the full-SP in 11 of the remaining 14, and in the full-SP with the i-gel RA in the remaining 3. The average insertion time was 24.0 s during the first attempt, 22.2 s during the second, and 18.2 s during the third. No major complications were observed. Both the full-SP and the i-gel RA can be used for i-gel insertion.

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, Sanae; Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka; Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader andmore » the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.« less

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

PubMed

Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

2017-09-11

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Comparison of Insertional RNA Editing in Myxomycetes

PubMed Central

Chen, Cai; Frankhouser, David; Bundschuh, Ralf

2012-01-01

RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871

A Genetic Screen for Pathogenicity Genes in the Hemibiotrophic Fungus Colletotrichum higginsianum Identifies the Plasma Membrane Proton Pump Pma2 Required for Host Penetration

PubMed Central

Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian

2015-01-01

We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547

Greater Utilization of Dental Technicians, II. Report of Clinical Tests.

ERIC Educational Resources Information Center

Ludwick, William E.; And Others

Following specialized training in which naval dental assistants were taught to insert restorations in cavities prepared by dental officers, clinical tests were applied to determine how much more a dental officer can accomplish when he delegates certain procedures to specially trained assistants, to evaluate the quality of the restorations, and to…

Accuracy analysis of pedicle screw placement in posterior scoliosis surgery: comparison between conventional fluoroscopic and computer-assisted technique.

PubMed

Kotani, Yoshihisa; Abumi, Kuniyoshi; Ito, Manabu; Takahata, Masahiko; Sudo, Hideki; Ohshima, Shigeki; Minami, Akio

2007-06-15

The accuracy of pedicle screw placement was evaluated in posterior scoliosis surgeries with or without the use of computer-assisted surgical techniques. In this retrospective cohort study, the pedicle screw placement accuracy in posterior scoliosis surgery was compared between conventional fluoroscopic and computer-assisted surgical techniques. There has been no study systemically analyzing the perforation pattern and comparative accuracy of pedicle screw placement in posterior scoliosis surgery. The 45 patients who received posterior correction surgeries were divided into 2 groups: Group C, manual control (25 patients); and Group N, navigation surgery (20 patients). The average Cobb angles were 73.7 degrees and 73.1 degrees before surgery in Group C and Group N, respectively. Using CT images, vertebral rotation, pedicle axes as measured to anteroposterior sacral axis and vertebral axis, and insertion angle error were measured. In perforation cases, the angular tendency, insertion point, and length abnormality were evaluated. The perforation was observed in 11% of Group C and 1.8% in Group N. In Group C, medial perforations of left screws were demonstrated in 8 of 9 perforated screws and 55% were distributed either in L1 or T12. The perforation consistently occurred in pedicles in which those axes approached anteroposterior sacral axis within 5 degrees . The average insertion errors were 8.4 degrees and 5.0 degrees in Group C and Group N, respectively, which were significantly different (P < 0.02). The medial perforation in Group C occurred around L1, especially when pedicle axis approached anteroposterior sacral axis. This consistent tendency was considered as the limitation of fluoroscopic screw insertion in which horizontal vertebral image was not visible. The use of surgical navigation system successfully reduced the perforation rate and insertion angle errors, demonstrating the clear advantage in safe and accurate pedicle screw placement of scoliosis surgery.

Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation.

PubMed

Toyama, H; Anthony, C; Lidstrom, M E

1998-09-01

Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.

Molecular Characteristics of the Mycobacterium tuberculosis LAM-RUS Family Prevalent in Central Russia▿ †

PubMed Central

Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor

2007-01-01

We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651

Clinical acceptance and accuracy assessment of spinal implants guided with SpineAssist surgical robot: retrospective study.

PubMed

Devito, Dennis P; Kaplan, Leon; Dietl, Rupert; Pfeiffer, Michael; Horne, Dale; Silberstein, Boris; Hardenbrook, Mitchell; Kiriyanthan, George; Barzilay, Yair; Bruskin, Alexander; Sackerer, Dieter; Alexandrovsky, Vitali; Stüer, Carsten; Burger, Ralf; Maeurer, Johannes; Donald, Gordon D; Gordon, Donald G; Schoenmayr, Robert; Friedlander, Alon; Knoller, Nachshon; Schmieder, Kirsten; Pechlivanis, Ioannis; Kim, In-Se; Meyer, Bernhard; Shoham, Moshe

2010-11-15

Retrospective, multicenter study of robotically-guided spinal implant insertions. Clinical acceptance of the implants was assessed by intraoperative radiograph, and when available, postoperative computed tomography (CT) scans were used to determine placement accuracy. To verify the clinical acceptance and accuracy of robotically-guided spinal implants and compare to those of unguided free-hand procedures. SpineAssist surgical robot has been used to guide implants and guide-wires to predefined locations in the spine. SpineAssist which, to the best of the authors' knowledge, is currently the sole robot providing surgical assistance in positioning tools in the spine, guided over 840 cases in 14 hospitals, between June 2005 and June 2009. Clinical acceptance of 3271 pedicle screws and guide-wires inserted in 635 reported cases was assessed by intraoperative fluoroscopy, where placement accuracy of 646 pedicle screws inserted in 139 patients was measured using postoperative CT scans. Screw placements were found to be clinically acceptable in 98% of the cases when intraoperatively assessed by fluoroscopic images. Measurements derived from postoperative CT scans demonstrated that 98.3% of the screws fell within the safe zone, where 89.3% were completely within the pedicle and 9% breached the pedicle by up to 2 mm. The remaining 1.4% of the screws breached between 2 and 4 mm, while only 2 screws (0.3%) deviated by more than 4 mm from the pedicle wall. Neurologic deficits were observed in 4 cases yet, following revisions, no permanent nerve damage was encountered, in contrast to the 0.6% to 5% of neurologic damage reported in the literature. SpineAssist offers enhanced performance in spinal surgery when compared to free-hand surgeries, by increasing placement accuracy and reducing neurologic risks. In addition, 49% of the cases reported herein used a percutaneous approach, highlighting the contribution of SpineAssist in procedures without anatomic landmarks.

A general insert label for peptide display on chimeric filamentous bacteriophages.

PubMed

Kaplan, Gilad; Gershoni, Jonathan M

2012-01-01

The foreign insert intended to be displayed via recombinant phage proteins can have a negative effect on protein expression and phage assembly. A typical example is the case of display of peptides longer than 6 amino acid residues on the major coat protein, protein VIII of the filamentous bacteriophages M13 and fd. A solution to this problem has been the use of "two-gene systems" generating chimeric phages that concomitantly express wild-type protein VIII along with recombinant protein VIII. Although the two-gene systems are much more permissive in regard to insert length and composition, some cases can still adversely affect phage assembly. Although these phages genotypically contain the desired DNA of the insert, they appear to be phenotypically wild type. To avoid false-negative results when using chimeric phages in binding studies, it is necessary to confirm that the observed lack of phage recognition is not due to faulty assembly and display of the intended insert. Here we describe a strategy for generating antibodies that specifically recognize recombinant protein VIII regardless of the nature of its foreign insert. These antibodies can be used as a general monitor of the display of recombinant protein VIII into phage particles. Copyright © 2011 Elsevier Inc. All rights reserved.

Integrated genome-wide Alu methylation and transcriptome profiling analyses reveal novel epigenetic regulatory networks associated with autism spectrum disorder.

PubMed

Saeliw, Thanit; Tangsuwansri, Chayanin; Thongkorn, Surangrat; Chonchaiya, Weerasak; Suphapeetiporn, Kanya; Mutirangura, Apiwat; Tencomnao, Tewin; Hu, Valerie W; Sarachana, Tewarit

2018-01-01

Alu elements are a group of repetitive elements that can influence gene expression through CpG residues and transcription factor binding. Altered gene expression and methylation profiles have been reported in various tissues and cell lines from individuals with autism spectrum disorder (ASD). However, the role of Alu elements in ASD remains unclear. We thus investigated whether Alu elements are associated with altered gene expression profiles in ASD. We obtained five blood-based gene expression profiles from the Gene Expression Omnibus database and human Alu-inserted gene lists from the TranspoGene database. Differentially expressed genes (DEGs) in ASD were identified from each study and overlapped with the human Alu-inserted genes. The biological functions and networks of Alu-inserted DEGs were then predicted by Ingenuity Pathway Analysis (IPA). A combined bisulfite restriction analysis of lymphoblastoid cell lines (LCLs) derived from 36 ASD and 20 sex- and age-matched unaffected individuals was performed to assess the global DNA methylation levels within Alu elements, and the Alu expression levels were determined by quantitative RT-PCR. In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup. Alu methylation and expression were altered in LCLs from ASD subgroups. Our findings highlight the association of Alu elements with gene dysregulation in ASD blood samples and warrant further investigation. Moreover, the classification of ASD individuals into subgroups based on phenotypes may be beneficial and could provide insights into the still unknown etiology and the underlying mechanisms of ASD.

Biased hypermutation occurred frequently in a gene inserted into the IC323 recombinant measles virus during its persistence in the brains of nude mice.

PubMed

Otani, Sanae; Ayata, Minoru; Takeuchi, Kaoru; Takeda, Makoto; Shintaku, Haruo; Ogura, Hisashi

2014-08-01

Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. Copyright © 2014 Elsevier Inc. All rights reserved.

Microwave-assisted chemical insertion: a rapid technique for screening cathodes for Mg-ion batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaveevivitchai, Watchareeya; Huq, Ashfia; Manthiram, Arumugam

We report an ultrafast microwave-assisted solvothermal method for chemical insertion of Mg2+ ions into host materials using magnesium acetate [Mg(CH3COO)2] as a metal-ion source and diethylene glycol (DEG) as a reducing agent. For instance, up to 3 Mg ions per formula unit of a microporous host framework Mo2.5+yVO9+z could be inserted in as little as 30 min at 170–195 °C in air. This process is superior to the traditional method which involves the use of organometallic reagents, such as di-n-butylmagnesium [(C4H9)2Mg] and magnesium bis(2,6-di-tert-butylphenoxide) [Mg-(O-2,6-But2C6H3)2], and requires an inert atmosphere with extremely long reaction times. Considering the lack of robustmore » electrolytes for Mg-ion batteries, this facile approach can be readily used as a rapid screening technique to identify potential Mg-ion electrode hosts without the necessity of fabricating electrodes and assembling electrochemical cells. Due to the mild reaction conditions, the overall structure and morphology of the Mg-ion inserted products are maintained and the compounds can be used successfully as a cathode in Mg-ion batteries. The combined synchrotron X-ray and neutron diffraction Rietveld analysis reveals the structure of the Mg-inserted compounds and gives an insight into the interactions between the Mg ions and the open-tunnel host framework.« less

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

PubMed

Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

2012-12-01

In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

PubMed

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

The development of the conditionally replication-competent adenovirus: replacement of E4 orf1-4 region by exogenous gene.

PubMed

Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin

2010-05-01

Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.

The Wnt-1 (int-1) oncogene promoter and its mechanism of activation by insertion of proviral DNA of the mouse mammary tumor virus.

PubMed Central

Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A

1990-01-01

Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322

A transposable element in a NAC gene is associated with drought tolerance in maize seedlings

PubMed Central

Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng

2015-01-01

Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.

PubMed

Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato

2018-01-01

CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.

Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3.

PubMed

Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H

2006-04-01

We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.

Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

PubMed

Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

2015-04-01

In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

PubMed

Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

2008-12-01

With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

A functional 12T-insertion polymorphism in the ATP1A1 promoter confers decreased susceptibility to hypertension in a male Sardinian population.

PubMed

Herrera, Victoria L; Pasion, Khristine A; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5'-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28-0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/- male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/- mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population.

A Functional 12T-Insertion Polymorphism in the ATP1A1 Promoter Confers Decreased Susceptibility to Hypertension in a Male Sardinian Population

PubMed Central

Herrera, Victoria L.; Pasion, Khristine A.; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5’-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28–0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/− male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/− mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population. PMID:25615575

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

PubMed Central

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

Transposon based functional characterization of soybean genes

USDA-ARS?s Scientific Manuscript database

Type II transposable elements that use cut and paste mechanism for jumping from one genomic region to another is ideal in tagging and cloning genes. Precise excision from an insertion site in a mutant gene leads to regaining the wild-type function. Thus, function of a gene can be established based o...

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

PubMed

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

The Brown Midrib Leaf (bml) Mutation in Rice (Oryza sativa L.) Causes Premature Leaf Senescence and the Induction of Defense Responses.

PubMed

Akhter, Delara; Qin, Ran; Nath, Ujjal Kumar; Alamin, Md; Jin, Xiaoli; Shi, Chunhai

2018-04-09

Isolating and characterizing mutants with altered senescence phenotypes is one of the ways to understand the molecular basis of leaf aging. Using ethyl methane sulfonate mutagenesis, a new rice ( Oryza sativa ) mutant, brown midrib leaf ( bml ), was isolated from the indica cultivar 'Zhenong34'. The bml mutants had brown midribs in their leaves and initiated senescence prematurely, at the onset of heading. The mutants had abnormal cells with degraded chloroplasts and contained less chlorophyll compared to the wild type (WT). The bml mutant showed excessive accumulation of reactive oxygen species (ROS), increased activities of superoxide dismutase, catalase, and malondialdehyde, upregulation of senescence-induced STAY-GREEN genes and senescence-related transcription factors, and down regulation of photosynthesis-related genes. The levels of abscisic acid (ABA) and jasmonic acid (JA) were increased in bml with the upregulation of some ABA and JA biosynthetic genes. In pathogen response, bml demonstrated higher resistance against Xanthomonas oryzae pv. oryzae and upregulation of four pathogenesis-related genes compared to the WT. A genetic study confirmed that the bml trait was caused by a single recessive nuclear gene ( BML ). A map-based cloning using insertion/deletion markers confirmed that BML was located in the 57.32kb interval between the L5IS7 and L5IS11 markers on the short arm of chromosome 5. A sequence analysis of the candidate region identified a 1 bp substitution (G to A) in the 5'-UTR (+98) of bml . BML is a candidate gene associated with leaf senescence, ROS regulation, and disease response, also involved in hormone signaling in rice. Therefore, this gene might be useful in marker-assisted backcrossing/gene editing to improve rice cultivars.

Left ventricular assist device implantation via left thoracotomy: alternative to repeat sternotomy.

PubMed

Pierson, Richard N; Howser, Renee; Donaldson, Terri; Merrill, Walter H; Dignan, Rebecca J; Drinkwater, Davis C; Christian, Karla G; Butler, Javed; Chomsky, Don; Wilson, John R; Clark, Rick; Davis, Stacy F

2002-03-01

Repeat sternotomy for left ventricular assist device insertion may result in injury to the right heart or patent coronary grafts, complicating intraoperative and postoperative management. In 4 critically ill patients, left thoracotomy was used as an alternative to repeat sternotomy. Anastomosis of the outflow conduit to the descending thoracic aorta provided satisfactory hemodynamic support.

Left ventricular assist device implantation in a patient who had previously undergone apical myectomy for hypertrophic cardiomyopathy.

PubMed

Cho, Yang Hyun; Deo, Salil V; Topilsky, Yan; Grogan, Martha A; Park, Soon J

2012-03-01

Apical hypertrophy is a rare variant of hypertropic cardiomyopathy. These patients may present with end-stage congestive heart failure subsequent to long standing diastolic dysfunction. We report the technique for left ventricular assist device insertion in a patient with previous apical myectomy for hypertrophic cardiomyopathy. © 2012 Wiley Periodicals, Inc.

Liver-Directed Lentiviral Gene Therapy in a Dog Model of Hemophilia B

PubMed Central

Bartholomae, Cynthia C.; Volpin, Monica; Della Valle, Patrizia; Sanvito, Francesca; Sergi Sergi, Lucia; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D’Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K.; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2017-01-01

We investigated the safety and efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B, and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We show that gene therapy using lentiviral vectors targeting expression of a canine factor IX transgene to hepatocytes was well-tolerated and provided stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we show that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be useful for the treatment of hemophilia. PMID:25739762

Satisfactory Short-Term Results of Navigation-Assisted Gap-Balancing Total Knee Arthroplasty Using Ultracongruent Insert.

PubMed

Yoon, Jung-Ro; Yang, Jae-Hyuk

2018-03-01

The use of highly conforming ultracongruent (UC) polyethylene insert is bone-preserving and became a relatively common alternative to the conventional posterior stabilized total knee arthroplasty (TKA) design. The purpose of this study was to analyze the short-term clinical and radiologic results of UC insert TKA using the navigation-assisted gap-balancing technique. Two hundred thirty-three knees were operated with a mean follow-up period of 8.1 years (minimum of 5 years). Radiologic and clinical outcomes were assessed before operation and at latest follow-up using the Knee Society Score and Western Ontario and McMaster Universities Osteoarthritis Index score. For statistical analysis, paired sample t-test and analysis of variance were used. Significance was considered as P < .05. According to the preoperative deformities (valgus, mild varus, and moderate varus), there were 23 cases (9.9%) of valgus deformity, 180 cases (77.3%) of mild varus deformity, and 30 cases (12.9%) of moderate varus deformity. Overall, the results at mean 8.1 years revealed an improvement in mean Knee Society Score (54 ± 12 to 92 ± 3) and mean Western Ontario and McMaster Universities Osteoarthritis Index scores (62 ± 14 to 17 ± 3). Overall, 220 of 233 cases (94.4%) were in neutral alignment (between -3° and +3°) at latest follow-up. There were no migrating or shifting prosthesis that should be considered as possible failure. There was 0% component revision rate. Navigation-assisted gap-balancing technique using UC insert TKA had satisfactory short-term outcome. Strict gap-balancing technique using the offset-type-force-controlled-spreader-system aided in the satisfactory results. Copyright © 2017 Elsevier Inc. All rights reserved.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Comprehensive identification of Vibrio vulnificus genes required for growth in human serum.

PubMed

Carda-Diéguez, M; Silva-Hernández, F X; Hubbard, T P; Chao, M C; Waldor, M K; Amaro, C

2018-12-31

Vibrio vulnificus can be a highly invasive pathogen capable of spreading from an infection site to the bloodstream, causing sepsis and death. To survive and proliferate in blood, the pathogen requires mechanisms to overcome the innate immune defenses and metabolic limitations of this host niche. We created a high-density transposon mutant library in YJ016, a strain representative of the most virulent V. vulnificus lineage (or phylogroup) and used transposon insertion sequencing (TIS) screens to identify loci that enable the pathogen to survive and proliferate in human serum. Initially, genes underrepresented for insertions were used to estimate the V. vulnificus essential gene set; comparisons of these genes with similar TIS-based classification of underrepresented genes in other vibrios enabled the compilation of a common Vibrio essential gene set. Analysis of the relative abundance of insertion mutants in the library after exposure to serum suggested that genes involved in capsule biogenesis are critical for YJ016 complement resistance. Notably, homologues of two genes required for YJ016 serum-resistance and capsule biogenesis were not previously linked to capsule biogenesis and are largely absent from other V. vulnificus strains. The relative abundance of mutants after exposure to heat inactivated serum was compared with the findings from the serum screen. These comparisons suggest that in both conditions the pathogen relies on its Na + transporting NADH-ubiquinone reductase (NQR) complex and type II secretion system to survive/proliferate within the metabolic constraints of serum. Collectively, our findings reveal the potency of comparative TIS screens to provide knowledge of how a pathogen overcomes the diverse limitations to growth imposed by serum.

Left ventricular diastolic filling with an implantable ventricular assist device: beat to beat variability with overall improvement

NASA Technical Reports Server (NTRS)

Nakatani, S.; Thomas, J. D.; Vandervoort, P. M.; Zhou, J.; Greenberg, N. L.; Savage, R. M.; McCarthy, P. M.

1997-01-01

OBJECTIVES: We studied the effects of left ventricular (LV) unloading by an implantable ventricular assist device on LV diastolic filling. BACKGROUND: Although many investigators have reported reliable systemic and peripheral circulatory support with implantable LV assist devices, little is known about their effect on cardiac performance. METHODS: Peak velocities of early diastolic filling, late diastolic filling, late to early filling ratio, deceleration time of early filling, diastolic filling period and atrial filling fraction were measured by intraoperative transesophageal Doppler echocardiography before and after insertion of an LV assist device in eight patients. A numerical model was developed to simulate this situation. RESULTS: Before device insertion, all patients showed either a restrictive or a monophasic transmitral flow pattern. After device insertion, transmitral flow showed rapid beat to beat variation in each patient, from abnormal relaxation to restrictive patterns. However, when the average values obtained from 10 consecutive beats were considered, overall filling was significantly normalized from baseline, with early filling velocity falling from 87 +/- 31 to 64 +/- 26 cm/s (p < 0.01) and late filling velocity rising from 8 +/- 11 to 32 +/- 23 cm/s (p < 0.05), resulting in an increase in the late to early filling ratio from 0.13 +/- 0.18 to 0.59 +/- 0.38 (p < 0.01) and a rise in the atrial filling fraction from 8 +/- 10% to 26 +/- 17% (p < 0.01). The deceleration time (from 112 +/- 40 to 160 +/- 44 ms, p < 0.05) and the filling period corrected by the RR interval (from 39 +/- 8% to 54 +/- 10%, p < 0.005) were also significantly prolonged. In the computer model, asynchronous LV assistance produced significant beat to beat variation in filling indexes, but overall a normalization of deceleration time as well as other variables. CONCLUSIONS: With LV assistance, transmitral flow showed rapidly varying patterns beat by beat in each patient, but overall diastolic filling tended to normalize with an increase of atrial contribution to the filling. Because of the variable nature of the transmitral flow pattern with the assist device, the timing of the device cycle must be considered when inferring diastolic function from transmitral flow pattern.

The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

PubMed Central

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

2003-01-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

PubMed

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

2003-08-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.

PubMed Central

Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J

1986-01-01

Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717

Perturbation of nuclear architecture by long-distance chromosome interactions.

PubMed

Dernburg, A F; Broman, K W; Fung, J C; Marshall, W F; Philips, J; Agard, D A; Sedat, J W

1996-05-31

Position-effect variegation (PEV) describes the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. Using FISH, we have tested whether variegated expression of the eye-color gene brown in Drosophila is influenced by its nuclear localization. In embryonic nuclei, a heterochromatic insertion at the brown locus is always spatially isolated from other heterochromatin. However, during larval development this insertion physically associates with other heterochromatic regions on the same chromosome in a stochastic manner. These observations indicate that the brown gene is silenced by specific contact with centromeric heterochromatin. Moreover, they provide direct evidence for long-range chromosome interactions and their impact on three-dimensional nuclear architecture, while providing a cohesive explanation for the phenomenon of PEV.

The decisive role of the patient-side surgeon in robotic surgery.

PubMed

Sgarbura, Olivia; Vasilescu, Catalin

2010-12-01

Minimally invasive technology literature is mainly concerned about the feasibility of the robotic procedures and the performance of the console surgeon. However, few of these technologies could be applied without a well-trained team. Our goal was to demonstrate that robotic surgery depends more on the patient-side assistant surgeon's abilities than has been previously reported. In our department, 280 interventions in digestive, thoracic, and gynecological surgery were performed since the acquisition of the robotic equipment. There are three teams trained in robotic surgery with three console surgeons and four certified patient-side surgeons. Four more patient-side assistants were trained at our center. Trocar placement, docking and undocking of the robot, insertion of the laparoscopic instruments, and hemostatic maneuvers with various devices were quantified and compared. Assistants trained by using animal or cadaver surgery are more comfortable with the robotic instruments handling and with docking and undocking of the robot. Assistants who finalized their residency or attend their final year are more accurate with the insertion of the laparoscopic instrument to the targeted organ and more skillful with LigaSure or clip applier devices. Interventions that require vivid participation of the assistants have shorter assistant-depending time intervals at the end of the learning curve than at the beginning. Robotic surgery is a team effort and is greatly dependant on the performance of assistant surgeons. Interventions that have the benefit of a trained team are more rapid and secure.

Identification and Characterization of Crr1a, a Gene for Resistance to Clubroot Disease (Plasmodiophora brassicae Woronin) in Brassica rapa L.

PubMed Central

Hatakeyama, Katsunori; Suwabe, Keita; Tomita, Rubens Norio; Kato, Takeyuki; Nunome, Tsukasa; Fukuoka, Hiroyuki; Matsumoto, Satoru

2013-01-01

Clubroot disease, caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin, is one of the most economically important diseases of Brassica crops in the world. Although many clubroot resistance (CR) loci have been identified through genetic analysis and QTL mapping, the molecular mechanisms of defense responses against P. brassicae remain unknown. Fine mapping of the Crr1 locus, which was originally identified as a single locus, revealed that it comprises two gene loci, Crr1a and Crr1b. Here we report the map-based cloning and characterization of Crr1a, which confers resistance to clubroot in Brassica rapa. Crr1aG004, cloned from the resistant line G004, encodes a Toll-Interleukin-1 receptor/nucleotide-binding site/leucine-rich repeat (TIR-NB-LRR) protein expressed in the stele and cortex of hypocotyl and roots, where secondary infection of the pathogen occurs, but not in root hairs, where primary infection occurs. Gain-of-function analysis proved that Crr1aG004 alone conferred resistance to isolate Ano-01 in susceptible Arabidopsis and B. rapa. In comparison, the susceptible allele Crr1aA9709 encodes a truncated NB-LRR protein, which lacked more than half of the TIR domain on account of the insertion of a solo-long terminal repeat (LTR) in exon 1 and included several substitutions and insertion-deletions in the LRR domain. This study provides a basis for further molecular analysis of defense mechanisms against P. brassicae and will contribute to the breeding of resistant cultivars of Brassica vegetables by marker-assisted selection. Data deposition The sequence reported in this paper has been deposited in the GenBank database (accession no. AB605024). PMID:23382954

Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

PubMed

Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H

2016-09-01

Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

Genome Engineering in Bacillus anthracis Using Cre Recombinase

PubMed Central

Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

2006-01-01

Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

PubMed

Negi, Vir S; Devaraju, Panneer; Gulati, Reena

2015-09-01

SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.

Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps

Treesearch

Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen

2003-01-01

Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...

What makes up plant genomes: The vanishing line between transposable elements and genes.

PubMed

Zhao, Dongyan; Ferguson, Ann A; Jiang, Ning

2016-02-01

The ultimate source of evolution is mutation. As the largest component in plant genomes, transposable elements (TEs) create numerous types of mutations that cannot be mimicked by other genetic mechanisms. When TEs insert into genomic sequences, they influence the expression of nearby genes as well as genes unlinked to the insertion. TEs can duplicate, mobilize, and recombine normal genes or gene fragments, with the potential to generate new genes or modify the structure of existing genes. TEs also donate their transposase coding regions for cellular functions in a process called TE domestication. Despite the host defense against TE activity, a subset of TEs survived and thrived through discreet selection of transposition activity, target site, element size, and the internal sequence. Finally, TEs have established strategies to reduce the efficacy of host defense system by increasing the cost of silencing TEs. This review discusses the recent progress in the area of plant TEs with a focus on the interaction between TEs and genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

PubMed Central

Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B

2018-01-01

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624

Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

DOE PAGES

Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.; ...

2018-03-09

The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less

Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

PubMed Central

Chen, Song; Li, Xianchun

2007-01-01

Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene.

PubMed

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.

A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene

PubMed Central

Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2015-01-01

Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation. PMID:26581077

Rechargeable Aluminum-Ion Batteries Based on an Open-Tunnel Framework.

PubMed

Kaveevivitchai, Watchareeya; Huq, Ashfia; Wang, Shaofei; Park, Min Je; Manthiram, Arumugam

2017-09-01

Rechargeable batteries based on an abundant metal such as aluminum with a three-electron transfer per atom are promising for large-scale electrochemical energy storage. Aluminum can be handled in air, thus offering superior safety, easy fabrication, and low cost. However, the development of Al-ion batteries has been challenging due to the difficulties in identifying suitable cathode materials. This study presents the use of a highly open framework Mo 2.5 +  y VO 9 +  z as a cathode for Al-ion batteries. The open-tunnel oxide allows a facile diffusion of the guest species and provides sufficient redox centers to help redistribute the charge within the local host lattice during the multivalent-ion insertion, thus leading to good rate capability with a specific capacity among the highest reported in the literature for Al-based batteries. This study also presents the use of Mo 2.5 +  y VO 9 +  z as a model host to develop a novel ultrafast technique for chemical insertion of Al ions into host structures. The microwave-assisted method employing diethylene glycol and aluminum diacetate (Al(OH)(C 2 H 3 O 2 ) 2 ) can be performed in air in as little as 30 min, which is far superior to the traditional chemical insertion techniques involving moisture-sensitive organometallic reagents. The Al-inserted Al x Mo 2.5 +  y VO 9 +  z obtained by the microwave-assisted chemical insertion can be used in Al-based rechargeable batteries. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Needle-tissue interactive mechanism and steering control in image-guided robot-assisted minimally invasive surgery: a review.

PubMed

Li, Pan; Yang, Zhiyong; Jiang, Shan

2018-06-01

Image-guided robot-assisted minimally invasive surgery is an important medicine procedure used for biopsy or local target therapy. In order to reach the target region not accessible using traditional techniques, long and thin flexible needles are inserted into the soft tissue which has large deformation and nonlinear characteristics. However, the detection results and therapeutic effect are directly influenced by the targeting accuracy of needle steering. For this reason, the needle-tissue interactive mechanism, path planning, and steering control are investigated in this review by searching literatures in the last 10 years, which results in a comprehensive overview of the existing techniques with the main accomplishments, limitations, and recommendations. Through comprehensive analyses, surgical simulation for insertion into multi-layer inhomogeneous tissue is verified as a primary and propositional aspect to be explored, which accurately predicts the nonlinear needle deflection and tissue deformation. Investigation of the path planning of flexible needles is recommended to an anatomical or a deformable environment which has characteristics of the tissue deformation. Nonholonomic modeling combined with duty-cycled spinning for needle steering, which tracks the tip position in real time and compensates for the deviation error, is recommended as a future research focus in the steering control in anatomical and deformable environments. Graphical abstract a Insertion force when the needle is inserted into soft tissue. b Needle deflection model when the needle is inserted into soft tissue [68]. c Path planning in anatomical environments [92]. d Duty-cycled spinning incorporated in nonholonomic needle steering [64].

A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.

PubMed

Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna

2008-03-01

Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.

Liver-directed lentiviral gene therapy in a dog model of hemophilia B.

PubMed

Cantore, Alessio; Ranzani, Marco; Bartholomae, Cynthia C; Volpin, Monica; Valle, Patrizia Della; Sanvito, Francesca; Sergi, Lucia Sergi; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D'Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi

2015-03-04

We investigated the efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We showed that gene therapy using lentiviral vectors targeting the expression of a canine factor IX transgene in hepatocytes was well tolerated and provided a stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we showed that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be potentially useful for the treatment of hemophilia. Copyright © 2015, American Association for the Advancement of Science.

Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

PubMed

Byrne, Susan M; Church, George M

2015-01-01

CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

Unstable transpositions of his4 in yeast.

PubMed Central

Greer, H; Fink, G R

1979-01-01

Unstable transpositions in yeast have been selected in which the his4C gene from chromosome III is inserted into chromosome XII. This event is associated with the generation of a recessive lethal mutation, resulting from the integration of his4C into an essential gene. Strains with these transpositions are viable as diploids or aneuploids for chromosome XII. The event that generates the transpositions does not lead reciprocally to a deletion on chromosome III, implying that synthesis of a new copy of his4C and subsequent transposition may have occurred. The his4C transpositions are unstable and give rise to C- segregants at a high frequency, as a result of either precise excision of the his4C gene (restoring function of the gene into which insertion had occurred) or chromosome loss. PMID:386353

High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells

PubMed Central

Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian

2015-01-01

The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076

Construction of a recombinant duck enteritis virus vaccine expressing hemagglutinin of H9N2 avian influenza virus and evaluation of its efficacy in ducks.

PubMed

Sun, Ying; Yang, Chenghuai; Li, Junping; Li, Ling; Cao, Minghui; Li, Qihong; Li, Huijiao

2017-01-01

H9 subtype avian influenza viruses (AIVs) remain a significant burden in the poultry industry and are considered to be one of the most likely causes of any new influenza pandemic in humans. As ducks play an important role in the maintenance of H9 viruses in nature, successful control of the spread of H9 AIVs in ducks will have significant beneficial effects on public health. Duck enteritis virus (DEV) may be a promising candidate viral vector for aquatic poultry vaccination. In this study, we constructed a recombinant DEV, rDEV-∆UL2-HA, inserting the hemagglutinin (HA) gene from duck-origin H9N2 AIV into the UL2 gene by homologous recombination. One-step growth analyses showed that the HA gene insertion had no effect on viral replication and suggested that the UL2 gene was nonessential for virus growth in vitro. In vivo tests further showed that the insertion of the HA gene in place of the UL2 gene did not affect the immunogenicity of the virus. Moreover, a single dose of 10 3 TCID 50 of rDEV-∆UL2-HA induced solid protection against lethal DEV challenge and completely prevented H9N2 AIV viral shedding. To our knowledge, this is the first report of a DEV-vectored vaccine providing robust protection against both DEV and H9N2 AIV virus infections in ducks.

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Lentiviral-Mediated Gene Therapy in Fanconi Anemia-A Mice Reveals Long-Term Engraftment and Continuous Turnover of Corrected HSCs.

PubMed

Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred

2015-01-01

Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.

Identification of Salmonella typhimurium Genes Required for Colonization of the Chicken Alimentary Tract and for Virulence in Newly Hatched Chicks

PubMed Central

Turner, Arthur K.; Lovell, Margaret A.; Hulme, Scott D.; Zhang-Barber, Li; Barrow, Paul A.

1998-01-01

From a collection of 2,800 Tn5-TC1 transposon mutants of Salmonella typhimurium F98, 18 that showed reduced intestinal colonization of 3-week-old chicks were identified. The sites of transposon insertion were determined for most of the mutants and included insertions in the lipopolysaccharide biosynthesis genes rfaK, rfaY, rfbK, and rfbB and the genes dksA, clpB, hupA, and sipC. In addition, identification was made of an insertion into a novel gene that encodes a protein showing similarity to the IIC component of the mannose class of phosphoenolpyruvate-carbohydrate phosphotransferase systems, which we putatively called ptsC. Transduction of most of the transposon mutations to a fresh S. typhimurium F98 genetic background and construction of defined mutations in the rfbK, dksA, hupA, sipC, and ptsC genes of S. typhimurium F98 supported the role in colonization of all but the pts locus. The virulence of the rfbK, dksA, hupA, sipC, and ptsC defined mutants and clpB and rfaY transductants in 1-day-old chicks was tested. All but the ptsC and rfaY mutants were attenuated for virulence. A number of other phenotypes associated with some of the mutations are described. PMID:9573095

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Evolutionary transgenomics: prospects and challenges.

PubMed

Correa, Raul; Baum, David A

2015-01-01

Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.

Study of Gene Trafficking between Acanthamoeba and Giant Viruses Suggests an Undiscovered Family of Amoeba-Infecting Viruses.

PubMed

Maumus, Florian; Blanc, Guillaume

2016-12-14

The nucleocytoplasmic large DNA viruses (NCLDV) are a group of extremely complex double-stranded DNA viruses, which are major parasites of a variety of eukaryotes. Recent studies showed that certain unicellular eukaryotes contain fragments of NCLDV DNA integrated in their genome, when surprisingly many of these organisms were not previously shown to be infected by NCLDVs. These findings prompted us to search the genome of Acanthamoeba castellanii strain Neff (Neff), one of the most prolific hosts in the discovery of giant NCLDVs, for possible DNA inserts of viral origin. We report the identification of 267 markers of lateral gene transfer with viruses, approximately half of which are clustered in Neff genome regions of viral origins, transcriptionally inactive or exhibit nucleotide-composition signatures suggestive of a foreign origin. The integrated viral genes had diverse origin among relatives of viruses that infect Neff, including Mollivirus, Pandoravirus, Marseillevirus, Pithovirus, and Mimivirus However, phylogenetic analysis suggests the existence of a yet-undiscovered family of amoeba-infecting NCLDV in addition to the five already characterized. The active transcription of some apparently anciently integrated virus-like genes suggests that some viral genes might have been domesticated during the amoeba evolution. These insights confirm that genomic insertion of NCLDV DNA is a common theme in eukaryotes. This gene flow contributed fertilizing the eukaryotic gene repertoire and participated in the occurrence of orphan genes, a long standing issue in genomics. Search for viral inserts in eukaryotic genomes followed by environmental screening of the original viruses should be used to isolate radically new NCLDVs. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Robot-assisted real-time magnetic resonance image-guided transcatheter aortic valve replacement.

PubMed

Miller, Justin G; Li, Ming; Mazilu, Dumitru; Hunt, Tim; Horvath, Keith A

2016-05-01

Real-time magnetic resonance imaging (rtMRI)-guided transcatheter aortic valve replacement (TAVR) offers improved visualization, real-time imaging, and pinpoint accuracy with device delivery. Unfortunately, performing a TAVR in a MRI scanner can be a difficult task owing to limited space and an awkward working environment. Our solution was to design a MRI-compatible robot-assisted device to insert and deploy a self-expanding valve from a remote computer console. We present our preliminary results in a swine model. We used an MRI-compatible robotic arm and developed a valve delivery module. A 12-mm trocar was inserted in the apex of the heart via a subxiphoid incision. The delivery device and nitinol stented prosthesis were mounted on the robot. Two continuous real-time imaging planes provided a virtual real-time 3-dimensional reconstruction. The valve was deployed remotely by the surgeon via a graphic user interface. In this acute nonsurvival study, 8 swine underwent robot-assisted rtMRI TAVR for evaluation of feasibility. Device deployment took a mean of 61 ± 5 seconds. Postdeployment necropsy was performed to confirm correlations between imaging and actual valve positions. These results demonstrate the feasibility of robotic-assisted TAVR using rtMRI guidance. This approach may eliminate some of the challenges of performing a procedure while working inside of an MRI scanner, and may improve the success of TAVR. It provides superior visualization during the insertion process, pinpoint accuracy of deployment, and, potentially, communication between the imaging device and the robotic module to prevent incorrect or misaligned deployment. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Peer-assisted learning model enhances clinical clerk's procedural skills.

PubMed

Huang, Chia-Chang; Hsu, Hui-Chi; Yang, Ling-Yu; Chen, Chen-Huan; Yang, Ying-Ying; Chang, Ching-Chih; Chuang, Chiao-Lin; Lee, Wei-Shin; Lee, Fa-Yauh; Hwang, Shinn-Jang

2018-05-17

Failure to transfer procedural skills learned in a laboratory to the bedside is commonly due to a lack of peer support/stimulation. A digital platform (Facebook) allows new clinical clerks to share experiences and tips that help augment their procedural skills in a peer-assisted learning/teaching method. This study aims to investigate the effectiveness of the innovation of using the digital platform to support the transfer of laboratory-trained procedural skills in the clinical units. Volunteer clinical clerks (n = 44) were enrolled into the peer-assisted learning (PAL) group, which was characterized by the peer-assisted learning of procedural skills during their final 3-month clinical clerkship block. Other clerks (n = 51) did not join the procedural skills-specific Facebook group and served as the self-directed learning regular group. The participants in both the PAL and regular groups completed pre- and post-intervention self-assessments for general self-assessed efficiency ratings (GSER) and skills specific self-assessed efficiency ratings (SSSER) for performing vein puncture, intravenous (IV) catheter and nasogastric (NG) tube insertion. Finally, all clerks received the post-intervention 3-station Objective Structured Clinical Skills Examination (OSCE) to test their proficiency for the abovementioned three procedural skills. Higher cumulative numbers of vein punctures, IV catheter insertions and NG tube insertions at the bedside were carried out by the PAL group than the regular group. A greater improvement in GSERs and SSSERs for medical procedures was found in the PAL group than in the regular group. The PAL group obtained higher procedural skills scores in the post-intervention OSCEs than the regular group. Our study suggested that the implementation of a procedural skill-specific digital platform effectively helps clerks to transfer laboratory-trained procedural skills into the clinical units. In comparison with the regular self-directed learning group, the peer-assisted learning characteristics of Facebook give additional benefits to the PAL group by enhancing their procedural skills. Copyright © 2018. Published by Elsevier Taiwan LLC.

Insertional engineering of chromosomes with Sleeping Beauty transposition: an overview.

PubMed

Grabundzija, Ivana; Izsvák, Zsuzsanna; Ivics, Zoltán

2011-01-01

Novel genetic tools and mutagenesis strategies based on the Sleeping Beauty (SB) transposable element are currently under development with a vision to link primary DNA sequence information to gene functions in vertebrate models. By virtue of its inherent capacity to insert into DNA, the SB transposon can be developed into powerful tools for chromosomal manipulations. Mutagenesis screens based on SB have numerous advantages including high throughput and easy identification of mutated alleles. Forward genetic approaches based on insertional mutagenesis by engineered SB transposons have the advantage of providing insight into genetic networks and pathways based on phenotype. Indeed, the SB transposon has become a highly instrumental tool to induce tumors in experimental animals in a tissue-specific -manner with the aim of uncovering the genetic basis of diverse cancers. Here, we describe a battery of mutagenic cassettes that can be applied in conjunction with SB transposon vectors to mutagenize genes, and highlight versatile experimental strategies for the generation of engineered chromosomes for loss-of-function as well as gain-of-function mutagenesis for functional gene annotation in vertebrate models.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

PubMed

Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

2013-07-01

We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease.

PubMed Central

Urban, M; Bhargava, T; Hamer, J E

1999-01-01

Cells tolerate exposure to cytotoxic compounds through the action of ATP-driven efflux pumps belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. Phytopathogenic fungi encounter toxic environments during plant invasion as a result of the plant defense response. Here we demonstrate the requirement for an ABC transporter during host infection by the fungal plant pathogen Magnaporthe grisea. The ABC1 gene was identified in an insertional mutagenesis screen for pathogenicity mutants. The ABC1 insertional mutant and a gene-replacement mutant arrest growth and die shortly after penetrating either rice or barley epidermal cells. The ABC1-encoded protein is similar to yeast ABC transporters implicated in multidrug resistance, and ABC1 gene transcripts are inducible by toxic drugs and a rice phytoalexin. However, abc1 mutants are not hypersensitive to antifungal compounds. The non-pathogenic, insertional mutation in ABC1 occurs in the promoter region and dramatically reduces transcript induction by metabolic poisons. These data strongly suggest that M.grisea requires the up-regulation of specific ABC transporters for pathogenesis; most likely to protect itself against plant defense mechanisms. PMID:9927411

In vivo modification of a maize engineered minichromosome.

PubMed

Gaeta, Robert T; Masonbrink, Rick E; Zhao, Changzeng; Sanyal, Abhijit; Krishnaswamy, Lakshminarasimhan; Birchler, James A

2013-06-01

Engineered minichromosomes provide efficient platforms for stacking transgenes in crop plants. Methods for modifying these chromosomes in vivo are essential for the development of customizable systems for the removal of selection genes or other sequences and for the addition of new genes. Previous studies have demonstrated that Cre, a site-specific recombinase, could be used to modify lox sites on transgenes on maize minichromosomes; however, these studies demonstrated somatic recombination only, and modified minichromosomes could not be recovered. We describe the recovery of an engineered chromosome composed of little more than a centromere plus transgene that was derived by telomere-mediated truncation. We used the fiber fluorescence in situ hybridization technique and detected a transgene on the minichromosome inserted among stretches of CentC centromere repeats, and this insertion was large enough to suggest a tandem insertion. By crossing the minichromosome to a plant expressing Cre-recombinase, the Bar selection gene was removed, leaving behind a single loxP site. This study demonstrates that engineered chromosomes can be modified in vivo using site-specific recombinases, a demonstration essential to the development of amendable chromosome platforms in plants.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Single gene insertion drives bioalcohol production by a thermophilic archaeon

PubMed Central

Basen, Mirko; Schut, Gerrit J.; Nguyen, Diep M.; Lipscomb, Gina L.; Benn, Robert A.; Prybol, Cameron J.; Vaccaro, Brian J.; Poole, Farris L.; Kelly, Robert M.; Adams, Michael W. W.

2014-01-01

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184

Single gene insertion drives bioalcohol production by a thermophilic archaeon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basen, M; Schut, GJ; Nguyen, DM

2014-12-09

Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. Bymore » heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.« less

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

Transposon Mutagenesis Identified Chromosomal and Plasmid Genes Essential for Adaptation of the Marine Bacterium Dinoroseobacter shibae to Anaerobic Conditions

PubMed Central

Ebert, Matthias; Laaß, Sebastian; Burghartz, Melanie; Petersen, Jörn; Koßmehl, Sebastian; Wöhlbrand, Lars; Rabus, Ralf; Wittmann, Christoph; Jahn, Dieter

2013-01-01

Anaerobic growth and survival are integral parts of the life cycle of many marine bacteria. To identify genes essential for the anoxic life of Dinoroseobacter shibae, a transposon library was screened for strains impaired in anaerobic denitrifying growth. Transposon insertions in 35 chromosomal and 18 plasmid genes were detected. The essential contribution of plasmid genes to anaerobic growth was confirmed with plasmid-cured D. shibae strains. A combined transcriptome and proteome approach identified oxygen tension-regulated genes. Transposon insertion sites of a total of 1,527 mutants without an anaerobic growth phenotype were determined to identify anaerobically induced but not essential genes. A surprisingly small overlap of only three genes (napA, phaA, and the Na+/Pi antiporter gene Dshi_0543) between anaerobically essential and induced genes was found. Interestingly, transposon mutations in genes involved in dissimilatory and assimilatory nitrate reduction (napA, nasA) and corresponding cofactor biosynthesis (genomic moaB, moeB, and dsbC and plasmid-carried dsbD and ccmH) were found to cause anaerobic growth defects. In contrast, mutation of anaerobically induced genes encoding proteins required for the later denitrification steps (nirS, nirJ, nosD), dimethyl sulfoxide reduction (dmsA1), and fermentation (pdhB1, arcA, aceE, pta, acs) did not result in decreased anaerobic growth under the conditions tested. Additional essential components (ferredoxin, cccA) of the anaerobic electron transfer chain and central metabolism (pdhB) were identified. Another surprise was the importance of sodium gradient-dependent membrane processes and genomic rearrangements via viruses, transposons, and insertion sequence elements for anaerobic growth. These processes and the observed contributions of cell envelope restructuring (lysM, mipA, fadK), C4-dicarboxylate transport (dctM1, dctM3), and protease functions to anaerobic growth require further investigation to unravel the novel underlying adaptation strategies. PMID:23974024

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

PubMed

Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

2015-08-01

In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

The Tgm9-induced indexed insertional mutant collection to conduct community-based reverse genetics studies in soybean

USDA-ARS?s Scientific Manuscript database

Until now, functional analyses of soybean genes have been very arduous because of the lack of a rapid transformation procedure. Recently identified the active endogenous type II transposable element, Tgm9, excises from insertion sites and restores wild-type phenotypes. Thus, this element provides a ...

Facial asymmetry and clinical manifestations in patients with novel insertion of the TCOF1 gene.

PubMed

Su, P-H; Liu, Y-F; Yu, J-S; Chen, J-Y; Chen, S-J; Lai, Y-J

2012-11-01

This study explored the role of TCOF1 insertion mutations in Taiwanese patients with craniofacial anomalies. Twelve patients with single or multiple, asymmetrical congenital craniofacial anomalies were enrolled. Genomic DNA was prepared from leukocytes; the coding regions of TCOF1 were analyzed by polymerase chain reaction and direct sequencing. Clinical manifestations were correlated to the TCOF1 mutation. Six of 12 patients diagnosed with hemifacial microsomia exhibited a novel insertion mutation 4127 ins G (frameshift) in exon 24 in the TCOF1 gene. All six patients were diagnosed with anomalies on the left side. In addition, four of these six patients had hearing impairment; three had other major anomalies; and two had developmental delay. The insertion caused a frameshift, an early truncation, the loss of two putative nuclear localization signals (residues 1404-1420 and 1424-1440), and the loss of coiled coil domain (1406-1426) in treacle protein. These findings support the existence of two regulators of growth of the mandibular condyles. © 2011 John Wiley & Sons A/S.

Nicotinamide dependence of uropathogenic Escherichia coli UTI89 and application of nadB as a neutral insertion site.

PubMed

Li, Zhaoli; Bouckaert, Julie; Deboeck, Francine; De Greve, Henri; Hernalsteens, Jean-Pierre

2012-03-01

NAD and NADP are ubiquitous in the metabolism of Escherichia coli K-12. NAD auxotrophy can be rendered by mutation in any of the three genes nadB, nadA and nadC. The nadB and nadA genes were defined as antivirulence loci in Shigella spp., as a mutation (mainly in nadB) disrupting the synthesis of quinolinate is required for virulence. Uropathogenic E. coli (UPEC) isolates from acute cystitis patients, exhibiting nicotinamide auxotrophy, were of serotype O18 : K1 : H7. E. coli UTI89, the model uropathogenic and O18 : K1 : H7 strain, requires nicotinamide or quinolinate for growth. A mutation in the nadB gene, encoding L-aspartate oxidase, was shown to be responsible for the nicotinamide requirement of UTI89. This was further confirmed by complementation of UTI89 with a recombinant plasmid harbouring the nadB gene of E. coli K-12. An Ala28Val point mutant of the recombinant plasmid failed to support the growth of UTI89 in minimal medium. This proves that the Ala28Val mutation in the NadB gene of UTI89 completely impedes de novo synthesis of nicotinamide. In spontaneous prototrophic revertants of UTI89, the nadB gene has a Val28Ala mutation. Both analyses implicate that the nicotinamide auxotrophy of UTI89 is caused by a single Ala28Val mutation in NadB. We showed that the same mutation is also present in other NAD auxotrophic E. coli O18 strains. No significant differences were observed between the virulence of isogenic NAD auxotrophic and prototrophic strains in the murine ascending urinary tract infection model. Considering these data, we applied the nadB locus as a neutral site for DNA insertions in the bacterial chromosome. We successfully restored the parental phenotype of a fimH mutant by inserting fimH, with a synthetic em7 promoter, into the nadB gene. This neutral insertion site is of significance for further research on the pathogenicity of UPEC.

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

PubMed Central

Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi

2012-01-01

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700

Site-controlled GaN nanocolumns with InGaN insertions grown by MBE

NASA Astrophysics Data System (ADS)

Nechaev, D. V.; Semenov, A. N.; Koshelev, O. A.; Jmerik, V. N.; Davydov, V. Yu; Smirnov, A. N.; Pozina, G.; Shubina, T. V.; Ivanov, S. V.

2017-11-01

The site-controlled plasma-assisted molecular beam epitaxy (PA MBE) has been developed to fabricate the regular array of GaN nanocolumns (NCs) with InGaN insertions on micro-cone patterned sapphire substrates (μ-CPSSs). Two-stage growth of GaN NCs, including a nucleation layer grown at metal-rich conditions and high temperature GaN growth in strong N-rich condition, has been developed to achieve the selective growth of the NCs. Microcathodoluminescence measurements have demonstrated pronounced emission from the InGaN insertions in 450-600 nm spectral range. The optically isolated NCs can be used as effective nano-emitters operating in the visible range.

Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

PubMed

Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

2012-05-01

Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A potyvirus-based gene vector allows producing active human S-COMT and animal GFP, but not human sorcin, in vector-infected plants.

PubMed

Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T

2006-05-01

Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.

Efficient conditional and promoter-specific in vivo expression of cDNAs of choice by taking advantage of recombinase-mediated cassette exchange using FlEx gene traps

PubMed Central

Schebelle, Laura; Wolf, Claudia; Stribl, Carola; Javaheri, Tahereh; Schnütgen, Frank; Ettinger, Andreas; Ivics, Zoltán; Hansen, Jens; Ruiz, Patricia; von Melchner, Harald; Wurst, Wolfgang; Floss, Thomas

2010-01-01

Recombinase-mediated cassette exchange (RMCE) exploits the possibility to unidirectionally exchange any genetic material flanked by heterotypic recombinase recognition sites (RRS) with target sites in the genome. Due to a limited number of available pre-fabricated target sites, RMCE in mouse embryonic stem (ES) cells has not been tapped to its full potential to date. Here, we introduce a universal system, which allows the targeted insertion of any given transcriptional unit into 85 742 previously annotated retroviral conditional gene trap insertions, representing 7013 independent genes in mouse ES cells, by RMCE. This system can be used to express any given cDNA under the control of endogenous trapped promoters in vivo, as well as for the generation of transposon ‘launch pads’ for chromosomal region-specific ‘Sleeping Beauty’ insertional mutagenesis. Moreover, transcription of the gene-of-interest is only activated upon Cre-recombinase activity, a feature that adds conditionality to this expression system, which is demonstrated in vivo. The use of the RMCE system presented in this work requires one single-cloning step followed by one overnight gateway clonase reaction and subsequent cassette exchange in ES cells with efficiencies of 40% in average. PMID:20139417

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

[Genetic diversity and relationships of northern eurasia populations for polymorphic Alu-insertions].

PubMed

Khitrinskaia, I Iu; Khar'kov, V N; Voevoda, M I; Stepanova, V A

2014-01-01

We for the first time have examined the autosomal gene pool of the Siberia, Central Asian and the Far East populations (27 populations of 12 ethnic groups) using a set of polymorphic Alu insertions in the human genome. The results of the analysis testify (i) to a significant level of genetic diversity in the Northern Eurasian populations and (ii) to a considerable differentiation of gene pool in the population of this region. It has been shown that at the CD4 locus, the frequency of Alu (-) is inversely related to the Mongoloid component of the population, the lowest and highest frequencies of the Alu deletion at locus CD4 were recorded respectively in Eskimo (0.012) and Russian and Ukrainian (0.35). The analysis of gene flow proved Caucasoid populations (Russian, Tajik and Uzbek), as well as those of Turkic ethnic groups from the Southern Siberia (Altaians and Tuvinians) and Khanty and Mansy populations to be the recipients of a considerable gene flow from the outside of the concerned population system, as compared with the East Siberian and the Far East ethnic groups. The results of the correlation analysis received with use polymorphic Alu insertion testify to the greatest correlation of genetic distances with anthropological characteristics of populations.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Precise Correction of Disease Mutations in Induced Pluripotent Stem Cells Derived From Patients With Limb Girdle Muscular Dystrophy.

PubMed

Turan, Soeren; Farruggio, Alfonso P; Srifa, Waracharee; Day, John W; Calos, Michele P

2016-04-01

Limb girdle muscular dystrophies types 2B (LGMD2B) and 2D (LGMD2D) are degenerative muscle diseases caused by mutations in the dysferlin and alpha-sarcoglycan genes, respectively. Using patient-derived induced pluripotent stem cells (iPSC), we corrected the dysferlin nonsense mutation c.5713C>T; p.R1905X and the most common alpha-sarcoglycan mutation, missense c.229C>T; p.R77C, by single-stranded oligonucleotide-mediated gene editing, using the CRISPR/Cas9 gene-editing system to enhance the frequency of homology-directed repair. We demonstrated seamless, allele-specific correction at efficiencies of 0.7-1.5%. As an alternative, we also carried out precise gene addition strategies for correction of the LGMD2B iPSC by integration of wild-type dysferlin cDNA into the H11 safe harbor locus on chromosome 22, using dual integrase cassette exchange (DICE) or TALEN-assisted homologous recombination for insertion precise (THRIP). These methods employed TALENs and homologous recombination, and DICE also utilized site-specific recombinases. With DICE and THRIP, we obtained targeting efficiencies after selection of ~20%. We purified iPSC corrected by all methods and verified rescue of appropriate levels of dysferlin and alpha-sarcoglycan protein expression and correct localization, as shown by immunoblot and immunocytochemistry. In summary, we demonstrate for the first time precise correction of LGMD iPSC and validation of expression, opening the possibility of cell therapy utilizing these corrected iPSC.

A Silent ABC Transporter Isolated from Streptomyces rochei F20 Induces Multidrug Resistance

PubMed Central

Fernández-Moreno, Miguel A.; Carbó, Lázaro; Cuesta, Trinidad; Vallín, Carlos; Malpartida, Francisco

1998-01-01

In the search for heterologous activators for actinorhodin production in Streptomyces lividans, 3.4 kb of DNA from Streptomyces rochei F20 (a streptothricin producer) were characterized. Subcloning experiments showed that the minimal DNA fragment required for activation was 0.4 kb in size. The activation is mediated by increasing the levels of transcription of the actII-ORF4 gene. Sequencing of the minimal activating fragment did not reveal any clues about its mechanism; nevertheless, it was shown to overlap the 3′ end of two convergent genes, one of whose translated products (ORF2) strongly resembles that of other genes belonging to the ABC transporter superfamily. Computer-assisted analysis of the 3.4-kb DNA sequence showed the 3′ terminus of an open reading frame (ORF), i.e., ORFA, and three complete ORFs (ORF1, ORF2, and ORFB). Searches in the databases with their respective gene products revealed similarities for ORF1 and ORF2 with ATP-binding proteins and transmembrane proteins, respectively, which are found in members of the ABC transporter superfamily. No similarities for ORFA and ORFB were found in the databases. Insertional inactivation of ORF1 and ORF2, their transcription analysis, and their cloning in heterologous hosts suggested that these genes were not expressed under our experimental conditions; however, cloning of ORF1 and ORF2 together (but not separately) under the control of an expressing promoter induced resistance to several chemically different drugs: oleandomycin, erythromycin, spiramycin, doxorubicin, and tetracycline. Thus, this genetic system, named msr, is a new bacterial multidrug ABC transporter. PMID:9696745

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

Model-assisted template extraction SRAF application to contact holes patterns in high-end flash memory device fabrication

NASA Astrophysics Data System (ADS)

Seoud, Ahmed; Kim, Juhwan; Ma, Yuansheng; Jayaram, Srividya; Hong, Le; Chae, Gyu-Yeol; Lee, Jeong-Woo; Park, Dae-Jin; Yune, Hyoung-Soon; Oh, Se-Young; Park, Chan-Ha

2018-03-01

Sub-resolution assist feature (SRAF) insertion techniques have been effectively used for a long time now to increase process latitude in the lithography patterning process. Rule-based SRAF and model-based SRAF are complementary solutions, and each has its own benefits, depending on the objectives of applications and the criticality of the impact on manufacturing yield, efficiency, and productivity. Rule-based SRAF provides superior geometric output consistency and faster runtime performance, but the associated recipe development time can be of concern. Model-based SRAF provides better coverage for more complicated pattern structures in terms of shapes and sizes, with considerably less time required for recipe development, although consistency and performance may be impacted. In this paper, we introduce a new model-assisted template extraction (MATE) SRAF solution, which employs decision tree learning in a model-based solution to provide the benefits of both rule-based and model-based SRAF insertion approaches. The MATE solution is designed to automate the creation of rules/templates for SRAF insertion, and is based on the SRAF placement predicted by model-based solutions. The MATE SRAF recipe provides optimum lithographic quality in relation to various manufacturing aspects in a very short time, compared to traditional methods of rule optimization. Experiments were done using memory device pattern layouts to compare the MATE solution to existing model-based SRAF and pixelated SRAF approaches, based on lithographic process window quality, runtime performance, and geometric output consistency.

Laparoscopic mesh fixation using laser-assisted tissue soldering in a porcine model.

PubMed

Lanzafame, Raymond J; Soltz, Barbara A; Stadler, Istvan; Soltz, Robert

2009-01-01

Animal studies using open surgical models indicate that collagen solder is capable of fixation of surgical meshes without interfering with tissue integration, increasing adhesions, or increasing inflammation intraperitoneally. This study describes development of instrumentation and techniques for laparoscopic herniorrhaphy using laser-assisted soldering technology. Anesthetized 20 kg to 25 kg female Yorkshire pigs underwent laparoscopy with a 3-trocar technique. Parietex TET, Parietex TEC, and Prolene mesh segments (5 x 5 cm) were embedded in 55% collagen solder. Segments were inserted by using a specially designed introducer and affixed to the peritoneum by using prototype laser devices (1.45 micro, 4.5 W continuous wave, 5-mm spot, 55 degrees C set temperature) and a custom laparoscopic handpiece (IPOM). Parietex PCO mesh was inserted and affixed using the Endo-hernia stapler (Control). Animals were recovered and underwent second-look laparoscopy at 6 weeks. Mesh sites were harvested after animals were euthanized. The mesh-solder constructs were easily inserted and affixed in an IPOM approach. Prolene mesh tended to curl at its edges as the solder was melted. Postoperative healing was similar to that in Control segments in all cases. Collagen-based tissue soldering permits normal wound healing and may mitigate or reduce the use of staples or other foreign bodies for laparoscopic mesh fixation, prevent tissue ischemia and possibly nerve entrapment, which result in severe postoperative pain and morbidity. Laser-assisted mesh fixation is a promising alternative for laparoscopic herniorrhaphy. Further development of this strategy is warranted.

iPod touch-assisted instrumentation of the spine: a technical report.

PubMed

Jost, Gregory F; Bisson, Erica F; Schmidt, Meic H

2013-12-01

Instrumentation of the spine depends on choosing the correct insertion angles to implant screws. Although modern image guidance facilitates precise instrumentation of the spine, the equipment is costly and availability is limited. Although most surgeons use lateral fluoroscopy to guide instrumentation in the sagittal plane, the lateromedial angulation is often chosen by estimation. To overcome the associated uncertainty, iPod touch-based applications for measuring angles can be used to assist with screw implantation. To evaluate the use of the iPod touch to adjust instruments to the optimal axial insertion angle for placement of pedicle screws in the lumbar spine. Twenty lumbar pedicle screws in 5 consecutive patients were implanted using the iPod touch. The lateromedial angulation was measured on preoperative images and reproduced in the operative field with the iPod touch. The instruments to implant the screws were aligned with the side of the iPod for screw insertion. Actual screw angles were remeasured on postoperative imaging. We collected demographic, clinical, and operative data for each patient. In 16 of 20 screws, the accuracy of implantation was within 3 degrees of the ideal trajectory. The 4 screws with an angle mismatch of 7 to 13 degrees were all implanted at the caudal end of the exposure, where maintaining the planned angulation was impeded by strong muscles pushing medially. iPod touch-assisted instrumentation of the spine is a very simple technique, which, in combination with a lateral fluoroscopy, may guide placement of pedicle screws in the lumbar spine.

The dam replacing gene product enhances Neisseria gonorrhoeae FA1090 viability and biofilm formation

PubMed Central

Kwiatek, Agnieszka; Bacal, Pawel; Wasiluk, Adrian; Trybunko, Anastasiya; Adamczyk-Poplawska, Monika

2014-01-01

Many Neisseriaceae do not exhibit Dam methyltransferase activity and, instead of the dam gene, possess drg (dam replacing gene) inserted in the leuS/dam locus. The drg locus in Neisseria gonorrhoeae FA1090 has a lower GC-pairs content (40.5%) compared to the whole genome of N. gonorrhoeae FA1090 (52%). The gonococcal drg gene encodes a DNA endonuclease Drg, with GmeATC specificity. Disruption of drg or insertion of the dam gene in gonococcal genome changes the level of expression of genes as shown by transcriptome analysis. For the drg-deficient N. gonorrhoeae mutant, a total of 195 (8.94% of the total gene pool) genes exhibited an altered expression compared to the wt strain by at least 1.5 fold. In dam-expressing N. gonorrhoeae mutant, the expression of 240 genes (11% of total genes) was deregulated. Most of these deregulated genes were involved in translation, DNA repair, membrane biogenesis and energy production as shown by cluster of orthologous group analysis. In vivo, the inactivation of drg gene causes the decrease of the number of live neisserial cells and long lag phase of growth. The insertion of dam gene instead of drg locus restores cell viability. We have also shown that presence of the drg gene product is important for N. gonorrhoeae FA1090 in adhesion, including human epithelial cells, and biofilm formation. Biofilm produced by drg-deficient strain is formed by more dispersed cells, compared to this one formed by parental strain as shown by scanning electron and confocal microscopy. Also adherence assays show a significantly smaller biomass of formed biofilm (OD570 = 0.242 ± 0.038) for drg-deficient strain, compared to wild-type strain (OD570 = 0.378 ± 0.057). Dam-expressing gonococcal cells produce slightly weaker biofilm with cells embedded in an extracellular matrix. This strain has also a five times reduced ability for adhesion to human epithelial cells. In this context, the presence of Drg is more advantageous for N. gonorrhoeae biology than Dam presence. PMID:25566225

A Novel Retrotransposon Inserted in the Dominant Vrn-B1 Allele Confers Spring Growth Habit in Tetraploid Wheat (Triticum turgidum L.).

PubMed

Chu, C-G; Tan, C T; Yu, G-T; Zhong, S; Xu, S S; Yan, L

2011-12-01

Vernalization genes determine winter/spring growth habit in temperate cereals and play important roles in plant development and environmental adaptation. In wheat (Triticum L. sp.), it was previously shown that allelic variation in the vernalization gene VRN1 was due to deletions or insertions either in the promoter or in the first intron. Here, we report a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled haploid population that segregated for winter-spring growth habit but was derived from two spring tetraploid wheat genotypes, the durum wheat (T. turgidum subsp. durum) variety 'Lebsock' and T. turgidum subsp. carthlicum accession PI 94749. Genetic analysis revealed that Lebsock carried the dominant Vrn-A1 and recessive vrn-B1 alleles, whereas PI 94749 had the recessive vrn-A1 and dominant Vrn-B1 alleles. The Vrn-A1 allele in Lebsock was the same as the Vrn-A1c allele previously reported in hexaploid wheat. No differences existed between the vrn-B1 and Vrn-B1 alleles, except that a 5463-bp insertion was detected in the 5'-UTR region of the Vrn-B1 allele. This insertion was a novel retrotransposon (designated as retrotrans_VRN), which was flanked by a 5-bp target site duplication and contained primer binding site and polypurine tract motifs, a 325-bp long terminal repeat, and an open reading frame encoding 1231 amino acids. The insertion of retrotrans_VRN resulted in expression of Vrn-B1 without vernalization. Retrotrans_VRN is prevalent among T. turgidum subsp. carthlicum accessions, less prevalent among T. turgidum subsp. dicoccum accessions, and rarely found in other tetraploid wheat subspecies.

Phenotypic characterization of xpr, a global regulator of extracellular virulence factors in Staphylococcus aureus

NASA Technical Reports Server (NTRS)

Smeltzer, M. S.; Hart, M. E.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)

1993-01-01

We recently described a Tn551 insertion in the chromosome of Staphylococcus aureus S6C that resulted in drastically reduced expression of extracellular lipase (M. S. Smeltzer, S. R. Gill, and J. J. Iandolo, J. Bacteriol. 174:4000-4006, 1992). The insertion was localized to a chromosomal site (designated omega 1058) distinct from the lipase structural gene (geh) and the accessory gene regulator (agr), both of which were structurally intact in the lipase-negative (Lip-) mutants. In this report, we describe a phenotypic comparison between strains S6C, a hyperproducer of enterotoxin B; KSI9051, a derivative of S6C carrying the Tn551 insertion at omega 1058; ISP546, an 8325-4 strain that carries a Tn551 insertion in the agr locus; and ISP479C, the parent strain of ISP546 cured of the Tn551 delivery plasmid pI258repA36. Compared with their respective parent strains, ISP546 and KSI9051 produced greatly reduced amounts of lipase, alpha-toxin, delta-toxin, protease, and nuclease. KSI9051 also produced reduced amounts of staphylococcal enterotoxin B. Coagulase production was increased in ISP546 but not in KSI9051. Using a mouse model, we also demonstrated that ISP546 and KSI9051 were far less virulent than ISP479C and S6C. We have designated the genetic element defined by the Tn551 insertion at omega 1058 xpr to denote its role as a regulator of extracellular protein synthesis. We conclude that xpr and agr are similar and possibly interactive regulatory genes that play an important role in pathogenesis of staphylococcal disease.

Identification of Immune-Related Genes and Development of SSR/SNP Markers from the Spleen Transcriptome of Schizothorax prenanti.

PubMed

Luo, Hui; Xiao, Shijun; Ye, Hua; Zhang, Zhengshi; Lv, Changhuan; Zheng, Shuming; Wang, Zhiyong; Wang, Xiaoqing

2016-01-01

Schizothorax prenanti (S. prenanti) is mainly distributed in the upstream regions of the Yangtze River and its tributaries in China. This species is indigenous and commercially important. However, in recent years, wild populations and aquacultures have faced the serious challenges of germplasm variation loss and an increased susceptibility to a range of pathogens. Currently, the genetics and immune mechanisms of S. prenanti are unknown, partly due to a lack of genome and transcriptome information. Here, we sought to identify genes related to immune functions and to identify molecular markers to study the function of these genes and for trait mapping. To this end, the transcriptome from spleen tissues of S. prenanti was analyzed and sequenced. Using paired-end reads from the Illumina Hiseq2500 platform, 48,517 transcripts were isolated from the spleen transcriptome. These transcripts could be clustered into 37,785 unigenes with an N50 length of 2,539 bp. The majority of the unigenes (35,653, 94.4%) were successfully annotated using non-redundant nucleotide sequence analysis (nt), and the non-redundant protein (nr), Swiss-Prot, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. KEGG pathway assignment identified more than 500 immune-related genes. Furthermore, 7,545 putative simple sequence repeats (SSRs), 857,535 single nucleotide polymorphisms (SNPs), and 53,481 insertion/deletion (InDels) were detected from the transcriptome. This is the first reported high-throughput transcriptome analysis of S. prenanti, and it provides valuable genetic resources for the investigation of immune mechanisms, conservation of germplasm, and molecular marker-assisted breeding of S. prenanti.

A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.

PubMed

Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu

2014-06-01

Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.

Abort Options for Human Missions to Earth-Moon Halo Orbits

NASA Technical Reports Server (NTRS)

Jesick, Mark C.

2013-01-01

Abort trajectories are optimized for human halo orbit missions about the translunar libration point (L2), with an emphasis on the use of free return trajectories. Optimal transfers from outbound free returns to L2 halo orbits are numerically optimized in the four-body ephemeris model. Circumlunar free returns are used for direct transfers, and cislunar free returns are used in combination with lunar gravity assists to reduce propulsive requirements. Trends in orbit insertion cost and flight time are documented across the southern L2 halo family as a function of halo orbit position and free return flight time. It is determined that the maximum amplitude southern halo incurs the lowest orbit insertion cost for direct transfers but the maximum cost for lunar gravity assist transfers. The minimum amplitude halo is the most expensive destination for direct transfers but the least expensive for lunar gravity assist transfers. The on-orbit abort costs for three halos are computed as a function of abort time and return time. Finally, an architecture analysis is performed to determine launch and on-orbit vehicle requirements for halo orbit missions.

The expanding universe of transposon technologies for gene and cell engineering.

PubMed

Ivics, Zoltán; Izsvák, Zsuzsanna

2010-12-07

Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons) can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (sh)RNA expression cassette, a mutagenic gene trap or a therapeutic gene construct) cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB) was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB), discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

Paucity and preferential suppression of transgenes in late replication domains of the D. melanogaster genome.

PubMed

Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F

2010-05-21

Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.

Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.

PubMed Central

Khairy, Heba; Wübbeler, Jan Hendrik

2015-01-01

Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888

Single- and double-balloon enteroscopy-assisted endoscopic retrograde cholangiopancreatography in patients with Roux-en-Y plus hepaticojejunostomy anastomosis and Whipple resection.

PubMed

Itokawa, Fumihide; Itoi, Takao; Ishii, Kentaro; Sofuni, Atsushi; Moriyasu, Fuminori

2014-04-01

In patients with Roux-en-Y hepaticojejunostomy (HJ with R-Y) and Whipple resection, endoscopic retrograde cholangiopancreatography (ERCP) can be challenging. We report our experience with ERCP using balloon-assisted enteroscopy (BAE) (BAE-ERCP) in patients with HJ with R-Y, and Whipple resection. BAE-ERCP procedures were carried out in 62 patients (HJ with R-Y:Whipple resection=34:28). Overall, the rates of reaching the anastomosis were 85.3% (29/34) in HJ with R-Y and 96.4% (27/28) in Whipple resection. In terms of HJ with R-Y, insertion success rate by standard single-balloon enteroscopy (SBE) was 89.3% (25/28). Insertion success rate by short BAE, including SBE and double-balloon enteroscopy (DBE), was 50% (3/6). There was a statistically significant difference of insertion success rate between standard long BE and short BE (P=0.021). However, in the Whipple patients, insertion success rate by standard and short SBE was 93.8% (15/16) and 91.7% (11/12), respectively. Initial insertion success rate by short BAE in Whipple patients was significantly higher than in HJ with R-Y (91.7% vs 50%, P=0.045). Therapeutic interventions included dilation of anastomosis stricture, stone extraction, endoscopic mechanical lithotripsy, biliary stent placement, stent extraction, endoscopic nasobiliary drainage, direct cholangioscopy, and electrohydraulic lithotripsy. Our HJ with R-Y series and Whipple series treatment success rate was 90% (18/20) and 95.0% (19/20), respectively. BAE-ERCP enabled ERCP to be carried out in patients with HJ. It is considered safe and feasible. Further experience and device improvement are needed. © 2014 The Authors. Digestive Endoscopy © 2014 Japan Gastroenterological Endoscopy Society.

Unsatisfactory clinical outcomes of second-generation mobile bearing floating platform total knee arthroplasty: comparing outcomes with fixed bearing after five years minimum.

PubMed

Yoon, Jung-Ro; Yang, Jae-Hyuk

2018-03-20

The purpose of this retrospective study was to analyze and compare the clinical and radiologic outcomes of fixed bearing ultracongruent (UC) insert total knee arthroplasty (TKA) and mobile bearing (MB) floating platform TKA using the navigation-assisted gap balancing technique with a minimum follow-up of five years. The study retrospectively enrolled 105 patients who received the UC type fixed bearing insert (group 1) and 95 patients who received the floating platform MB insert (group 2) during the period from August 2009 to June 2012. All surgery was performed using the navigation-assisted gap balancing technique. For strict assessment of gap measurements, the offset-type-force-controlled-spreader-system was used. Radiologic and clinical outcomes were assessed before operation and at the most recent follow-up using the Knee Society Score (KSS) and the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) score. For statistical analysis, paired sample t tests were used. A p value less than 0.05 was considered significant. Although the radiologic alignments were satisfactory for both groups (99/105 [94%] cases were neutral for group 1 and 90/95 [94%] for group 2), the functional and total WOMAC scores were inferior in group 2 (p < 0.05). There were two cases of insert breakage in group 2 that required bearing exchange. The Kaplan-Meier survivorship rates for groups 1 and 2 at 77 months were 100.0 and 97.9%, respectively. Second-generation MB floating platform TKA cases did not have satisfactory outcomes. There were two cases of insert breakage, which required bearing exchange. Other patients who underwent surgery with second-generation MB floating platform were encouraged to avoid high knee flexion activities, resulting in lower clinical performance.

Enhanced Lighting Techniques and Augmented Reality to Improve Human Task Performance

NASA Technical Reports Server (NTRS)

Maida, James C.; Bowen, Charles K.; Pace, John W.

2005-01-01

One of the most versatile tools designed for use on the International Space Station (ISS) is the Special Purpose Dexterous Manipulator (SPDM) robot. Operators for this system are trained at NASA Johnson Space Center (JSC) using a robotic simulator, the Dexterous Manipulator Trainer (DMT), which performs most SPDM functions under normal static Earth gravitational forces. The SPDM is controlled from a standard Robotic Workstation. A key feature of the SPDM and DMT is the Force/Moment Accommodation (FMA) system, which limits the contact forces and moments acting on the robot components, on its payload, an Orbital Replaceable Unit (ORU), and on the receptacle for the ORU. The FMA system helps to automatically alleviate any binding of the ORU as it is inserted or withdrawn from a receptacle, but it is limited in its correction capability. A successful ORU insertion generally requires that the reference axes of the ORU and receptacle be aligned to within approximately 0.25 inch and 0.5 degree of nominal values. The only guides available for the operator to achieve these alignment tolerances are views from any available video cameras. No special registration markings are provided on the ORU or receptacle, so the operator must use their intrinsic features in the video display to perform the pre-insertion alignment task. Since optimum camera views may not be available, and dynamic orbital lighting conditions may limit viewing periods, long times are anticipated for performing some ORU insertion or extraction operations. This study explored the feasibility of using augmented reality (AR) to assist with SPDM operations. Geometric graphical symbols were overlaid on the end effector (EE) camera view to afford cues to assist the operator in attaining adequate pre-insertion ORU alignment.

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.

PubMed Central

Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G

1989-01-01

In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366

A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan

2015-07-01

To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

[Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].

PubMed

Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K

2005-07-01

Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).

The insertion of the non-heme FeB cofactor into nitric oxide reductase from P. denitrificans depends on NorQ and NorD accessory proteins.

PubMed

Kahle, Maximilian; Ter Beek, Josy; Hosler, Jonathan P; Ädelroth, Pia

2018-06-03

Bacterial NO reductases (NOR) catalyze the reduction of NO into N 2 O, either as a step in denitrification or as a detoxification mechanism. cNOR from Paracoccus (P.) denitrificans is expressed from the norCBQDEF operon, but only the NorB and NorC proteins are found in the purified NOR complex. Here, we established a new purification method for the P. denitrificans cNOR via a His-tag using heterologous expression in E. coli. The His-tagged enzyme is both structurally and functionally very similar to non-tagged cNOR. We were also able to express and purify cNOR from the structural genes norCB only, in absence of the accessory genes norQDEF. The produced protein is a stable NorCB complex containing all hemes and it can bind gaseous ligands (CO) to heme b 3 , but it is catalytically inactive. We show that this deficient cNOR lacks the non-heme iron cofactor Fe B . Mutational analysis of the nor gene cluster revealed that it is the norQ and norD genes that are essential to form functional cNOR. NorQ belongs to the family of MoxR P-loop AAA+ ATPases, which are in general considered to facilitate enzyme activation processes often involving metal insertion. Our data indicates that NorQ and NorD work together in order to facilitate non-heme Fe insertion. This is noteworthy since in many cases Fe cofactor binding occurs spontaneously. We further suggest a model for NorQ/D-facilitated metal insertion into cNOR. Copyright © 2018 Elsevier B.V. All rights reserved.

Reverse genetics of Newcastle disease virus

USDA-ARS?s Scientific Manuscript database

Reverse genetics allows the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique allows genetic manipulation and cloning of viral genomes, mutation through site-directed mutagenesis, and gene insertion or deletion, among othe...

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

The genome sequence of sweet cherry (Prunus avium) for use in genomics-assisted breeding.

PubMed

Shirasawa, Kenta; Isuzugawa, Kanji; Ikenaga, Mitsunobu; Saito, Yutaro; Yamamoto, Toshiya; Hirakawa, Hideki; Isobe, Sachiko

2017-10-01

We determined the genome sequence of sweet cherry (Prunus avium) using next-generation sequencing technology. The total length of the assembled sequences was 272.4 Mb, consisting of 10,148 scaffold sequences with an N50 length of 219.6 kb. The sequences covered 77.8% of the 352.9 Mb sweet cherry genome, as estimated by k-mer analysis, and included >96.0% of the core eukaryotic genes. We predicted 43,349 complete and partial protein-encoding genes. A high-density consensus map with 2,382 loci was constructed using double-digest restriction site-associated DNA sequencing. Comparing the genetic maps of sweet cherry and peach revealed high synteny between the two genomes; thus the scaffolds were integrated into pseudomolecules using map- and synteny-based strategies. Whole-genome resequencing of six modern cultivars found 1,016,866 SNPs and 162,402 insertions/deletions, out of which 0.7% were deleterious. The sequence variants, as well as simple sequence repeats, can be used as DNA markers. The genomic information helps us to identify agronomically important genes and will accelerate genetic studies and breeding programs for sweet cherries. Further information on the genomic sequences and DNA markers is available in DBcherry (http://cherry.kazusa.or.jp (8 May 2017, date last accessed)). © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

PubMed

Fléchard, Maud; Gilot, Philippe

2014-07-01

We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

PubMed Central

Letsou, Anthea; Liskay, R. Michael

1987-01-01

With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

Angiotensin-converting enzyme gene insertion/deletion polymorphism studies in Asian Indian pregnant women biochemically identifies gestational diabetes mellitus.

PubMed

Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna

2014-12-01

Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Recombinant Parainfluenza Virus 5 Expressing Hemagglutinin of Influenza A Virus H5N1 Protected Mice against Lethal Highly Pathogenic Avian Influenza Virus H5N1 Challenge

PubMed Central

Li, Zhuo; Mooney, Alaina J.; Gabbard, Jon D.; Gao, Xiudan; Xu, Pei; Place, Ryan J.; Hogan, Robert J.; Tompkins, S. Mark

2013-01-01

A safe and effective vaccine is the best way to prevent large-scale highly pathogenic avian influenza virus (HPAI) H5N1 outbreaks in the human population. The current FDA-approved H5N1 vaccine has serious limitations. A more efficacious H5N1 vaccine is urgently needed. Parainfluenza virus 5 (PIV5), a paramyxovirus, is not known to cause any illness in humans. PIV5 is an attractive vaccine vector. In our studies, a single dose of a live recombinant PIV5 expressing a hemagglutinin (HA) gene of H5N1 (rPIV5-H5) from the H5N1 subtype provided sterilizing immunity against lethal doses of HPAI H5N1 infection in mice. Furthermore, we have examined the effect of insertion of H5N1 HA at different locations within the PIV5 genome on the efficacy of a PIV5-based vaccine. Interestingly, insertion of H5N1 HA between the leader sequence, the de facto promoter of PIV5, and the first viral gene, nucleoprotein (NP), did not lead to a viable virus. Insertion of H5N1 HA between NP and the next gene, V/phosphorprotein (V/P), led to a virus that was defective in growth. We have found that insertion of H5N1 HA at the junction between the small hydrophobic (SH) gene and the hemagglutinin-neuraminidase (HN) gene gave the best immunity against HPAI H5N1 challenge: a dose as low as 1,000 PFU was sufficient to protect against lethal HPAI H5N1 challenge in mice. The work suggests that recombinant PIV5 expressing H5N1 HA has great potential as an HPAI H5N1 vaccine. PMID:23077314

Using the candidate gene approach for detecting genes underlying seed oil concentration and yield in soybean.

PubMed

Eskandari, Mehrzad; Cober, Elroy R; Rajcan, Istvan

2013-07-01

Increasing the oil concentration in soybean seeds has been given more attention in recent years because of demand for both edible oil and biodiesel production. Oil concentration in soybean is a complex quantitative trait regulated by many genes as well as environmental conditions. To identify genes governing seed oil concentration in soybean, 16 putative candidate genes of three important gene families (GPAT: acyl-CoA:sn-glycerol-3-phosphate acyltransferase, DGAT: acyl-CoA:diacylglycerol acyltransferase, and PDAT: phospholipid:diacylglycerol acyltransferase) involved in triacylglycerol (TAG) biosynthesis pathways were selected and their sequences retrieved from the soybean database ( http://www.phytozome.net/soybean ). Three sequence mutations were discovered in either coding or noncoding regions of three DGAT soybean isoforms when comparing the parents of a 203 recombinant inbreed line (RIL) population; OAC Wallace and OAC Glencoe. The RIL population was used to study the effects of these mutations on seed oil concentration and other important agronomic and seed composition traits, including seed yield and protein concentration across three field locations in Ontario, Canada, in 2009 and 2010. An insertion/deletion (indel) mutation in the GmDGAT2B gene in OAC Wallace was significantly associated with reduced seed oil concentration across three environments and reduced seed yield at Woodstock in 2010. A mutation in the 3' untranslated (3'UTR) region of GmDGAT2C was associated with seed yield at Woodstock in 2009. A mutation in the intronic region of GmDGAR1B was associated with seed yield and protein concentration at Ottawa in 2010. The genes identified in this study had minor effects on either seed yield or oil concentration, which was in agreement with the quantitative nature of the traits. However, the novel gene-specific markers designed in the present study can be used in soybean breeding for marker-assisted selection aimed at increasing seed yield and oil concentration with no significant impact on seed protein concentration.

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Usefulness of a Flexible Port for Natural Orifice Transluminal Endoscopic Surgery by the Transrectal and Transvaginal Routes

PubMed Central

Ohdaira, Takeshi; Ikeda, Keiichi; Tajiri, Hisao; Yasuda, Yoshikazu; Hashizume, Makoto

2010-01-01

We developed a flexible port for NOTES which allows the use of conventional forceps for laparoscope-assisted surgery without change. The port is not affected by the location of the through hole in the gastrointestinal tract or vagina which elicits a problem in conventional NOTES, and its length can be adjusted during surgery by cutting the port itself. The port is made of polymer resin with a low friction coefficient. Furthermore, the port walls have a square wave structure which contributes to (1) the prevention of devices, for example, endoscope, from getting stuck at the time of insertion and retrieval, (2) the prevention of port slippage in the surgical opening for port insertion, (3) the prevention of unexpected port removal, (4) the prevention of port bore deformation, and (5) the improvement of port flexibility in the longitudinal direction. We validated the insertion and retrieval capacities of commercially available forceps for laparoscope-assisted surgery and power devices. Furthermore, we used the flexible port to conduct cholecystectomy and partial gastrectomy. We could confirm that the selection of the flexible port diameter according to the device type allowed the smooth insertion and retrieval of the device and that the port produced no air leakage. We affirmed that it is possible to conduct surgery by the cross or parallel method similarly to single port surgery. We considered that the flexible port has a potential of becoming a revolutionary port in NOTES. PMID:20508827

Influence of Screw Length and Bone Thickness on the Stability of Temporary Implants

PubMed Central

Fernandes, Daniel Jogaib; Elias, Carlos Nelson; Ruellas, Antônio Carlos de Oliveira

2015-01-01

The purpose of this work was to study the influence of screw length and bone thickness on the stability of temporary implants. A total of 96 self-drilling temporary screws with two different lengths were inserted into polyurethane blocks (n = 66), bovine femurs (n = 18) and rabbit tibia (n = 12) with different cortical thicknesses (1 to 8 mm). Screws insertion in polyurethane blocks was assisted by a universal testing machine, torque peaks were collected by a digital torquemeter and bone thickness was monitored by micro-CT. The results showed that the insertion torque was significantly increased with the thickness of cortical bone from polyurethane (p < 0.0001), bovine (p = 0.0035) and rabbit (p < 0.05) sources. Cancellous bone improved significantly the mechanical implant stability. Insertion torque and insertion strength was successfully moduled by equations, based on the cortical/cancellous bone behavior. Based on the results, insertion torque and bone strength can be estimate in order to prevent failure of the cortical layer during temporary screw placement. The stability provided by a cortical thickness of 2 or 1 mm coupled to cancellous bone was deemed sufficient for temporary implants stability. PMID:28793582

Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism

USDA-ARS?s Scientific Manuscript database

Objectives: Newcastle disease virus (NDV), a member of the Paramxoviridae family, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU...

Mechanism for DNA transposons to generate introns on genomic scales

PubMed Central

Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

2017-01-01

Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

Endogenous Retroviruses: With Us and Against Us

NASA Astrophysics Data System (ADS)

Meyer, Thomas J.; Rosenkrantz, Jimi L.; Carbone, Lucia; Chavez, Shawn L.

2017-04-01

Mammalian genomes are scattered with thousands of copies of endogenous retroviruses (ERVs), mobile genetic elements that are relics of ancient retroviral infections. After inserting copies into the germ line of a host, most ERVs accumulate mutations that prevent the normal assembly of infectious viral particles, becoming trapped in host genomes and unable to leave to infect other cells. While most copies of ERVs are inactive, some are transcribed and encode the proteins needed to generate new insertions at novel loci. In some cases, old copies are removed via recombination and other mechanisms. This creates a shifting landscape of ERV copies within host genomes. New insertions can disrupt normal expression of nearby genes via directly inserting into key regulatory elements or by containing regulatory motifs within their sequences. Further, the transcriptional silencing of ERVs via epigenetic modification may result in changes to the epigenetic regulation of adjacent genes. In these ways, ERVs can be potent sources of regulatory disruption as well as genetic innovation. Here, we provide a brief review of the association between ERVs and gene expression, especially as observed in pre-implantation development and placentation. Moreover, we will describe the roles ERVs may play in somatic tissues, mostly in the context of human disease, including cancer, neurodegenerative disorders, and schizophrenia. Lastly, we discuss the recent discovery that some ERVs may have been pressed into the service of their host genomes to aid in the innate immune response to exogenous viral infections.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Cell Cycle Status of CD34+ Hemopoietic Stem Cells Determines Lentiviral Integration in Actively Transcribed and Development-related Genes

PubMed Central

Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P

2015-01-01

Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760

Insertional Mutagenesis for Genes involved in Otic/Vestibular Development and Function in Xenopus Tropicalis

NASA Technical Reports Server (NTRS)

Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)

2002-01-01

Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Y.; Li, X.M.; Shapiro, L.J.

1994-09-01

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

Efficient transformation and expression of gfp gene in Valsa mali var. mali.

PubMed

Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

2015-01-01

Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing.

PubMed

Gilling, Damian H; Luna, Vicki Ann; Pflugradt, Cori

2014-01-01

The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future.

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

Evaluation of Measles Vaccine Virus as a Vector to Deliver Respiratory Syncytial Virus Fusion Protein or Epstein-Barr Virus Glycoprotein gp350

PubMed Central

Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong

2012-01-01

Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906

Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

Treesearch

Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

2007-01-01

We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

Stx1 prophage excision in Escherichia coli strain PA20 confers strong curli and biofilm formation by restoring native mlrA

USDA-ARS?s Scientific Manuscript database

Prophage insertions in Escherichia coli O157:H7 mlrA contribute to the low expression of curli fimbriae and biofilm observed in many clinical isolates. Varying levels of CsgD-dependent curli/biofilm expression are restored to strains bearing prophage insertions in mlrA by mutation of regulatory gene...

Origin of mitochondria by intracellular enslavement of a photosynthetic purple bacterium

PubMed Central

Cavalier-Smith, Thomas

2006-01-01

Mitochondria originated by permanent enslavement of purple non-sulphur bacteria. These endosymbionts became organelles through the origin of complex protein-import machinery and insertion into their inner membranes of protein carriers for extracting energy for the host. A chicken-and-egg problem exists: selective advantages for evolving import machinery were absent until inner membrane carriers were present, but this very machinery is now required for carrier insertion. I argue here that this problem was probably circumvented by conversion of the symbiont protein-export machinery into protein-import machinery, in three phases. I suggest that the first carrier entered the periplasmic space via pre-existing β-barrel proteins in the bacterial outer membrane that later became Tom40, and inserted into the inner membrane probably helped by a pre-existing inner membrane protein, thereby immediately providing the protoeukaryote host with photosynthesate. This would have created a powerful selective advantage for evolving more efficient carrier import by inserting Tom70 receptors. Massive gene transfer to the nucleus inevitably occurred by mutation pressure. Finally, pressure from harmful, non-selected gene transfer to the nucleus probably caused evolution of the presequence mechanism, and photosynthesis was lost. PMID:16822756

Transposable elements and insecticide resistance.

PubMed

Rostant, Wayne G; Wedell, Nina; Hosken, David J

2012-01-01

Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

A Genome-Wide Functional Investigation into the Roles of Receptor-Like Proteins in Arabidopsis1[W][OA

PubMed Central

Wang, Guodong; Ellendorff, Ursula; Kemp, Ben; Mansfield, John W.; Forsyth, Alec; Mitchell, Kathy; Bastas, Kubilay; Liu, Chun-Ming; Woods-Tör, Alison; Zipfel, Cyril; de Wit, Pierre J.G.M.; Jones, Jonathan D.G.; Tör, Mahmut; Thomma, Bart P.H.J.

2008-01-01

Receptor-like proteins (RLPs) are cell surface receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail. In several plant species, RLPs have been found to play a role in disease resistance, such as the tomato (Solanum lycopersicum) Cf and Ve proteins and the apple (Malus domestica) HcrVf2 protein that mediate resistance against the fungal pathogens Cladosporium fulvum, Verticillium spp., and Venturia inaequalis, respectively. In addition, RLPs play a role in plant development; Arabidopsis (Arabidopsis thaliana) TOO MANY MOUTHS (TMM) regulates stomatal distribution, while Arabidopsis CLAVATA2 (CLV2) and its functional maize (Zea mays) ortholog FASCINATED EAR2 regulate meristem maintenance. In total, 57 RLP genes have been identified in the Arabidopsis genome and a genome-wide collection of T-DNA insertion lines was assembled. This collection was functionally analyzed with respect to plant growth and development and sensitivity to various stress responses, including susceptibility toward pathogens. A number of novel developmental phenotypes were revealed for our CLV2 and TMM insertion mutants. In addition, one AtRLP gene was found to mediate abscisic acid sensitivity and another AtRLP gene was found to influence nonhost resistance toward Pseudomonas syringae pv phaseolicola. This genome-wide collection of Arabidopsis RLP gene T-DNA insertion mutants provides a tool for future investigations into the biological roles of RLPs. PMID:18434605

A Pseudomonas putida double mutant deficient in butanol assimilation: a promising step for engineering a biological biofuel production platform.

PubMed

Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L

2016-03-01

Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

PubMed

Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

2013-01-01

The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

Molecular biology. Mothers setting boundaries.

PubMed

Thorvaldsen, J L; Bartolomei, M S

2000-06-23

Certain genes are only expressed at one allele, a phenomenon called imprinting. Although it is well established that one allele of certain imprinted genes is silenced through methylation, this does not appear to be the case for all imprinted genes. In a thoughtful Perspective, Thorvaldsen and Bartolomei discuss new findings showing that insertion of insulator elements (boundary regions) between the promoter of a gene and its enhancer (a sequence that boosts gene expression) may be another way in which genes are silenced during imprinting.

hisT is part of a multigene operon in Escherichia coli K-12.

PubMed Central

Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E

1985-01-01

The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810

Short and long-term genome stability analysis of prokaryotic genomes.

PubMed

Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France

2013-05-08

Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were able to explore genome organization stability at different time-scales and to find significant differences for pathogen and non-pathogen species. The output of our framework also allows to identify the conserved gene clusters and/or partial occurrences thereof, making possible to explore how gene clusters assembled during evolution.

[Optimizing primary total hip replacement--a technique to effect saving of manpower].

PubMed

Huber, J F; Rink, M; Broger, I; Zumstein, M; Ruflin, G B

2003-01-01

Development of a standardized surgical technique for total hip replacement thereby saving manpower (one assistant) by using a retractor system. Total hip replacement is performed with the patient in a true lateral position on a tunnel cushion. By means of a direct lateral approach the pelvitrochanteric muscles are partially detached using an omega-shaped cut. The Bookwalter retractor is fixed dorsally on the operating table. The ring is centered keeping the greater trochanter in the middle. The Hohmann retractors are fixed to the ring to sufficiently expose the acetabulum. To insert the femoral stem the ring needs to be opened dorsally and the patient's leg is bent 90 degrees in the hip and the knee over the tunnel cushion. The muscles inserting at the greater trochanter are retracted by a separate Hohmann retractor with weight. In a case control study with matched pairs the patients treated with this technique were compared with those treated in supine position with the transgluteal approach. The number of assistants required and the operating time were assessed. All the hip replacements with the patient in side position were performed with one assistant, in supine position with two assistants. The operating time did not differ significantly (supine position 110 min/side position 112 min). The complication rate in both groups was comparable (one secondary wound healing, one transient ischalgia). The process of total hip replacement can be optimized. The described technique allows to spare one surgical assistant without prolonging the operating time.

Novel mutants of Erwinia carotovora subsp. carotovora defective in the production of plant cell wall degrading enzymes generated by Mu transpososome-mediated insertion mutagenesis.

PubMed

Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres

2005-02-01

As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.

Development of a femoral template for computer-assisted tunnel placement in anatomical double-bundle ACL reconstruction.

PubMed

Luites, J W H; Wymenga, A B; Blankevoort, L; Kooloos, J M G; Verdonschot, N

2011-01-01

Femoral graft placement is an important factor in the success of anterior cruciate ligament (ACL) reconstruction. In addition to improving the accuracy of femoral tunnel placement, Computer Assisted Surgery (CAS) can be used to determine the anatomic location. This is achieved by using a 3D femoral template which indicates the position of the anatomical ACL center based on endoscopically measurable landmarks. This study describes the development and application of this method. The template is generated through statistical shape analysis of the ACL insertion, with respect to the anteromedial (AM) and posterolateral (PL) bundles. The ligament insertion data, together with the osteocartilage edge on the lateral notch, were mapped onto a cylinder fitted to the intercondylar notch surface (n = 33). Anatomic variation, in terms of standard variation of the positions of the ligament centers in the template, was within 2.2 mm. The resulting template was programmed in a computer-assisted navigation system for ACL replacement and its accuracy and precision were determined on 31 femora. It was found that with the navigation system the AM and PL tunnels could be positioned with an accuracy of 2.5 mm relative to the anatomic insertion centers; the precision was 2.4 mm. This system consists of a template that can easily be implemented in 3D computer navigation software. Requiring no preoperative images and planning, the system provides adequate accuracy and precision to position the entrance of the femoral tunnels for anatomical single- or double-bundle ACL reconstruction.

Laparoscopic Mesh Fixation Using Laser-Assisted Tissue Soldering in a Porcine Model

PubMed Central

Soltz, Barbara A.; Stadler, Istvan; Soltz, Robert

2009-01-01

Background and Objective: Animal studies using open surgical models indicate that collagen solder is capable of fixation of surgical meshes without interfering with tissue integration, increasing adhesions, or increasing inflammation intraperitoneally. This study describes development of instrumentation and techniques for laparoscopic herniorrhaphy using laser-assisted soldering technology. Study Design and Methods: Anesthetized 20 kg to 25 kg female Yorkshire pigs underwent laparoscopy with a 3-trocar technique. Parietex TET, Parietex TEC, and Prolene mesh segments (5 × 5 cm) were embedded in 55% collagen solder. Segments were inserted by using a specially designed introducer and affixed to the peritoneum by using prototype laser devices (1.45 µ, 4.5 W continuous wave, 5-mm spot, 55° C set temperature) and a custom laparoscopic handpiece (IPOM). Parietex PCO mesh was inserted and affixed using the Endo-hernia stapler (Control). Animals were recovered and underwent second-look laparoscopy at 6 weeks. Mesh sites were harvested after animals were euthanized. Results: The mesh-solder constructs were easily inserted and affixed in an IPOM approach. Prolene mesh tended to curl at its edges as the solder was melted. Postoperative healing was similar to that in Control segments in all cases. Discussion and Conclusion: Collagen-based tissue soldering permits normal wound healing and may mitigate or reduce the use of staples or other foreign bodies for laparoscopic mesh fixation, prevent tissue ischemia and possibly nerve entrapment, which result in severe postoperative pain and morbidity. Laser-assisted mesh fixation is a promising alternative for laparoscopic herniorrhaphy. Further development of this strategy is warranted. PMID:19793465

Insulation of Enhancer-Promoter Communication by a Gypsy Transposon Insert in the Drosophila cut Gene: Cooperation between Suppressor of Hairy-wing and Modifier of mdg4 Proteins

PubMed Central

Gause, Maria; Morcillo, Patrick; Dorsett, Dale

2001-01-01

The Drosophila mod(mdg4) gene products counteract heterochromatin-mediated silencing of the white gene and help activate genes of the bithorax complex. They also regulate the insulator activity of the gypsy transposon when gypsy inserts between an enhancer and promoter. The Su(Hw) protein is required for gypsy-mediated insulation, and the Mod(mdg4)-67.2 protein binds to Su(Hw). The aim of this study was to determine whether Mod(mdg4)-67.2 is a coinsulator that helps Su(Hw) block enhancers or a facilitator of activation that is inhibited by Su(Hw). Here we provide evidence that Mod(mdg4)-67.2 acts as a coinsulator by showing that some loss-of-function mod(mdg4) mutations decrease enhancer blocking by a gypsy insert in the cut gene. We find that the C terminus of Mod(mdg4)-67.2 binds in vitro to a region of Su(Hw) that is required for insulation, while the N terminus mediates self-association. The N terminus of Mod(mdg4)-67.2 also interacts with the Chip protein, which facilitates activation of cut. Mod(mdg4)-67.2 truncated in the C terminus interferes in a dominant-negative fashion with insulation in cut but does not significantly affect heterochromatin-mediated silencing of white. We infer that multiple contacts between Su(Hw) and a Mod(mdg4)-67.2 multimer are required for insulation. We theorize that Mod(mdg4)-67.2 usually aids gene activation but can also act as a coinsulator by helping Su(Hw) trap facilitators of activation, such as the Chip protein. PMID:11416154

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

PubMed

Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

2015-11-18

RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation.

PubMed

Goulin, Eduardo Henrique; Savi, Daiani Cristina; Petters, Desirrê Alexia Lourenço; Kava, Vanessa; Galli-Terasawa, Lygia; Silva, Geraldo José; Glienke, Chirlei

2016-11-01

Phyllosticta citricarpa is the epidemiological agent of Citrus Black Spot (CBS) disease, which is responsible for large economic losses worldwide. CBS is characterized by the presence of spores (pycnidiospores) in dark lesions of fruit, which are also responsible for short distance dispersal of the disease. The identification of genes involved in asexual reproduction of P. citricarpa can be an alternative for directional disease control. We analyzed a library of mutants obtained through Agrobacterium tumefaciens transformation system, looking for alterations in growth and reproductive structure formation. Two mutant strains were found to have lost the ability to form pycnidia. The flanking T-DNA insertion regions were identified on P. citricarpa genome by using blast analysis and further gene prediction. The predicted genes containing the T-DNA insertions were identified as Spindle Poison Sensitivity Scp3, Ion Transport protein, and Cullin Binding proteins. The Ion Transport and Cullin Binding proteins are known to be correlated with sexual and asexual reproduction in fungi; however, the exact mechanism by which these proteins act on spore formation in P. citricarpa needs to be better characterized. The Scp3 proteins are suggested here for the first time as being associated with asexual reproduction in fungus. This protein is associated with microtubule formation, and as microtubules play an essential role as spindle machinery for chromosome segregation and cytokinesis, insertions in this gene can lead to abnormal formations, such as that observed here in P. citricarpa. We suggest these genes as new targets for fungicide development and CBS disease control, by iRNA. Copyright © 2016 Elsevier GmbH. All rights reserved.

Identification of Tumor Rejection Antigens for Breast Cancer Using a Mouse Tumor Rejection Model

DTIC Science & Technology

2009-05-01

plaques were randomly picked and PCR with T3 and T7 primer was done to validate the cDNA insert. The inserts ranged from 500 to 3,500 bp. A...modifications. Briefly, 5 103 phage clones were plated with XL-Blue on NZY agar plates. After 4 hours of incubation at 37jC, isopropyl-L-thio-h-D...using XLOLR cells and ExAssist helper phage (Stratagene). Plasmid DNA was prepared using a FastPlasmid kit (Eppendorf, Hamburg, Germany). The nucleotide

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

PubMed Central

Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena

2016-01-01

ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816

Human Alu insertion polymorphisms in North African populations.

PubMed

Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel

2011-10-01

Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

Resources for Biological Annotation of the Drosophila Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerald M. Rubin

2005-08-08

This project supported seed money for the development of cDNA and genetic resources to support studies of the Drosophila melanogaster genome. Key publications supported by this work that provide additional detail: (1) ''The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes''; and (2) ''The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes''.

Genetic resources offer efficient tools for rice functional genomics research.

PubMed

Lo, Shuen-Fang; Fan, Ming-Jen; Hsing, Yue-Ie; Chen, Liang-Jwu; Chen, Shu; Wen, Ien-Chie; Liu, Yi-Lun; Chen, Ku-Ting; Jiang, Mirng-Jier; Lin, Ming-Kuang; Rao, Meng-Yen; Yu, Lin-Chih; Ho, Tuan-Hua David; Yu, Su-May

2016-05-01

Rice is an important crop and major model plant for monocot functional genomics studies. With the establishment of various genetic resources for rice genomics, the next challenge is to systematically assign functions to predicted genes in the rice genome. Compared with the robustness of genome sequencing and bioinformatics techniques, progress in understanding the function of rice genes has lagged, hampering the utilization of rice genes for cereal crop improvement. The use of transfer DNA (T-DNA) insertional mutagenesis offers the advantage of uniform distribution throughout the rice genome, but preferentially in gene-rich regions, resulting in direct gene knockout or activation of genes within 20-30 kb up- and downstream of the T-DNA insertion site and high gene tagging efficiency. Here, we summarize the recent progress in functional genomics using the T-DNA-tagged rice mutant population. We also discuss important features of T-DNA activation- and knockout-tagging and promoter-trapping of the rice genome in relation to mutant and candidate gene characterizations and how to more efficiently utilize rice mutant populations and datasets for high-throughput functional genomics and phenomics studies by forward and reverse genetics approaches. These studies may facilitate the translation of rice functional genomics research to improvements of rice and other cereal crops. © 2015 John Wiley & Sons Ltd.

Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

PubMed Central

Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

2010-01-01

Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

Percutaneous Sacroiliac Screw Placement: A Prospective Randomized Comparison of Robot-assisted Navigation Procedures with a Conventional Technique

PubMed Central

Wang, Jun-Qiang; Wang, Yu; Feng, Yun; Han, Wei; Su, Yong-Gang; Liu, Wen-Yong; Zhang, Wei-Jun; Wu, Xin-Bao; Wang, Man-Yi; Fan, Yu-Bo

2017-01-01

Background: Sacroiliac (SI) screw fixation is a demanding technique, with a high rate of screw malposition due to the complex pelvic anatomy. TiRobot™ is an orthopedic surgery robot which can be used for SI screw fixation. This study aimed to evaluate the accuracy of robot-assisted placement of SI screws compared with a freehand technique. Methods: Thirty patients requiring posterior pelvic ring stabilization were randomized to receive freehand or robot-assisted SI screw fixation, between January 2016 and June 2016 at Beijing Jishuitan Hospital. Forty-five screws were placed at levels S1 and S2. In both methods, the primary end point screw position was assessed and classified using postoperative computed tomography. Fisher's exact probability test was used to analyze the screws’ positions. Secondary end points, such as duration of trajectory planning, surgical time after reduction of the pelvis, insertion time for guide wire, number of guide wire attempts, and radiation exposure without pelvic reduction, were also assessed. Results: Twenty-three screws were placed in the robot-assisted group and 22 screws in the freehand group; no postoperative complications or revisions were reported. The excellent and good rate of screw placement was 100% in the robot-assisted group and 95% in the freehand group. The P value (0.009) showed the same superiority in screw distribution. The fluoroscopy time after pelvic reduction in the robot-assisted group was significantly shorter than that in the freehand group (median [Q1, Q3]: 6.0 [6.0, 9.0] s vs. median [Q1, Q3]: 36.0 [21.5, 48.0] s; χ2 = 13.590, respectively, P < 0.001); no difference in operation time after reduction of the pelvis was noted (χ2 = 1.990, P = 0.158). Time for guide wire insertion was significantly shorter for the robot-assisted group than that for the freehand group (median [Q1, Q3]: 2.0 [2.0, 2.7] min vs. median [Q1, Q3]: 19.0 [15.5, 45.0] min; χ2 = 20.952, respectively, P < 0.001). The number of guide wire attempts in the robot-assisted group was significantly less than that in the freehand group (median [Q1, Q3]: 1.0 [1.0,1.0] time vs. median [Q1, Q3]: 7.0 [1.0, 9.0] times; χ2 = 15.771, respectively, P < 0.001). The instrumented SI levels did not differ between both groups (from S1 to S2, χ2 = 4.760, P = 0.093). Conclusions: Accuracy of the robot-assisted technique was superior to that of the freehand technique. Robot-assisted navigation is safe for unstable posterior pelvic ring stabilization, especially in S1, but also in S2. SI screw insertion with robot-assisted navigation is clinically feasible. PMID:29067950

Percutaneous Sacroiliac Screw Placement: A Prospective Randomized Comparison of Robot-assisted Navigation Procedures with a Conventional Technique.

PubMed

Wang, Jun-Qiang; Wang, Yu; Feng, Yun; Han, Wei; Su, Yong-Gang; Liu, Wen-Yong; Zhang, Wei-Jun; Wu, Xin-Bao; Wang, Man-Yi; Fan, Yu-Bo

2017-11-05

Sacroiliac (SI) screw fixation is a demanding technique, with a high rate of screw malposition due to the complex pelvic anatomy. TiRobot™ is an orthopedic surgery robot which can be used for SI screw fixation. This study aimed to evaluate the accuracy of robot-assisted placement of SI screws compared with a freehand technique. Thirty patients requiring posterior pelvic ring stabilization were randomized to receive freehand or robot-assisted SI screw fixation, between January 2016 and June 2016 at Beijing Jishuitan Hospital. Forty-five screws were placed at levels S1 and S2. In both methods, the primary end point screw position was assessed and classified using postoperative computed tomography. Fisher's exact probability test was used to analyze the screws' positions. Secondary end points, such as duration of trajectory planning, surgical time after reduction of the pelvis, insertion time for guide wire, number of guide wire attempts, and radiation exposure without pelvic reduction, were also assessed. Twenty-three screws were placed in the robot-assisted group and 22 screws in the freehand group; no postoperative complications or revisions were reported. The excellent and good rate of screw placement was 100% in the robot-assisted group and 95% in the freehand group. The P value (0.009) showed the same superiority in screw distribution. The fluoroscopy time after pelvic reduction in the robot-assisted group was significantly shorter than that in the freehand group (median [Q1, Q3]: 6.0 [6.0, 9.0] s vs. median [Q1, Q3]: 36.0 [21.5, 48.0] s; χ2 = 13.590, respectively, P < 0.001); no difference in operation time after reduction of the pelvis was noted (χ2 = 1.990, P = 0.158). Time for guide wire insertion was significantly shorter for the robot-assisted group than that for the freehand group (median [Q1, Q3]: 2.0 [2.0, 2.7] min vs. median [Q1, Q3]: 19.0 [15.5, 45.0] min; χ2 = 20.952, respectively, P < 0.001). The number of guide wire attempts in the robot-assisted group was significantly less than that in the freehand group (median [Q1, Q3]: 1.0 [1.0,1.0] time vs. median [Q1, Q3]: 7.0 [1.0, 9.0] times; χ2 = 15.771, respectively, P < 0.001). The instrumented SI levels did not differ between both groups (from S1 to S2, χ2 = 4.760, P = 0.093). Accuracy of the robot-assisted technique was superior to that of the freehand technique. Robot-assisted navigation is safe for unstable posterior pelvic ring stabilization, especially in S1, but also in S2. SI screw insertion with robot-assisted navigation is clinically feasible.

Characterization of a Gene Family Encoding SEA (Sea-urchin Sperm Protein, Enterokinase and Agrin)-Domain Proteins with Lectin-Like and Heme-Binding Properties from Schistosoma japonicum

PubMed Central

Mbanefo, Evaristus Chibunna; Kikuchi, Mihoko; Huy, Nguyen Tien; Shuaibu, Mohammed Nasir; Cherif, Mahamoud Sama; Yu, Chuanxin; Wakao, Masahiro; Suda, Yasuo; Hirayama, Kenji

2014-01-01

Background We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. Methodology/Principal Findings Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin)-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10−6 M) and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. Conclusions The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation), and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted. PMID:24416467

Tn-Seq Analysis of Vibrio cholerae Intestinal Colonization Reveals a Role for T6SS-Mediated Antibacterial Activity in the Host

PubMed Central

Fu, Yang; Waldor, Matthew K.; Mekalanos, John J.

2014-01-01

SUMMARY Analysis of genes required for host infection will provide clues to the drivers of evolutionary fitness of pathogens like Vibrio cholerae, a mounting threat to global heath. We used transposon insertion site sequencing (Tn-seq) to comprehensively assess the contribution of nearly all V. cholerae genes toward growth in the infant rabbit intestine. Four hundred genes were identified as critical to V. cholerae in vivo fitness. These included most known colonization factors and several new genes affecting the bacterium's metabolic properties, resistance to bile, and ability to synthesize cyclic AMP-GMP. Notably, a mutant carrying an insertion in tsiV3, encoding immunity to a bacteriocidal type VI secretion system (T6SS) effector VgrG3, exhibited a colonization defect. The reduced in vivo fitness of tsiV3 mutants depends on their cocolonization with bacterial cells carrying an intact T6SS locus and VgrG3 gene, suggesting that the V. cholerae T6SS is functional and mediates antagonistic interbacterial interactions during infection. PMID:24331463

A baculovirus dual expression vector derived from the Autographa californica nuclear polyhedrosis virus polyhedrin and p10 promoters: co-expression of two influenza virus genes in insect cells.

PubMed

Weyer, U; Possee, R D

1991-12-01

A baculovirus transfer vector, pAcUW3, was developed to facilitate the insertion of two influenza virus genes, those encoding the haemagglutinin (HA) and neuraminidase (NA) membrane glycoproteins, into the Autographa californica nuclear polyhedrosis virus genome in a single cotransfection experiment. The NA gene was inserted in place of the polyhedrin coding sequences under the control of the polyhedrin promoter, whereas the HA gene was placed under the control of a copy of the p10 promoter at a site upstream of and in opposite orientation to the polyhedrin promoter. After infection of Spodoptera frugiperda cells with the recombinant virus, AcUW3HANA, both HA and NA were expressed in the very late phase of infection and were shown to be functional in appropriate assays. Immunofluorescence assays demonstrated their localization at the surface of infected insect cells. The expression of both foreign genes in the recombinant virus was found to be stable for at least 12 passages in cell culture.

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Solar system 'fast mission' trajectories using aerogravity assist

NASA Technical Reports Server (NTRS)

Randolph, James E.; Mcronald, Angus D.

1992-01-01

Initial analyses of the aerogravity assist (AGA) delivery technique to solar system targets (and beyond) has been encouraging. Mission opportunities are introduced that do not exist with typical gravity assist trajectories and current launch capabilities. The technique has the most payoff for high-energy missions such as outer planet orbiters and flybys. The goal of this technique is to reduce the flight duration significantly and to eliminate propulsion for orbit insertion. The paper will discuss detailed analyses and parametric studies that consider launch opportunities for missions to the sun, Saturn, Uranus, Neptune, and Pluto using AGA at Venus and Mars.

Type 3 fimbriae and biofilm formation are regulated by the transcriptional regulators MrkHI in Klebsiella pneumoniae.

PubMed

Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven

2011-07-01

Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.

Type 3 Fimbriae and Biofilm Formation Are Regulated by the Transcriptional Regulators MrkHI in Klebsiella pneumoniae▿

PubMed Central

Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven

2011-01-01

Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997

A mixed group II/group III twintron in the Euglena gracilis chloroplast ribosomal protein S3 gene: evidence for intron insertion during gene evolution.

PubMed Central

Copertino, D W; Christopher, D A; Hallick, R B

1991-01-01

The splicing of a 409 nucleotide intron from the Euglena gracilis chloroplast ribosomal protein S3 gene (rps3) was examined by cDNA cloning and sequencing, and northern hybridization. Based on the characterization of a partially spliced pre-mRNA, the intron was characterized as a 'mixed' twintron, composed of a 311 nucleotide group II intron internal to a 98 nucleotide group III intron. Twintron excision is via a 2-step sequential splicing pathway, with removal of the internal group II intron preceding excision of the external group III intron. Based on secondary structural analysis of the twintron, we propose that group III introns may represent highly degenerate versions of group II introns. The existence of twintrons is interpreted as evidence that group II introns were inserted during the evolution of Euglena chloroplast genes from a common ancestor with eubacteria, archaebacteria, cyanobacteria, and other chloroplasts. Images PMID:1721702

Heme and menaquinone induced electron transport in lactic acid bacteria.

PubMed

Brooijmans, Rob; Smit, Bart; Santos, Filipe; van Riel, Jan; de Vos, Willem M; Hugenholtz, Jeroen

2009-05-29

For some lactic acid bacteria higher biomass production as a result of aerobic respiration has been reported upon supplementation with heme and menaquinone. In this report, we have studied a large number of species among lactic acid bacteria for the existence of this trait. Heme- (and menaquinone) stimulated aerobic growth was observed for several species and genera of lactic acid bacteria. These include Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacilllus brevis, Lactobacillus paralimentarius, Streptococcus entericus and Lactococcus garviae. The increased biomass production without further acidification, which are respiration associated traits, are suitable for high-throughput screening as demonstrated by the screening of 8000 Lactococcus lactis insertion mutants. Respiration-negative insertion-mutants were found with noxA, bd-type cytochrome and menaquinol biosynthesis gene-disruptions. Phenotypic screening and in silico genome analysis suggest that respiration can be considered characteristic for certain species. We propose that the cyd-genes were present in the common ancestor of lactic acid bacteria, and that multiple gene-loss events best explains the observed distribution of these genes among the species.

Cytokine-independent growth and clonal expansion of a primary human CD8+ T-cell clone following retroviral transduction with the IL-15 gene

PubMed Central

Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.

2007-01-01

Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346

Gene relocations within chloroplast genomes of Jasminum and Menodora (Oleaceae) are due to multiple, overlapping inversions.

PubMed

Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong

2007-05-01

The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.

ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial dysfunction in patients with untreated hypertension.

PubMed

Makris, T K; Stavroulakis, G A; Dafni, U G; Gialeraki, A E; Krespi, P G; Hatzizacharias, A N; Tsoukala, C G; Vythoulkas, J S; Kyriakidis, M K

2000-11-01

Angiotensin-converting enzyme (ACE) gene polymorphism has been associated with an increased incidence of myocardial infarction. Recent studies have investigated a potential influence of ACE gene polymorphism on fibrinolysis or endothelial function. It has been previously established that essential hypertension is accompanied by endothelial dysfunction and fibrinolytic balance disorders. The aim of our study was to study the relation between ACE gene polymorphism and fibrinolytic/hemostatic factors as well as endothelial cell damage markers in patients with hypertension. The following parameters were evaluated in 104 patients with previously untreated hypertension: plasminogen activator inhibitor-1 (PAI-1), tissue plasminogen activator (tPA) antigen, fibrinogen, D-dimer, and von Willebrand factor (vWF). The genotype of the ACE gene was also determined (by the polymerase chain reaction method), and patients were characterized according to the observed alleles as deletion/deletion (DD), insertion/insertion (II), or insertion/deletion (ID). Those with DD genotype (n = 42) had significantly higher plasma levels of PAI-1 antigen (P =. 012), tPA antigen (P =.0001), fibrinogen (P =.0002), D-dimer (P =. 0001) and vWF (P =.0004) compared with ID (n = 30) or II (n = 32) genotypes. The ACE gene genotypes appeared to be significant predictors for plasma PAI-1 antigen, tPA antigen, fibrinogen, D -dimer, and vWF even after adjustment for age, sex, body mass index, triglyceride and cholesterol levels, and blood pressure. Our findings suggest that the ACE/DD genotype is associated with hemostasis balance disturbances reflecting hypercoagulability and endothelial damage in patients with untreated hypertension.

Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.

PubMed

Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P

2018-05-10

Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.

DNA transposon-based gene vehicles - scenes from an evolutionary drive

PubMed Central

2013-01-01

DNA transposons are primitive genetic elements which have colonized living organisms from plants to bacteria and mammals. Through evolution such parasitic elements have shaped their host genomes by replicating and relocating between chromosomal loci in processes catalyzed by the transposase proteins encoded by the elements themselves. DNA transposable elements are constantly adapting to life in the genome, and self-suppressive regulation as well as defensive host mechanisms may assist in buffering ‘cut-and-paste’ DNA mobilization until accumulating mutations will eventually restrict events of transposition. With the reconstructed Sleeping Beauty DNA transposon as a powerful engine, a growing list of transposable elements with activity in human cells have moved into biomedical experimentation and preclinical therapy as versatile vehicles for delivery and genomic insertion of transgenes. In this review, we aim to link the mechanisms that drive transposon evolution with the realities and potential challenges we are facing when adapting DNA transposons for gene transfer. We argue that DNA transposon-derived vectors may carry inherent, and potentially limiting, traits of their mother elements. By understanding in detail the evolutionary journey of transposons, from host colonization to element multiplication and inactivation, we may better exploit the potential of distinct transposable elements. Hence, parallel efforts to investigate and develop distinct, but potent, transposon-based vector systems will benefit the broad applications of gene transfer. Insight and clever optimization have shaped new DNA transposon vectors, which recently debuted in the first DNA transposon-based clinical trial. Learning from an evolutionary drive may help us create gene vehicles that are safer, more efficient, and less prone for suppression and inactivation. PMID:24320156

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

Comparative biomechanical effectiveness of over-the-counter devices for individuals with a flexible flatfoot secondary to forefoot varus.

PubMed

Hurd, Wendy J; Kavros, Steven J; Kaufman, Kenton R

2010-11-01

Evaluate effects of a new off-the-shelf insert on frontal plane foot biomechanics and compare effectiveness of the new and an existing off-the-shelf insert and a motion-control shoe in neutralizing frontal plane foot biomechanics. Descriptive. Biomechanics laboratory. Fifteen uninjured subjects with a flexible flatfoot secondary to forefoot varus. Three-dimensional kinematic and kinetic data were collected as subjects walked and jogged at their self-selected speed while wearing a motion-control running shoe, the shoe with a new off-the-shelf insert, and the shoe with an existing off-the-shelf insert. Frontal plane kinematics and rearfoot kinetics were evaluated during stance. Statistical analysis was performed using a repeated measures analysis of variance and Student-Newman-Keuls post hoc tests (α ≤ 0.05). The new insert and motion-control shoe placed the forefoot in a less-everted position than the existing off-the-shelf insert during walking. There were no differences in forefoot kinematics during jogging, nor were there differences in rearfoot motion during walking or jogging. The rearfoot eversion moment was significantly lower with the new off-the-shelf insert compared with the motion-control shoe and the existing insert during walking and jogging. A new off-the-shelf device is available that promotes more neutral frontal plane biomechanics, thus providing a theoretical rationale for using this device for injury prevention and treatment. The comparative biomechanical effectiveness of a motion-control shoe and the orthotic inserts may assist health care professionals in selecting a device to correct the flatfoot structure.

Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

PubMed Central

Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

PubMed Central

Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

PubMed

Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

Effect of impeller design and spacing on gas exchange in a percutaneous respiratory assist catheter.

PubMed

Jeffries, R Garrett; Frankowski, Brian J; Burgreen, Greg W; Federspiel, William J

2014-12-01

Providing partial respiratory assistance by removing carbon dioxide (CO2 ) can improve clinical outcomes in patients suffering from acute exacerbations of chronic obstructive pulmonary disease and acute respiratory distress syndrome. An intravenous respiratory assist device with a small (25 Fr) insertion diameter eliminates the complexity and potential complications associated with external blood circuitry and can be inserted by nonspecialized surgeons. The impeller percutaneous respiratory assist catheter (IPRAC) is a highly efficient CO2 removal device for percutaneous insertion to the vena cava via the right jugular or right femoral vein that utilizes an array of impellers rotating within a hollow-fiber membrane bundle to enhance gas exchange. The objective of this study was to evaluate the effects of new impeller designs and impeller spacing on gas exchange in the IPRAC using computational fluid dynamics (CFD) and in vitro deionized water gas exchange testing. A CFD gas exchange and flow model was developed to guide a progressive impeller design process. Six impeller blade geometries were designed and tested in vitro in an IPRAC device with 2- or 10-mm axial spacing and varying numbers of blades (2-5). The maximum CO2 removal efficiency (exchange per unit surface area) achieved was 573 ± 8 mL/min/m(2) (40.1 mL/min absolute). The gas exchange rate was found to be largely independent of blade design and number of blades for the impellers tested but increased significantly (5-10%) with reduced axial spacing allowing for additional shaft impellers (23 vs. 14). CFD gas exchange predictions were within 2-13% of experimental values and accurately predicted the relative improvement with impellers at 2- versus 10-mm axial spacing. The ability of CFD simulation to accurately forecast the effects of influential design parameters suggests it can be used to identify impeller traits that profoundly affect facilitated gas exchange. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Cas9-Guide RNA Directed Genome Editing in Soybean[OPEN

PubMed Central

Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P.; Koellhoffer, Jessica P.; Huang, Lingxia; Ward, R. Timothy; Clifton, Elizabeth; Falco, S. Carl; Cigan, A. Mark

2015-01-01

Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing. PMID:26294043

A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

PubMed Central

Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

2011-01-01

Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

A prospective comparison of performance during back-to-back, anterograde manual spiral enteroscopy and double-balloon enteroscopy.

PubMed

Despott, Edward J; Murino, Alberto; Bourikas, Leonidas; Nakamura, Masanao; Ramachandra, Vino; Fraser, Chris

2015-05-01

Spiral enteroscopy is a recently introduced technology alternative to balloon-assisted enteroscopy for examination of the small bowel. To compare small bowel insertion depths and procedure duration by spiral enteroscopy and double-balloon enteroscopy performed in the same cohort of patients, in immediate succession, using the same method of insertion depth estimation. A prospective, back-to-back comparative study was performed in 15 patients. Spiral enteroscopy procedures were performed first and a tattoo was placed to mark the most distal point. Double-balloon enteroscopy passed the tattoo placed at spiral enteroscopy in 14/15 cases (93%). Median insertion depths for double-balloon enteroscopy and spiral enteroscopy were 265cm and 175cm, respectively (P=0.004). Median time to achieve maximal depth of insertion was significantly shorter for spiral enteroscopy compared with double-balloon enteroscopy (24min vs. 45min, respectively; P=0.0005). However, in 14 patients no differences were found in median time to reach the same insertion depth (P=0.28). Double-balloon enteroscopy achieved significantly greater small bowel insertion depth than spiral enteroscopy. Although overall double-balloon enteroscopy procedure duration was longer, the time taken to reach the same small bowel insertion depth by both spiral enteroscopy and double-balloon enteroscopy was similar. Copyright © 2015 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

Novel genes associated with enhanced motility of Escherichia coli ST131

PubMed Central

Kakkanat, Asha; Phan, Minh-Duy; Lo, Alvin W.; Beatson, Scott A.

2017-01-01

Uropathogenic Escherichia coli (UPEC) is the cause of ~75% of all urinary tract infections (UTIs) and is increasingly associated with multidrug resistance. This includes UPEC strains from the recently emerged and globally disseminated sequence type 131 (ST131), which is now the dominant fluoroquinolone-resistant UPEC clone worldwide. Most ST131 strains are motile and produce H4-type flagella. Here, we applied a combination of saturated Tn5 mutagenesis and transposon directed insertion site sequencing (TraDIS) as a high throughput genetic screen and identified 30 genes associated with enhanced motility of the reference ST131 strain EC958. This included 12 genes that repress motility of E. coli K-12, four of which (lrhA, ihfA, ydiV, lrp) were confirmed in EC958. Other genes represented novel factors that impact motility, and we focused our investigation on characterisation of the mprA, hemK and yjeA genes. Mutation of each of these genes in EC958 led to increased transcription of flagellar genes (flhD and fliC), increased expression of the FliC flagellin, enhanced flagella synthesis and a hyper-motile phenotype. Complementation restored all of these properties to wild-type level. We also identified Tn5 insertions in several intergenic regions (IGRs) on the EC958 chromosome that were associated with enhanced motility; this included flhDC and EC958_1546. In both of these cases, the Tn5 insertions were associated with increased transcription of the downstream gene(s), which resulted in enhanced motility. The EC958_1546 gene encodes a phage protein with similarity to esterase/deacetylase enzymes involved in the hydrolysis of sialic acid derivatives found in human mucus. We showed that over-expression of EC958_1546 led to enhanced motility of EC958 as well as the UPEC strains CFT073 and UTI89, demonstrating its activity affects the motility of different UPEC strains. Overall, this study has identified and characterised a number of novel factors associated with enhanced UPEC motility. PMID:28489862

An insertion approach electrochemical aptasensor for mucin 1 detection based on exonuclease-assisted target recycling.

PubMed

Wen, Wei; Hu, Rong; Bao, Ting; Zhang, Xiuhua; Wang, Shengfu

2015-09-15

In this work, a sensitive exonuclease-assisted amplification electrochemical aptasensor through insertion approach was developed for the detection of mucin 1 (MUC 1). In order to construct the aptasensor, 6-Mercapto-1-hexanol (MCH) was used to block partial sites of gold electrode (GE), followed by thiolated capture probe self-assembled on GE. Methylene blue (MB) labeled aptamer hybridized with capture probe at both ends to form double-strand DNA. For the MB labeled termini was close to GE, the electrochemical response was remarkable. The presence of MUC 1 caused the dissociation of the double-strand DNA owing to the specific recognition of aptamer to MUC 1. Then exonuclease I (Exo I) selectively digested the aptamer which bound with MUC 1, the released MUC 1 participated new binding with the rest aptamer. Insertion approach improved the reproducibility and Exo I-catalyzed target recycling improved the sensitivity of the aptasensor significantly. Under optimal experimental conditions, the proposed aptasensor had a good linear correlation ranged from 10 pM to 1 μM with a detection limit of 4 pM (Signal to Noise ratio, S/N=3). The strategy had great potential for the simple and sensitive detection of other cancer markers. Copyright © 2015 Elsevier B.V. All rights reserved.

Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

PubMed

Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

2015-08-01

Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley.

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

MERE1, a low-copy-number copia-type retroelement in Medicago truncatula active during tissue culture.

PubMed

Rakocevic, Alexandra; Mondy, Samuel; Tirichine, Leïla; Cosson, Viviane; Brocard, Lysiane; Iantcheva, Anelia; Cayrel, Anne; Devier, Benjamin; Abu El-Heba, Ghada Ahmed; Ratet, Pascal

2009-11-01

We have identified an active Medicago truncatula copia-like retroelement called Medicago RetroElement1-1 (MERE1-1) as an insertion in the symbiotic NSP2 gene. MERE1-1 belongs to a low-copy-number family in the sequenced Medicago genome. These copies are highly related, but only three of them have a complete coding region and polymorphism exists between the long terminal repeats of these different copies. This retroelement family is present in all M. truncatula ecotypes tested but also in other legume species like Lotus japonicus. It is active only during tissue culture in both R108 and Jemalong Medicago accessions and inserts preferentially in genes.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

PubMed

Rodić, Nemanja; Burns, Kathleen H

2013-03-01

LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

Characterization of T-DNA insertion mutants with decreased virulence in the entomopathogenic fungus Beauveria bassiana JEF-007.

PubMed

Kim, Sihyeon; Lee, Se Jin; Nai, Yu-Shin; Yu, Jeong Seon; Lee, Mi Rong; Yang, Yi-Ting; Kim, Jae Su

2016-10-01

The bean bug, Riptortus pedestris, is a major agricultural pest that reduces crop quality and value. Chemical pesticides have contributed to pest management, but resistance to these chemicals has significantly limited their use. Alternative strategies with different modes of action, such as entomopathogenic fungi, are therefore of great interest. Herein, we explored how entomopathogenic fungi can potentially be used to control the bean bug and focused on identifying virulence-related genes. Beauveria bassiana (JEF isolates) were assayed against bean bugs under laboratory conditions. One isolate, JEF-007, showed >80 % virulence by both spray and contact exposure methods. Agrobacterium tumefaciens-mediated transformation (AtMT) of JEF-007 generated 249 random transformants, two of which (B1-06 and C1-49) showed significantly reduced virulence against Tenebrio molitor and R. pedestris immatures. Both species were used for rapid screening of virulence-reduced mutants. The two transformants had different morphologies, conidial production, and thermotolerance than the wild type. To determine the localization of the randomly inserted T-DNA, thermal asymmetric interlaced (TAIL) PCR was conducted and analysis of the two clones found multiple T-DNA insertions (two in B1-06 and three in C1-49). Genes encoding complex I intermediate-associated protein 30 (CIA30) and the autophagy protein (Atg22) were possibly disrupted by the T-DNA insertion and might be involved in the virulence. This work provides a strong platform for future functional genetic studies of bean bug-pathogenic B. bassiana. The genes putatively involved in fungal virulence should be experimentally validated by knockdown in future studies.

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

PubMed

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Detection and characterization of miniature inverted-repeat transposable elements in “Candidatus Liberibacter asiaticus”

USDA-ARS?s Scientific Manuscript database

Miniature inverted-repeat transposable elements (MITEs) are non-autonomous transposons (devoid a transposase gene, tps) involving insertion/deletion of genomic DNA in bacterial genomes influencing gene functions. No transposon has yet been reported in “Candidatus Liberibacter asiaticus”, an alpha-pr...

Counterbalancing clinical supervision and independent practice: case studies in learning thoracic epidural catheter insertion.

PubMed

Johnson, T

2010-12-01

Thoracic epidural catheter placement is an example of a demanding and high-risk clinical skill that junior anaesthetists need to learn by experience and under the supervision of consultants. This learning is known to present challenges that require further study. Ten consultant and 10 trainee anaesthetists in a teaching hospital were interviewed about teaching and learning this skill in the operating theatre, and a phenomenological analysis of their experience was performed. Trainee participation was limited by time pressure, lack of familiarity with consultants, and consultants' own need for clinical experience. There was a particular tension between safe and effective consultant practice and permitting trainees' independence. Three distinct stages of participation and assistance were identified from reports of ideal practice: early (part-task or basic procedure, consultant always present giving instruction and feedback), middle (independent practice with straightforward cases without further instruction), and late (skill extension and transfer). Learning assistance provided by consultants varied, but it was often not matched to the trainees' stages of learning. Negotiation of participation and assistance was recognized as being useful, but it did not happen routinely. There are many obstacles to trainees' participation in thoracic epidural catheter insertion, and learning assistance is not matched to need. A more explicit understanding of stages of learning is required to benefit the learning of this and other advanced clinical skills.

Video. Natural Orifice Translumenal Endoscopic Surgery with a miniature in vivo surgical robot.

PubMed

Lehman, Amy C; Dumpert, Jason; Wood, Nathan A; Visty, Abigail Q; Farritor, Shane M; Varnell, Brandon; Oleynikov, Dmitry

2009-07-01

The application of flexible endoscopy tools for Natural Orifice Translumenal Endoscopic Surgery (NOTES) is constrained due to limitations in dexterity, instrument insertion, navigation, visualization, and retraction. Miniature endolumenal robots can mitigate these constraints by providing a stable platform for visualization and dexterous manipulation. This video demonstrates the feasibility of using an endolumenal miniature robot to improve vision and to apply off-axis forces for task assistance in NOTES procedures. A two-armed miniature in vivo robot has been developed for NOTES. The robot is remotely controlled, has on-board cameras for guidance, and grasper and cautery end effectors for manipulation. Two basic configurations of the robot allow for flexibility during insertion and rigidity for visualization and tissue manipulation. Embedded magnets in the body of the robot and in an exterior surgical console are used for attaching the robot to the interior abdominal wall. This enables the surgeon to arbitrarily position the robot throughout a procedure. The visualization and task assistance capabilities of the miniature robot were demonstrated in a nonsurvivable NOTES procedure in a porcine model. An endoscope was used to create a transgastric incision and advance an overtube into the peritoneal cavity. The robot was then inserted through the overtube and into the peritoneal cavity using an endoscope. The surgeon successfully used the robot to explore the peritoneum and perform small-bowel dissection. This study has demonstrated the feasibility of inserting an endolumenal robot per os. Once deployed, the robot provided visualization and dexterous capabilities from multiple orientations. Further miniaturization and increased dexterity will enhance future capabilities.

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

PubMed

Rurek, M; Oczkowski, M; Augustyniak, H

1998-01-01

A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

Role of the 2 adenine (g.11293_11294insAA) insertion polymorphism in the 3' untranslated region of the factor VII (FVII) gene: molecular characterization of a patient with severe FVII deficiency.

PubMed

Peyvandi, F; Garagiola, I; Palla, R; Marziliano, N; Mannucci, P M

2005-11-01

Polymorphic variants in the gene encoding factor VII (F7) affect the plasma levels of this coagulation protein and modify the clinical phenotype of FVII deficiency in some patients. In this study we report the in vitro functional analysis of a novel polymorphic variant located in the 3' untranslated region of F7: g.11293_11294insAA. To determine whether this variant regulates FVII expression, we initially compared an expression vector containing FVII cDNA with g.11293_11294insAA with the FVII wild-type (WT) construct. The kinetics of mRNA production showed that the insertion decreases the steady-state FVII mRNA levels. To assess whether the insertion influences the phenotype of FVII-deficient patients, we evaluated its effect on the expression of FVII in a patient with severe FVII deficiency (undetectable FVII activity and antigen) carrying two additional homozygous missense variations (p.Arg277Cys and p.Arg353Gln). The two substitutions alone reduced the expression of FVII activity and antigen in vitro, but with the insertion polymorphism in our expression vector the patient's phenotype of undetectable plasma FVII was recapitulated. The insertion polymorphism in the 3' untranslated region of F7 is another modifier of FVII expression that might explain the poor genotype-phenotype correlation in some FVII-deficient patients. Copyright 2005 Wiley-Liss, Inc.

A novel helper phage enabling construction of genome-scale ORF-enriched phage display libraries.

PubMed

Gupta, Amita; Shrivastava, Nimisha; Grover, Payal; Singh, Ajay; Mathur, Kapil; Verma, Vaishali; Kaur, Charanpreet; Chaudhary, Vijay K

2013-01-01

Phagemid-based expression of cloned genes fused to the gIIIP coding sequence and rescue using helper phages, such as VCSM13, has been used extensively for constructing large antibody phage display libraries. However, for randomly primed cDNA and gene fragment libraries, this system encounters reading frame problems wherein only one of 18 phages display the translated foreign peptide/protein fused to phagemid-encoded gIIIP. The elimination of phages carrying out-of-frame inserts is vital in order to improve the quality of phage display libraries. In this study, we designed a novel helper phage, AGM13, which carries trypsin-sensitive sites within the linker regions of gIIIP. This renders the phage highly sensitive to trypsin digestion, which abolishes its infectivity. For open reading frame (ORF) selection, the phagemid-borne phages are rescued using AGM13, so that clones with in-frame inserts express fusion proteins with phagemid-encoded trypsin-resistant gIIIP, which becomes incorporated into the phages along with a few copies of AGM13-encoded trypsin-sensitive gIIIP. In contrast, clones with out-of-frame inserts produce phages carrying only AGM13-encoded trypsin-sensitive gIIIP. Trypsin treatment of the phage population renders the phages with out-of-frame inserts non-infectious, whereas phages carrying in-frame inserts remain fully infectious and can hence be enriched by infection. This strategy was applied efficiently at a genome scale to generate an ORF-enriched whole genome fragment library from Mycobacterium tuberculosis, in which nearly 100% of the clones carried in-frame inserts after selection. The ORF-enriched libraries were successfully used for identification of linear and conformational epitopes for monoclonal antibodies specific to mycobacterial proteins.

Whole genome analyses of marine fish pathogenic isolate, Mycobacterium sp. 012931.

PubMed

Kurokawa, Satoru; Kabayama, Jun; Hwang, Seong Don; Nho, Seong Won; Hikima, Jun-ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Mori, Tetsushi; Aoki, Takashi

2014-10-01

Mycobacterium is a genus within the order Actinomycetales that comprises of a large number of well-characterized species, several of which includes pathogens known to cause serious disease in human and animal. Here, we report the whole genome sequence of Mycobacterium sp. strain 012931 isolated from the marine fish, yellowtail (Seriola quinqueradiata). Mycobacterium sp. 012931 is a fish pathogen causing serious damage to aquaculture farms in Japan. DNA dot plot analysis showed that Mycobacterium sp. 012931 was more closely related to Mycobacterium marinum when compared across several Mycobacterium species. However, little conservation of the gene order was observed between Mycobacterium sp. 012931 and M. marinum genome. The annotated 5,464 genes of Mycobacterium sp. 012931 was classified into 26 subsystems. The insertion/deletion gene analysis shows Mycobacterium sp. 012931 had 643 unique genes that were not found in the M. marinum strains. In the virulence, disease, and defense subsystem, both insertion and deletion genes of Mycobacterium sp. 012931 were associated with the PPE gene cluster of Mycobacteria. Of seven plcB genes in Mycobacterium sp. 012931, plcB_2 and plcB_3 showed low identities with those of M. marinum strains. Therefore, Mycobacterium sp. 012931 has differences on genetic and virulence from M. marinum and may induce different interaction mechanisms between host and pathogen.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

PubMed

Luo, Ming; Gilbert, Brian; Ayliffe, Michael

2016-07-01

Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

PubMed

Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

2011-10-01

A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing

PubMed Central

Gilling, Damian H.; Luna, Vicki Ann; Pflugradt, Cori

2014-01-01

The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future. PMID:27350960

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon.

PubMed

Lorenzen, Marcé D; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W

2008-07-22

Maternal-Effect Dominant Embryonic Arrest ("Medea") factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea(1) activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea(1) reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations.

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon

PubMed Central

Lorenzen, Marcé D.; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J.; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W.

2008-01-01

Maternal-Effect Dominant Embryonic Arrest (“Medea”) factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea1 activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea1 reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations. PMID:18621706

A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

DOE PAGES

Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...

2015-03-31

Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less

Correlation between connexin 32 gene mutations and clinical phenotype in X-linked dominant Charcot-Marie-Tooth neuropathy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.; Ionasescu, R.; Searby, C.

1996-06-14

We studied the relationship between the genotype and clinical phenotype in 27 families with dominant X-linked Charcot-Marie-Tooth (CMTX1) neuropathy. Twenty-two families showed mutations in the coding region of the connexin32 (cx32) gene. The mutations include four nonsense mutations, eight missense mutations, two medium size deletions, and one insertion. Most missense mutations showed a mild clinical phenotype (five out of eight), whereas all nonsense mutations, the larger of the two deletions, and the insertion that produced frameshifts showed severe phenotypes. Five CMTX1 families with mild clinical phenotype showed no point mutations of the cx32 gene coding region. Three of these familiesmore » showed positive genetic linkage with the markers of the Xq13.1 region. The genetic linkage of the remaining two families could not be evaluated because of their small size. 25 refs., 1 fig., 1 tab.« less

The B73 maize genome: complexity, diversity, and dynamics.

PubMed

Schnable, Patrick S; Ware, Doreen; Fulton, Robert S; Stein, Joshua C; Wei, Fusheng; Pasternak, Shiran; Liang, Chengzhi; Zhang, Jianwei; Fulton, Lucinda; Graves, Tina A; Minx, Patrick; Reily, Amy Denise; Courtney, Laura; Kruchowski, Scott S; Tomlinson, Chad; Strong, Cindy; Delehaunty, Kim; Fronick, Catrina; Courtney, Bill; Rock, Susan M; Belter, Eddie; Du, Feiyu; Kim, Kyung; Abbott, Rachel M; Cotton, Marc; Levy, Andy; Marchetto, Pamela; Ochoa, Kerri; Jackson, Stephanie M; Gillam, Barbara; Chen, Weizu; Yan, Le; Higginbotham, Jamey; Cardenas, Marco; Waligorski, Jason; Applebaum, Elizabeth; Phelps, Lindsey; Falcone, Jason; Kanchi, Krishna; Thane, Thynn; Scimone, Adam; Thane, Nay; Henke, Jessica; Wang, Tom; Ruppert, Jessica; Shah, Neha; Rotter, Kelsi; Hodges, Jennifer; Ingenthron, Elizabeth; Cordes, Matt; Kohlberg, Sara; Sgro, Jennifer; Delgado, Brandon; Mead, Kelly; Chinwalla, Asif; Leonard, Shawn; Crouse, Kevin; Collura, Kristi; Kudrna, Dave; Currie, Jennifer; He, Ruifeng; Angelova, Angelina; Rajasekar, Shanmugam; Mueller, Teri; Lomeli, Rene; Scara, Gabriel; Ko, Ara; Delaney, Krista; Wissotski, Marina; Lopez, Georgina; Campos, David; Braidotti, Michele; Ashley, Elizabeth; Golser, Wolfgang; Kim, HyeRan; Lee, Seunghee; Lin, Jinke; Dujmic, Zeljko; Kim, Woojin; Talag, Jayson; Zuccolo, Andrea; Fan, Chuanzhu; Sebastian, Aswathy; Kramer, Melissa; Spiegel, Lori; Nascimento, Lidia; Zutavern, Theresa; Miller, Beth; Ambroise, Claude; Muller, Stephanie; Spooner, Will; Narechania, Apurva; Ren, Liya; Wei, Sharon; Kumari, Sunita; Faga, Ben; Levy, Michael J; McMahan, Linda; Van Buren, Peter; Vaughn, Matthew W; Ying, Kai; Yeh, Cheng-Ting; Emrich, Scott J; Jia, Yi; Kalyanaraman, Ananth; Hsia, An-Ping; Barbazuk, W Brad; Baucom, Regina S; Brutnell, Thomas P; Carpita, Nicholas C; Chaparro, Cristian; Chia, Jer-Ming; Deragon, Jean-Marc; Estill, James C; Fu, Yan; Jeddeloh, Jeffrey A; Han, Yujun; Lee, Hyeran; Li, Pinghua; Lisch, Damon R; Liu, Sanzhen; Liu, Zhijie; Nagel, Dawn Holligan; McCann, Maureen C; SanMiguel, Phillip; Myers, Alan M; Nettleton, Dan; Nguyen, John; Penning, Bryan W; Ponnala, Lalit; Schneider, Kevin L; Schwartz, David C; Sharma, Anupma; Soderlund, Carol; Springer, Nathan M; Sun, Qi; Wang, Hao; Waterman, Michael; Westerman, Richard; Wolfgruber, Thomas K; Yang, Lixing; Yu, Yeisoo; Zhang, Lifang; Zhou, Shiguo; Zhu, Qihui; Bennetzen, Jeffrey L; Dawe, R Kelly; Jiang, Jiming; Jiang, Ning; Presting, Gernot G; Wessler, Susan R; Aluru, Srinivas; Martienssen, Robert A; Clifton, Sandra W; McCombie, W Richard; Wing, Rod A; Wilson, Richard K

2009-11-20

We report an improved draft nucleotide sequence of the 2.3-gigabase genome of maize, an important crop plant and model for biological research. Over 32,000 genes were predicted, of which 99.8% were placed on reference chromosomes. Nearly 85% of the genome is composed of hundreds of families of transposable elements, dispersed nonuniformly across the genome. These were responsible for the capture and amplification of numerous gene fragments and affect the composition, sizes, and positions of centromeres. We also report on the correlation of methylation-poor regions with Mu transposon insertions and recombination, and copy number variants with insertions and/or deletions, as well as how uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. These analyses inform and set the stage for further investigations to improve our understanding of the domestication and agricultural improvements of maize.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Comprehensive genetic testing for female and male infertility using next-generation sequencing.

PubMed

Patel, Bonny; Parets, Sasha; Akana, Matthew; Kellogg, Gregory; Jansen, Michael; Chang, Chihyu; Cai, Ying; Fox, Rebecca; Niknazar, Mohammad; Shraga, Roman; Hunter, Colby; Pollock, Andrew; Wisotzkey, Robert; Jaremko, Malgorzata; Bisignano, Alex; Puig, Oscar

2018-05-19

To develop a comprehensive genetic test for female and male infertility in support of medical decisions during assisted reproductive technology (ART) protocols. We developed a next-generation sequencing (NGS) gene panel consisting of 87 genes including promoters, 5' and 3' untranslated regions, exons, and selected introns. In addition, sex chromosome aneuploidies and Y chromosome microdeletions were analyzed concomitantly using the same panel. The NGS panel was analytically validated by retrospective analysis of 118 genomic DNA samples with known variants in loci representative of female and male infertility. Our results showed analytical accuracy of > 99%, with > 98% sensitivity for single-nucleotide variants (SNVs) and > 91% sensitivity for insertions/deletions (indels). Clinical sensitivity was assessed with samples containing variants representative of male and female infertility, and it was 100% for SNVs/indels, CFTR IVS8-5T variants, sex chromosome aneuploidies, and copy number variants (CNVs) and > 93% for Y chromosome microdeletions. Cost analysis shows potential savings when comparing this single NGS assay with the standard approach, which includes multiple assays. A single, comprehensive, NGS panel can simplify the ordering process for healthcare providers, reduce turnaround time, and lower the overall cost of testing for genetic assessment of infertility in females and males, while maintaining accuracy.

Bioinformatics analysis to assess potential risks of allergenicity and toxicity of HRAP and PFLP proteins in genetically modified bananas resistant to Xanthomonas wilt disease.

PubMed

Jin, Yuan; Goodman, Richard E; Tetteh, Afua O; Lu, Mei; Tripathi, Leena

2017-11-01

Banana Xanthomonas wilt (BXW) disease threatens banana production and food security throughout East Africa. Natural resistance is lacking among common cultivars. Genetically modified (GM) bananas resistant to BXW disease were developed by inserting the hypersensitive response-assisting protein (Hrap) or/and the plant ferredoxin-like protein (Pflp) gene(s) from sweet pepper (Capsicum annuum). Several of these GM banana events showed 100% resistance to BXW disease under field conditions in Uganda. The current study evaluated the potential allergenicity and toxicity of the expressed proteins HRAP and PFLP based on evaluation of published information on the history of safe use of the natural source of the proteins as well as established bioinformatics sequence comparison methods to known allergens (www.AllergenOnline.org and NCBI Protein) and toxins (NCBI Protein). The results did not identify potential risks of allergy and toxicity to either HRAP or PFLP proteins expressed in the GM bananas that might suggest potential health risks to humans. We recognize that additional tests including stability of these proteins in pepsin assay, nutrient analysis and possibly an acute rodent toxicity assay may be required by national regulatory authorities. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Early-progressive dilated cardiomyopathy in a family with Becker muscular dystrophy related to a novel frameshift mutation in the dystrophin gene exon 27.

PubMed

Tsuda, Takeshi; Fitzgerald, Kristi; Scavena, Mena; Gidding, Samuel; Cox, Mary O; Marks, Harold; Flanigan, Kevin M; Moore, Steven A

2015-03-01

We report a family in which two male siblings with Becker muscular dystrophy (BMD) developed severe dilated cardiomyopathy (DCM) and progressive heart failure (HF) at age 11 years; one died at age 14 years while awaiting heart transplant and the other underwent left ventricular assist device implantation at the same age. Genetic analysis of one sibling showed a novel frameshift mutation in exon 27 of Duchenne muscular dystrophy (DMD) gene (c.3779_3785delCTTTGGAinsGG), in which seven base pairs are deleted and two are inserted. Although this predicts an amino-acid substitution and premature termination (p.Thr1260Argfs*8), muscle biopsy dystrophin immunostaining instead indicates that the mutation is more likely to alter splicing. Despite relatively preserved skeletal muscular performance, both the siblings developed progressive HF secondary to early-onset DCM. In addition, their 7-year-old nephew with delayed gross motor development, mild proximal muscle weakness and markedly elevated serum creatine kinase level (>13 000 IU l(-1)) at 16 months was recently demonstrated to have the familial DMD mutation. Here, we report a novel genotype of BMD with early-onset DCM and progressive lethal HF during early adolescence.

Biodegradation of the organic disulfide 4,4'-dithiodibutyric acid by Rhodococcus spp.

PubMed

Khairy, Heba; Wübbeler, Jan Hendrik; Steinbüchel, Alexander

2015-12-01

Four Rhodococcus spp. exhibited the ability to use 4,4'-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Lentiviral Vector Induced Insertional Haploinsufficiency of Ebf1 Causes Murine Leukemia

PubMed Central

Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute

2012-01-01

Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design. PMID:22472950

Cryptic insertion of 3'FOXO1 into inverted chromosome arm 2q in the presence of two normal chromosome 13s and 13 small interstitial duplications in a patient with alveolar rhabdomyosarcoma.

PubMed

Hackman, Sarah; Calvey, Laura; Bernreuter, Kristen; Mark, Mengya Wang; Starnes, Sarah; Batanian, Jacqueline R

2015-09-01

Alveolar rhabdomyosarcoma (ARMS) is a pediatric soft tissue neoplasm with a characteristic translocation, t(2;13)(q35;q14), which is detected in 70-80% of cases. This well-described translocation produces the gene fusion product PAX3-FOXO1. Cryptic rearrangements of this fusion have never before been reported in ARMS. Here we describe a patient with ARMS that showed, by fluorescence in situ hybridization and G-banded chromosomes, a cryptic insertion of 3'FOXO1 into inverted chromosome 2q. The inversion breakpoints were depicted by array comparative genomic hybridization as two small interstitial duplications, one of which involved the PAX3 gene. In addition, the array comparative genomic hybridization results revealed 1q gain, 16q loss, and 11 more small duplications, with one of them involving the FOXO1 gene. Although the pathogenesis in classic ARMS cases is thought to be driven by the 5'PAX3-3'FOXO1 fusion on derivative chromosome 13, here we report a novel cryptic insertion of 3'FOXO1 resulting in a pathogenic fusion with 5'PAX3 on inverted chromosome 2q. Copyright © 2015 Elsevier Inc. All rights reserved.

piggyBac Transposon-Mediated Transgenesis in the Apicomplexan Parasite Eimeria tenella

PubMed Central

Su, Huali; Liu, Xianyong; Yan, Wenchao; Shi, Tuanyuan; Zhao, Xinxin; Blake, Damer P.; Tomley, Fiona M.; Suo, Xun

2012-01-01

piggyBac, a type II transposon that is useful for efficient transgenesis and insertional mutagenesis, has been used for effective and stable transfection in a wide variety of organisms. In this study we investigate the potential use of the piggyBac transposon system for forward genetics studies in the apicomplexan parasite Eimeria tenella. Using the restriction enzyme-mediated integration (REMI) method, E. tenella sporozoites were electroporated with a donor plasmid containing the enhanced yellow fluorescent protein (EYFP) gene flanked by piggyBac inverted terminal repeats (ITRs), an Asc I-linearized helper plasmid containing the transposase gene and the restriction enzyme Asc I. Subsequently, electroporated sporozoites were inoculated into chickens via the cloacal route and transfected progeny oocysts expressing EYFP were sorted by flow cytometry. A transgenic E. tenella population was selected by successive in vivo passage. Southern-blotting analysis showed that exogenous DNA containing the EYFP gene was integrated into the parasite genome at a limited number of integration sites and that the inserted part of the donor plasmid was the fragment located between the 5′ and 3′ ITRs as indicated by primer-specific PCR screening. Genome walking revealed that the insertion sites were TTAA-specific, which is consistent with the transposition characteristics of piggyBac. PMID:22768223

Random mutagenesis of the hyperthermophilic archaeon Pyrococcus furiosus using in vitro mariner transposition and natural transformation.

PubMed

Guschinskaya, Natalia; Brunel, Romain; Tourte, Maxime; Lipscomb, Gina L; Adams, Michael W W; Oger, Philippe; Charpentier, Xavier

2016-11-08

Transposition mutagenesis is a powerful tool to identify the function of genes, reveal essential genes and generally to unravel the genetic basis of living organisms. However, transposon-mediated mutagenesis has only been successfully applied to a limited number of archaeal species and has never been reported in Thermococcales. Here, we report random insertion mutagenesis in the hyperthermophilic archaeon Pyrococcus furiosus. The strategy takes advantage of the natural transformability of derivatives of the P. furiosus COM1 strain and of in vitro Mariner-based transposition. A transposon bearing a genetic marker is randomly transposed in vitro in genomic DNA that is then used for natural transformation of P. furiosus. A small-scale transposition reaction routinely generates several hundred and up to two thousands transformants. Southern analysis and sequencing showed that the obtained mutants contain a single and random genomic insertion. Polyploidy has been reported in Thermococcales and P. furiosus is suspected of being polyploid. Yet, about half of the mutants obtained on the first selection are homozygous for the transposon insertion. Two rounds of isolation on selective medium were sufficient to obtain gene conversion in initially heterozygous mutants. This transposition mutagenesis strategy will greatly facilitate functional exploration of the Thermococcales genomes.

Virus-Like Particles Derived from HIV-1 for Delivery of Nuclear Proteins: Improvement of Production and Activity by Protein Engineering.

PubMed

Robert, Marc-André; Lytvyn, Viktoria; Deforet, Francis; Gilbert, Rénald; Gaillet, Bruno

2017-01-01

Virus-like particles (VLPs) derived from retroviruses and lentiviruses can be used to deliver recombinant proteins without the fear of causing insertional mutagenesis to the host cell genome. In this study we evaluate the potential of an inducible lentiviral vector packaging cell line for VLP production. The Gag gene from HIV-1 was fused to a gene encoding a selected protein and it was transfected into the packaging cells. Three proteins served as model: the green fluorescent protein and two transcription factors-the cumate transactivator (cTA) of the inducible CR5 promoter and the human Krüppel-like factor 4 (KLF4). The sizes of the VLPs were 120-150 nm in diameter and they were resistant to freeze/thaw cycles. Protein delivery by the VLPs reached up to 100% efficacy in human cells and was well tolerated. Gag-cTA triggered up to 1100-fold gene activation of the reporter gene in comparison to the negative control. Protein engineering was required to detect Gag-KLF4 activity. Thus, insertion of the VP16 transactivation domain increased the activity of the VLPs by eightfold. An additional 2.4-fold enhancement was obtained by inserting nuclear export signal. In conclusion, our platform produced VLPs capable of efficient protein transfer, and it was shown that protein engineering can be used to improve the activity of the delivered proteins as well as VLP production.

Major recent and independent changes in levels and patterns of expression have occurred at the b gene, a regulatory locus in maize.

PubMed

Selinger, D A; Chandler, V L

1999-12-21

The b locus encodes a transcription factor that regulates the expression of genes that produce purple anthocyanin pigment. Different b alleles are expressed in distinct tissues, causing tissue-specific anthocyanin production. Understanding how phenotypic diversity is produced and maintained at the b locus should provide models for how other regulatory genes, including those that influence morphological traits and development, evolve. We have investigated how different levels and patterns of pigmentation have evolved by determining the phenotypic and evolutionary relationships between 18 alleles that represent the diversity of b alleles in Zea mays. Although most of these alleles have few phenotypic differences, five alleles have very distinct tissue-specific patterns of pigmentation. Superimposing the phenotypes on the molecular phylogeny reveals that the alleles with strong and distinctive patterns of expression are closely related to alleles with weak expression, implying that the distinctive patterns have arisen recently. We have identified apparent insertions in three of the five phenotypically distinct alleles, and the fourth has unique upstream restriction fragment length polymorphisms relative to closely related alleles. The insertion in B-Peru has been shown to be responsible for its unique expression and, in the other two alleles, the presence of the insertion correlates with the phenotype. These results suggest that major changes in gene expression are probably the result of large-scale changes in DNA sequence and/or structure most likely mediated by transposable elements.

The phosphoprotein genes of measles viruses from subacute sclerosing panencephalitis cases encode functional as well as non-functional proteins and display reduced editing.

PubMed

Millar, E L; Rennick, L J; Weissbrich, B; Schneider-Schaulies, J; Duprex, W P; Rima, B K

2016-01-04

Products expressed from the second (P/V/C) gene are important in replication and abrogating innate immune responses during acute measles virus (MV) infection. Thirteen clone sets were derived from the P/V/C genes of measles virus (MV) RNA extracted from brains of a unique collection of seven cases of subacute sclerosing panencephalitis (SSPE) caused by persistent MV in the central nervous system (CNS). Whether these functions are fully maintained when MV replicates in the CNS has not been previously determined. Co-transcriptional editing of the P mRNAs by non-template insertion of guanine (G) nucleotides, which generates mRNAs encoding the viral V protein, occurs much less frequently (9%) in the SSPE derived samples than during the acute infection (30-50%). Thus it is likely that less V protein, which is involved in combatting the innate immune response, is produced. The P genes in MV from SSPE cases were not altered by biased hypermutation but exhibited a high degree of variation within each case. Most but not all SSPE derived phospho-(P) proteins were functional in mini genome replication/transcription assays. An eight amino acid truncation of the carboxyl-terminus made the P protein non-functional while the insertion of an additional glycine residue by insertion of G nucleotides at the editing site had no effect on protein function. Copyright © 2015 Elsevier B.V. All rights reserved.

Over 10,000 new maize mutants added to the uniformMu public resource: now 67,000 total Mu insertions with 42% genome coverage

USDA-ARS?s Scientific Manuscript database

Over 10,000 new mutants have been added to the UniformMu reverse genetics resource in release 7, bringing the total to over 67,000 germinal transposon insertions. These are available in 11,140 independent seed stocks. Close to half of the maize filtered gene set (42%) is represented by at least one ...

An insertion mutation in ABCB4 is associated with gallbladder mucocele formation in dogs

USDA-ARS?s Scientific Manuscript database

The only known physiologic function of the ABCB4 gene product is translocation of phosphatidylcholine (PC) across the hepatocyte plasma membrane into biliary canaliculi. In people, mutations of the ABCB4 gene produce several disease syndromes involving the biliary system including intrahepatic chol...

Novel modes of RNA editing in mitochondria

PubMed Central

Moreira, Sandrine; Valach, Matus; Aoulad-Aissa, Mohamed; Otto, Christian; Burger, Gertraud

2016-01-01

Abstract Gene structure and expression in diplonemid mitochondria are unparalleled. Genes are fragmented in pieces (modules) that are separately transcribed, followed by the joining of module transcripts to contiguous RNAs. Some instances of unique uridine insertion RNA editing at module boundaries were noted, but the extent and potential occurrence of other editing types remained unknown. Comparative analysis of deep transcriptome and genome data from Diplonema papillatum mitochondria reveals ∼220 post-transcriptional insertions of uridines, but no insertions of other nucleotides nor deletions. In addition, we detect in total 114 substitutions of cytosine by uridine and adenosine by inosine, amassed into unusually compact clusters. Inosines in transcripts were confirmed experimentally. This is the first report of adenosine-to-inosine editing of mRNAs and ribosomal RNAs in mitochondria. In mRNAs, editing causes mostly amino-acid additions and non-synonymous substitutions; in ribosomal RNAs, it permits formation of canonical secondary structures. Two extensively edited transcripts were compared across four diplonemids. The pattern of uridine-insertion editing is strictly conserved, whereas substitution editing has diverged dramatically, but still rendering diplonemid proteins more similar to other eukaryotic orthologs. We posit that RNA editing not only compensates but also sustains, or even accelerates, ultra-rapid evolution of genome structure and sequence in diplonemid mitochondria. PMID:27001515

Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

PubMed

Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

1998-01-01

Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

Characterization of growth and reproduction performance, transgene integration, expression and transmission patterns in transgenic pigs produced by piggyBac transposition-mediated gene transfer

PubMed Central

Zeng, Fang; Li, Zicong; Cai, Gengyuan; Gao, Wenchao; Jiang, Gelong; Liu, Dewu; Urschitz, Johann; Moisyadi, Stefan; Wu, Zhenfang

2016-01-01

Previously we successfully produced a group of EGFP-expressing founder transgenic pigs by a newly developed efficient and simple pig transgenesis method based on cytoplasmic injection of piggyBac plasmids. In this study, we investigated the growth and reproduction performance, and characterized the transgene insertion, transmission and expression patterns in transgenic pigs generated by piggyBac transposition. Results showed that transgene has no injurious effect on the growth and reproduction of transgenic pigs. Multiple copies of monogenic EGFP transgene were inserted at noncoding sequences of host genome, and passed from founder transgenic pigs to their transgenic offspring in segregation or linkage manner. The EGFP transgene was ubiquitously expressed in transgenic pigs, and its expression intensity was associated with transgene copy number but not related to its promoter DNA methylation level. To the best of our knowledge, this is first study that fully described the growth and reproduction performance, transgene insertion, expression and transmission profiles in transgenic pigs produced by piggyBac system. It not only demonstrates that piggyBac transposition-mediated gene transfer is an effective and favourable approach for pig transgenesis, but also provides scientific information for understanding the transgene insertion, expression and transmission patterns in transgenic animals produced by piggyBac transposition. PMID:27565868

Instability of the insertional mutation in CftrTgH(neoim)Hgu cystic fibrosis mouse model

PubMed Central

Charizopoulou, Nikoletta; Jansen, Silke; Dorsch, Martina; Stanke, Frauke; Dorin, Julia R; Hedrich, Hans-Jürgen; Tümmler, Burkhard

2004-01-01

Background A major boost to the cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoim)Hgu CF mouse model we have generated using strict brother × sister mating two inbred CftrTgH(neoim)Hgu mouse lines (CF/1 and CF/3). Thereafter, the insertional mutation was introgressed from CF/3 into three inbred backgrounds (C57BL/6, BALB/c, DBA/2J) generating congenic animals. In every backcross cycle germline transmission of the insertional mutation was monitored by direct probing the insertion via Southern RFLP. In order to bypass this time consuming procedure we devised an alternative PCR based protocol whereby mouse strains are differentiated at the Cftr locus by Cftr intragenic microsatellite genotypes that are tightly linked to the disrupted locus. Results Using this method we were able to identify animals carrying the insertional mutation based upon the differential haplotypic backgrounds of the three inbred strains and the mutant CftrTgH(neoim)Hgu at the Cftr locus. Moreover, this method facilitated the identification of the precise vector excision from the disrupted Cftr locus in two out of 57 typed animals. This reversion to wild type status took place without any loss of sequence revealing the instability of insertional mutations during the production of congenic animals. Conclusions We present intragenic microsatellite markers as a tool for fast and efficient identification of the introgressed locus of interest in the recipient strain during congenic animal breeding. Moreover, the same genotyping method allowed the identification of a vector excision event, posing questions on the stability of insertional mutations in mice. PMID:15102331

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Vera, Jessica M.; Grass, Jeff

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE PAGES

Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...

2018-05-02

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.

PubMed

Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B

2000-10-01

Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.

A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

PubMed Central

Macé, Matthias; Crouau-Roy, Brigitte

2008-01-01

Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953

Identification of two integration sites in favor of transgene expression in Trichoderma reesei.

PubMed

Qin, Lina; Jiang, Xianzhang; Dong, Zhiyang; Huang, Jianzhong; Chen, Xiuzhen

2018-01-01

The ascomycete fungus Trichoderma reesei was widely used as a biotechnological workhorse for production of cellulases and recombinant proteins due to its large capacity of protein secretion. Transgenesis by random integration of a gene of interest (GOI) into the genome of T. reesei can generate series of strains that express different levels of the indicated transgene. The insertion site of the GOI plays an important role in the ultimate production of the targeted proteins. However, so far no systematic studies have been made to identify transgene integration loci for optimal expression of the GOI in T. reesei . Currently, only the locus of exocellobiohydrolases I encoding gene ( cbh1) is widely used as a promising integration site to lead to high expression level of the GOI. No additional sites associated with efficient gene expression have been characterized. To search for gene integration sites that benefit for the secreted expression of GOI, the food-and-mouth disease virus 2A protein was applied for co-expression of an Aspergillus niger lipA gene and Discosoma sp. DsRed1 gene in T. reesei, by random integration of the expression cassette into the genome. We demonstrated that the fluorescent intensity of RFP (red fluorescent protein) inside of the cell was well correlated with the secreted lipase yields, based on which, we successfully developed a high-throughput screening method to screen strains with relatively higher secreted expression of the GOI (in this study, lipase). The copy number and the insertion sites of the transgene were investigated among the selected highly expressed strains. Eventually, in addition to cbh1 gene locus, two other genome insertion loci that efficiently facilitate gene expression in T. reesei were identified. We have successfully developed a high-throughput screening method to screen strains with optimal expression of the indicated secreted proteins in T. reesei . Moreover, we identified two optimal genome loci for transgene expression, which could provide new approach to modulate gene expression levels while retaining the indicated promoter and culture conditions.

Foamy Virus Vector Carries a Strong Insulator in Its Long Terminal Repeat Which Reduces Its Genotoxic Potential

PubMed Central

2017-01-01

ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446

Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.

PubMed

d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P

2003-04-01

The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.

Plastid and mitochondrial genomes of Coccophora langsdorfii (Fucales, Phaeophyceae) and the utility of molecular markers

PubMed Central

Graf, Louis; Kim, Yae Jin; Cho, Ga Youn; Miller, Kathy Ann

2017-01-01

Coccophora langsdorfii (Turner) Greville (Fucales) is an intertidal brown alga that is endemic to Northeast Asia and increasingly endangered by habitat loss and climate change. We sequenced the complete circular plastid and mitochondrial genomes of C. langsdorfii. The circular plastid genome is 124,450 bp and contains 139 protein-coding, 28 tRNA and 6 rRNA genes. The circular mitochondrial genome is 35,660 bp and contains 38 protein-coding, 25 tRNA and 3 rRNA genes. The structure and gene content of the C. langsdorfii plastid genome is similar to those of other species in the Fucales. The plastid genomes of brown algae in other orders share similar gene content but exhibit large structural recombination. The large in-frame insert in the cox2 gene in the mitochondrial genome of C. langsdorfii is typical of other brown algae. We explored the effect of this insertion on the structure and function of the cox2 protein. We estimated the usefulness of 135 plastid genes and 35 mitochondrial genes for developing molecular markers. This study shows that 29 organellar genes will prove efficient for resolving brown algal phylogeny. In addition, we propose a new molecular marker suitable for the study of intraspecific genetic diversity that should be tested in a large survey of populations of C. langsdorfii. PMID:29095864

A novel perfusion-based method for cochlear implant electrode insertion.

PubMed

Kale, Sushrut; Cervantes, Vanessa M; Wu, Mailing R; Pisano, Dominic V; Sheth, Nakul; Olson, Elizabeth S

2014-08-01

A cochlear implant (CI) restores partial hearing to profoundly deaf individuals. CI electrodes are inserted manually in the cochlea and surgeons rely on tactile feedback from the implant to determine when to stop the insertion. This manual insertion method results in a large degree of variability in surgical outcomes and intra-cochlear trauma. Additionally, implants often span only the basal turn. In the present study we report on the development of a new method to assist CI electrode insertion. The design objectives are (1) an automated and standardized insertion technique across patients with (2) more apical insertion than is possible by the contemporary methods, while (3) minimizing insertion trauma. The method relies on a viscous fluid flow through the cochlea to carry the electrode array with it. A small cochleostomy (∼100-150 um in diameter) is made in scala vestibuli (SV) and the round window (RW) membrane is opened. A flow of diluted Sodium Hyaluronate (also known as Hyaluronic Acid, (HA)) is set up from the RW to the SV opening using a perfusion pump that sets up a unidirectional flow. Once the flow is established an implant is dropped into the ongoing flow. Here we present a proof-of-concept study where we used this technique to insert silicone implants all the way to the cochlear apex in rats and gerbils. In light-microscopic histology, the implantation occurred without cochlear trauma. To further assess the ototoxicity of the HA perfusion, we measured compound action potential (CAP) thresholds following the perfusion of HA, and found that the CAP thresholds were substantially elevated. Thus, at this point the method is promising, and requires further development to become clinically viable. Copyright © 2014 Elsevier B.V. All rights reserved.

Multicenter surgical experience evaluation on the Mid-Scala electrode and insertion tools.

PubMed

Gazibegovic, Dzemal; Bero, Eva M

2017-02-01

The HiFocus Mid-Scala electrode is intended to improve hearing for individuals with severe-to-profound hearing loss by providing extended electrical coverage of the cochlea while minimizing trauma related to insertion. The electrode is appropriate for use with a wide range of surgical techniques, including either a cochleostomy or round window insertion, and the use of either a free-hand or tool-assisted approach. The objective of this survey was to evaluate how the HiFocus Mid-Scala electrode and insertion tools was used across a population of cochlear implant recipients of differing ages, audiologic profiles, and anatomical characteristics. The intent was to understand the type and frequency of surgical techniques applicable with the electrode, and to provide guidelines for clinical practice. Two questionnaires were completed by surgeons at implant centres located in the United States, Europe, and Asia. Before any surgeries were conducted, surgeons completed a questionnaire that assessed their overall cochlear implant surgical practice and preferences. Following each HiFocus Mid-Scala electrode insertion, surgeons completed a questionnaire that summarized their experience during that surgical procedure. Questionnaires were completed by 32 surgeons from 16 centres for a total of 143 surgeries (112 adults, 31 children). Most surgeons (62 %) preferred to insert the electrode via the round window or an extended round window compared with a cochleostomy (16 %), whereas the remaining 22 % indicated that they made an insertion choice based on presenting anatomy. Sixty-nine percent preferred a free-hand approach over using insertion tools. In 32 procedures, surgeons elected to deviate from an intended round window insertion to either an extended round window or cochleostomy approach.

Thermodynamics of membrane insertion and refolding of the diphtheria toxin T-domain

PubMed Central

Vargas-Uribe, Mauricio; Rodnin, Mykola V.; Öjemalm, Karin; Holgado, Aurora; Kyrychenko, Alexander; Nilsson, IngMarie; Posokhov, Yevgen O.; Makhatadze, George; von Heijne, Gunnar; Ladokhin, Alexey S.

2014-01-01

The diphtheria toxin translocation (T) domain inserts into the endosomal membrane in response to the endosomal acidification and enables the delivery of the catalytic domain into the cell. The insertion pathway consists of a series of conformational changes that occur in solution and in the membrane and leads to the conversion of a water-soluble state into a transmembrane state. In this work, we utilize various biophysical techniques to characterize the insertion pathway from the thermodynamic perspective. Thermal and chemical unfolding measured by differential scanning calorimetry, circular dichroism and tryptophan fluorescence reveal that the free energy of unfolding of the T-domain at neutral and mildly acidic pH differ by 3–5 kcal/mol, depending on the experimental conditions. Fluorescence correlation spectroscopy measurements show that the free energy change from the membrane-competent state to the interfacial state is approximately −8 kcal/mol and is pH-independent, while that from the membrane-competent state to the transmembrane state ranges between −9.5 to −12 kcal/mol, depending on the membrane lipid composition and pH. Finally, the thermodynamics of transmembrane insertion of individual helices was tested using an in vitro assay that measures the translocon-assisted integration of test sequences into the microsomal membrane. These experiments suggest that even the most hydrophobic helix TH8 has only a small favorable free energy of insertion. The free energy for the insertion of the consensus insertion unit TH8-TH9 is slightly more favorable, yet less favorable than that measured for the entire protein, suggesting a cooperative effect for the membrane insertion of the helices of the T-domain. PMID:25281329

Angiotensin-converting enzyme insertion/deletion gene polymorphism in Egyptian children with systemic lupus erythematosus: a possible relation to proliferative nephritis.

PubMed

Hammad, A; Yahia, S; Laimon, W; Hamed, S M; Shouma, A; Shalaby, N M; Abdel-Hady, D; Ghanem, R; El-Farahaty, R M; El-Bassiony, S R; Hammad, E M

2017-06-01

Introduction Angiotensin-converting enzyme (ACE) is crucial in the pathogenesis of systemic lupus erythematosus through angiotensin II which regulates vascular tone and endothelial functions. Objectives To study the frequency of ACE insertion/deletion (I/D) gene polymorphism in Egyptian children with systemic lupus erythematosus and its possible relation to the renal pathology in cases with lupus nephritis. Subjects and methods The frequency of ACE gene insertion/deletion polymorphism genotypes was determined in 78 Egyptian children with systemic lupus erythematosus and compared to a matched group of 140 healthy controls using polymerase chain reaction. Results The DD genotype of the ACE gene was higher in systemic lupus erythematosus patients when compared to controls ( P<0.0001; odds ratio (OR) 2.4; 95% confidence interval (CI) 1.7-3.3) and the D allele was more frequent than the I allele in systemic lupus erythematosus patients in comparison to controls ( P < 0.0001; OR = 2.2; 95% CI = (1.6-3.1). In the lupus nephritis group, the DD genotype was significantly higher in those with proliferative lupus nephritis when compared to those with non-proliferative lupus nephritis ( P = 0.02; OR = 1.45; 95% CI = 1.4-1.6). Also, patients with proliferative lupus nephritis showed a higher frequency of the D allele ( P < 0.001; OR = 1.98; 95% CI = 1.3-2.9). Conclusion The D allele and DD genotype of the ACE gene appear to be a risk factor for the susceptibility of systemic lupus erythematosus and occurrence of proliferative nephritis in Egyptian children.

Pseudomonas syringae effector avrB confers soybean cultivar-specific avirulence on Soybean mosaic virus adapted for transgene expression but effector avrPto does not.

PubMed

Wang, Li; Eggenberger, Alan; Hill, John; Bogdanove, Adam J

2006-03-01

Soybean mosaic virus (SMV) was adapted for transgene expression in soybean and used to examine the function of avirulence genes avrB and avrPto of Pseudomonas syringae pvs. glycinea and tomato, respectively. A cloning site was introduced between the P1 and HC-Pro genes in 35S-driven infectious cDNAs of strains SMV-N and SMV-G7. Insertion of the uidA gene or the green fluorescent protein gene into either modified cDNA and bombardment into primary leaves resulted in systemic expression that reflected the pattern of viral movement into uninoculated leaves. Insertion of avrB blocked symptom development and detectable viral movement in cv. Harosoy, which carries the Rpg1-b resistance gene corresponding to avrB, but not in cvs. Keburi or Hurrelbrink, which lack Rpg1-b. In Keburi and Hurrelbrink, symptoms caused by SMV carrying avrB appeared more quickly and were more severe than those caused by the virus without avrB. Insertion of avrPto enhanced symptoms in Harosoy, Hurrelbrink, and Keburi. This result was unexpected because avrPto was reported to confer avirulence on P. syringae pv. glycinea inoculated to Harosoy. We inoculated Harosoy with P syringae pv. glycinea expressing avrPto, but observed no hypersensitive reaction, avrPto-dependent induction of pathogenesis-related protein la, or limitation of bacterial population growth. In Hurrelbrink, avrPto enhanced bacterial multiplication and exacerbated symptoms. Our results establish SMV as an expression vector for soybean. They demonstrate that resistance triggered by avrB is effective against SMV, and that avrB and avrPto have general virulence effects in soybean. The results also led to a reevaluation of the reported avirulence activity of avrPto in this plant.

CRISPR/Cas9-Mediated Insertion of loxP Sites in the Mouse Dock7 Gene Provides an Effective Alternative to Use of Targeted Embryonic Stem Cells.

PubMed

Bishop, Kathleen A; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J; Rosen, Clifford J; Cui, Xiaoxia; Liaw, Lucy

2016-07-07

Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. Copyright © 2016 Bishop et al.

Unique and redundant functional domains of APETALA1 and CAULIFLOWER, two recently duplicated Arabidopsis thaliana floral MADS-box genes.

PubMed

Alvarez-Buylla, Elena R; García-Ponce, Berenice; Garay-Arroyo, Adriana

2006-01-01

APETALA1 (AP1) and CAULIFLOWER (CAL) are closely related MADS box genes that are partially redundant during Arabidopsis thaliana floral meristem determination. AP1 is able to fully substitute for CAL functions, but not vice versa, and AP1 has unique sepal and petal identity specification functions. In this study, the unique and redundant functions of these two genes has been mapped to the four protein domains that characterize type-II MADS-domain proteins by expressing all 15 chimeric combinations of AP1 and CAL cDNA regions under control of the AP1 promoter in ap1-1 loss-of-function plants. The "in vivo" function of these chimeric genes was analysed in Arabidopsis plants by expressing the chimeras. Rescue of flower meristem and sepal/petal identities was scored in single and multiple insert homozygous transgenic lines. Using these chimeric lines, it was found that distinct residues of the AP1 K domain not shared by the same CAL domain are necessary and sufficient for complete recovery of floral meristem identity, in the context of the CAL protein sequence, while both AP1 COOH and K domains are indispensable for complete rescue of sepal identity. By contrast, either one of these two AP1 domains is necessary and sufficient for complete petal identity recovery. It was also found that there were positive and negative synergies among protein domains and their combinations, and that multiple-insert lines showed relatively better rescue than equivalent single-insert lines. Finally, several lines had flowers with extra sepals and petals suggesting that chimeric proteins yield abnormal transcriptional complexes that may alter the expression or regulation of genes that control floral organ number under normal conditions.

Truncated Photosystem Chlorophyll Antenna Size in the Green Microalga Chlamydomonas reinhardtii upon Deletion of the TLA3-CpSRP43 Gene1[C][W][OA

PubMed Central

Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios

2012-01-01

The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions. PMID:23043081

Isolation and characterization of a Ds-tagged rice (Oryza sativa L.) GA-responsive dwarf mutant defective in an early step of the gibberellin biosynthesis pathway.

PubMed

Margis-Pinheiro, Marcia; Zhou, Xue-Rong; Zhu, Qian-Hao; Dennis, Elizabeth S; Upadhyaya, Narayana M

2005-03-01

We have isolated a severe dwarf transposon (Ds) insertion mutant in rice (Oryza sativa L.), which could be differentiated early in the seedling stage by reduced shoot growth and dark green leaves, and later by severe dwarfism and failure to initiate flowering. These mutants, however, showed normal seed germination and root growth. One of the sequences flanking Ds, rescued from the mutant, was of a chromosome 4-located putative ent-kaurene synthase (KS) gene, encoding the enzyme catalyzing the second step of the gibberellin (GA) biosynthesis pathway. Dwarf mutants were always homozygous for this Ds insertion and no normal plants homozygous for this mutation were recovered in the segregating progeny, indicating that the Ds insertion mutation is recessive. As mutations in three recently reported rice GA-responsive dwarf mutant alleles and the dwarf mutation identified in this study mapped to the same locus, we designate the corresponding gene OsKS1. The osks1 mutant seedlings were responsive to exogenous gibberellin (GA3). OsKS1 transcripts of about 2.3 kb were detected in leaves and stem of wild-type plants, but not in germinating seeds or roots, suggesting that OsKS1 is not involved in germination or root growth. There are at least five OsKS1-like genes in the rice genome, four of which are also represented in rice expressed sequence tag (EST) databases. All OsKS1-like genes are transcribed with different expression patterns. ESTs corresponding to all six OsKS genes are represented in other cereal databases including barley, wheat and maize, suggesting that they are biologically active.

Copy number determination of genetically-modified hematopoietic stem cells.

PubMed

Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke

2009-01-01

Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.

Arthroscopic-Assisted Triangular Fibrocartilage Complex Reconstruction.

PubMed

Chu-Kay Mak, Michael; Ho, Pak-Cheong

2017-11-01

Injury of the triangular fibrocartilage complex (TFCC) is a common cause of ulnar-sided wrist pain. Volar and dorsal radioulnar ligaments and their foveal insertion are the most important stabilizing components of the TFCC. In irreparable tears, anatomic reconstruction of the TFCC aims to restore normal biomechanics and stability of the distal radioulnar joint. We proposed a novel arthroscopic-assisted technique using a palmaris longus tendon graft. Arthroscopic-assisted TFCC reconstruction is a safe and effective approach with outcomes comparable to conventional open reconstruction and may result in a better range of motion from minimizing soft tissue dissection and subsequent scarring. Copyright © 2017 Elsevier Inc. All rights reserved.

Per-operative vibration analysis: a valuable tool for defining correct stem insertion: preliminary report.

PubMed

Mulier, Michiel; Pastrav, Cesar; Van der Perre, Georges

2008-01-01

Defining the stem insertion end point during total hip replacement still relies on the surgeon's feeling. When a custom-made stem prosthesis with an optimal fit into the femoral canal is used, the risk of per-operative fractures is even greater than with standard prostheses. Vibration analysis is used in other clinical settings and has been tested as a means to detect optimal stem insertion in the laboratory. The first per-operative use of vibration analysis during non-cemented custom-made stem insertion in 30 patients is reported here. Thirty patients eligible for total hip replacement with uncemented stem prosthesis were included. The neck of the stem was connected with a shaker that emitted white noise as excitation signal and an impedance head that measured the frequency response. The response signal was sent to a computer that analyzed the frequency response function after each insertion phase. A technician present in the operating theatre but outside the laminated airflow provided feed-back to the surgeon. The correlation index between the frequency response function measured during the last two insertion hammering sessions was >0.99 in 86.7% of the cases. In four cases the surgeon stopped the insertion procedure because of a perceived risk of fracture. Two special cases illustrating the potential benefit of per-operative vibration analysis are described. The results of intra-operative vibration analysis indicate that this technique may be a useful tool assisting the orthopaedic surgeon in defining the insertion endpoint of the stem. The development of a more user-friendly device is therefore warranted.

Chromosomal Amplification of the blaOXA-58 Carbapenemase Gene in a Proteus mirabilis Clinical Isolate.

PubMed

Girlich, Delphine; Bonnin, Rémy A; Bogaerts, Pierre; De Laveleye, Morgane; Huang, Daniel T; Dortet, Laurent; Glaser, Philippe; Glupczynski, Youri; Naas, Thierry

2017-02-01

Horizontal gene transfer may occur between distantly related bacteria, thus leading to genetic plasticity and in some cases to acquisition of novel resistance traits. Proteus mirabilis is an enterobacterial species responsible for human infections that may express various acquired β-lactam resistance genes, including different classes of carbapenemase genes. Here we report a Proteus mirabilis clinical isolate (strain 1091) displaying resistance to penicillin, including temocillin, together with reduced susceptibility to carbapenems and susceptibility to expanded-spectrum cephalosporins. Using biochemical tests, significant carbapenem hydrolysis was detected in P. mirabilis 1091. Since PCR failed to detect acquired carbapenemase genes commonly found in Enterobacteriaceae, we used a whole-genome sequencing approach that revealed the presence of bla OXA-58 class D carbapenemase gene, so far identified only in Acinetobacter species. This gene was located on a 3.1-kb element coharboring a bla AmpC -like gene. Remarkably, these two genes were bracketed by putative XerC-XerD binding sites and inserted at a XerC-XerD site located between the terminase-like small- and large-subunit genes of a bacteriophage. Increased expression of the two bla genes resulted from a 6-time tandem amplification of the element as revealed by Southern blotting. This is the first isolation of a clinical P. mirabilis strain producing OXA-58, a class D carbapenemase, and the first description of a XerC-XerD-dependent insertion of antibiotic resistance genes within a bacteriophage. This study revealed a new role for the XerC-XerD recombinase in bacteriophage biology. Copyright © 2017 American Society for Microbiology.

Chromosomal Amplification of the blaOXA-58 Carbapenemase Gene in a Proteus mirabilis Clinical Isolate

PubMed Central

Girlich, Delphine; Bogaerts, Pierre; De Laveleye, Morgane; Huang, Daniel T.; Glupczynski, Youri

2016-01-01

ABSTRACT Horizontal gene transfer may occur between distantly related bacteria, thus leading to genetic plasticity and in some cases to acquisition of novel resistance traits. Proteus mirabilis is an enterobacterial species responsible for human infections that may express various acquired β-lactam resistance genes, including different classes of carbapenemase genes. Here we report a Proteus mirabilis clinical isolate (strain 1091) displaying resistance to penicillin, including temocillin, together with reduced susceptibility to carbapenems and susceptibility to expanded-spectrum cephalosporins. Using biochemical tests, significant carbapenem hydrolysis was detected in P. mirabilis 1091. Since PCR failed to detect acquired carbapenemase genes commonly found in Enterobacteriaceae, we used a whole-genome sequencing approach that revealed the presence of blaOXA-58 class D carbapenemase gene, so far identified only in Acinetobacter species. This gene was located on a 3.1-kb element coharboring a blaAmpC-like gene. Remarkably, these two genes were bracketed by putative XerC-XerD binding sites and inserted at a XerC-XerD site located between the terminase-like small- and large-subunit genes of a bacteriophage. Increased expression of the two bla genes resulted from a 6-time tandem amplification of the element as revealed by Southern blotting. This is the first isolation of a clinical P. mirabilis strain producing OXA-58, a class D carbapenemase, and the first description of a XerC-XerD-dependent insertion of antibiotic resistance genes within a bacteriophage. This study revealed a new role for the XerC-XerD recombinase in bacteriophage biology. PMID:27855079