MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase.

PubMed

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-02-11

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity.

Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase

PubMed Central

Kaufmann, Isabelle; Martin, Georges; Friedlein, Arno; Langen, Hanno; Keller, Walter

2004-01-01

In mammals, polyadenylation of mRNA precursors (pre-mRNAs) by poly(A) polymerase (PAP) depends on cleavage and polyadenylation specificity factor (CPSF). CPSF is a multisubunit complex that binds to the canonical AAUAAA hexamer and to U-rich upstream sequence elements on the pre-mRNA, thereby stimulating the otherwise weakly active and nonspecific polymerase to elongate efficiently RNAs containing a poly(A) signal. Based on sequence similarity to the Saccharomyces cerevisiae polyadenylation factor Fip1p, we have identified human Fip1 (hFip1) and found that the protein is an integral subunit of CPSF. hFip1 interacts with PAP and has an arginine-rich RNA-binding motif that preferentially binds to U-rich sequence elements on the pre-mRNA. Recombinant hFip1 is sufficient to stimulate the in vitro polyadenylation activity of PAP in a U-rich element-dependent manner. hFip1, CPSF160 and PAP form a ternary complex in vitro, suggesting that hFip1 and CPSF160 act together in poly(A) site recognition and in cooperative recruitment of PAP to the RNA. These results show that hFip1 significantly contributes to CPSF-mediated stimulation of PAP activity. PMID:14749727

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

PubMed

Ford, K G; Neidle, S

1995-06-01

The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

Plasmodium falciparum Nucleosomes Exhibit Reduced Stability and Lost Sequence Dependent Nucleosome Positioning

PubMed Central

Silberhorn, Elisabeth; Schwartz, Uwe; Symelka, Anne; de Koning-Ward, Tania; Längst, Gernot

2016-01-01

The packaging and organization of genomic DNA into chromatin represents an additional regulatory layer of gene expression, with specific nucleosome positions that restrict the accessibility of regulatory DNA elements. The mechanisms that position nucleosomes in vivo are thought to depend on the biophysical properties of the histones, sequence patterns, like phased di-nucleotide repeats and the architecture of the histone octamer that folds DNA in 1.65 tight turns. Comparative studies of human and P. falciparum histones reveal that the latter have a strongly reduced ability to recognize internal sequence dependent nucleosome positioning signals. In contrast, the nucleosomes are positioned by AT-repeat sequences flanking nucleosomes in vivo and in vitro. Further, the strong sequence variations in the plasmodium histones, compared to other mammalian histones, do not present adaptations to its AT-rich genome. Human and parasite histones bind with higher affinity to GC-rich DNA and with lower affinity to AT-rich DNA. However, the plasmodium nucleosomes are overall less stable, with increased temperature induced mobility, decreased salt stability of the histones H2A and H2B and considerable reduced binding affinity to GC-rich DNA, as compared with the human nucleosomes. In addition, we show that plasmodium histone octamers form the shortest known nucleosome repeat length (155bp) in vitro and in vivo. Our data suggest that the biochemical properties of the parasite histones are distinct from the typical characteristics of other eukaryotic histones and these properties reflect the increased accessibility of the P. falciparum genome. PMID:28033404

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

[Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

PubMed

Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

2009-01-01

The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

Investigating intermolecular forces associated with thrombus initiation using optical tweezers

NASA Astrophysics Data System (ADS)

Arya, Maneesh; Lopez, Jose A.; Romo, Gabriel M.; Dong, Jing-Fei; McIntire, Larry V.; Moake, Joel L.; Anvari, Bahman

2002-05-01

Thrombus formation occurs when a platelet membrane receptor, glycoprotein (GP) Ib-IX-V complex, binds to its ligand, von Willebrand factor (vWf), in the subendothelium or plasma. To determine which GP Ib-IX-V amino acid sequences are critical for bond formation, we have used optical tweezers to measure forces involved in the binding of vWf to GP Ib-IX-V variants. Inasmuch as GP Ib(alpha) subunit is the primary component in human GP Ib-IX-V complex that binds to vWf, and that canine GP Ib(alpha) , on the other hand, does not bind to human vWf, we progressively replaced human GP Ib(alpha) amino acid sequences with canine GP Ib(alpha) sequences to determine the sequences essential for vWf/GP Ib(alpha) binding. After measuring the adhesive forces between optically trapped, vWf-coated beads and GP Ib(alpha) variants expressed on mammalian cells, we determined that leucine- rich repeat 2 of GP Ib(alpha) was necessary for vWf/GP Ib-IX- V bond formation. We also found that deletion of the N- terminal flanking sequence and leucine-rich repeat 1 reduced adhesion strength to vWf but did not abolish binding. While divalent cations are known to influence binding of vWf, addition of 1mM CaCl2 had no effect on measured vWf/GP Ib(alpha) bond strengths.

Increased targeting of adenine-rich sequences by (2-amino-2-methyl-3-butanone oxime)dichloroplatinum(II) and investigations into its low cytotoxicity.

PubMed

Hambley, T W; Ling, E C; O'Mara, S; McKeage, M J; Russell, P J

2000-12-01

Using assays based on the inhibition of restriction enzyme cleavage of plasmid and synthetic DNA, the complex (2-amino-2-methyl-3-butanone oxime)dichloroplatinum(II), [PtCl2(ambo)], has been shown to have an increased tendency for binding to adenine-rich sequences when compared to cis[PtCl2(NH3)2] (cisplatin). [PtCl2(ambo)] was found to form substantially fewer interstrand adducts than does cisplatin. The in vitro cytotoxicity of [PtCl2(ambo)] against a human bladder cancer cell line was determined and found to be more than two orders of magnitude lower than that of cisplatin, yet it was also found to be equally effective at passing into cells and binding to isolated DNA.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

PubMed

Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

2018-01-01

Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

Different modes of interaction by TIAR and HuR with target RNA and DNA

PubMed Central

Kim, Henry S.; Wilce, Matthew C. J.; Yoga, Yano M. K.; Pendini, Nicole R.; Gunzburg, Menachem J.; Cowieson, Nathan P.; Wilson, Gerald M.; Williams, Bryan R. G.; Gorospe, Myriam; Wilce, Jacqueline A.

2011-01-01

TIAR and HuR are mRNA-binding proteins that play important roles in the regulation of translation. They both possess three RNA recognition motifs (RRMs) and bind to AU-rich elements (AREs), with seemingly overlapping specificity. Here we show using SPR that TIAR and HuR bind to both U-rich and AU-rich RNA in the nanomolar range, with higher overall affinity for U-rich RNA. However, the higher affinity for U–rich sequences is mainly due to faster association with U-rich RNA, which we propose is a reflection of the higher probability of association. Differences between TIAR and HuR are observed in their modes of binding to RNA. TIAR is able to bind deoxy-oligonucleotides with nanomolar affinity, whereas HuR affinity is reduced to a micromolar level. Studies with U-rich DNA reveal that TIAR binding depends less on the 2′-hydroxyl group of RNA than HuR binding. Finally we show that SAXS data, recorded for the first two domains of TIAR in complex with RNA, are more consistent with a flexible, elongated shape and not the compact shape that the first two domains of Hu proteins adopt upon binding to RNA. We thus propose that these triple-RRM proteins, which compete for the same binding sites in cells, interact with their targets in fundamentally different ways. PMID:21233170

Different modes of interaction by TIAR and HuR with target RNA and DNA.

PubMed

Kim, Henry S; Wilce, Matthew C J; Yoga, Yano M K; Pendini, Nicole R; Gunzburg, Menachem J; Cowieson, Nathan P; Wilson, Gerald M; Williams, Bryan R G; Gorospe, Myriam; Wilce, Jacqueline A

2011-02-01

TIAR and HuR are mRNA-binding proteins that play important roles in the regulation of translation. They both possess three RNA recognition motifs (RRMs) and bind to AU-rich elements (AREs), with seemingly overlapping specificity. Here we show using SPR that TIAR and HuR bind to both U-rich and AU-rich RNA in the nanomolar range, with higher overall affinity for U-rich RNA. However, the higher affinity for U-rich sequences is mainly due to faster association with U-rich RNA, which we propose is a reflection of the higher probability of association. Differences between TIAR and HuR are observed in their modes of binding to RNA. TIAR is able to bind deoxy-oligonucleotides with nanomolar affinity, whereas HuR affinity is reduced to a micromolar level. Studies with U-rich DNA reveal that TIAR binding depends less on the 2'-hydroxyl group of RNA than HuR binding. Finally we show that SAXS data, recorded for the first two domains of TIAR in complex with RNA, are more consistent with a flexible, elongated shape and not the compact shape that the first two domains of Hu proteins adopt upon binding to RNA. We thus propose that these triple-RRM proteins, which compete for the same binding sites in cells, interact with their targets in fundamentally different ways.

Expression cloning and characterization of a novel gene that encodes the RNA-binding protein FAU-1 from Pyrococcus furiosus.

PubMed Central

Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi

2003-01-01

We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195

cAMP-Mediated Stimulation of Tyrosine Hydroxylase mRNA Translation Is Mediated by Polypyrimidine-Rich Sequences within Its 3′-Untranslated Region and Poly(C)-Binding Protein 2

PubMed Central

Xu, Lu; Sterling, Carol R.

2009-01-01

Tyrosine hydroxylase (TH) plays a critical role in maintaining the appropriate concentrations of catecholamine neurotransmitters in brain and periphery, particularly during long-term stress, long-term drug treatment, or neurodegenerative diseases. Its expression is controlled by both transcriptional and post-transcriptional mechanisms. In a previous report, we showed that treatment of rat midbrain slice explant cultures or mouse MN9D cells with cAMP analog or forskolin leads to induction of TH protein without concomitant induction of TH mRNA. We further showed that cAMP activates mechanisms that regulate TH mRNA translation via cis-acting sequences within its 3′-untranslated region (UTR). In the present report, we extend these studies to show that MN9D cytoplasmic proteins bind to the same TH mRNA 3′-UTR domain that is required for the cAMP response. RNase T1 mapping demonstrates binding of proteins to a 27-nucleotide polypyrimidine-rich sequence within this domain. A specific mutation within the polypyrimidine-rich sequence inhibits protein binding and cAMP-mediated translational activation. UV-cross-linking studies identify a ∼44-kDa protein as a major TH mRNA 3′-UTR binding factor, and cAMP induces the 40- to 42-kDa poly(C)-binding protein-2 (PCBP2) in MN9D cells. We show that PCBP2 binds to the TH mRNA 3′-UTR domain that participates in the cAMP response. Overexpression of PCBP2 induces TH protein without concomitant induction of TH mRNA. These results support a model in which cAMP induces PCBP2, leading to increased interaction with its cognate polypyrimidine binding site in the TH mRNA 3′-UTR. This increased interaction presumably plays a role in the activation of TH mRNA translation by cAMP in dopaminergic neurons. PMID:19620256

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦

PubMed Central

Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.

2016-01-01

Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566

Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

PubMed Central

Grange, T; de Sa, C M; Oddos, J; Pictet, R

1987-01-01

We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

Conserved noncoding sequences (CNSs) in higher plants.

PubMed

Freeling, Michael; Subramaniam, Shabarinath

2009-04-01

Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.

The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5'TOP sequence.

PubMed

Lahr, Roni M; Mack, Seshat M; Héroux, Annie; Blagden, Sarah P; Bousquet-Antonelli, Cécile; Deragon, Jean-Marc; Berman, Andrea J

2015-09-18

La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. A putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. These studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5'TOP sequence

DOE PAGES

Lahr, Roni M.; Mack, Seshat M.; Heroux, Annie; ...

2015-07-22

La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. Amore » putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. Ultimately, these studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis.« less

U2 small nuclear ribonucleoprotein particle (snRNP) auxiliary factor of 65 kDa, U2AF65, can promote U1 snRNP recruitment to 5' splice sites.

PubMed Central

Förch, Patrik; Merendino, Livia; Martínez, Concepción; Valcárcel, Juan

2003-01-01

The splicing factor U2AF(65), U2 small nuclear ribonucleoprotein particle (snRNP) auxillary factor of 65 kDa, binds to pyrimidine-rich sequences at 3' splice sites to recruit U2 snRNP to pre-mRNAs. We report that U2AF(65) can also promote the recruitment of U1 snRNP to weak 5' splice sites that are followed by uridine-rich sequences. The arginine- and serine-rich domain of U2AF(65) is critical for U1 recruitment, and we discuss the role of its RNA-RNA annealing activity in this novel function of U2AF(65). PMID:12558503

Interaction of Plasmodium vivax Tryptophan-rich Antigen PvTRAg38 with Band 3 on Human Erythrocyte Surface Facilitates Parasite Growth*

PubMed Central

Alam, Mohd. Shoeb; Choudhary, Vandana; Zeeshan, Mohammad; Tyagi, Rupesh K.; Rathore, Sumit; Sharma, Yagya D.

2015-01-01

Plasmodium tryptophan-rich proteins are involved in host-parasite interaction and thus potential drug/vaccine targets. Recently, we have described several P. vivax tryptophan-rich antigens (PvTRAgs), including merozoite expressed PvTRAg38, from this noncultivable human malaria parasite. PvTRAg38 is highly immunogenic in humans and binds to host erythrocytes, and this binding is inhibited by the patient sera. This binding is also affected if host erythrocytes were pretreated with chymotrypsin. Here, Band 3 has been identified as the chymotrypsin-sensitive erythrocyte receptor for this parasite protein. Interaction of PvTRAg38 with Band 3 has been mapped to its three different ectodomains (loops 1, 3, and 6) exposed at the surface of the erythrocyte. The binding region of PvTRAg38 to Band3 has been mapped to its sequence, KWVQWKNDKIRSWLSSEW, present at amino acid positions 197–214. The recombinant PvTRAg38 was able to inhibit the parasite growth in in vitro Plasmodium falciparum culture probably by competing with the ligand(s) of this heterologous parasite for the erythrocyte Band 3 receptor. In conclusion, the host-parasite interaction at the molecular level is much more complicated than known so far and should be considered during the development of anti-malarial therapeutics. PMID:26149684

Binding of high mobility group A proteins to the mammalian genome occurs as a function of AT-content

PubMed Central

Schübeler, Dirk

2017-01-01

Genomic location can inform on potential function and recruitment signals for chromatin-associated proteins. High mobility group (Hmg) proteins are of similar size as histones with Hmga1 and Hmga2 being particularly abundant in replicating normal tissues and in cancerous cells. While several roles for Hmga proteins have been proposed we lack a comprehensive description of their genomic location as a function of chromatin, DNA sequence and functional domains. Here we report such a characterization in mouse embryonic stem cells in which we introduce biotin-tagged constructs of wild-type and DNA-binding domain mutants. Comparative analysis of the genome-wide distribution of Hmga proteins reveals pervasive binding, a feature that critically depends on a functional DNA-binding domain and which is shared by both Hmga proteins. Assessment of the underlying queues instructive for this binding modality identifies AT richness, defined as high frequency of A or T bases, as the major criterion for local binding. Additionally, we show that other chromatin states such as those linked to cis-regulatory regions have little impact on Hmga binding both in stem and differentiated cells. As a consequence, Hmga proteins are preferentially found at AT-rich regions such as constitutively heterochromatic regions but are absent from enhancers and promoters arguing for a limited role in regulating individual genes. In line with this model, we show that genetic deletion of Hmga proteins in stem cells causes limited transcriptional effects and that binding is conserved in neuronal progenitors. Overall our comparative study describing the in vivo binding modality of Hmga1 and Hmga2 identifies the proteins’ preference for AT-rich DNA genome-wide and argues against a suggested function of Hmga at regulatory regions. Instead we discover pervasive binding with enrichment at regions of higher AT content irrespective of local variation in chromatin modifications. PMID:29267285

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

NASA Astrophysics Data System (ADS)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

PubMed

Zhou, Huan-Xiang

2006-11-01

Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

Lighting Up the Thioflavin T by Parallel-Stranded TG(GA) n DNA Homoduplexes.

PubMed

Zhu, Jinbo; Yan, Zhiqiang; Zhou, Weijun; Liu, Chuanbo; Wang, Jin; Wang, Erkang

2018-06-22

Thioflavin T (ThT) was once regarded to be a specific fluorescent probe for the human telomeric G-quadruplex, but more other kinds of DNA were found that can also bind to ThT in recent years. Herein, we focus on G-rich parallel-stranded DNA and utilize fluorescence, absorbance, circular dichroism, and surface plasmon resonance spectroscopy to investigate its interaction with ThT. Pyrene label and molecular modeling are applied to unveil the binding mechanism. We find a new class of non-G-quadruplex G-rich parallel-stranded ( ps) DNA with the sequence of TG(GA) n can bind to ThT and increase the fluorescence with an enhancement ability superior to G-quadruplex. The optimal binding specificity for ThT is conferred by two parts. The first part is composed of two bases TG at the 5' end, which is a critical domain and plays an important role in the formation of the binding site for ThT. The second part is the rest alternative d(GA) bases, which forms the ps homoduplex and cooperates with the TG bases at the 5' end to bind the ThT.

Targeted binding of the M13 bacteriophage to thiamethoxam organic crystals.

PubMed

Cho, Whirang; Fowler, Jeffrey D; Furst, Eric M

2012-04-10

Phage display screening with a combinatorial library was used to identify M13-type bacteriophages that express peptides with selective binding to organic crystals of thiamethoxam. The six most strongly binding phages exhibit at least 1000 times the binding affinity of wild-type M13 and express heptapeptide sequences that are rich in hydrophobic, hydrogen-bonding amino acids and proline. Among the peptide sequences identified, M13 displaying the pIII domain heptapeptide ASTLPKA exhibits the strongest binding to thiamethoxam in competitive binding assays. Electron and confocal microscopy confirm the specific binding affinity of ASTLPKA to thiamethoxam. Using atomic force microscope (AFM) probes functionalized with ASTLPKA expressing phage, we found that the average adhesion force between the bacteriophage and a thiamethoxam surface is 1.47 ± 0.80 nN whereas the adhesion force of wild-type M13KE phage is 0.18 ± 0.07 nN. Such a strongly binding bacteriophage could be used to modify the surface chemistry of thiamethoxam crystals and other organic solids with a high degree of specificity. © 2012 American Chemical Society

The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.

PubMed Central

Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D

1993-01-01

Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

Evolution of sfbI Encoding Streptococcal Fibronectin-Binding Protein I: Horizontal Genetic Transfer and Gene Mosaic Structure

PubMed Central

Towers, Rebecca J.; Fagan, Peter K.; Talay, Susanne R.; Currie, Bart J.; Sriprakash, Kadaba S.; Walker, Mark J.; Chhatwal, Gursharan S.

2003-01-01

Streptococcal fibronectin-binding protein is an important virulence factor involved in colonization and invasion of epithelial cells and tissues by Streptococcus pyogenes. In order to investigate the mechanisms involved in the evolution of sfbI, the sfbI genes from 54 strains were sequenced. Thirty-four distinct alleles were identified. Three principal mechanisms appear to have been involved in the evolution of sfbI. The amino-terminal aromatic amino acid-rich domain is the most variable region and is apparently generated by intergenic recombination of horizontally acquired DNA cassettes, resulting in a genetic mosaic in this region. Two distinct and divergent sequence types that shared only 61 to 70% identity were identified in the central proline-rich region, while variation at the 3′ end of the gene is due to deletion or duplication of defined repeat units. Potential antigenic and functional variabilities in SfbI imply significant selective pressure in vivo with direct implications for the microbial pathogenesis of S. pyogenes. PMID:14662917

Multivalent binding of formin-binding protein 21 (FBP21)-tandem-WW domains fosters protein recognition in the pre-spliceosome.

PubMed

Klippel, Stefan; Wieczorek, Marek; Schümann, Michael; Krause, Eberhard; Marg, Berenice; Seidel, Thorsten; Meyer, Tim; Knapp, Ernst-Walter; Freund, Christian

2011-11-04

The high abundance of repetitive but nonidentical proline-rich sequences in spliceosomal proteins raises the question of how these known interaction motifs recruit their interacting protein domains. Whereas complex formation of these adaptors with individual motifs has been studied in great detail, little is known about the binding mode of domains arranged in tandem repeats and long proline-rich sequences including multiple motifs. Here we studied the interaction of the two adjacent WW domains of spliceosomal protein FBP21 with several ligands of different lengths and composition to elucidate the hallmarks of multivalent binding for this class of recognition domains. First, we show that many of the proteins that define the cellular proteome interacting with FBP21-WW1-WW2 contain multiple proline-rich motifs. Among these is the newly identified binding partner SF3B4. Fluorescence resonance energy transfer (FRET) analysis reveals the tandem-WW domains of FBP21 to interact with splicing factor 3B4 (SF3B4) in nuclear speckles where splicing takes place. Isothermal titration calorimetry and NMR shows that the tandem arrangement of WW domains and the multivalency of the proline-rich ligands both contribute to affinity enhancement. However, ligand exchange remains fast compared with the NMR time scale. Surprisingly, a N-terminal spin label attached to a bivalent ligand induces NMR line broadening of signals corresponding to both WW domains of the FBP21-WW1-WW2 protein. This suggests that distinct orientations of the ligand contribute to a delocalized and semispecific binding mode that should facilitate search processes within the spliceosome.

Multivalent Binding of Formin-binding Protein 21 (FBP21)-Tandem-WW Domains Fosters Protein Recognition in the Pre-spliceosome*

PubMed Central

Klippel, Stefan; Wieczorek, Marek; Schümann, Michael; Krause, Eberhard; Marg, Berenice; Seidel, Thorsten; Meyer, Tim; Knapp, Ernst-Walter; Freund, Christian

2011-01-01

The high abundance of repetitive but nonidentical proline-rich sequences in spliceosomal proteins raises the question of how these known interaction motifs recruit their interacting protein domains. Whereas complex formation of these adaptors with individual motifs has been studied in great detail, little is known about the binding mode of domains arranged in tandem repeats and long proline-rich sequences including multiple motifs. Here we studied the interaction of the two adjacent WW domains of spliceosomal protein FBP21 with several ligands of different lengths and composition to elucidate the hallmarks of multivalent binding for this class of recognition domains. First, we show that many of the proteins that define the cellular proteome interacting with FBP21-WW1-WW2 contain multiple proline-rich motifs. Among these is the newly identified binding partner SF3B4. Fluorescence resonance energy transfer (FRET) analysis reveals the tandem-WW domains of FBP21 to interact with splicing factor 3B4 (SF3B4) in nuclear speckles where splicing takes place. Isothermal titration calorimetry and NMR shows that the tandem arrangement of WW domains and the multivalency of the proline-rich ligands both contribute to affinity enhancement. However, ligand exchange remains fast compared with the NMR time scale. Surprisingly, a N-terminal spin label attached to a bivalent ligand induces NMR line broadening of signals corresponding to both WW domains of the FBP21-WW1-WW2 protein. This suggests that distinct orientations of the ligand contribute to a delocalized and semispecific binding mode that should facilitate search processes within the spliceosome. PMID:21917930

A MicroRNA Superfamily Regulates Nucleotide Binding Site–Leucine-Rich Repeats and Other mRNAs[W][OA

PubMed Central

Shivaprasad, Padubidri V.; Chen, Ho-Ming; Patel, Kanu; Bond, Donna M.; Santos, Bruno A.C.M.; Baulcombe, David C.

2012-01-01

Analysis of tomato (Solanum lycopersicum) small RNA data sets revealed the presence of a regulatory cascade affecting disease resistance. The initiators of the cascade are microRNA members of an unusually diverse superfamily in which miR482 and miR2118 are prominent members. Members of this superfamily are variable in sequence and abundance in different species, but all variants target the coding sequence for the P-loop motif in the mRNA sequences for disease resistance proteins with nucleotide binding site (NBS) and leucine-rich repeat (LRR) motifs. We confirm, using transient expression in Nicotiana benthamiana, that miR482 targets mRNAs for NBS-LRR disease resistance proteins with coiled-coil domains at their N terminus. The targeting causes mRNA decay and production of secondary siRNAs in a manner that depends on RNA-dependent RNA polymerase 6. At least one of these secondary siRNAs targets other mRNAs of a defense-related protein. The miR482-mediated silencing cascade is suppressed in plants infected with viruses or bacteria so that expression of mRNAs with miR482 or secondary siRNA target sequences is increased. We propose that this process allows pathogen-inducible expression of NBS-LRR proteins and that it contributes to a novel layer of defense against pathogen attack. PMID:22408077

Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin.

PubMed

Bensing, Barbara A; Loukachevitch, Lioudmila V; McCulloch, Kathryn M; Yu, Hai; Vann, Kendra R; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M; Iverson, T M

2016-04-01

Streptococcus sanguinisis a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets.S. sanguinisexpresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterisation of secretory calcium-binding phosphoprotein-proline-glutamine-rich 1: a novel basal lamina component expressed at cell-tooth interfaces.

PubMed

Moffatt, Pierre; Wazen, Rima M; Dos Santos Neves, Juliana; Nanci, Antonio

2014-12-01

Functional genomic screening of the rat enamel organ (EO) has led to the identification of a number of secreted proteins expressed during the maturation stage of amelogenesis, including amelotin (AMTN) and odontogenic ameloblast-associated (ODAM). In this study, we characterise the gene, protein and pattern of expression of a related protein called secretory calcium-binding phosphoprotein-proline-glutamine-rich 1 (SCPPPQ1). The Scpppq1 gene resides within the secretory calcium-binding phosphoprotein (Scpp) cluster. SCPPPQ1 is a highly conserved, 75-residue, secreted protein rich in proline, leucine, glutamine and phenylalanine. In silico data mining has revealed no correlation to any known sequences. Northern blotting of various rat tissues suggests that the expression of Scpppq1 is restricted to tooth and associated tissues. Immunohistochemical analyses show that the protein is expressed during the late maturation stage of amelogenesis and in the junctional epithelium where it localises to an atypical basal lamina at the cell-tooth interface. This discrete localisation suggests that SCPPPQ1, together with AMTN and ODAM, participates in structuring the basal lamina and in mediating attachment of epithelia cells to mineralised tooth surfaces.

Three RNA recognition motifs participate in RNA recognition and structural organization by the pro-apoptotic factor TIA-1

PubMed Central

Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.

2012-01-01

T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

Mapping Hfq-RNA interaction surfaces using tryptophan fluorescence quenching

PubMed Central

Robinson, Kirsten E.; Orans, Jillian; Kovach, Alexander R.; Link, Todd M.; Brennan, Richard G.

2014-01-01

Hfq is a posttranscriptional riboregulator and RNA chaperone that binds small RNAs and target mRNAs to effect their annealing and message-specific regulation in response to environmental stressors. Structures of Hfq-RNA complexes indicate that U-rich sequences prefer the proximal face and A-rich sequences the distal face; however, the Hfq-binding sites of most RNAs are unknown. Here, we present an Hfq-RNA mapping approach that uses single tryptophan-substituted Hfq proteins, all of which retain the wild-type Hfq structure, and tryptophan fluorescence quenching (TFQ) by proximal RNA binding. TFQ properly identified the respective distal and proximal binding of A15 and U6 RNA to Gram-negative Escherichia coli (Ec) Hfq and the distal face binding of (AA)3A, (AU)3A and (AC)3A to Gram-positive Staphylococcus aureus (Sa) Hfq. The inability of (GU)3G to bind the distal face of Sa Hfq reveals the (R-L)n binding motif is a more restrictive (A-L)n binding motif. Remarkably Hfq from Gram-positive Listeria monocytogenes (Lm) binds (GU)3G on its proximal face. TFQ experiments also revealed the Ec Hfq (A-R-N)n distal face-binding motif should be redefined as an (A-A-N)n binding motif. TFQ data also demonstrated that the 5′-untranslated region of hfq mRNA binds both the proximal and distal faces of Ec Hfq and the unstructured C-terminus. PMID:24288369

Unusually weak oxygen binding, physical properties, partial sequence, autoxidation rate and a potential phosphorylation site of beluga whale (Delphinapterus leucas) myoglobin.

PubMed

Stewart, J M; Blakely, J A; Karpowicz, P A; Kalanxhi, E; Thatcher, B J; Martin, B M

2004-03-01

We purified myoglobin from beluga whale (Delphinapterus leucas) muscle (longissimus dorsi) with size exclusion and cation exchange chromatographies. The molecular mass was determined by mass spectrometry (17,081 Da) and the isoelectric pH (9.4) by capillary isoelectric focusing. The near-complete amino acid sequence was determined and a phylogeny indicated that beluga was in the same clad as Dall's and harbor porpoises. There were consensus motifs for a phosphorylation site on the protein surface with the most likely site at serine-117. This motif was common to all cetacean myoglobins examined. Two oxygen-binding studies at 37 degrees C indicated dissociation constants (20.5 and 23.6 microM) 5.7-6.6 times larger than horse myoglobin (3.6 microM). The autoxidation rate of beluga myoglobin at 37 degrees C, pH 7.2 was 0.218+/-0.028 h(-1), 1/3 larger than reported for myoglobin of terrestrial mammals. There was no clear sequence change to explain the difference in oxygen binding or autoxidation although substitutions (N66 and T67) in an invariant rich sequence (HGNTV) distal to the heme may play a role. Structural models based on the protein sequence and constructed on topologies of known templates (horse and sperm whale crystal structures) were not adequate to assess perturbation of the heme pocket.

Structure-based Analysis to Hu-DNA Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swinger,K.; Rice, P.

2007-01-01

HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

RNA Binding of T-cell Intracellular Antigen-1 (TIA-1) C-terminal RNA Recognition Motif Is Modified by pH Conditions*

PubMed Central

Cruz-Gallardo, Isabel; Aroca, Ángeles; Persson, Cecilia; Karlsson, B. Göran; Díaz-Moreno, Irene

2013-01-01

T-cell intracellular antigen-1 (TIA-1) is a DNA/RNA-binding protein that regulates critical events in cell physiology by the regulation of pre-mRNA splicing and mRNA translation. TIA-1 is composed of three RNA recognition motifs (RRMs) and a glutamine-rich domain and binds to uridine-rich RNA sequences through its C-terminal RRM2 and RRM3 domains. Here, we show that RNA binding mediated by either isolated RRM3 or the RRM23 construct is controlled by slight environmental pH changes due to the protonation/deprotonation of TIA-1 RRM3 histidine residues. The auxiliary role of the C-terminal RRM3 domain in TIA-1 RNA recognition is poorly understood, and this work provides insight into its binding mechanisms. PMID:23902765

Identification and specificity studies of small-molecule ligands for SH3 protein domains.

PubMed

Inglis, Steven R; Stojkoski, Cvetan; Branson, Kim M; Cawthray, Jacquie F; Fritz, Daniel; Wiadrowski, Emma; Pyke, Simon M; Booker, Grant W

2004-10-21

The Src Homology 3 (SH3) domains are small protein-protein interaction domains that bind proline-rich sequences and mediate a wide range of cell-signaling and other important biological processes. Since deregulated signaling pathways form the basis of many human diseases, the SH3 domains have been attractive targets for novel therapeutics. High-affinity ligands for SH3 domains have been designed; however, these have all been peptide-based and no examples of entirely nonpeptide SH3 ligands have previously been reported. Using the mouse Tec Kinase SH3 domain as a model system for structure-based ligand design, we have identified several simple heterocyclic compounds that selectively bind to the Tec SH3 domain. Using a combination of nuclear magnetic resonance chemical shift perturbation, structure-activity relationships, and site-directed mutagenesis, the binding of these compounds at the proline-rich peptide-binding site has been characterized. The most potent of these, 2-aminoquinoline, bound with Kd = 125 microM and was able to compete for binding with a proline-rich peptide. Synthesis of 6-substituted-2-aminoquinolines resulted in ligands with up to 6-fold improved affinity over 2-aminoquinoline and enhanced specificity for the Tec SH3 domain. Therefore, 2-aminoquinolines may potentially be useful for the development of high affinity small molecule ligands for SH3 domains.

Rice MEL2, the RNA recognition motif (RRM) protein, binds in vitro to meiosis-expressed genes containing U-rich RNA consensus sequences in the 3'-UTR.

PubMed

Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi

2015-10-01

Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.

Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

NASA Astrophysics Data System (ADS)

Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

1992-09-01

Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

The Dictyostelium Carmil Protein Links Capping Protein and the Arp2/3 Complex to Type I Myosins through Their Sh3 Domains

PubMed Central

Jung, Goeh; Remmert, Kirsten; Wu, Xufeng; Volosky, Joanne M.; III, John A. Hammer

2001-01-01

Fusion proteins containing the Src homology (SH)3 domains of Dictyostelium myosin IB (myoB) and IC (myoC) bind a 116-kD protein (p116), plus nine other proteins identified as the seven member Arp2/3 complex, and the α and β subunits of capping protein. Immunoprecipitation reactions indicate that myoB and myoC form a complex with p116, Arp2/3, and capping protein in vivo, that the myosins bind to p116 through their SH3 domains, and that capping protein and the Arp2/3 complex in turn bind to p116. Cloning of p116 reveals a protein dominated by leucine-rich repeats and proline-rich sequences, and indicates that it is a homologue of Acan 125. Studies using p116 fusion proteins confirm the location of the myosin I SH3 domain binding site, implicate NH2-terminal sequences in binding capping protein, and show that a region containing a short sequence found in several G-actin binding proteins, as well as an acidic stretch, can activate Arp2/3-dependent actin nucleation. p116 localizes along with the Arp2/3 complex, myoB, and myoC in dynamic actin-rich cellular extensions, including the leading edge of cells undergoing chemotactic migration, and dorsal, cup-like, macropinocytic extensions. Cells lacking p116 exhibit a striking defect in the formation of these macropinocytic structures, a concomitant reduction in the rate of fluid phase pinocytosis, a significant decrease in the efficiency of chemotactic aggregation, and a decrease in cellular F-actin content. These results identify a complex that links key players in the nucleation and termination of actin filament assembly with a ubiquitous barbed end–directed motor, indicate that the protein responsible for the formation of this complex is physiologically important, and suggest that previously reported myosin I mutant phenotypes in Dictyostelium may be due, at least in part, to defects in the assembly state of actin. We propose that p116 and Acan 125, along with homologues identified in Caenorhabditis elegans, Drosophila, mouse, and man, be named CARMIL proteins, for capping protein, Arp2/3, and myosin I linker. PMID:11425877

Structural basis for genome wide recognition of 5-bp GC motifs by SMAD transcription factors.

PubMed

Martin-Malpartida, Pau; Batet, Marta; Kaczmarska, Zuzanna; Freier, Regina; Gomes, Tiago; Aragón, Eric; Zou, Yilong; Wang, Qiong; Xi, Qiaoran; Ruiz, Lidia; Vea, Angela; Márquez, José A; Massagué, Joan; Macias, Maria J

2017-12-12

Smad transcription factors activated by TGF-β or by BMP receptors form trimeric complexes with Smad4 to target specific genes for cell fate regulation. The CAGAC motif has been considered as the main binding element for Smad2/3/4, whereas Smad1/5/8 have been thought to preferentially bind GC-rich elements. However, chromatin immunoprecipitation analysis in embryonic stem cells showed extensive binding of Smad2/3/4 to GC-rich cis-regulatory elements. Here, we present the structural basis for specific binding of Smad3 and Smad4 to GC-rich motifs in the goosecoid promoter, a nodal-regulated differentiation gene. The structures revealed a 5-bp consensus sequence GGC(GC)|(CG) as the binding site for both TGF-β and BMP-activated Smads and for Smad4. These 5GC motifs are highly represented as clusters in Smad-bound regions genome-wide. Our results provide a basis for understanding the functional adaptability of Smads in different cellular contexts, and their dependence on lineage-determining transcription factors to target specific genes in TGF-β and BMP pathways.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

PubMed

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

RNA Helicase Associated with AU-rich Element (RHAU/DHX36) Interacts with the 3′-Tail of the Long Non-coding RNA BC200 (BCYRN1)*

PubMed Central

Booy, Evan P.; McRae, Ewan K. S.; Howard, Ryan; Deo, Soumya R.; Ariyo, Emmanuel O.; Dzananovic, Edis; Meier, Markus; Stetefeld, Jörg; McKenna, Sean A.

2016-01-01

RNA helicase associated with AU-rich element (RHAU) is an ATP-dependent RNA helicase that demonstrates high affinity for quadruplex structures in DNA and RNA. To elucidate the significance of these quadruplex-RHAU interactions, we have performed RNA co-immunoprecipitation screens to identify novel RNAs bound to RHAU and characterize their function. In the course of this study, we have identified the non-coding RNA BC200 (BCYRN1) as specifically enriched upon RHAU immunoprecipitation. Although BC200 does not adopt a quadruplex structure and does not bind the quadruplex-interacting motif of RHAU, it has direct affinity for RHAU in vitro. Specifically designed BC200 truncations and RNase footprinting assays demonstrate that RHAU binds to an adenosine-rich region near the 3′-end of the RNA. RHAU truncations support binding that is dependent upon a region within the C terminus and is specific to RHAU isoform 1. Tests performed to assess whether BC200 interferes with RHAU helicase activity have demonstrated the ability of BC200 to act as an acceptor of unwound quadruplexes via a cytosine-rich region near the 3′-end of the RNA. Furthermore, an interaction between BC200 and the quadruplex-containing telomerase RNA was confirmed by pull-down assays of the endogenous RNAs. This leads to the possibility that RHAU may direct BC200 to bind and exert regulatory functions at quadruplex-containing RNA or DNA sequences. PMID:26740632

Detecting Coevolution in and among Protein Domains

PubMed Central

Yeang, Chen-Hsiang; Haussler, David

2007-01-01

Correlated changes of nucleic or amino acids have provided strong information about the structures and interactions of molecules. Despite the rich literature in coevolutionary sequence analysis, previous methods often have to trade off between generality, simplicity, phylogenetic information, and specific knowledge about interactions. Furthermore, despite the evidence of coevolution in selected protein families, a comprehensive screening of coevolution among all protein domains is still lacking. We propose an augmented continuous-time Markov process model for sequence coevolution. The model can handle different types of interactions, incorporate phylogenetic information and sequence substitution, has only one extra free parameter, and requires no knowledge about interaction rules. We employ this model to large-scale screenings on the entire protein domain database (Pfam). Strikingly, with 0.1 trillion tests executed, the majority of the inferred coevolving protein domains are functionally related, and the coevolving amino acid residues are spatially coupled. Moreover, many of the coevolving positions are located at functionally important sites of proteins/protein complexes, such as the subunit linkers of superoxide dismutase, the tRNA binding sites of ribosomes, the DNA binding region of RNA polymerase, and the active and ligand binding sites of various enzymes. The results suggest sequence coevolution manifests structural and functional constraints of proteins. The intricate relations between sequence coevolution and various selective constraints are worth pursuing at a deeper level. PMID:17983264

Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

PubMed

Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

2017-05-23

A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Zinc Finger Independent Genome-Wide Binding of Sp2 Potentiates Recruitment of Histone-Fold Protein Nf-y Distinguishing It from Sp1 and Sp3

PubMed Central

Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram

2015-01-01

Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500

Salivary agglutinin, which binds Streptococcus mutans and Helicobacter pylori, is the lung scavenger receptor cysteine-rich protein gp-340.

PubMed

Prakobphol, A; Xu, F; Hoang, V M; Larsson, T; Bergstrom, J; Johansson, I; Frängsmyr, L; Holmskov, U; Leffler, H; Nilsson, C; Borén, T; Wright, J R; Strömberg, N; Fisher, S J

2000-12-22

Salivary agglutinin is a high molecular mass component of human saliva that binds Streptococcus mutans, an oral bacterium implicated in dental caries. To study its protein sequence, we isolated the agglutinin from human parotid saliva. After trypsin digestion, a portion was analyzed by matrix-assisted laser/desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), which gave the molecular mass of 14 unique peptides. The remainder of the digest was subjected to high performance liquid chromatography, and the separated peptides were analyzed by MALDI-TOF/post-source decay; the spectra gave the sequences of five peptides. The molecular mass and peptide sequence information showed that salivary agglutinin peptides were identical to sequences in lung (lavage) gp-340, a member of the scavenger receptor cysteine-rich protein family. Immunoblotting with antibodies that specifically recognized either lung gp-340 or the agglutinin confirmed that the salivary agglutinin was gp-340. Immunoblotting with an antibody specific to the sialyl Le(x) carbohydrate epitope detected expression on the salivary but not the lung glycoprotein, possible evidence of different glycoforms. The salivary agglutinin also interacted with Helicobacter pylori, implicated in gastritis and peptic ulcer disease, Streptococcus agalactiae, implicated in neonatal meningitis, and several oral commensal streptococci. These results identify the salivary agglutinin as gp-340 and suggest it binds bacteria that are important determinants of either the oral ecology or systemic diseases.

Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.

PubMed

Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi

2017-03-23

A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Proteins in Load-Bearing Junctions: The Histidine-Rich Metal-Binding Protein of Mussel Byssus†,‡

PubMed Central

Zhao, Hua; Waite, J. Herbert

2007-01-01

Building complex load-bearing scaffolds depends on effective ways of joining functionally different biomacromolecules. The junction between collagen fibers and foamlike adhesive plaques in mussel byssus is robust despite the strikingly dissimilar connected structures. mcfp-4, the matrix protein from this junction, and its presecreted form from the foot tissue of Mytilus californianus were isolated and characterized. mcfp-4 has a mass of ∼93 kDa as determined by MALDI-TOF mass spectrometry. Its composition is dominated by histidine (22 mol %), but levels of lysine, arginine, and aspartate are also significant. A small amount of 3,4-dihydroxyphenyl-L-alanine (2 mol %) can be detected by amino acid analysis and redox cycling assays. The cDNA-deduced sequence of mcfp-4 reveals multiple variants with highly repetitive internal structures, including ∼36 tandemly repeated His-rich decapeptides (e.g., HVHTHRVLHK) in the N-terminal half and 16 somewhat more degenerate aspartate-rich undecapeptides (e.g., DDHVNDIAQTA) in the C-terminal half. Incubation of a synthetic peptide based on the His-rich decapeptide with Fe3+, Co2+, Ni2+, Zn2+, and Cu2+ indicates that only Cu is strongly bound. MALDI-TOF mass spectrometry of the peptide modified with diethyl pyrocarbonate before and after Cu binding suggests that histidine residues dominate Cu binding. In contrast, the aspartate-rich undecapeptides preferentially bind Ca2+. mcfp-4 is strategically positioned to function as a macromolecular bifunctional linker by using metal ions to couple its own His-rich domains to the His-rich termini of the preCOLs. Ca2+ may mediate coupling of the C-terminus to other calcium-binding plaque proteins. PMID:17115717

Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

PubMed Central

Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

2001-01-01

Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

Structure of the dimeric exonuclease TREX1 in complex with DNA displays a proline-rich binding site for WW Domains.

PubMed

Brucet, Marina; Querol-Audí, Jordi; Serra, Maria; Ramirez-Espain, Ximena; Bertlik, Kamila; Ruiz, Lidia; Lloberas, Jorge; Macias, Maria J; Fita, Ignacio; Celada, Antonio

2007-05-11

TREX1 is the most abundant mammalian 3' --> 5' DNA exonuclease. It has been described to form part of the SET complex and is responsible for the Aicardi-Goutières syndrome in humans. Here we show that the exonuclease activity is correlated to the binding preferences toward certain DNA sequences. In particular, we have found three motifs that are selected, GAG, ACA, and CTGC. To elucidate how the discrimination occurs, we determined the crystal structures of two murine TREX1 complexes, with a nucleotide product of the exonuclease reaction, and with a single-stranded DNA substrate. Using confocal microscopy, we observed TREX1 both in nuclear and cytoplasmic subcellular compartments. Remarkably, the presence of TREX1 in the nucleus requires the loss of a C-terminal segment, which we named leucine-rich repeat 3. Furthermore, we detected the presence of a conserved proline-rich region on the surface of TREX1. This observation points to interactions with proline-binding domains. The potential interacting motif "PPPVPRPP" does not contain aromatic residues and thus resembles other sequences that select SH3 and/or Group 2 WW domains. By means of nuclear magnetic resonance titration experiments, we show that, indeed, a polyproline peptide derived from the murine TREX1 sequence interacted with the WW2 domain of the elongation transcription factor CA150. Co-immunoprecipitation studies confirmed this interaction with the full-length TREX1 protein, thereby suggesting that TREX1 participates in more functional complexes than previously thought.

Analysis of the thermodynamics of binding of an SH3 domain to proline-rich peptides using a chimeric fusion protein.

PubMed

Candel, Adela M; van Nuland, Nico A J; Martin-Sierra, Francisco M; Martinez, Jose C; Conejero-Lara, Francisco

2008-03-14

A complete understanding of the thermodynamic determinants of binding between SH3 domains and proline-rich peptides is crucial to the development of rational strategies for designing ligands for these important domains. Recently we engineered a single-chain chimeric protein by fusing the alpha-spectrin Src homology region 3 (SH3) domain to the decapeptide APSYSPPPPP (p41). This chimera mimics the structural and energetic features of the interaction between SH3 domains and proline-rich peptides. Here we show that analysing the unfolding thermodynamics of single-point mutants of this chimeric fusion protein constitutes a very useful approach to deciphering the thermodynamics of SH3-ligand interactions. To this end, we investigated the contribution of each proline residue of the ligand sequence to the SH3-peptide interaction by producing six single Pro-Ala mutants of the chimeric protein and analysing their unfolding thermodynamics by differential scanning calorimetry (DSC). Structural analyses of the mutant chimeras by circular dichroism, fluorescence and NMR together with NMR-relaxation measurements indicate conformational flexibility at the binding interface, which is strongly affected by the different Pro-Ala mutations. An analysis of the DSC thermograms on the basis of a three-state unfolding model has allowed us to distinguish and separate the thermodynamic magnitudes of the interaction at the binding interface. The model assumes equilibrium between the "unbound" and "bound" states at the SH3-peptide binding interface. The resulting thermodynamic magnitudes classify the different proline residues according to their importance in the interaction as P2 approximately P7 approximately P10>P9 approximately P6>P8, which agrees well with Lim's model for the interaction between SH3 domains and proline-rich peptides. In addition, the thermodynamic signature of the interaction is the same as that usually found for this type of binding, with a strong enthalpy-entropy compensation for all the mutants. This compensation appears to derive from an increase in conformational flexibility concomitant to the weakening of the interactions at the binding interface. We conclude that our approach, based on DSC and site-directed mutagenesis analysis of chimeric fusion proteins, may serve as a suitable tool to analyse the energetics of weak biomolecular interactions such as those involving SH3 domains.

Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

PubMed

Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

1999-07-30

A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

Convolutional neural network architectures for predicting DNA–protein binding

PubMed Central

Zeng, Haoyang; Edwards, Matthew D.; Liu, Ge; Gifford, David K.

2016-01-01

Motivation: Convolutional neural networks (CNN) have outperformed conventional methods in modeling the sequence specificity of DNA–protein binding. Yet inappropriate CNN architectures can yield poorer performance than simpler models. Thus an in-depth understanding of how to match CNN architecture to a given task is needed to fully harness the power of CNNs for computational biology applications. Results: We present a systematic exploration of CNN architectures for predicting DNA sequence binding using a large compendium of transcription factor datasets. We identify the best-performing architectures by varying CNN width, depth and pooling designs. We find that adding convolutional kernels to a network is important for motif-based tasks. We show the benefits of CNNs in learning rich higher-order sequence features, such as secondary motifs and local sequence context, by comparing network performance on multiple modeling tasks ranging in difficulty. We also demonstrate how careful construction of sequence benchmark datasets, using approaches that control potentially confounding effects like positional or motif strength bias, is critical in making fair comparisons between competing methods. We explore how to establish the sufficiency of training data for these learning tasks, and we have created a flexible cloud-based framework that permits the rapid exploration of alternative neural network architectures for problems in computational biology. Availability and Implementation: All the models analyzed are available at http://cnn.csail.mit.edu. Contact: gifford@mit.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27307608

Molecular basis of CENP-C association with the CENP-A nucleosome at yeast centromeres

PubMed Central

Xiao, Hua; Wang, Feng; Wisniewski, Jan; Shaytan, Alexey K.; Ghirlando, Rodolfo; FitzGerald, Peter C.; Huang, Yingzi; Wei, Debbie; Li, Shipeng; Landsman, David; Panchenko, Anna R.; Wu, Carl

2017-01-01

Histone CENP-A-containing nucleosomes play an important role in nucleating kinetochores at centromeres for chromosome segregation. However, the molecular mechanisms by which CENP-A nucleosomes engage with kinetochore proteins are not well understood. Here, we report the finding of a new function for the budding yeast Cse4/CENP-A histone-fold domain interacting with inner kinetochore protein Mif2/CENP-C. Strikingly, we also discovered that AT-rich centromere DNA has an important role for Mif2 recruitment. Mif2 contacts one side of the nucleosome dyad, engaging with both Cse4 residues and AT-rich nucleosomal DNA. Both interactions are directed by a contiguous DNA- and histone-binding domain (DHBD) harboring the conserved CENP-C motif, an AT hook, and RK clusters (clusters enriched for arginine–lysine residues). Human CENP-C has two related DHBDs that bind preferentially to DNA sequences of higher AT content. Our findings suggest that a DNA composition-based mechanism together with residues characteristic for the CENP-A histone variant contribute to the specification of centromere identity. PMID:29074736

DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

PubMed

Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2013-10-01

Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

Echinoderm phosphorylated matrix proteins UTMP16 and UTMP19 have different functions in sea urchin tooth mineralization.

PubMed

Alvares, Keith; Dixit, Saryu N; Lux, Elizabeth; Veis, Arthur

2009-09-18

Studies of mineralization of embryonic spicules and of the sea urchin genome have identified several putative mineralization-related proteins. These predicted proteins have not been isolated or confirmed in mature mineralized tissues. Mature Lytechinus variegatus teeth were demineralized with 0.6 N HCl after prior removal of non-mineralized constituents with 4.0 M guanidinium HCl. The HCl-extracted proteins were fractionated on ceramic hydroxyapatite and separated into bound and unbound pools. Gel electrophoresis compared the protein distributions. The differentially present bands were purified and digested with trypsin, and the tryptic peptides were separated by high pressure liquid chromatography. NH2-terminal sequences were determined by Edman degradation and compared with the genomic sequence bank data. Two of the putative mineralization-related proteins were found. Their complete amino acid sequences were cloned from our L. variegatus cDNA library. Apatite-binding UTMP16 was found to be present in two isoforms; both isoforms had a signal sequence, a Ser-Asp-rich extracellular matrix domain, and a transmembrane and cytosolic insertion sequence. UTMP19, although rich in Glu and Thr did not bind to apatite. It had neither signal peptide nor transmembrane domain but did have typical nuclear localization and nuclear exit signal sequences. Both proteins were phosphorylated and good substrates for phosphatase. Immunolocalization studies with anti-UTMP16 show it to concentrate at the syncytial membranes in contact with the mineral. On the basis of our TOF-SIMS analyses of magnesium ion and Asp mapping of the mineral phase composition, we speculate that UTMP16 may be important in establishing the high magnesium columns that fuse the calcite plates together to enhance the mechanical strength of the mineralized tooth.

Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification.

PubMed

Huang, Ke-Jing; Liu, Yu-Jie; Zhang, Ji-Zong; Cao, Jun-Tao; Liu, Yan-Ming

2015-05-15

We have developed a sensitive sensing platform for 17β-estradiol by combining the aptamer probe and hybridization reaction. In this assay, 2-dimensional cobalt sulfide nanosheet (CoS) was synthesized by a simple hydrothermal method with L-cysteine as sulfur donor. An electrochemical aptamer biosensor was constructed by assembling a thiol group tagged 17β-estradiol aptamer on CoS and gold nanoparticles (AuNPs) modified electrode. Methylene blue was applied as a tracer and a guanine-rich complementary DNA sequence was designed to bind with the unbound 17β-estradiol aptamer for signal amplification. The binding of guanine-rich DNA to the aptamer was inhibited when the aptamer captured 17β-estradiol. Using guanine-rich DNA in the assay greatly amplified the redox signal of methylene blue bound to the detection probe. The CoS/AuNPs film formed on the biosensor surface appeared to be a good conductor for accelerating the electron transfer. The method demonstrated a high sensitivity of detection with the dynamic concentration range spanning from 1.0×10(-9) to 1.0×10(-12) M and a detection limit of 7.0×10(-13) M. Besides, the fabricated biosensor exhibited good selectivity toward 17β-estradiol even when interferents were presented at 100-fold concentrations. Our attempt will extend the application of the CoS nanosheet and this signal amplification assay to biosensing areas. Copyright © 2014 Elsevier B.V. All rights reserved.

The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition.

PubMed

Tamayo, Joel V; Teramoto, Takamasa; Chatterjee, Seema; Hall, Traci M Tanaka; Gavis, Elizabeth R

2017-04-04

The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo's RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subset of Glo's functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

DOE PAGES

Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema; ...

2017-04-04

The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

Small leucine-rich repeat proteoglycans associated with mature insoluble elastin serve as binding sites for galectins.

PubMed

Itoh, Aiko; Nonaka, Yasuhiro; Ogawa, Takashi; Nakamura, Takanori; Nishi, Nozomu

2017-11-01

We previously reported that galectin-9 (Gal-9), an immunomodulatory animal lectin, could bind to insoluble collagen preparations and exerted direct cytocidal effects on immune cells. In the present study, we found that mature insoluble elastin is capable of binding Gal-9 and other members of the human galectin family. Lectin blot analysis of a series of commercial water-soluble elastin preparations, PES-(A) ~ PES-(E), revealed that only PES-(E) contained substances recognized by Gal-9. Gal-9-interacting substances in PES-(E) were affinity-purified, digested with trypsin and then analyzed by reversed-phase HPLC. Peptide fragments derived from five members of the small leucine-rich repeat proteoglycan family, versican, lumican, osteoglycin/mimecan, prolargin, and fibromodulin, were identified by N-terminal amino acid sequence analysis. The results indicate that Gal-9 and possibly other galectins recognize glycans attached to small leucine-rich repeat proteoglycans associated with insoluble elastin and also indicate the possibility that mature insoluble elastin serves as an extracellular reservoir for galectins.

The poly(rC)-binding protein αCP2 is a noncanonical factor in X. laevis cytoplasmic polyadenylation

PubMed Central

Vishnu, Melanie R.; Sumaroka, Marina; Klein, Peter S.; Liebhaber, Stephen A.

2011-01-01

Post-transcriptional control of mRNA stability and translation is central to multiple developmental pathways. This control can be linked to cytoplasmic polyadenylation in certain settings. In maturing Xenopus oocytes, specific mRNAs are targeted for polyadenylation via recruitment of the Cytoplasmic Polyadenylation Element (CPE) binding protein (CPEB) to CPE(s) within the 3′ UTR. Cytoplasmic polyadenylation is also critical to early embryonic events, although corresponding determinants are less defined. Here, we demonstrate that the Xenopus ortholog of the poly(rC) binding protein αCP2 can recruit cytoplasmic poly(A) polymerase activity to mRNAs in Xenopus post-fertilization embryos, and that this recruitment relies on cis sequences recognized by αCP2. We find that the hα-globin 3′ UTR, a validated mammalian αCP2 target, constitutes an effective target for cytoplasmic polyadenylation in Xenopus embryos, but not during Xenopus oocyte maturation. We further demonstrate that the cytoplasmic polyadenylation activity is dependent on the action of the C-rich αCP-binding site in conjunction with the adjacent AAUAAA. Consistent with its ability to target mRNA for poly(A) addition, we find that XαCP2 associates with core components of the Xenopus cytoplasmic polyadenylation complex, including the cytoplasmic poly(A) polymerase XGLD2. Furthermore, we observe that the C-rich αCP-binding site can robustly enhance the activity of a weak canonical oocyte maturation CPE in early embryos, possibly via a direct interaction between XαCP2 and CPEB1. These studies establish XαCP2 as a novel cytoplasmic polyadenylation trans factor, indicate that C-rich sequences can function as noncanonical cytoplasmic polyadenylation elements, and expand our understanding of the complexities underlying cytoplasmic polyadenylation in specific developmental settings. PMID:21444632

[Structure-functional organization of eukaryotic high-affinity copper importer CTR1 determines its ability to transport copper, silver and cisplatin].

PubMed

Skvortsov, A N; Zatulovskiĭ, E A; Puchkova, L V

2012-01-01

It was shown recently, that high affinity Cu(I) importer eukaryotic protein CTR1 can also transport in vitro abiogenic Ag(I) ions and anticancer drug cisplatin. At present there is no rational explanation how CTR1 can transfer platinum group, which is different by coordination properties from highly similar Cu(I) and Ag(I). To understand this phenomenon we analyzed 25 sequences of chordate CTR1 proteins, and found out conserved patterns of organization of N-terminal extracellular part of CTR1 which correspond to initial metal binding. Extracellular copper-binding motifs were qualified by their coordination properties. It was shown that relative position of Met- and His-rich copper-binding motifs in CTR1 predisposes the extracellular CTR1 part to binding of copper, silver and cisplatin. Relation between tissue-specific expression of CTR1 gene, steady-state copper concentration, and silver and platinum accumulation in organs of mice in vivo was analyzed. Significant positive but incomplete correlation exists between these variables. Basing on structural and functional peculiarities of N-terminal part of CTR1 a hypothesis of coupled transport of copper and cisplatin has been suggested, which avoids the disagreement between CTR1-mediated cisplatin transport in vitro, and irreversible binding of platinum to Met-rich peptides.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

Cellular corepressor TLE2 inhibits replication-and-transcription- activator-mediated transactivation and lytic reactivation of Kaposi's sarcoma-associated herpesvirus.

PubMed

He, Zhiheng; Liu, Yunhua; Liang, Deguang; Wang, Zhuo; Robertson, Erle S; Lan, Ke

2010-02-01

Replication and transcription activator (RTA) encoded by open reading frame 50 (ORF50) of Kaposi's sarcoma-associated herpesvirus (KSHV) is essential and sufficient to initiate lytic reactivation. RTA activates its target genes through direct binding with high affinity to its responsive elements or by interaction with cellular factors, such as RBP-Jkappa, Ap-1, C/EBP-alpha, and Oct-1. In this study, we identified transducin-like enhancer of split 2 (TLE2) as a novel RTA binding protein by using yeast two-hybrid screening of a human spleen cDNA library. The interaction between TLE2 and RTA was confirmed by glutathione S-transferase (GST) binding and coimmunoprecipitation assays. Immunofluorescence analysis showed that TLE2 and RTA were colocalized in the same nuclear compartment in KSHV-infected cells. This interaction recruited TLE2 to RTA bound to its recognition sites on DNA and repressed RTA auto-activation and transactivation activity. Moreover, TLE2 also inhibited the induction of lytic replication and virion production driven by RTA. We further showed that the Q (Gln-rich), SP (Ser-Pro-rich), and WDR (Trp-Asp repeat) domains of TLE2 and the Pro-rich domain of RTA were essential for this interaction. RBP-Jkappa has been shown previously to bind to the same Pro-rich domain of RTA, and this binding can be subject to competition by TLE2. In addition, TLE2 can form a complex with RTA to access the cognate DNA sequence of the RTA-responsive element at different promoters. Intriguingly, the transcription level of TLE2 could be upregulated by RTA during the lytic reactivation process. In conclusion, we identified a new RTA binding protein, TLE2, and demonstrated that TLE2 inhibited replication and transactivation mediated by RTA. This provides another potentially important mechanism for maintenance of KSHV viral latency through interaction with a host protein.

Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.

PubMed

Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S

2008-01-01

Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.

A selective and label-free strategy for rapid screening of telomere-binding Ligands via fluorescence regulation of DNA/silver nanocluster

NASA Astrophysics Data System (ADS)

Cheng, Rui; Xu, Jing; Zhang, Xiafei; Shi, Zhilu; Zhang, Qi; Jin, Yan

2017-03-01

Herein, the conformational switch of G-rich oligonucleotide (GDNA) demonstrated the obvious functional switch of GDNA which was found to significantly affect the fluorescence of the in-situ synthesized DNA/silver nanocluster (DNA-AgNC) in homogeneous solution. We envisioned that the allosteric interaction between GDNA and DNA-AgNC would be possible to be used for screening telomere-binding ligands. A unimolecular probe (12C5TG) is ingeniously designed consisting of three contiguous DNA elements: G-rich telomeric DNA (GDNA) as molecular recognition sequence, T-rich DNA as linker and C-rich DNA as template of DNA-AgNC. The quantum yield and stability of 12C5TG-AgNC is greatly improved because the nearby deoxyguanosines tended to protect DNA/AgNC against oxidation. However, in the presence of ligands, the formation of G-quadruplex obviously quenched the fluorescence of DNA-AgNC. By taking full advantage of intramolecular allosteric effect, telomere-binding ligands were selectively and label-free screened by using deoxyguanines and G-quadruplex as natural fluorescence enhancer and quencher of DNA-AgNC respectively. Therefore, the functional switching of G-rich structure offers a cost-effective, facile and reliable way to screen drugs, which holds a great potential in bioanalysis as well.

In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acosta-Reyes, Francisco J.; Dardonville, Christophe; Koning, Harry P. de

New features of an antiprotozoal DNA minor-groove binding drug, which acts as a cross-linking agent, are presented. It also fills the minor groove of DNA completely and prevents the access of proteins. These features are also expected for other minor-groove binding drugs when associated with suitable DNA targets. The DNA of several pathogens is very rich in AT base pairs. Typical examples include the malaria parasite Plasmodium falciparum and the causative agents of trichomoniasis and trypanosomiases. This fact has prompted studies of drugs which interact with the minor groove of DNA, some of which are used in medical practice. Previousmore » studies have been performed almost exclusively with the AATT sequence. New features should be uncovered through the study of different DNA sequences. In this paper, the crystal structure of the complex of the DNA duplex d(AAAATTTT){sub 2} with the dicationic drug 4, 4′-bis(imidazolinylamino)diphenylamine (CD27) is presented. The drug binds to the minor groove of DNA as expected, but it shows two new features that have not previously been described: (i) the drugs protrude from the DNA and interact with neighbouring molecules, so that they may act as cross-linking agents, and (ii) the drugs completely cover the whole minor groove of DNA and displace bound water. Thus, they may prevent the access to DNA of proteins such as AT-hook proteins. These features are also expected for other minor-groove binding drugs when associated with all-AT DNA. These findings allow a better understanding of this family of compounds and will help in the development of new, more effective drugs. New data on the biological interaction of CD27 with the causative agent of trichomoniasis, Trichomonas vaginalis, are also reported.« less

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Side chain-side chain interactions of arginine with tyrosine and aspartic acid in Arg/Gly/Tyr-rich domains within plant glycine-rich RNA binding proteins.

PubMed

Kumaki, Yasuhiro; Nitta, Katsutoshi; Hikichi, Kunio; Matsumoto, Takeshi; Matsushima, Norio

2004-07-01

Plant glycine-rich RNA-binding proteins (GRRBPs) contain a glycine-rich region at the C-terminus whose structure is quite unknown. The C-terminal glycine-rich part is interposed with arginine and tyrosine (arginine/glycine/tyrosine (RGY)-rich domain). Comparative sequence analysis of forty-one GRRBPs revealed that the RGY-rich domain contains multiple repeats of Tyr-(Xaa)h-(Arg)k-(Xaa)l, where Xaa is mainly Gly, "k" is 1 or 2, and "h" and "l" range from 0 to 10. Two peptides, 1 (G1G2Y3G4G5G6R7R8D9G10) and 2 (G1G2R3R4D5G6G7Y8G9G10), corresponding to sections of the RGY-rich domain in Zea mays RAB15, were selected for CD and NMR experiments. The CD spectra indicate a unique, positive band near 228 nm in both peptides that has been ascribed to tyrosine residues in ordered structures. The pH titration by NMR revealed that a side chain-side chain interaction, presumably an H-Nepsilon...O=Cgamma hydrogen bonding interaction in the salt bridge, occurs between Arg (i) and Asp (i + 2). 1D GOESY experiments indicated the presence of NOE between the aromatic side chain proton and the arginine side chain proton in the two peptides suggesting strongly that the Arg (i) aromatic side chain interacts directly with the Tyr (i +/- 4 or i +/- 5) side chain.

Characterization and N-terminal sequencing of a calcium binding protein from the calcareous concretion organic matrix of the terrestrial crustacean Orchestia cavimana.

PubMed

Luquet, G; Testenière, O; Graf, F

1996-04-16

We extracted proteins from the organic matrix of calcareous concretions, which represents the calcium storage form in a terrestrial crustacean. Electrophoretic analyses of water-soluble organic-matrix proteinaceous components revealed 11 polypeptides, 6 of which are probably glycosylated. Among the unglycosylated proteins, we characterized a 23 kDa polypeptide, with an isoelectric point of 5.5, which is able to bind calcium. Its N-terminal sequence is rich in acidic amino acids (essentially aspartic acid). All these characteristics suggest its involvement in the calcium precipitation process within the successive layers of the organic matrix.

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

Sequences required for induction of neurotensin receptor gene expression during neuronal differentiation of N1E-115 neuroblastoma cells.

PubMed

Tavares, D; Tully, K; Dobner, P R

1999-10-15

The promoter region of the mouse high affinity neurotensin receptor (Ntr-1) gene was characterized, and sequences required for expression in neuroblastoma cell lines that express high affinity NT-binding sites were characterized. Me(2)SO-induced neuronal differentiation of N1E-115 neuroblastoma cells increased both the expression of the endogenous Ntr-1 gene and reporter genes driven by NTR-1 promoter sequences by 3-4-fold. Deletion analysis revealed that an 83-base pair promoter region containing the transcriptional start site is required for Me(2)SO activation. Detailed mutational analysis of this region revealed that a CACCC box and the central region of a large GC-rich palindrome are the crucial cis-regulatory elements required for Me(2)SO induction. The CACCC box is bound by at least one factor that is induced upon Me(2)SO treatment of N1E-115 cells. The Me(2)SO effect was found to be both selective and cell type-restricted. Basal expression in the neuroblastoma cell lines required a distinct set of sequences, including an Sp1-like sequence, and a sequence resembling an NGFI-A-binding site; however, a more distal 5' sequence was found to repress basal activity in N1E-115 cells. These results provide evidence that Ntr-1 gene regulation involves both positive and negative regulatory elements located in the 5'-flanking region and that Ntr-1 gene activation involves the coordinate activation or induction of several factors, including a CACCC box binding complex.

Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

NASA Astrophysics Data System (ADS)

Ray, Sujay

Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Finally, we studied another protein-GQ system where a protein complex works synergistically with a GQ to suppress DNA damage signals by preventing RPA to bind to telomeric DNA. Human telomeres that terminate with a single-stranded 3' G-overhang can be recognized as a DNA damage site by RPA. The protection of telomere-1 (POT1) and POT1-interacting protein (TPP1) heterodimer, binds specifically to telomeric DNA and protects it against RPA binding. Using model telomeric DNA, we studied the competition between POT1/TPP1 and RPA to access telomeric GQs in vitro. Under physiological salt and pH conditions, POT1/TPP1 stably load to a minimal DNA sequence adjacent to a folded GQ and unfolds the anti-parallel GQ as the parallel conformation remains folded. We showed that GQ formation of telomeres enhances the ability of POT1/TPP1 to block RPA's access to telomeres by two orders of magnitude and contributes to suppress DNA damage signals.

mRNA stability in mammalian cells.

PubMed Central

Ross, J

1995-01-01

This review concerns how cytoplasmic mRNA half-lives are regulated and how mRNA decay rates influence gene expression. mRNA stability influences gene expression in virtually all organisms, from bacteria to mammals, and the abundance of a particular mRNA can fluctuate manyfold following a change in the mRNA half-life, without any change in transcription. The processes that regulate mRNA half-lives can, in turn, affect how cells grow, differentiate, and respond to their environment. Three major questions are addressed. Which sequences in mRNAs determine their half-lives? Which enzymes degrade mRNAs? Which (trans-acting) factors regulate mRNA stability, and how do they function? The following specific topics are discussed: techniques for measuring eukaryotic mRNA stability and for calculating decay constants, mRNA decay pathways, mRNases, proteins that bind to sequences shared among many mRNAs [like poly(A)- and AU-rich-binding proteins] and proteins that bind to specific mRNAs (like the c-myc coding-region determinant-binding protein), how environmental factors like hormones and growth factors affect mRNA stability, and how translation and mRNA stability are linked. Some perspectives and predictions for future research directions are summarized at the end. PMID:7565413

Localization and characterization of an alpha-thrombin-binding site on platelet glycoprotein Ib alpha.

PubMed

De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M

1994-03-04

Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.

TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

PubMed

Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

2015-01-01

It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA

PubMed Central

Lisbin, Michael J.; Qiu, Jan; White, Kalpana

2001-01-01

Drosophila melanogaster neural-specific protein, ELAV, has been shown to regulate the neural-specific splicing of three genes: neuroglian (nrg), erect wing, and armadillo. Alternative splicing of the nrg transcript involves alternative inclusion of a 3′-terminal exon. Here, using a minigene reporter, we show that the nrg alternatively spliced intron (nASI) has all the determinants required to recreate proper neural-specific RNA processing seen with the endogenous nrg transcript, including regulation by ELAV. An in vitro UV cross-linking assay revealed that ELAV from nuclear extracts cross-links to four distinct sites along the 3200 nucleotide long nASI; one EXS is positioned at the polypyrimidine tract of the default 3′ splice site. ELAV cross-linking sites (EXSs) have in common long tracts of (U)-rich sequence rather than a precise consensus; moreover, each tract has at least two 8/10U elements; their importance is validated by mutant transgene reporter analysis. Further, we propose criteria for ELAV target sequence recognition based on the four EXSs, sites within the nASI that are (U) rich but do not cross-link with ELAV, and predicted EXSs from a phylogenetic comparison with Drosophila virilis nASI. These results suggest that ELAV regulates nrg alternative splicing by direct interaction with the nASI. PMID:11581160

The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA.

PubMed

Lisbin, M J; Qiu, J; White, K

2001-10-01

Drosophila melanogaster neural-specific protein, ELAV, has been shown to regulate the neural-specific splicing of three genes: neuroglian (nrg), erect wing, and armadillo. Alternative splicing of the nrg transcript involves alternative inclusion of a 3'-terminal exon. Here, using a minigene reporter, we show that the nrg alternatively spliced intron (nASI) has all the determinants required to recreate proper neural-specific RNA processing seen with the endogenous nrg transcript, including regulation by ELAV. An in vitro UV cross-linking assay revealed that ELAV from nuclear extracts cross-links to four distinct sites along the 3200 nucleotide long nASI; one EXS is positioned at the polypyrimidine tract of the default 3' splice site. ELAV cross-linking sites (EXSs) have in common long tracts of (U)-rich sequence rather than a precise consensus; moreover, each tract has at least two 8/10U elements; their importance is validated by mutant transgene reporter analysis. Further, we propose criteria for ELAV target sequence recognition based on the four EXSs, sites within the nASI that are (U) rich but do not cross-link with ELAV, and predicted EXSs from a phylogenetic comparison with Drosophila virilis nASI. These results suggest that ELAV regulates nrg alternative splicing by direct interaction with the nASI.

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

PubMed

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

Hsp70 Is a Novel Posttranscriptional Regulator of Gene Expression That Binds and Stabilizes Selected mRNAs Containing AU-Rich Elements

PubMed Central

Kishor, Aparna; Tandukar, Bishal; Ly, Yann V.; Toth, Eric A.; Suarez, Yvelisse; Brewer, Gary

2013-01-01

The AU-rich elements (AREs) encoded within many mRNA 3′ untranslated regions (3′UTRs) are targets for factors that control transcript longevity and translational efficiency. Hsp70, best known as a protein chaperone with well-defined peptide-refolding properties, is known to interact with ARE-like RNA substrates in vitro. Here, we show that cofactor-free preparations of Hsp70 form direct, high-affinity complexes with ARE substrates based on specific recognition of U-rich sequences by both the ATP- and peptide-binding domains. Suppressing Hsp70 in HeLa cells destabilized an ARE reporter mRNA, indicating a novel ARE-directed mRNA-stabilizing role for this protein. Hsp70 also bound and stabilized endogenous ARE-containing mRNAs encoding vascular endothelial growth factor (VEGF) and Cox-2, which involved a mechanism that was unaffected by an inhibitor of its protein chaperone function. Hsp70 recognition and stabilization of VEGF mRNA was mediated by an ARE-like sequence in the proximal 3′UTR. Finally, stabilization of VEGF mRNA coincided with the accumulation of Hsp70 protein in HL60 promyelocytic leukemia cells recovering from acute thermal stress. We propose that the binding and stabilization of selected ARE-containing mRNAs may contribute to the cytoprotective effects of Hsp70 following cellular stress but may also provide a novel mechanism linking constitutively elevated Hsp70 expression to the development of aggressive neoplastic phenotypes. PMID:23109422

DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

PubMed

Lafuente, M J; Gamo, F J; Gancedo, C

1996-09-01

We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

PubMed

Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

2014-02-03

The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

Revealing Ligand Binding Sites and Quantifying Subunit Variants of Noncovalent Protein Complexes in a Single Native Top-Down FTICR MS Experiment

NASA Astrophysics Data System (ADS)

Li, Huilin; Wongkongkathep, Piriya; Van Orden, Steve L.; Ogorzalek Loo, Rachel R.; Loo, Joseph A.

2014-12-01

"Native" mass spectrometry (MS) has been proven to be increasingly useful for structural biology studies of macromolecular assemblies. Using horse liver alcohol dehydrogenase (hADH) and yeast alcohol dehydrogenase (yADH) as examples, we demonstrate that rich information can be obtained in a single native top-down MS experiment using Fourier transform ion cyclotron mass spectrometry (FTICR MS). Beyond measuring the molecular weights of the protein complexes, isotopic mass resolution was achieved for yeast ADH tetramer (147 kDa) with an average resolving power of 412,700 at m/z 5466 in absorption mode, and the mass reflects that each subunit binds to two zinc atoms. The N-terminal 89 amino acid residues were sequenced in a top-down electron capture dissociation (ECD) experiment, along with the identifications of the zinc binding site at Cys46 and a point mutation (V58T). With the combination of various activation/dissociation techniques, including ECD, in-source dissociation (ISD), collisionally activated dissociation (CAD), and infrared multiphoton dissociation (IRMPD), 40% of the yADH sequence was derived directly from the native tetramer complex. For hADH, native top-down ECD-MS shows that both E and S subunits are present in the hADH sample, with a relative ratio of 4:1. Native top-down ISD of the hADH dimer shows that each subunit (E and S chains) binds not only to two zinc atoms, but also the NAD/NADH ligand, with a higher NAD/NADH binding preference for the S chain relative to the E chain. In total, 32% sequence coverage was achieved for both E and S chains.

Thermodynamics of Nucleic Acid ‘Shape Readout’ by an Aminosugar†

PubMed Central

Xi, Hongjuan; Davis, Erik; Ranjan, Nihar; Xue, Liang; Hyde-Volpe, David; Arya, Dev P.

2012-01-01

Recognition of nucleic acids is important for our understanding of nucleic acid structure as well as for our understanding of nucleic acid-protein interactions. In addition to the direct readout mechanisms of nucleic acids such as H-bonding, shape recognition of nucleic acids is being increasingly recognized to play an equally important role in DNA recognition. Competition Dialysis, UV, Flourescent Intercalator displacement (FID), Computational Docking, and calorimetry studies were conducted to study the interaction of neomycin with a variety of nucleic acid conformations (shapes). At pH 5.5, these results suggest: (1) Neomycin binds three RNA structures (16S A site rRNA, poly(rA)•poly(rA), and poly(rA)•poly(rU)) with high affinities, Ka~107M−1. (2) The binding of neomycin to A-form GC-rich oligomer d(A2G15C15T2)2 has comparable affinity to RNA structures. (3) The binding of neomycin to DNA•RNA hybrids shows a three-fold variance attributable to their structural differences (poly(dA) •poly(rU), Ka=9.4×106M−1 and poly(rA)•poly(dT), Ka=3.1×106M−1). (4) The interaction of neomycin with DNA triplex poly(dA)•2poly(dT) yields a binding affinity of Ka=2.4×105M−1. (5) Poly(dA-dT)2 showed the lowest association constant for all nucleic acids studied (Ka=<105). (6) Neomycin binds to G-quadruplexes with Ka~104-105M−1. (7) Computational studies show that the decrease in major groove width in the B to A transition correlates with increasing neomycin affinity. Neomycin’s affinity for various nucleic acid structures can be ranked as follows, RNAs and GC-rich d(A2G15C15T2)2 structures > poly(dA)•poly(rU) > poly(rA)•poly(dT) > T•A-T triplex , G-quadruplexes, B-form AT-rich or GC-rich DNA sequences. The results illustrate the first example of a small molecule based ‘shape readout’ of different nucleic acid conformations. PMID:21863895

Biophysical characterization of the basic cluster in the transcription repression domain of human MeCP2 with AT-rich DNA.

PubMed

Mushtaq, Ameeq Ul; Lee, Yejin; Hwang, Eunha; Bang, Jeong Kyu; Hong, Eunmi; Byun, Youngjoo; Song, Ji-Joon; Jeon, Young Ho

2018-01-01

MeCP2 is a chromatin associated protein which is highly expressed in brain and relevant with Rett syndrome (RTT). There are AT-hook motifs in MeCP2 which can bind with AT-rich DNA, suggesting a role in chromatin binding. Here, we report the identification and characterization of another AT-rich DNA binding motif (residues 295 to 313) from the C-terminal transcription repression domain of MeCP2 by nuclear magnetic resonance (NMR) and isothermal calorimetry (ITC). This motif shows a micromolar affinity to AT-rich DNA, and it binds to the minor groove of DNA like AT-hook motifs. Together with the previous studies, our results provide an insight into a critical role of this motif in chromatin structure and function. Copyright © 2017 Elsevier Inc. All rights reserved.

Allelic barley MLA immune receptors recognize sequence-unrelated avirulence effectors of the powdery mildew pathogen

USDA-ARS?s Scientific Manuscript database

Disease resistance (R) genes encoding intracellular nucleotide-binding domain and leucine-rich repeat proteins (NLRs) are key components of the plant innate immune system and typically detect the presence of isolate-specific avirulence (AVR) effectors from pathogens. NLRs define the fastest evolving...

A crustacean Ca2+-binding protein with a glutamate-rich sequence promotes CaCO3 crystallization.

PubMed

Endo, Hirotoshi; Takagi, Yasuaki; Ozaki, Noriaki; Kogure, Toshihiro; Watanabe, Toshiki

2004-11-15

The DD4 mRNA of the penaeid prawn Penaeus japonicus was shown previously to be expressed in the epidermis adjacent to the exoskeleton specifically during the post-moult period, when calcification of the exoskeleton took place. The encoded protein possessed a Ca2+-binding site, suggesting its involvement in the calcification of the exoskeleton. In the present study, an additional ORF (open reading frame) of 289 amino acids was identified at the 5' end of the previous ORF. The newly identified part of the encoded protein included a region of approx. 120 amino acids that was highly rich in glutamate residues, and contained one or more Ca2+-binding sites. In an immunohistochemical study, signals were detected within calcified regions in the endocuticular layer of the exoskeleton. Bacterially expressed partial segments of the protein induced CaCO3 crystallization in vitro. Finally, a reverse transcription-PCR study showed that the expression was limited to an early part of the post-moult period, preceding significant calcification of the exoskeleton. These observations argue for the possibility that the encoded protein, renamed crustocalcin (CCN), promotes formation of CaCO3 crystals in the exoskeleton by inducing nucleation.

Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

PubMed

Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

2016-01-01

c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.

Isolation and N-terminal sequencing of a novel cadmium-binding protein from Boletus edulis

NASA Astrophysics Data System (ADS)

Collin-Hansen, C.; Andersen, R. A.; Steinnes, E.

2003-05-01

A Cd-binding protein was isolated from the popular edible mushroom Boletus edulis, which is a hyperaccumulator of both Cd and Hg. Wild-growing samples of B. edulis were collected from soils rich in Cd. Cd radiotracer was added to the crude protein preparation obtained from ethanol precipitation of heat-treated cytosol. Proteins were then further separated in two consecutive steps; gel filtration and anion exchange chromatography. In both steps the Cd radiotracer profile showed only one distinct peak, which corresponded well with the profiles of endogenous Cd obtained by atomic absorption spectrophotometry (AAS). Concentrations of the essential elements Cu and Zn were low in the protein fractions high in Cd. N-terminal sequencing performed on the Cd-binding protein fractions revealed a protein with a novel amino acid sequence, which contained aromatic amino acids as well as proline. Both the N-terminal sequencing and spectrofluorimetric analysis with EDTA and ABD-F (4-aminosulfonyl-7-fluoro-2, 1, 3-benzoxadiazole) failed to detect cysteine in the Cd-binding fractions. These findings conclude that the novel protein does not belong to the metallothionein family. The results suggest a role for the protein in Cd transport and storage, and they are of importance in view of toxicology and food chemistry, but also for environmental protection.

Favorable 2'-substitution in the loop region of a thrombin-binding DNA aptamer.

PubMed

Awachat, Ragini; Wagh, Atish A; Aher, Manisha; Fernandes, Moneesha; Kumar, Vaijayanti A

2018-06-01

Simple 2'-OMe-chemical modification in the loop region of the 15mer G-rich DNA sequence GGTTGGTGTGGTTGG is reported. The G-quadruplex structure of this thrombin-binding aptamer (TBA), is stabilized by single modifications (T → 2'-OMe-U), depending on the position of the modification. The structural stability also renders significantly increased inhibition of thrombin-induced fibrin polymerization, a process closely associated with blood-clotting. Copyright © 2018 Elsevier Ltd. All rights reserved.

Evolution of Hsp70 Gene Expression: A Role for Changes in AT-Richness within Promoters

PubMed Central

Ma, Ronghui; Zhang, Bo; Kang, Le

2011-01-01

In disparate organisms adaptation to thermal stress has been linked to changes in the expression of genes encoding heat-shock proteins (Hsp). The underlying genetics, however, remain elusive. We show here that two AT-rich sequence elements in the promoter region of the hsp70 gene of the fly Liriomyza sativae that are absent in the congeneric species, Liriomyza huidobrensis, have marked cis-regulatory consequences. We studied the cis-regulatory consequences of these elements (called ATRS1 and ATRS2) by measuring the constitutive and heat-shock-induced luciferase luminescence that they drive in cells transfected with constructs carrying them modified, deleted, or intact, in the hsp70 promoter fused to the luciferase gene. The elements affected expression level markedly and in different ways: Deleting ATRS1 augmented both the constitutive and the heat-shock-induced luminescence, suggesting that this element represses transcription. Interestingly, replacing the element with random sequences of the same length and A+T content delivered the wild-type luminescence pattern, proving that the element's high A+T content is crucial for its effects. Deleting ATRS2 decreased luminescence dramatically and almost abolished heat-shock inducibility and so did replacing the element with random sequences matching the element's length and A+T content, suggesting that ATRS2's effects on transcription and heat-shock inducibility involve a common mechanism requiring at least in part the element's specific primary structure. Finally, constitutive and heat-shock luminescence were reduced strongly when two putative binding sites for the Zeste transcription factor identified within ATRS2 were altered through site-directed mutagenesis, and the heat-shock-induced luminescence increased when Zeste was over-expressed, indicating that Zeste participates in the effects mapped to ATRS2 at least in part. AT-rich sequences are common in promoters and our results suggest that they should play important roles in regulatory evolution since they can affect expression markedly and constrain promoter DNA in at least two different ways. PMID:21655251

Evidence for Context-Dependent Complementarity of Non-Shine-Dalgarno Ribosome Binding Sites to Escherichia coli rRNA

PubMed Central

Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.

2013-01-01

While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812

Role of the Pepino mosaic virus 3'-untranslated region elements in negative-strand RNA synthesis in vitro.

PubMed

Osman, Toba A M; Olsthoorn, René C L; Livieratos, Ioannis C

2014-09-22

Pepino mosaic virus (PepMV) is a mechanically-transmitted positive-strand RNA potexvirus, with a 6410 nt long single-stranded (ss) RNA genome flanked by a 5'-methylguanosine cap and a 3' poly-A tail. Computer-assisted folding of the 64 nt long PepMV 3'-untranslated region (UTR) resulted in the prediction of three stem-loop structures (hp1, hp2, and hp3 in the 3'-5' direction). The importance of these structures and/or sequences for promotion of negative-strand RNA synthesis and binding to the RNA dependent RNA polymerase (RdRp) was tested in vitro using a specific RdRp assay. Hp1, which is highly variable among different PepMV isolates, appeared dispensable for negative-strand synthesis. Hp2, which is characterized by a large U-rich loop, tolerated base-pair changes in its stem as long as they maintained the stem integrity but was very sensitive to changes in the U-rich loop. Hp3, which harbours the conserved potexvirus ACUUAA hexamer motif, was essential for template activity. Template-RNA polymerase binding competition experiments showed that the ACUUAA sequence represents a high-affinity RdRp binding element. Copyright © 2014 Elsevier B.V. All rights reserved.

Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

PubMed

Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

2001-08-17

Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

NASA Astrophysics Data System (ADS)

Gresh, Nohad; Perrée-fauvet, Martine

1999-03-01

On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

The RNA-binding complex ESCRT-II in Xenopus laevis eggs recognizes purine-rich sequences through its subunit Vps25.

PubMed

Emerman, Amy B; Blower, Michael

2018-06-14

RNA-binding proteins (RBPs) are critical regulators of gene expression. Recent studies have uncovered hundreds of mRNA-binding proteins that do not contain annotated RNA-binding domains and have well-established roles in other cellular processes. Investigation of these nonconventional RBPs is critical for revealing novel RNA-binding domains and may disclose connections between RNA regulation and other aspects of cell biology. Endosomal sorting complex required for transport II (ESCRT-II) is a nonconventional RNA-binding complex that has a canonical role in multivesicular body formation. ESCRT-II previously has been identified as an RNA-binding complex in Drosophila oocytes, but whether its RNA-binding properties extend beyond Drosophila is unknown. In this study, we found that the RNA-binding properties of ESCRT-II are conserved in Xenopus eggs, where ESCRT-II interacted with hundreds of mRNAs. Using a UV-crosslinking approach, we demonstrated that ESCRT-II binds directly to RNA through its subunit Vps25. UV-crosslinking and immunoprecipitation (CLIP)-Seq revealed that Vps25 specifically recognizes a polypurine (i.e. GA-rich) motif in RNA. Using purified components, we could reconstitute the selective Vps25-mediated binding of the polypurine motif in vitro. Our results provide insight into the mechanism by which ESCRT-II selectively binds to mRNAs and also suggest an unexpected link between endosome biology and RNA regulation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

ERIC Educational Resources Information Center

Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

2009-01-01

Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

Identification and distribution of the NBS-LRR gene family in the cassava genome

USDA-ARS?s Scientific Manuscript database

Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

The Cytoplasmic Tail of the T Cell Receptor CD3 ε Subunit Contains a Phospholipid-Binding Motif that Regulates T Cell Functions1

PubMed Central

DeFord-Watts, Laura M.; Tassin, Tara C.; Becker, Amy M.; Medeiros, Jennifer J.; Albanesi, Joseph P.; Love, Paul E.; Wülfing, Christoph; van Oers, Nicolai S. C.

2010-01-01

The CD3 ε subunit of the TCR complex contains two defined signaling domains, a proline-rich sequence and an ITAM. We identified a third signaling sequence in CD3 ε, termed the basic-rich stretch (BRS). Herein, we show that the positively charged residues of the BRS enable this region of CD3 ε to complex a subset of acidic phospholipids, including PI(3)P, PI(4)P, PI(5)P, PI(3,4,5)P3, and PI(4,5)P2. Transgenic mice containing mutations of the BRS exhibited varying developmental defects, ranging from reduced thymic cellularity to a complete block in T cell development. Peripheral T cells from BRS-modified mice also exhibited several defects, including decreased TCR surface expression, reduced TCR-mediated signaling responses to agonist peptide-loaded APCs, and delayed CD3 ε localization to the immunological synapse. Overall, these findings demonstrate a functional role for the CD3 ε lipid-binding domain in T cell biology. PMID:19542373

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli

PubMed Central

Kim, Jin Sun; Park, Su Jung; Kwak, Kyung Jin; Kim, Yeon Ok; Kim, Joo Yeol; Song, Jinkyung; Jang, Boseung; Jung, Che-Hun; Kang, Hunseung

2007-01-01

Despite the fact that cold shock domain proteins (CSDPs) and glycine-rich RNA-binding proteins (GRPs) have been implicated to play a role during the cold adaptation process, their importance and function in eukaryotes, including plants, are largely unknown. To understand the functional role of plant CSDPs and GRPs in the cold response, two CSDPs (CSDP1 and CSDP2) and three GRPs (GRP2, GRP4 and GRP7) from Arabidopsis thaliana were investigated. Heterologous expression of CSDP1 or GRP7 complemented the cold sensitivity of BX04 mutant Escherichia coli that lack four cold shock proteins (CSPs) and is highly sensitive to cold stress, and resulted in better survival rate than control cells during incubation at low temperature. In contrast, CSDP2 and GRP4 had very little ability. Selective evolution of ligand by exponential enrichment (SELEX) revealed that GRP7 does not recognize specific RNAs but binds preferentially to G-rich RNA sequences. CSDP1 and GRP7 had DNA melting activity, and enhanced RNase activity. In contrast, CSDP2 and GRP4 had no DNA melting activity and did not enhance RNAase activity. Together, these results indicate that CSDPs and GRPs help E.coli grow and survive better during cold shock, and strongly imply that CSDP1 and GRP7 exhibit RNA chaperone activity during the cold adaptation process. PMID:17169986

Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

PubMed Central

Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

1986-01-01

The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

The human RNA-binding protein and E3 ligase MEX-3C binds the MEX-3-recognition element (MRE) motif with high affinity.

PubMed

Yang, Lingna; Wang, Chongyuan; Li, Fudong; Zhang, Jiahai; Nayab, Anam; Wu, Jihui; Shi, Yunyu; Gong, Qingguo

2017-09-29

MEX-3 is a K-homology (KH) domain-containing RNA-binding protein first identified as a translational repressor in Caenorhabditis elegans , and its four orthologs (MEX-3A-D) in human and mouse were subsequently found to have E3 ubiquitin ligase activity mediated by a RING domain and critical for RNA degradation. Current evidence implicates human MEX-3C in many essential biological processes and suggests a strong connection with immune diseases and carcinogenesis. The highly conserved dual KH domains in MEX-3 proteins enable RNA binding and are essential for the recognition of the 3'-UTR and post-transcriptional regulation of MEX-3 target transcripts. However, the molecular mechanisms of translational repression and the consensus RNA sequence recognized by the MEX-3C KH domain are unknown. Here, using X-ray crystallography and isothermal titration calorimetry, we investigated the RNA-binding activity and selectivity of human MEX-3C dual KH domains. Our high-resolution crystal structures of individual KH domains complexed with a noncanonical U-rich and a GA-rich RNA sequence revealed that the KH1/2 domains of human MEX-3C bound MRE10, a 10-mer RNA (5'-CAGAGUUUAG-3') consisting of an eight-nucleotide MEX-3-recognition element (MRE) motif, with high affinity. Of note, we also identified a consensus RNA motif recognized by human MEX-3C. The potential RNA-binding sites in the 3'-UTR of the human leukocyte antigen serotype ( HLA-A2 ) mRNA were mapped with this RNA-binding motif and further confirmed by fluorescence polarization. The binding motif identified here will provide valuable information for future investigations of the functional pathways controlled by human MEX-3C and for predicting potential mRNAs regulated by this enzyme. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Origin Replication Complex Binding, Nucleosome Depletion Patterns, and a Primary Sequence Motif Can Predict Origins of Replication in a Genome with Epigenetic Centromeres

PubMed Central

Tsai, Hung-Ji; Baller, Joshua A.; Liachko, Ivan; Koren, Amnon; Burrack, Laura S.; Hickman, Meleah A.; Thevandavakkam, Mathuravani A.; Rusche, Laura N.

2014-01-01

ABSTRACT Origins of DNA replication are key genetic elements, yet their identification remains elusive in most organisms. In previous work, we found that centromeres contain origins of replication (ORIs) that are determined epigenetically in the pathogenic yeast Candida albicans. In this study, we used origin recognition complex (ORC) binding and nucleosome occupancy patterns in Saccharomyces cerevisiae and Kluyveromyces lactis to train a machine learning algorithm to predict the position of active arm (noncentromeric) origins in the C. albicans genome. The model identified bona fide active origins as determined by the presence of replication intermediates on nondenaturing two-dimensional (2D) gels. Importantly, these origins function at their native chromosomal loci and also as autonomously replicating sequences (ARSs) on a linear plasmid. A “mini-ARS screen” identified at least one and often two ARS regions of ≥100 bp within each bona fide origin. Furthermore, a 15-bp AC-rich consensus motif was associated with the predicted origins and conferred autonomous replicating activity to the mini-ARSs. Thus, while centromeres and the origins associated with them are epigenetic, arm origins are dependent upon critical DNA features, such as a binding site for ORC and a propensity for nucleosome exclusion. PMID:25182328

Leucine-rich Repeats of Bacterial Surface Proteins Serve as Common Pattern Recognition Motifs of Human Scavenger Receptor gp340*

PubMed Central

Loimaranta, Vuokko; Hytönen, Jukka; Pulliainen, Arto T.; Sharma, Ashu; Tenovuo, Jorma; Strömberg, Nicklas; Finne, Jukka

2009-01-01

Scavenger receptors are innate immune molecules recognizing and inducing the clearance of non-host as well as modified host molecules. To recognize a wide pattern of invading microbes, many scavenger receptors bind to common pathogen-associated molecular patterns, such as lipopolysaccharides and lipoteichoic acids. Similarly, the gp340/DMBT1 protein, a member of the human scavenger receptor cysteine-rich protein family, displays a wide ligand repertoire. The peptide motif VEVLXXXXW derived from its scavenger receptor cysteine-rich domains is involved in some of these interactions, but most of the recognition mechanisms are unknown. In this study, we used mass spectrometry sequencing, gene inactivation, and recombinant proteins to identify Streptococcus pyogenes protein Spy0843 as a recognition receptor of gp340. Antibodies against Spy0843 are shown to protect against S. pyogenes infection, but no function or host receptor have been identified for the protein. Spy0843 belongs to the leucine-rich repeat (Lrr) family of eukaryotic and prokaryotic proteins. Experiments with truncated forms of the recombinant proteins confirmed that the Lrr region is needed in the binding of Spy0843 to gp340. The same motif of two other Lrr proteins, LrrG from the Gram-positive S. agalactiae and BspA from the Gram-negative Tannerella forsythia, also mediated binding to gp340. Moreover, inhibition of Spy0843 binding occurred with peptides containing the VEVLXXXXW motif, but also peptides devoid of the XXXXW motif inhibited binding of Lrr proteins. These results thus suggest that the conserved Lrr motif in bacterial proteins serves as a novel pattern recognition motif for unique core peptides of human scavenger receptor gp340. PMID:19465482

Binding the Mammalian High Mobility Group Protein AT-hook 2 to AT-Rich Deoxyoligonucleotides: Enthalpy-Entropy Compensation

PubMed Central

Joynt, Suzanne; Morillo, Victor; Leng, Fenfei

2009-01-01

HMGA2 is a DNA minor-groove binding protein. We previously demonstrated that HMGA2 binds to AT-rich DNA with very high binding affinity where the binding of HMGA2 to poly(dA-dT)2 is enthalpy-driven and to poly(dA)poly(dT) is entropy-driven. This is a typical example of enthalpy-entropy compensation. To further study enthalpy-entropy compensation of HMGA2, we used isothermal-titration-calorimetry to examine the interactions of HMGA2 with two AT-rich DNA hairpins: 5′-CCAAAAAAAAAAAAAAAGCCCCCGCTTTTTTTTTTTTTTTGG-3′ (FL-AT-1) and 5′-CCATATATATATATATAGCCCCCGCTATATATATATATATGG-3′ (FL-AT-2). Surprisingly, we observed an atypical isothermal-titration-calorimetry-binding curve at low-salt aqueous solutions whereby the apparent binding-enthalpy decreased dramatically as the titration approached the end. This unusual behavior can be attributed to the DNA-annealing coupled to the ligand DNA-binding and is eliminated by increasing the salt concentration to ∼200 mM. At this condition, HMGA2 binding to FL-AT-1 is entropy-driven and to FL-AT-2 is enthalpy-driven. Interestingly, the DNA-binding free energies for HMGA2 binding to both hairpins are almost temperature independent; however, the enthalpy-entropy changes are dependent on temperature, which is another aspect of enthalpy-entropy compensation. The heat capacity change for HMGA2 binding to FL-AT-1 and FL-AT-2 are almost identical, indicating that the solvent displacement and charge-charge interaction in the coupled folding/binding processes for both binding reactions are similar. PMID:19450485

Highly accessible AU-rich regions in 3' untranslated regions are hotspots for binding of regulatory factors.

PubMed

Plass, Mireya; Rasmussen, Simon H; Krogh, Anders

2017-04-01

Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3'UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing "free" target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks.

Highly accessible AU-rich regions in 3’ untranslated regions are hotspots for binding of regulatory factors

PubMed Central

2017-01-01

Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks. PMID:28410363

A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

PubMed

Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

1997-02-01

Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

PubMed Central

Fanning, T; Singer, M

1987-01-01

Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

Polymerase ribozyme efficiency increased by G/T-rich DNA oligonucleotides

PubMed Central

Yao, Chengguo; Müller, Ulrich F.

2011-01-01

The RNA world hypothesis states that the early evolution of life went through a stage where RNA served as genome and as catalyst. The replication of RNA world organisms would have been facilitated by ribozymes that catalyze RNA polymerization. To recapitulate an RNA world in the laboratory, a series of RNA polymerase ribozymes was developed previously. However, these ribozymes have a polymerization efficiency that is too low for self-replication, and the most efficient ribozymes prefer one specific template sequence. The limiting factor for polymerization efficiency is the weak sequence-independent binding to its primer/template substrate. Most of the known polymerase ribozymes bind an RNA heptanucleotide to form the P2 duplex on the ribozyme. By modifying this heptanucleotide, we were able to significantly increase polymerization efficiency. Truncations at the 3′-terminus of this heptanucleotide increased full-length primer extension by 10-fold, on a specific template sequence. In contrast, polymerization on several different template sequences was improved dramatically by replacing the RNA heptanucleotide with DNA oligomers containing randomized sequences of 15 nt. The presence of G and T in the random sequences was sufficient for this effect, with an optimal composition of 60% G and 40% T. Our results indicate that these DNA sequences function by establishing many weak and nonspecific base-pairing interactions to the single-stranded portion of the template. Such low-specificity interactions could have had important functions in an RNA world. PMID:21622900

Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

PubMed

Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2017-09-01

DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

Monitoring DNA triplex formation using multicolor fluorescence and application to insulin-like growth factor I promoter downregulation.

PubMed

Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe

2014-03-01

Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. © 2014 FEBS.

Divalent cations and molecular crowding buffers stabilize G-triplex at physiologically relevant temperatures

PubMed Central

Jiang, Hong-Xin; Cui, Yunxi; Zhao, Ting; Fu, Hai-Wei; Koirala, Deepak; Punnoose, Jibin Abraham; Kong, De-Ming; Mao, Hanbin

2015-01-01

G-triplexes are non-canonical DNA structures formed by G-rich sequences with three G-tracts. Putative G-triplex-forming sequences are expected to be more prevalent than putative G-quadruplex-forming sequences. However, the research on G-triplexes is rare. In this work, the effects of molecular crowding and several physiologically important metal ions on the formation and stability of G-triplexes were examined using a combination of circular dichroism, thermodynamics, optical tweezers and calorimetry techniques. We determined that molecular crowding conditions and cations, such as Na+, K+, Mg2+ and Ca2+, promote the formation of G-triplexes and stabilize these structures. Of these four metal cations, Ca2+ has the strongest stabilizing effect, followed by K+, Mg2+, and Na+ in a decreasing order. The binding of K+ to G-triplexes is accompanied by exothermic heats, and the binding of Ca2+ with G-triplexes is characterized by endothermic heats. G-triplexes formed from two G-triad layers are not stable at physiological temperatures; however, G-triplexes formed from three G-triads exhibit melting temperatures higher than 37°C, especially under the molecular crowding conditions and in the presence of K+ or Ca2+. These observations imply that stable G-triplexes may be formed under physiological conditions. PMID:25787838

Interactions of Human Nucleotide Excision Repair Protein XPA with DNA and RPA70 Delta c327: Chemical Shift Mapping and N-15 NMR Relaxation Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchko, Garry W.; Daughdrill, Gary W.; De Lorimier, Robert

1999-12-28

Human XPA is an essential component in the multienzyme nucleotide excision repair (NER) pathway. The solution structure of the minimal DNA binding domain of XPA (XPA-MBD: M98-F219) was recently determined [Buchko et al. (1998) Nucleic Acids Res. 26, 2779-2788, Ikegami et al (1998) Nat. Struct. Biol. 5, 701-706] and shown to consist of a compact zinc-binding core and a loop-rich C-terminal subdomain connected by a linker sequence.

Genetic and epigenetic regulation of AHR gene expression in MCF-7 breast cancer cells: role of the proximal promoter GC-rich region

PubMed Central

Englert, Neal A.; Turesky, Robert J.; Han, Weiguo; Bessette, Erin E.; Spivack, Simon D.; Caggana, Michele; Spink, David C.; Spink, Barbara C.

2014-01-01

The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor, contributes to carcinogenesis through its role in the regulation of cytochrome P450 1 (CYP1)-catalyzed metabolism of carcinogens. Here, we investigated genetic and epigenetic mechanisms that affect AhR expression. Analyses of the human AHR proximal promoter in MCF-7 human breast cancer cells using luciferase assays and electrophoretic mobility shift assays revealed multiple specificity protein (Sp) 1 binding sequences that are transcriptional activators in vitro. The regulation of AhR expression was evaluated in long-term estrogen exposed (LTEE) MCF-7 cells, which showed increased AhR expression, enhanced CYP1 inducibility, and increased capacity to form DNA adducts when exposed to the dietary carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. The increased AhR expression in LTEE cells was found not to result from increased mRNA stability, differential RNA processing, or decreased DNA methylation. Analysis of the AHR proximal promoter region using chromatin immunoprecipitation confirmed that enhanced expression of AhR in LTEE cells involves changes in histone modifications, notably decreased trimethylation of histone 3, lysine 27. Upon further examination of the GC-rich Sp1-binding region, we confirmed that it contains a polymorphic (GGGGC)n repeat. In a population of newborns from New York State, the allele frequency of (GGGGC)n was n = 4>5≫6, 2. Circular dichroism spectroscopy revealed the ability of sequences of this GC-rich region to form guanine-quadruplex structures in vitro. These studies revealed multiple levels at which AhR expression may be controlled, and offer additional insights into mechanisms regulating AhR expression that can ultimately impact carcinogenesis. PMID:22728919

Structures and ice-binding faces of the alanine-rich type I antifreeze proteins.

PubMed

Patel, Shruti N; Graether, Steffen P

2010-04-01

Antifreeze proteins (AFPs) protect cold-blooded organisms from the damage caused by freezing through their ability to inhibit ice growth. The type I AFP family, found in several fish species, contains proteins that have a high alanine content (>60% of the sequence) and structures that are almost all alpha-helical. We examine the structure of the type I AFP isoforms HPLC6 from winter flounder, shorthorn sculpin 3, and the winter flounder hyperactive type I AFP. The HPLC6 isoform structure consists of a single alpha-helix that is 37 residues long, whereas the shorthorn sculpin 3 isoform consists of two helical regions separated by a kink. The high-resolution structure of the hyperactive type I AFP has yet to be determined, but circular dichroism data and analytical ultracentrifugation suggest that the 195 residue protein is a side-by-side dimer of two alpha-helices. The alanine-rich ice-binding faces of HPLC6 and hyperactive type I AFP are discussed, and we propose that the ice-binding face of the shorthorn sculpin 3 AFP contains Ala14, Ala19, and Ala25. We also propose that the denaturation of hyperactive type I AFP at room temperature is explained by the stabilization of the dimerization interface through hydrogen bonds.

αCP Poly(C) Binding Proteins Act as Global Regulators of Alternative Polyadenylation

PubMed Central

Ji, Xinjun; Wan, Ji; Vishnu, Melanie

2013-01-01

We have previously demonstrated that the KH-domain protein αCP binds to a 3′ untranslated region (3′UTR) C-rich motif of the nascent human alpha-globin (hα-globin) transcript and enhances the efficiency of 3′ processing. Here we assess the genome-wide impact of αCP RNA-protein (RNP) complexes on 3′ processing with a specific focus on its role in alternative polyadenylation (APA) site utilization. The major isoforms of αCP were acutely depleted from a human hematopoietic cell line, and the impact on mRNA representation and poly(A) site utilization was determined by direct RNA sequencing (DRS). Bioinformatic analysis revealed 357 significant alterations in poly(A) site utilization that could be specifically linked to the αCP depletion. These APA events correlated strongly with the presence of C-rich sequences in close proximity to the impacted poly(A) addition sites. The most significant linkage was the presence of a C-rich motif within a window 30 to 40 bases 5′ to poly(A) signals (AAUAAA) that were repressed upon αCP depletion. This linkage is consistent with a general role for αCPs as enhancers of 3′ processing. These findings predict a role for αCPs in posttranscriptional control pathways that can alter the coding potential and/or levels of expression of subsets of mRNAs in the mammalian transcriptome. PMID:23629627

HIV and Drug Resistance: Hitting a Moving Target | Center for Cancer Research

Cancer.gov

Prior research revealed how HIV-1 makes its destructive entry into the target cell by fusing together the cholesterol-rich lipid bilayer of the viral envelope—made with key glycoproteins gp120 and gp41—and the host cell’s plasma membrane. Cell-viral interactions begin with the binding of gp120 to the CD4 receptor molecule on the target cell, followed by gp120 binding to coreceptors. These coreceptors likely reside in structures called lipid rafts—areas in the cell plasma membrane that are rich in cholesterol, saturated fatty acids, and certain proteins that facilitate the entry of viruses into host cells. Finally, sequences in gp41 trigger the fusion of the viral and cellular lipid bilayers. The lipid rafts are then involved in the production of new viral particles.

Bone Matrix Proteins: Isolation and Characterization of a Novel Cell-binding Keratan Sulfate Proteoglycan (Osteoadherin) from Bovine Bone

PubMed Central

Wendel, Mikael; Sommarin, Yngve; Heinegård, Dick

1998-01-01

A small cell-binding proteoglycan for which we propose the name osteoadherin was extracted from bovine bone with guanidine hydrochloride–containing EDTA. It was purified to homogeneity using a combination of ion-exchange chromatography, hydroxyapatite chromatography, and gel filtration. The Mr of the proteoglycan was 85,000 as determined by SDS-PAGE. The protein is rich in aspartic acid, glutamic acid, and leucine. Two internal octapeptides from the proteoglycan contained the sequences Glu-Ile-Asn-Leu-Ser-His-Asn-Lys and Arg-Asp-Leu-Tyr-Phe-Asn-Lys-Ile. These sequences are not previously described, and support the notion that osteoadherin belongs to the family of leucine-rich repeat proteins. A monospecific antiserum was raised in rabbits. An enzyme-linked immunosorbent assay was developed, and showed the osteoadherin content of bone extracts to be 0.4 mg/g of tissue wet weight, whereas none was found in extracts of various other bovine tissues. Metabolic labeling of primary bovine osteoblasts followed by immunoprecipitation showed the cells to synthesize and secrete the proteoglycan. Digesting the immunoprecipitated osteoadherin with N-glycosidase reduced its apparent size to 47 kD, thus showing the presence of several N-linked oligosaccharides. Digestion with keratanase indicated some of the oligosaccharides to be extended to keratan sulfate chains. In immunohistochemical studies of the bovine fetal rib growth plate, osteoadherin was exclusively identified in the primary bone spongiosa. Osteoadherin binds to hydroxyapatite. A potential function of this proteoglycan is to bind cells, since we showed it to be as efficient as fibronectin in promoting osteoblast attachment in vitro. The binding appears to be mediated by the integrin αvβ3, since this was the only integrin isolated by osteoadherin affinity chromatography of surface-iodinated osteoblast extracts. PMID:9566981

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Preparation and DNA-binding properties of substituted triostin antibiotics.

PubMed

Cornish, A; Fox, K R; Waring, M J

1983-02-01

Novel derivatives of the triostin group of antibiotics were prepared by supplementing cultures of the producing organism Streptomyces triostinicus with a variety of aromatic carboxylic acids. Five new antibiotics, each having both the natural quinoxaline chromophores replaced by a substituted ring system, were purified to homogeneity and characterized by high-pressure liquid chromatography and nuclear magnetic resonance. Their antibacterial activities and DNA-binding properties were investigated. Addition of a halogen atom at position 6 of the quinoxaline ring or an amino group at position 3 had little effect on either the biological activity or the DNA-binding characteristics. The bis-3-amino derivative is fluorescent, and its fluorescence is strongly quenched by calf thymus DNA and polydeoxyguanylate-polydeoxycytidylate but not by polydeoxyadenylate-polydeoxythymidylate, suggesting that it binds preferentially to guanosine-cytosine-rich sequences in natural DNA. Binding constants for the bis-6-chloro and bis-3-amino derivatives do not differ greatly from those of unsubstituted triostin A. The analogs having two quinoline chromophores or a chlorine atom in position 7 of the quinoxaline ring display little or no detectable antibacterial activity, in marked contrast to the other congeners. Bis-7-chloro-triostin A binds conspicuously more tightly to polydeoxyadenylate-polydeoxythymidylate than to any other polynucleotide tested.

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

A proline-rich sequence unique to MEK1 and MEK2 is required for raf binding and regulates MEK function.

PubMed

Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J

1995-10-01

Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs.

A proline-rich sequence unique to MEK1 and MEK2 is required for raf binding and regulates MEK function.

PubMed Central

Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J

1995-01-01

Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs. PMID:7565670

Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

PubMed Central

Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

2013-01-01

Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

A genome-wide interactome of DNA-associated proteins in the human liver.

PubMed

Ramaker, Ryne C; Savic, Daniel; Hardigan, Andrew A; Newberry, Kimberly; Cooper, Gregory M; Myers, Richard M; Cooper, Sara J

2017-11-01

Large-scale efforts like the ENCODE Project have made tremendous progress in cataloging the genomic binding patterns of DNA-associated proteins (DAPs), such as transcription factors (TFs). However, most chromatin immunoprecipitation-sequencing (ChIP-seq) analyses have focused on a few immortalized cell lines whose activities and physiology differ in important ways from endogenous cells and tissues. Consequently, binding data from primary human tissue are essential to improving our understanding of in vivo gene regulation. Here, we identify and analyze more than 440,000 binding sites using ChIP-seq data for 20 DAPs in two human liver tissue samples. We integrated binding data with transcriptome and phased WGS data to investigate allelic DAP interactions and the impact of heterozygous sequence variation on the expression of neighboring genes. Our tissue-based data set exhibits binding patterns more consistent with liver biology than cell lines, and we describe uses of these data to better prioritize impactful noncoding variation. Collectively, our rich data set offers novel insights into genome function in human liver tissue and provides a valuable resource for assessing disease-related disruptions. © 2017 Ramaker et al.; Published by Cold Spring Harbor Laboratory Press.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaya, Eiko; Jingami, Hisato

2006-04-14

PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

Diverse RNA-binding proteins interact with functionally related sets of RNAs, suggesting an extensive regulatory system.

PubMed

Hogan, Daniel J; Riordan, Daniel P; Gerber, André P; Herschlag, Daniel; Brown, Patrick O

2008-10-28

RNA-binding proteins (RBPs) have roles in the regulation of many post-transcriptional steps in gene expression, but relatively few RBPs have been systematically studied. We searched for the RNA targets of 40 proteins in the yeast Saccharomyces cerevisiae: a selective sample of the approximately 600 annotated and predicted RBPs, as well as several proteins not annotated as RBPs. At least 33 of these 40 proteins, including three of the four proteins that were not previously known or predicted to be RBPs, were reproducibly associated with specific sets of a few to several hundred RNAs. Remarkably, many of the RBPs we studied bound mRNAs whose protein products share identifiable functional or cytotopic features. We identified specific sequences or predicted structures significantly enriched in target mRNAs of 16 RBPs. These potential RNA-recognition elements were diverse in sequence, structure, and location: some were found predominantly in 3'-untranslated regions, others in 5'-untranslated regions, some in coding sequences, and many in two or more of these features. Although this study only examined a small fraction of the universe of yeast RBPs, 70% of the mRNA transcriptome had significant associations with at least one of these RBPs, and on average, each distinct yeast mRNA interacted with three of the RBPs, suggesting the potential for a rich, multidimensional network of regulation. These results strongly suggest that combinatorial binding of RBPs to specific recognition elements in mRNAs is a pervasive mechanism for multi-dimensional regulation of their post-transcriptional fate.

A single-stranded DNA binding protein from mouse tumor cells specifically recognizes the C-rich strand of the (AGG:CCT)n repeats that can alter DNA conformation.

PubMed Central

Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R

1992-01-01

A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

PubMed

Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

2018-01-22

An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

Synaptotagmin 1 causes phosphatidyl inositol lipid-dependent actin remodeling in cultured non-neuronal and neuronal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnsson, Anna-Karin; Karlsson, Roger, E-mail: roger.karlsson@wgi.su.se

2012-01-15

Here we demonstrate that a dramatic actin polymerizing activity caused by ectopic expression of the synaptic vesicle protein synaptotagmin 1 that results in extensive filopodia formation is due to the presence of a lysine rich sequence motif immediately at the cytoplasmic side of the transmembrane domain of the protein. This polybasic sequence interacts with anionic phospholipids in vitro, and, consequently, the actin remodeling caused by this sequence is interfered with by expression of a phosphatidyl inositol (4,5)-bisphosphate (PIP2)-targeted phosphatase, suggesting that it intervenes with the function of PIP2-binding actin control proteins. The activity drastically alters the behavior of a rangemore » of cultured cells including the neuroblastoma cell line SH-SY5Y and primary cortical mouse neurons, and, since the sequence is conserved also in synaptotagmin 2, it may reflect an important fine-tuning role for these two proteins during synaptic vesicle fusion and neurotransmitter release.« less

AlloRep: A Repository of Sequence, Structural and Mutagenesis Data for the LacI/GalR Transcription Regulators.

PubMed

Sousa, Filipa L; Parente, Daniel J; Shis, David L; Hessman, Jacob A; Chazelle, Allen; Bennett, Matthew R; Teichmann, Sarah A; Swint-Kruse, Liskin

2016-02-22

Protein families evolve functional variation by accumulating point mutations at functionally important amino acid positions. Homologs in the LacI/GalR family of transcription regulators have evolved to bind diverse DNA sequences and allosteric regulatory molecules. In addition to playing key roles in bacterial metabolism, these proteins have been widely used as a model family for benchmarking structural and functional prediction algorithms. We have collected manually curated sequence alignments for >3000 sequences, in vivo phenotypic and biochemical data for >5750 LacI/GalR mutational variants, and noncovalent residue contact networks for 65 LacI/GalR homolog structures. Using this rich data resource, we compared the noncovalent residue contact networks of the LacI/GalR subfamilies to design and experimentally validate an allosteric mutant of a synthetic LacI/GalR repressor for use in biotechnology. The AlloRep database (freely available at www.AlloRep.org) is a key resource for future evolutionary studies of LacI/GalR homologs and for benchmarking computational predictions of functional change. Copyright © 2015 Elsevier Ltd. All rights reserved.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Evidence for an uncommon alpha-actinin protein in Trichomonas vaginalis.

PubMed

Bricheux, G; Coffe, G; Pradel, N; Brugerolle, G

1998-09-15

As part of our ongoing project of identification of actin-binding proteins implicated in the cell transition (flagellate to amoeboid/adherent) of Trichomonas vaginalis, we have characterized an alpha-actinin-related protein in this parasite. The protein (P100) has a molecular mass of 100 kDa and an isoelectric point of 5.5. A monoclonal antibody raised against this protein co-localizes with the actin network. P100 gene transcripts are co-expressed with actin throughout the cell cycle. Analysis of the deduced protein sequence reveals three domains: an N-terminal actin-binding region; a central region rich in alpha-helix; and a C-terminal domain with Ca(2+)-binding capacity. Whereas the N- and C-terminal regions are well-conserved as compared to other alpha-actinins, we observe in the central region an atypical distribution of residues in five repeats. The sequence of the repeats does not show any homology with the rod domain of the other alpha-actinins, except for the first repeat which shows some similarity. The four other repeats of T. vaginalis P100 appear to result from a duplication event which is not detectable in the other sequences.

Molecular dynamics studies of the 3D structure and planar ligand binding of a quadruplex dimer.

PubMed

Li, Ming-Hui; Luo, Quan; Xue, Xiang-Gui; Li, Ze-Sheng

2011-03-01

G-rich sequences can fold into a four-stranded structure called a G-quadruplex, and sequences with short loops are able to aggregate to form stable quadruplex multimers. Few studies have characterized the properties of this variety of quadruplex multimers. Using molecular modeling and molecular dynamics simulations, the present study investigated a dimeric G-quadruplex structure formed from a simple sequence of d(GGGTGGGTGGGTGGGT) (G1), and its interactions with a planar ligand of a perylene derivative (Tel03). A series of analytical methods, including free energy calculations and principal components analysis (PCA), was used. The results show that a dimer structure with stacked parallel monomer structures is maintained well during the entire simulation. Tel03 can bind to the dimer efficiently through end stacking, and the binding mode of the ligand stacked with the 3'-terminal thymine base is most favorable. PCA showed that the dominant motions in the free dimer occur on the loop regions, and the presence of the ligand reduces the flexibility of the loops. Our investigation will assist in understanding the geometric structure of stacked G-quadruplex multimers and may be helpful as a platform for rational drug design.

Identification of metalloprotease/disintegrins in Xenopus laevis testis with a potential role in fertilization.

PubMed

Shilling, F M; Krätzschmar, J; Cai, H; Weskamp, G; Gayko, U; Leibow, J; Myles, D G; Nuccitelli, R; Blobel, C P

1997-06-15

Proteins containing a membrane-anchored metalloprotease domain, a disintegrin domain, and a cysteine-rich region (MDC proteins) are thought to play an important role in mammalian fertilization, as well as in somatic cell-cell interactions. We have identified PCR sequence tags encoding the disintegrin domain of five distinct MDC proteins from Xenopus laevis testis cDNA. Four of these sequence tags (xMDC9, xMDC11.1, xMDC11.2, and xMDC13) showed strong similarity to known mammalian MDC proteins, whereas the fifth (xMDC16) apparently represents a novel family member. Northern blot analysis revealed that the mRNA for xMDC16 was only expressed in testis, and not in heart, muscle, liver, ovaries, or eggs, whereas the mRNAs corresponding to the four other PCR products were expressed in testis and in some or all somatic tissues tested. The xMDC16 protein sequence, as predicted from the full-length cDNA, contains a metalloprotease domain with the active-site sequence HEXXH, a disintegrin domain, a cysteine-rich region, an EGF repeat, a transmembrane domain, and a short cytoplasmic tail. To study a potential role for these xMDC proteins in fertilization, peptides corresponding to the predicted integrin-binding domain of each protein were tested for their ability to inhibit X. laevis fertilization. Cyclic and linear xMDC16 peptides inhibited fertilization in a concentration-dependent manner, whereas xMDC16 peptides that were scrambled or had certain amino acid replacements in the predicted integrin-binding domain did not affect fertilization. Cyclic and linear xMDC9 peptides and linear xMDC13 peptides also inhibited fertilization similarly to xMDC16 peptides, whereas peptides corresponding to the predicted integrin-binding site of xMDC11.1 and xMDC11.2 did not. These results are discussed in the context of a model in which multiple MDC protein-receptor interactions are necessary for fertilization to occur.

Sequence analyses of fimbriae subunit FimA proteins on Actinomyces naeslundii genospecies 1 and 2 and Actinomyces odontolyticus with variant carbohydrate binding specificities

PubMed Central

Drobni, Mirva; Hallberg, Kristina; Öhman, Ulla; Birve, Anna; Persson, Karina; Johansson, Ingegerd; Strömberg, Nicklas

2006-01-01

Background Actinomyces naeslundii genospecies 1 and 2 express type-2 fimbriae (FimA subunit polymers) with variant Galβ binding specificities and Actinomyces odontolyticus a sialic acid specificity to colonize different oral surfaces. However, the fimbrial nature of the sialic acid binding property and sequence information about FimA proteins from multiple strains are lacking. Results Here we have sequenced fimA genes from strains of A.naeslundii genospecies 1 (n = 4) and genospecies 2 (n = 4), both of which harboured variant Galβ-dependent hemagglutination (HA) types, and from A.odontolyticus PK984 with a sialic acid-dependent HA pattern. Three unique subtypes of FimA proteins with 63.8–66.4% sequence identity were present in strains of A. naeslundii genospecies 1 and 2 and A. odontolyticus. The generally high FimA sequence identity (>97.2%) within a genospecies revealed species specific sequences or segments that coincided with binding specificity. All three FimA protein variants contained a signal peptide, pilin motif, E box, proline-rich segment and an LPXTG sorting motif among other conserved segments for secretion, assembly and sorting of fimbrial proteins. The highly conserved pilin, E box and LPXTG motifs are present in fimbriae proteins from other Gram-positive bacteria. Moreover, only strains of genospecies 1 were agglutinated with type-2 fimbriae antisera derived from A. naeslundii genospecies 1 strain 12104, emphasizing that the overall folding of FimA may generate different functionalities. Western blot analyses with FimA antisera revealed monomers and oligomers of FimA in whole cell protein extracts and a purified recombinant FimA preparation, indicating a sortase-independent oligomerization of FimA. Conclusion The genus Actinomyces involves a diversity of unique FimA proteins with conserved pilin, E box and LPXTG motifs, depending on subspecies and associated binding specificity. In addition, a sortase independent oligomerization of FimA subunit proteins in solution was indicated. PMID:16686953

Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

PubMed

DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

2003-07-08

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

Identification and functional characterization of an Src homology domain 3 domain-binding site on Cbl.

PubMed

Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland

2006-12-01

Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.

Novel aspects of sialoglycan recognition by the Siglec-like domains of streptococcal SRR glycoproteins.

PubMed

Bensing, Barbara A; Khedri, Zahra; Deng, Lingquan; Yu, Hai; Prakobphol, Akraporn; Fisher, Susan J; Chen, Xi; Iverson, Tina M; Varki, Ajit; Sullam, Paul M

2016-11-01

Serine-rich repeat glycoproteins are adhesins expressed by commensal and pathogenic Gram-positive bacteria. A subset of these adhesins, expressed by oral streptococci, binds sialylated glycans decorating human salivary mucin MG2/MUC7, and platelet glycoprotein GPIb. Specific sialoglycan targets were previously identified for the ligand-binding regions (BRs) of GspB and Hsa, two serine-rich repeat glycoproteins expressed by Streptococcus gordonii While GspB selectively binds sialyl-T antigen, Hsa displays broader specificity. Here we examine the binding properties of four additional BRs from Streptococcus sanguinis or Streptococcus mitis and characterize the molecular determinants of ligand selectivity and affinity. Each BR has two domains that are essential for sialoglycan binding by GspB. One domain is structurally similar to the glycan-binding module of mammalian Siglecs (sialic acid-binding immunoglobulin-like lectins), including an arginine residue that is critical for glycan recognition, and that resides within a novel, conserved YTRY motif. Despite low sequence similarity to GspB, one of the BRs selectively binds sialyl-T antigen. Although the other three BRs are highly similar to Hsa, each displayed a unique ligand repertoire, including differential recognition of sialyl Lewis antigens and sulfated glycans. These differences in glycan selectivity were closely associated with differential binding to salivary and platelet glycoproteins. Specificity of sialoglycan adherence is likely an evolving trait that may influence the propensity of streptococci expressing Siglec-like adhesins to cause infective endocarditis. Published by Oxford University Press 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

PubMed

Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

2018-01-09

Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA.

PubMed

Aparicio, Frederic; Vilar, Marçal; Perez-Payá, Enrique; Pallás, Vicente

2003-08-15

Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg(2+), lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera.

Leucine-Rich Repeat Kinase 2 Binds to Neuronal Vesicles through Protein Interactions Mediated by Its C-Terminal WD40 Domain

PubMed Central

Piccoli, Giovanni; Onofri, Franco; Cirnaru, Maria Daniela; Kaiser, Christoph J. O.; Jagtap, Pravinkumar; Kastenmüller, Andreas; Pischedda, Francesca; Marte, Antonella; von Zweydorf, Felix; Vogt, Andreas; Giesert, Florian; Pan, Lifeng; Antonucci, Flavia; Kiel, Christina; Zhang, Mingjie; Weinkauf, Sevil; Sattler, Michael; Sala, Carlo; Matteoli, Michela; Ueffing, Marius

2014-01-01

Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial and sporadic Parkinson's disease (PD). LRRK2 is a complex protein that consists of multiple domains, including predicted C-terminal WD40 repeats. In this study, we analyzed functional and molecular features conferred by the WD40 domain. Electron microscopic analysis of the purified LRRK2 C-terminal domain revealed doughnut-shaped particles, providing experimental evidence for its WD40 fold. We demonstrate that LRRK2 WD40 binds and sequesters synaptic vesicles via interaction with vesicle-associated proteins. In fact, a domain-based pulldown approach combined with mass spectrometric analysis identified LRRK2 as being part of a highly specific protein network involved in synaptic vesicle trafficking. In addition, we found that a C-terminal sequence variant associated with an increased risk of developing PD, G2385R, correlates with a reduced binding affinity of LRRK2 WD40 to synaptic vesicles. Our data demonstrate a critical role of the WD40 domain within LRRK2 function. PMID:24687852

Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1

PubMed Central

Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael

2014-01-01

Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

The alpha-fetoprotein third domain receptor binding fragment: in search of scavenger and associated receptor targets.

PubMed

Mizejewski, G J

2015-01-01

Recent studies have demonstrated that the carboxyterminal third domain of alpha-fetoprotein (AFP-CD) binds with various ligands and receptors. Reports within the last decade have established that AFP-CD contains a large fragment of amino acids that interact with several different receptor types. Using computer software specifically designed to identify protein-to-protein interaction at amino acid sequence docking sites, the computer searches identified several types of scavenger-associated receptors and their amino acid sequence locations on the AFP-CD polypeptide chain. The scavenger receptors (SRs) identified were CD36, CD163, Stabilin, SSC5D, SRB1 and SREC; the SR-associated receptors included the mannose, low-density lipoprotein receptors, the asialoglycoprotein receptor, and the receptor for advanced glycation endproducts (RAGE). Interestingly, some SR interaction sites were localized on the AFP-derived Growth Inhibitory Peptide (GIP) segment at amino acids #480-500. Following the detection studies, a structural subdomain analysis of both the receptor and the AFP-CD revealed the presence of epidermal growth factor (EGF) repeats, extracellular matrix-like protein regions, amino acid-rich motifs and dimerization subdomains. For the first time, it was reported that EGF-like sequence repeats were identified on each of the three domains of AFP. Thereafter, the localization of receptors on specific cell types were reviewed and their functions were discussed.

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA.

PubMed

Iakhiaeva, Elena; Iakhiaev, Alexei; Zwieb, Christian

2010-11-13

Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed.

Identification of amino acid residues in protein SRP72 required for binding to a kinked 5e motif of the human signal recognition particle RNA

PubMed Central

2010-01-01

Background Human cells depend critically on the signal recognition particle (SRP) for the sorting and delivery of their proteins. The SRP is a ribonucleoprotein complex which binds to signal sequences of secretory polypeptides as they emerge from the ribosome. Among the six proteins of the eukaryotic SRP, the largest protein, SRP72, is essential for protein targeting and possesses a poorly characterized RNA binding domain. Results We delineated the minimal region of SRP72 capable of forming a stable complex with an SRP RNA fragment. The region encompassed residues 545 to 585 of the full-length human SRP72 and contained a lysine-rich cluster (KKKKKKKKGK) at postions 552 to 561 as well as a conserved Pfam motif with the sequence PDPXRWLPXXER at positions 572 to 583. We demonstrated by site-directed mutagenesis that both regions participated in the formation of a complex with the RNA. In agreement with biochemical data and results from chymotryptic digestion experiments, molecular modeling of SRP72 implied that the invariant W577 was located inside the predicted structure of an RNA binding domain. The 11-nucleotide 5e motif contained within the SRP RNA fragment was shown by comparative electrophoresis on native polyacrylamide gels to conform to an RNA kink-turn. The model of the complex suggested that the conserved A240 of the K-turn, previously identified as being essential for the binding to SRP72, could protrude into a groove of the SRP72 RNA binding domain, similar but not identical to how other K-turn recognizing proteins interact with RNA. Conclusions The results from the presented experiments provided insights into the molecular details of a functionally important and structurally interesting RNA-protein interaction. A model for how a ligand binding pocket of SRP72 can accommodate a new RNA K-turn in the 5e region of the eukaryotic SRP RNA is proposed. PMID:21073748

Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes

PubMed Central

López-Garriga, Juan; Cadilla, Carmen L.

2016-01-01

The clam Lucina pectinata lives in sulfide-rich muds and houses intracellular symbiotic bacteria that need to be supplied with hydrogen sulfide and oxygen. This clam possesses three hemoglobins: hemoglobin I (HbI), a sulfide-reactive protein, and hemoglobin II (HbII) and III (HbIII), which are oxygen-reactive. We characterized the complete gene sequence and promoter regions for the oxygen reactive hemoglobins and the partial structure and promoters of the HbI gene from Lucina pectinata. We show that HbI has two mRNA variants, where the 5’end had either a sequence of 96 bp (long variant) or 37 bp (short variant). The gene structure of the oxygen reactive Hbs is defined by having 4-exons/3-introns with conservation of intron location at B12.2 and G7.0 and the presence of pre-coding introns, while the partial gene structure of HbI has the same intron conservation but appears to have a 5-exon/ 4-intron structure. A search for putative transcription factor binding sites (TFBSs) was done with the promoters for HbII, HbIII, HbI short and HbI long. The HbII, HbIII and HbI long promoters showed similar predicted TFBSs. We also characterized MITE-like elements in the HbI and HbII gene promoters and intronic regions that are similar to sequences found in other mollusk genomes. The gene expression levels of the clam Hbs, from sulfide-rich and sulfide-poor environments showed a significant decrease of expression in the symbiont-containing tissue for those clams in a sulfide-poor environment, suggesting that the sulfide concentration may be involved in the regulation of these proteins. Gene expression evaluation of the two HbI mRNA variants indicated that the longer variant is expressed at higher levels than the shorter variant in both environments. PMID:26824233

Resolution of Site-Specific Conformational Heterogeneity in Proline-Rich Molecular Recognition by Src Homology 3 Domains.

PubMed

Horness, Rachel E; Basom, Edward J; Mayer, John P; Thielges, Megan C

2016-02-03

Conformational heterogeneity and dynamics are increasingly evoked in models of protein molecular recognition but are challenging to experimentally characterize. Here we combine the inherent temporal resolution of infrared (IR) spectroscopy with the spatial resolution afforded by selective incorporation of carbon-deuterium (C-D) bonds, which provide frequency-resolved absorptions within a protein IR spectrum, to characterize the molecular recognition of the Src homology 3 (SH3) domain of the yeast protein Sho1 with its cognate proline-rich (PR) sequence of Pbs2. The IR absorptions of C-D bonds introduced at residues along a peptide of the Pbs2 PR sequence report on the changes in the local environments upon binding to the SH3 domain. Interestingly, upon forming the complex the IR spectra of the peptides labeled with C-D bonds at either of the two conserved prolines of the PXXP consensus recognition sequence show more absorptions than there are C-D bonds, providing evidence for the population of multiple states. In contrast, the NMR spectra of the peptides labeled with (13)C at the same residues show only single resonances, indicating rapid interconversion on the NMR time scale. Thus, the data suggest that the SH3 domain recognizes its cognate peptide with a component of induced fit molecular recognition involving the adoption of multiples states, which have previously gone undetected due to interconversion between the populated states that is too fast to resolve using conventional methods.

50 years of DNA ‘Breathing’: Reflections on Old and New Approaches

PubMed Central

von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.

2015-01-01

Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028

Replication Protein A-1 Has a Preference for the Telomeric G-rich Sequence in Trypanosoma cruzi.

PubMed

Pavani, Raphael Souza; Vitarelli, Marcela O; Fernandes, Carlos A H; Mattioli, Fabio F; Morone, Mariana; Menezes, Milene C; Fontes, Marcos R M; Cano, Maria Isabel N; Elias, Maria Carolina

2018-05-01

Replication protein A (RPA), the major eukaryotic single-stranded binding protein, is a heterotrimeric complex formed by RPA-1, RPA-2, and RPA-3. RPA is a fundamental player in replication, repair, recombination, and checkpoint signaling. In addition, increasing evidences have been adding functions to RPA in telomere maintenance, such as interaction with telomerase to facilitate its activity and also involvement in telomere capping in some conditions. Trypanosoma cruzi, the etiological agent of Chagas disease is a protozoa parasite that appears early in the evolution of eukaryotes. Recently, we have showed that T. cruziRPA presents canonical functions being involved with DNA replication and DNA damage response. Here, we found by FISH/IF assays that T. cruziRPA localizes at telomeres even outside replication (S) phase. In vitro analysis showed that one telomeric repeat is sufficient to bind RPA-1. Telomeric DNA induces different secondary structural modifications on RPA-1 in comparison with other types of DNA. In addition, RPA-1 presents a higher affinity for telomeric sequence compared to randomic sequence, suggesting that RPA may play specific roles in T. cruzi telomeric region. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

Drosophila cell cycle under arrest: uncapped telomeres plead guilty.

PubMed

Cenci, Giovanni

2009-04-01

Telomeres are specialized structures that protect chromosome ends from degradation and fusion events. In most organisms, telomeres consist of short, repetitive G-rich sequences added to chromosome ends by a reverse transcriptase with an internal RNA template, called telomerase. Specific DNA-binding protein complexes associate with telomeric sequences preventing chromosome ends from being recognized as DNA double strand breaks (DSBs). Telomeres that lose their cap activate the DNA damage response (DDR) likewise DSBs and, if inappropriately repaired, generate telomeric fusions, which eventually lead to genome instability. In Drosophila there is not telomerase, and telomere length is maintained by transposition of three specialized retroelements. However, fly telomeres are protected by multi protein complexes like their yeast and vertebrate counterparts; these complexes bind chromosome ends in a sequence-independent fashion and are required to prevent checkpoint activation and end-to-end fusion. Uncapped Drosophila telomeres elicit a DDR just as dysfunctional human telomeres. Most interestingly, uncapped Drosophila telomeres also activate the spindle assembly checkpoint (SAC) by recruiting the SAC kinase BubR1. BubR1 accumulations at chromosome ends trigger the SAC that inhibits the metaphase-to-anaphase transition. These findings, reviewed here, highlight an intriguing and unsuspected connection between telomeres and cell cycle regulation, providing a clue to understand human telomere function.

Genome-wide sequencing of longan (Dimocarpus longan Lour.) provides insights into molecular basis of its polyphenol-rich characteristics

PubMed Central

Lin, Yuling; Min, Jiumeng; Lai, Ruilian; Wu, Zhangyan; Chen, Yukun; Yu, Lili; Cheng, Chunzhen; Jin, Yuanchun; Tian, Qilin; Liu, Qingfeng; Liu, Weihua; Zhang, Chengguang; Lin, Lixia; Hu, Yan; Zhang, Dongmin; Thu, Minkyaw; Zhang, Zihao; Liu, Shengcai; Zhong, Chunshui; Fang, Xiaodong; Wang, Jian; Yang, Huanming

2017-01-01

Abstract Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems. To gain insights into the genomic basis of longan traits, a draft genome sequence was assembled. The draft genome (about 471.88 Mb) of a Chinese longan cultivar, “Honghezi,” was estimated to contain 31 007 genes and 261.88 Mb of repetitive sequences. No recent whole-genome-wide duplication event was detected in the genome. Whole-genome resequencing and analysis of 13 cultivated D. longan accessions revealed the extent of genetic diversity. Comparative transcriptome studies combined with genome-wide analysis revealed polyphenol-rich and pathogen resistance characteristics. Genes involved in secondary metabolism, especially those from significantly expanded (DHS, SDH, F3΄H, ANR, and UFGT) and contracted (PAL, CHS, and F3΄5΄H) gene families with tissue-specific expression, may be important contributors to the high accumulation levels of polyphenolic compounds observed in longan fruit. The high number of genes encoding nucleotide-binding site leucine-rich repeat (NBS-LRR) and leucine-rich repeat receptor-like kinase proteins, as well as the recent expansion and contraction of the NBS-LRR family, suggested a genomic basis for resistance to insects, fungus, and bacteria in this fruit tree. These data provide insights into the evolution and diversity of the longan genome. The comparative genomic and transcriptome analyses provided information about longan-specific traits, particularly genes involved in its polyphenol-rich and pathogen resistance characteristics. PMID:28368449

Two high-mobility group box domains act together to underwind and kink DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.

The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A ismore » thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.« less

A peek into tropomyosin binding and unfolding on the actin filament.

PubMed

Singh, Abhishek; Hitchcock-Degregori, Sarah E

2009-07-24

Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

Intermediate activity of midge antifreeze protein is due to a tyrosine-rich ice-binding site and atypical ice plane affinity.

PubMed

Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L

2016-04-01

An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.

The Role of HuR in the Post-Transcriptional Regulation of Interleukin-3 in T Cells

PubMed Central

González-Feliciano, José A.; Hernández-Pérez, Marimar; Estrella, Luis A.; Colón-López, Daisy D.; López, Armando; Martínez, Marina; Maurás-Rivera, Kirla R.; Lasalde, Clarivel; Martínez, Daviana; Araujo-Pérez, Félix; González, Carlos I.

2014-01-01

Human Interleukin-3 (IL-3) is a lymphokine member of a class of transiently expressed mRNAs harboring Adenosine/Uridine-Rich Elements (ARE) in their 3' untranslated regions (3'-UTRs). The regulatory effects of AREs are often mediated by specific ARE-binding proteins (ARE-BPs). In this report, we show that the human IL-3 3'-UTR plays a post-transcriptional regulation role in two human transformed cell lines. More specifically, we demonstrate that the hIL-3 3'-UTR represses the translation of a luciferase reporter both in HeLa and Jurkat T-cells. These results also revealed that the hIL-3 3'-UTR-mediated translational repression is exerted by an 83 nt region comprised mainly by AREs and some non-ARE sequences. Moreover, electrophoretic mobility shift assays (EMSAs) and UV-crosslinking analysis show that this hIL-3 ARE-rich region recruits five specific protein complexes, including the ARE-BPs HuR and TIA-1. HuR binding to this ARE-rich region appears to be spatially modulated during T-cell activation. Together, these results suggest that HuR recognizes the ARE-rich region and plays a role in the IL-3 3'-UTR-mediated post-transcriptional control in T-cells. PMID:24658545

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

G quadruplex RNA structures in PSD-95 mRNA: potential regulators of miR-125a seed binding site accessibility.

PubMed

Stefanovic, Snezana; Bassell, Gary J; Mihailescu, Mihaela Rita

2015-01-01

Fragile X syndrome (FXS) is the most common inherited form of intellectual disability caused by the CGG trinucleotide expansion in the 3'-untranslated region of the FMR1 gene on the X chromosome, that silences the expression of the Fragile X mental retardation protein (FMRP). FMRP has been shown to bind to a G-rich region within the PSD-95 mRNA which encodes for the postsynaptic density protein 95 (PSD-95), and together with the microRNA miR-125a, to play an important role in the reversible inhibition of the PSD-95 mRNA translation in neurons. The loss of FMRP in Fmr1 KO mice disables this translation control in the production of the PSD-95 protein. Interestingly, the miR-125a binding site on PSD-95 mRNA is embedded in the G-rich region bound by FMRP and postulated to adopt one or more G quadruplex structures. In this study, we have used different biophysical techniques to validate and characterize the formation of parallel G quadruplex structures and binding of miR-125a to its complementary sequence located within the 3' UTR of PSD-95 mRNA. Our results indicate that the PSD-95 mRNA G-rich region folds into alternate G quadruplex conformations that coexist in equilibrium. miR-125a forms a stable complex with PSD-95 mRNA, as evident by characteristic Watson-Crick base-pairing that coexists with one of the G quadruplex forms, suggesting a novel mechanism for G quadruplex structures to regulate the access of miR-125a to its binding site. © 2014 Stefanovic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

G quadruplex RNA structures in PSD-95 mRNA: potential regulators of miR-125a seed binding site accessibility

PubMed Central

Stefanovic, Snezana; Bassell, Gary J.

2015-01-01

Fragile X syndrome (FXS) is the most common inherited form of intellectual disability caused by the CGG trinucleotide expansion in the 3′-untranslated region of the FMR1 gene on the X chromosome, that silences the expression of the Fragile X mental retardation protein (FMRP). FMRP has been shown to bind to a G-rich region within the PSD-95 mRNA which encodes for the postsynaptic density protein 95 (PSD-95), and together with the microRNA miR-125a, to play an important role in the reversible inhibition of the PSD-95 mRNA translation in neurons. The loss of FMRP in Fmr1 KO mice disables this translation control in the production of the PSD-95 protein. Interestingly, the miR-125a binding site on PSD-95 mRNA is embedded in the G-rich region bound by FMRP and postulated to adopt one or more G quadruplex structures. In this study, we have used different biophysical techniques to validate and characterize the formation of parallel G quadruplex structures and binding of miR-125a to its complementary sequence located within the 3′ UTR of PSD-95 mRNA. Our results indicate that the PSD-95 mRNA G-rich region folds into alternate G quadruplex conformations that coexist in equilibrium. miR-125a forms a stable complex with PSD-95 mRNA, as evident by characteristic Watson–Crick base-pairing that coexists with one of the G quadruplex forms, suggesting a novel mechanism for G quadruplex structures to regulate the access of miR-125a to its binding site. PMID:25406362

Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

PubMed

Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

2015-08-01

Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

NASA Astrophysics Data System (ADS)

Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

2014-03-01

Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each case.

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells.

PubMed

Malina, Halina Z

2011-01-19

The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases.

System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells

PubMed Central

2011-01-01

Background The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Results Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. Conclusions The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases. PMID:21247434

Transcription factor MBF-I interacts with metal regulatory elements of higher eucaryotic metallothionein genes.

PubMed Central

Imbert, J; Zafarullah, M; Culotta, V C; Gedamu, L; Hamer, D

1989-01-01

Metallothionein (MT) gene promoters in higher eucaryotes contain multiple metal regulatory elements (MREs) that are responsible for the metal induction of MT gene transcription. We identified and purified to near homogeneity a 74-kilodalton mouse nuclear protein that specifically binds to certain MRE sequences. This protein, MBF-I, was purified employing as an affinity reagent a trout MRE that is shown to be functional in mouse cells but which lacks the G+C-rich and SP1-like sequences found in many mammalian MT gene promoters. Using point-mutated MREs, we showed that there is a strong correlation between DNA binding in vitro and MT gene regulation in vivo, suggesting a direct role of MBF-I in MT gene transcription. We also showed that MBF-I can induce MT gene transcription in vitro in a mouse extract and that this stimulation requires zinc. Images PMID:2586522

Improved prediction of MHC class I and class II epitopes using a novel Gibbs sampling approach.

PubMed

Nielsen, Morten; Lundegaard, Claus; Worning, Peder; Hvid, Christina Sylvester; Lamberth, Kasper; Buus, Søren; Brunak, Søren; Lund, Ole

2004-06-12

Prediction of which peptides will bind a specific major histocompatibility complex (MHC) constitutes an important step in identifying potential T-cell epitopes suitable as vaccine candidates. MHC class II binding peptides have a broad length distribution complicating such predictions. Thus, identifying the correct alignment is a crucial part of identifying the core of an MHC class II binding motif. In this context, we wish to describe a novel Gibbs motif sampler method ideally suited for recognizing such weak sequence motifs. The method is based on the Gibbs sampling method, and it incorporates novel features optimized for the task of recognizing the binding motif of MHC classes I and II. The method locates the binding motif in a set of sequences and characterizes the motif in terms of a weight-matrix. Subsequently, the weight-matrix can be applied to identifying effectively potential MHC binding peptides and to guiding the process of rational vaccine design. We apply the motif sampler method to the complex problem of MHC class II binding. The input to the method is amino acid peptide sequences extracted from the public databases of SYFPEITHI and MHCPEP and known to bind to the MHC class II complex HLA-DR4(B1*0401). Prior identification of information-rich (anchor) positions in the binding motif is shown to improve the predictive performance of the Gibbs sampler. Similarly, a consensus solution obtained from an ensemble average over suboptimal solutions is shown to outperform the use of a single optimal solution. In a large-scale benchmark calculation, the performance is quantified using relative operating characteristics curve (ROC) plots and we make a detailed comparison of the performance with that of both the TEPITOPE method and a weight-matrix derived using the conventional alignment algorithm of ClustalW. The calculation demonstrates that the predictive performance of the Gibbs sampler is higher than that of ClustalW and in most cases also higher than that of the TEPITOPE method.

Pub1p C-Terminal RRM Domain Interacts with Tif4631p through a Conserved Region Neighbouring the Pab1p Binding Site

PubMed Central

Rico-Lastres, Palma; Pérez-Cañadillas, José Manuel

2011-01-01

Pub1p, a highly abundant poly(A)+ mRNA binding protein in Saccharomyces cerevisiae, influences the stability and translational control of many cellular transcripts, particularly under some types of environmental stresses. We have studied the structure, RNA and protein recognition modes of different Pub1p constructs by NMR spectroscopy. The structure of the C-terminal RRM domain (RRM3) shows a non-canonical N-terminal helix that packs against the canonical RRM fold in an original fashion. This structural trait is conserved in Pub1p metazoan homologues, the TIA-1 family, defining a new class of RRM-type domains that we propose to name TRRM (TIA-1 C-terminal domain-like RRM). Pub1p TRRM and the N-terminal RRM1-RRM2 tandem bind RNA with high selectivity for U-rich sequences, with TRRM showing additional preference for UA-rich ones. RNA-mediated chemical shift changes map to β-sheet and protein loops in the three RRMs. Additionally, NMR titration and biochemical in vitro cross-linking experiments determined that Pub1p TRRM interacts specifically with the N-terminal region (1–402) of yeast eIF4G1 (Tif4631p), very likely through the conserved Box1, a short sequence motif neighbouring the Pab1p binding site in Tif4631p. The interaction involves conserved residues of Pub1p TRRM, which define a protein interface that mirrors the Pab1p-Tif4631p binding mode. Neither protein nor RNA recognition involves the novel N-terminal helix, whose functional role remains unclear. By integrating these new results with the current knowledge about Pub1p, we proposed different mechanisms of Pub1p recruitment to the mRNPs and Pub1p-mediated mRNA stabilization in which the Pub1p/Tif4631p interaction would play an important role. PMID:21931728

Direct Comparison of Amino Acid and Salt Interactions with Double-Stranded and Single-Stranded DNA from Explicit-Solvent Molecular Dynamics Simulations.

PubMed

Andrews, Casey T; Campbell, Brady A; Elcock, Adrian H

2017-04-11

Given the ubiquitous nature of protein-DNA interactions, it is important to understand the interaction thermodynamics of individual amino acid side chains for DNA. One way to assess these preferences is to perform molecular dynamics (MD) simulations. Here we report MD simulations of 20 amino acid side chain analogs interacting simultaneously with both a 70-base-pair double-stranded DNA and with a 70-nucleotide single-stranded DNA. The relative preferences of the amino acid side chains for dsDNA and ssDNA match well with values deduced from crystallographic analyses of protein-DNA complexes. The estimated apparent free energies of interaction for ssDNA, on the other hand, correlate well with previous simulation values reported for interactions with isolated nucleobases, and with experimental values reported for interactions with guanosine. Comparisons of the interactions with dsDNA and ssDNA indicate that, with the exception of the positively charged side chains, all types of amino acid side chain interact more favorably with ssDNA, with intercalation of aromatic and aliphatic side chains being especially notable. Analysis of the data on a base-by-base basis indicates that positively charged side chains, as well as sodium ions, preferentially bind to cytosine in ssDNA, and that negatively charged side chains, and chloride ions, preferentially bind to guanine in ssDNA. These latter observations provide a novel explanation for the lower salt dependence of DNA duplex stability in GC-rich sequences relative to AT-rich sequences.

Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

PubMed

Sánchez-Navarro, J A; Pallás, V

1997-01-01

The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

Controlling Self-Assembly of Engineered Peptides on Graphite by Rational Mutation

PubMed Central

So, Christopher R.; Hayamizu, Yuhei; Yazici, Hilal; Gresswell, Carolyn; Khatayevich, Dmitriy; Tamerler, Candan; Sarikaya, Mehmet

2012-01-01

Self-assembly of proteins on surfaces is utilized in many fields to integrate intricate biological structures and diverse functions with engineered materials. Controlling proteins at bio-solid interfaces relies on establishing key correlations between their primary sequences and resulting spatial organizations on substrates. Protein self-assembly, however, remains an engineering challenge. As a novel approach, we demonstrate here that short dodecapeptides selected by phage display are capable of self-assembly on graphite and form long-range ordered biomolecular nanostructures. Using atomic force microscopy and contact angle studies, we identify three amino-acid domains along the primary sequence that steer peptide ordering and lead to nanostructures with uniformly displayed residues. The peptides are further engineered via simple mutations to control fundamental interfacial processes, including initial binding, surface aggregation and growth kinetics, and intermolecular interactions. Tailoring short peptides via their primary sequence offers versatile control over molecular self-assembly, resulting in well-defined surface properties essential in building engineered, chemically rich, bio-solid interfaces. PMID:22233341

An N-terminal glycine-rich sequence contributes to retrovirus trimer of hairpins stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, Kirilee A.; Maerz, Anne L.; Baer, Severine

2007-08-10

Retroviral transmembrane proteins (TMs) contain a glycine-rich segment linking the N-terminal fusion peptide and coiled coil core. Previously, we reported that the glycine-rich segment (Met-326-Ser-337) of the human T-cell leukemia virus type 1 (HTLV-1) TM, gp21, is a determinant of membrane fusion function [K.A. Wilson, S. Baer, A.L. Maerz, M. Alizon, P. Poumbourios, The conserved glycine-rich segment linking the N-terminal fusion peptide to the coiled coil of human T-cell leukemia virus type 1 transmembrane glycoprotein gp21 is a determinant of membrane fusion function, J. Virol. 79 (2005) 4533-4539]. Here we show that the reduced fusion activity of an I334A mutantmore » correlated with a decrease in stability of the gp21 trimer of hairpins conformation, in the context of a maltose-binding protein-gp21 chimera. The stabilizing influence of Ile-334 required the C-terminal membrane-proximal sequence Trp-431-Ser-436. Proline substitution of four of five Gly residues altered gp21 trimer of hairpins stability. Our data indicate that flexibility within and hydrophobic interactions mediated by this region are determinants of gp21 stability and membrane fusion function.« less

The SpTransformer Gene Family (Formerly Sp185/333) in the Purple Sea Urchin and the Functional Diversity of the Anti-Pathogen rSpTransformer-E1 Protein

PubMed Central

Smith, L. Courtney; Lun, Cheng Man

2017-01-01

The complex innate immune system of sea urchins is underpinned by several multigene families including the SpTransformer family (SpTrf; formerly Sp185/333) with estimates of ~50 members, although the family size is likely variable among individuals of Strongylocentrotus purpuratus. The genes are small with similar structure, are tightly clustered, and have several types of repeats in the second of two exons and that surround each gene. The density of repeats suggests that the genes are positioned within regions of genomic instability, which may be required to drive sequence diversification. The second exon encodes the mature protein and is composed of blocks of sequence called elements that are present in mosaics of defined element patterns and are the major source of sequence diversity. The SpTrf genes respond swiftly to immune challenge, but only a single gene is expressed per phagocyte. Many of the mRNAs appear to be edited and encode proteins with altered and/or missense sequence that are often truncated, of which some may be functional. The standard SpTrf protein structure is an N-terminal glycine-rich region, a central RGD motif, a histidine-rich region, and a C-terminal region. Function is predicted from a recombinant protein, rSpTransformer-E1 (rSpTrf-E1), which binds to Vibrio and Saccharomyces, but not to Bacillus, and binds tightly to lipopolysaccharide, β-1,3-glucan, and flagellin, but not to peptidoglycan. rSpTrf-E1 is intrinsically disordered but transforms to α helical structure in the presence of binding targets including lipopolysaccharide, which may underpin the characteristics of binding to multiple targets. SpTrf proteins associate with coelomocyte membranes, and rSpTrf-E1 binds specifically to phosphatidic acid (PA). When rSpTrf-E1 is bound to PA in liposome membranes, it induces morphological changes in liposomes that correlate with PA clustering and leakage of luminal contents, and it extracts or removes PA from the bilayer. The multitasking activities of rSpTrf-E1 infer multiple and perhaps overlapping activities for the hundreds of native SpTrf proteins that are produced by individual sea urchins. This likely generates a flexible and highly protective immune system for the sea urchin in its marine habitat that it shares with broad arrays of microbes that may be pathogens and opportunists. PMID:28713368

A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

PubMed Central

Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

2015-01-01

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids. PMID:25870978

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Solution structure of the catalytic domain of RICH protein from goldfish.

PubMed

Kozlov, Guennadi; Denisov, Alexey Y; Pomerantseva, Ekaterina; Gravel, Michel; Braun, Peter E; Gehring, Kalle

2007-03-01

Regeneration-induced CNPase homolog (RICH) is an axonal growth-associated protein, which is induced in teleost fish upon optical nerve injury. RICH consists of a highly acidic N-terminal domain, a catalytic domain with 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) activity and a C-terminal isoprenylation site. In vitro RICH and mammalian brain CNPase specifically catalyze the hydrolysis of 2',3'-cyclic nucleotides to produce 2'-nucleotides, but the physiologically relevant in vivo substrate remains unknown. Here, we report the NMR structure of the catalytic domain of goldfish RICH and describe its binding to CNPase inhibitors. The structure consists of a twisted nine-stranded antiparallel beta-sheet surrounded by alpha-helices on both sides. Despite significant local differences mostly arising from a seven-residue insert in the RICH sequence, the active site region is highly similar to that of human CNPase. Likewise, refinement of the catalytic domain of rat CNPase using residual dipolar couplings gave improved agreement with the published crystal structure. NMR titrations of RICH with inhibitors point to a similar catalytic mechanism for RICH and CNPase. The results suggest a functional importance for the evolutionarily conserved phosphodiesterase activity and hint of a link with pre-tRNA splicing.

Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)

PubMed Central

Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.

1996-01-01

The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146

Molecular characterization and expression analysis of a glycine-rich RNA-binding protein gene from Malus hupehensis Rehd.

PubMed

Wang, Shuncai; Wang, Rongchao; Liang, Dong; Ma, Fengwang; Shu, Huairui

2012-04-01

Members of the plant glycine-rich RNA-binding protein (GR-RBP) family play diverse roles in regulating RNA metabolism for various cellular processes. To understand better their function at the molecular level in stress responses, we cloned a GR-RBP gene, MhGR-RBP1, from Malus hupehensis. Its full-length cDNA is 558 bp long, with a 495-bp open reading frame, and it encodes 164 amino acids. The deduced amino acid sequence contains an RNA-recognition motif (RRM) at the amino terminal and a glycine-rich domain at the carboxyl terminal; these are highly homologous with those from other plant species. Multiple alignment and phylogenetic analyses show that the deduced protein is a novel member of the plant GR-RBP family. To characterize this gene, we also applied a model for predicting its homology of protein structure with other species. Both organ-specific and stress-related expression were detected by quantitative real-time PCR and semi-quantitative RT-PCR, indicating that MhGR-RBP1 is expressed abundantly in young leaves but weakly in roots and shoots. Transcript levels in the leaves were increased markedly by drought, hydrogen peroxide (H(2)O(2)), and mechanical wounding, slightly by salt stress. Furthermore, the transcript is initially up- and down-regulated rapidly within 24 h of abscisic acid (ABA) treatment. After 24 h of ABA and jasmonic acid (JA) treatments with different concentrations, the transcript levels of MhGR-RBP1 were significantly repressed. These results suggest that MhGR-RBP1 may be involved in the responses to abiotic stresses, H(2)O(2), ABA, or JA.

Receptor-like genes in the major resistance locus of lettuce are subject to divergent selection.

PubMed Central

Meyers, B C; Shen, K A; Rohani, P; Gaut, B S; Michelmore, R W

1998-01-01

Disease resistance genes in plants are often found in complex multigene families. The largest known cluster of disease resistance specificities in lettuce contains the RGC2 family of genes. We compared the sequences of nine full-length genomic copies of RGC2 representing the diversity in the cluster to determine the structure of genes within this family and to examine the evolution of its members. The transcribed regions range from at least 7.0 to 13.1 kb, and the cDNAs contain deduced open reading frames of approximately 5. 5 kb. The predicted RGC2 proteins contain a nucleotide binding site and irregular leucine-rich repeats (LRRs) that are characteristic of resistance genes cloned from other species. Unique features of the RGC2 gene products include a bipartite LRR region with >40 repeats. At least eight members of this family are transcribed. The level of sequence diversity between family members varied in different regions of the gene. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitutions was lowest in the region encoding the nucleotide binding site, which is the presumed effector domain of the protein. The LRR-encoding region showed an alternating pattern of conservation and hypervariability. This alternating pattern of variation was also found in all comparisons within families of resistance genes cloned from other species. The Ka /Ks ratios indicate that diversifying selection has resulted in increased variation at these codons. The patterns of variation support the predicted structure of LRR regions with solvent-exposed hypervariable residues that are potentially involved in binding pathogen-derived ligands. PMID:9811792

Sequence-specific DNA binding activity of the cross-brace zinc finger motif of the piggyBac transposase

PubMed Central

Morellet, Nelly; Li, Xianghong; Wieninger, Silke A; Taylor, Jennifer L; Bischerour, Julien; Moriau, Séverine; Lescop, Ewen; Bardiaux, Benjamin; Mathy, Nathalie; Assrir, Nadine; Bétermier, Mireille; Nilges, Michael; Hickman, Alison B; Dyda, Fred; Craig, Nancy L; Guittet, Eric

2018-01-01

Abstract The piggyBac transposase (PB) is distinguished by its activity and utility in genome engineering, especially in humans where it has highly promising therapeutic potential. Little is known, however, about the structure–function relationships of the different domains of PB. Here, we demonstrate in vitro and in vivo that its C-terminal Cysteine-Rich Domain (CRD) is essential for DNA breakage, joining and transposition and that it binds to specific DNA sequences in the left and right transposon ends, and to an additional unexpectedly internal site at the left end. Using NMR, we show that the CRD adopts the specific fold of the cross-brace zinc finger protein family. We determine the interaction interfaces between the CRD and its target, the 5′-TGCGT-3′/3′-ACGCA-5′ motifs found in the left, left internal and right transposon ends, and use NMR results to propose docking models for the complex, which are consistent with our site-directed mutagenesis data. Our results provide support for a model of the PB/DNA interactions in the context of the transpososome, which will be useful for the rational design of PB mutants with increased activity. PMID:29385532

Exploring monovalent and multivalent peptides for the inhibition of FBP21-tWW.

PubMed

Henning, Lisa Maria; Bhatia, Sumati; Bertazzon, Miriam; Marczynke, Michaela; Seitz, Oliver; Volkmer, Rudolf; Haag, Rainer; Freund, Christian

2015-01-01

The coupling of peptides to polyglycerol carriers represents an important route towards the multivalent display of protein ligands. In particular, the inhibition of low affinity intracellular protein-protein interactions can be addressed by this design. We have applied this strategy to develop binding partners for FBP21, a protein which is important for the splicing of pre-mRNA in the nucleus of eukaryotic cells. Firstly, by using phage display the optimized sequence WPPPPRVPR was derived which binds with K Ds of 80 μM and 150 µM to the individual WW domains and with a K D of 150 μM to the tandem-WW1-WW2 construct. Secondly, this sequence was coupled to a hyperbranched polyglycerol (hPG) that allowed for the multivalent display on the surface of the dendritic polymer. This novel multifunctional hPG-peptide conjugate displayed a K D of 17.6 µM which demonstrates that the new carrier provides a venue for the future inhibition of proline-rich sequence recognition by FBP21 during assembly of the spliceosome.

Exploring monovalent and multivalent peptides for the inhibition of FBP21-tWW

PubMed Central

Bertazzon, Miriam; Marczynke, Michaela; Seitz, Oliver; Volkmer, Rudolf; Haag, Rainer

2015-01-01

Summary The coupling of peptides to polyglycerol carriers represents an important route towards the multivalent display of protein ligands. In particular, the inhibition of low affinity intracellular protein–protein interactions can be addressed by this design. We have applied this strategy to develop binding partners for FBP21, a protein which is important for the splicing of pre-mRNA in the nucleus of eukaryotic cells. Firstly, by using phage display the optimized sequence WPPPPRVPR was derived which binds with K Ds of 80 μM and 150 µM to the individual WW domains and with a K D of 150 μM to the tandem-WW1–WW2 construct. Secondly, this sequence was coupled to a hyperbranched polyglycerol (hPG) that allowed for the multivalent display on the surface of the dendritic polymer. This novel multifunctional hPG-peptide conjugate displayed a K D of 17.6 µM which demonstrates that the new carrier provides a venue for the future inhibition of proline-rich sequence recognition by FBP21 during assembly of the spliceosome. PMID:26124874

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

PubMed Central

Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

2013-01-01

The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

The cellodextrinase from Pseudomonas fluorescens subsp. cellulosa consists of multiple functional domains.

PubMed Central

Ferreira, L M; Hazlewood, G P; Barker, P J; Gilbert, H J

1991-01-01

A genomic library of Pseudomonas fluorescens subsp. cellulosa DNA was constructed in pUC18 and Escherichia coli recombinants expressing 4-methylumbelliferyl beta-D-cellobioside-hydrolysing activity (MUCase) were isolated. Enzyme produced by MUCase-positive clones did not hydrolyse either cellobiose or cellotriose but converted cellotetraose into cellobiose and cleaved cellopentaose and cellohexaose, producing a mixture of cellobiose and cellotriose. There was no activity against CM-cellulose, insoluble cellulose or xylan. On this basis, the enzyme is identified as an endo-acting cellodextrinase and is designated cellodextrinase C (CELC). Nucleotide sequencing of the gene (celC) which directs the synthesis of CELC revealed an open reading frame of 2153 bp, encoding a protein of Mr 80,189. The deduced primary sequence of CELC was confirmed by the Mr of purified CELC (77,000) and by the experimentally determined N-terminus of the enzyme which was identical with residues 38-47 of the translated sequence. The N-terminal region of CELC showed strong homology with endoglucanase, xylanases and an arabinofuranosidase of Ps. fluorescens subsp. cellulosa; homologous sequences included highly conserved serine-rich regions. Full-length CELC bound tightly to crystalline cellulose. Truncated forms of celC from which the DNA sequence encoding the conserved domain had been deleted, directed the synthesis of a functional cellodextrinase that did not bind to crystalline cellulose. This is consistent with the N-terminal region of CELC comprising a non-catalytic cellulose-binding domain which is distinct from the catalytic domain. The role of the cellulose-binding region is discussed. Images Fig. 2. Fig. 6. PMID:1953673

Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

PubMed

Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

2010-07-16

Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana.

Disorder and function: a review of the dehydrin protein family

PubMed Central

Graether, Steffen P.; Boddington, Kelly F.

2014-01-01

Dehydration proteins (dehydrins) are group 2 members of the late embryogenesis abundant (LEA) protein family. The protein architecture of dehydrins can be described by the presence of three types of conserved sequence motifs that have been named the K-, Y-, and S-segments. By definition, a dehydrin must contain at least one copy of the lysine-rich K-segment. Abiotic stresses such as drought, cold, and salinity cause the upregulation of dehydrin mRNA and protein levels. Despite the large body of genetic and protein evidence of the importance of these proteins in stress response, the in vivo protective mechanism is not fully known. In vitro experimental evidence from biochemical assays and localization experiments suggests multiple roles for dehydrins, including membrane protection, cryoprotection of enzymes, and protection from reactive oxygen species. Membrane binding by dehydrins is likely to be as a peripheral membrane protein, since the protein sequences are highly hydrophilic and contain many charged amino acids. Because of this, dehydrins in solution are intrinsically disordered proteins, that is, they have no well-defined secondary or tertiary structure. Despite their disorder, dehydrins have been shown to gain structure when bound to ligands such as membranes, and to possibly change their oligomeric state when bound to ions. We review what is currently known about dehydrin sequences and their structures, and examine the various ligands that have been shown to bind to this family of proteins. PMID:25400646

Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

Long-period oxygen-rich optical Miras in the solar neighborhood

NASA Technical Reports Server (NTRS)

Jura, M.; Yamamoto, A.; Kleinmann, S. G.

1993-01-01

The spatial distribution of the oxygen-rich Miras with periods longer than 400 days in the neighborhood of the sun were determined using available survey and the K-band period luminosity relationship. It is found that the exponential scale height of these stars is near 240 pc. There is a marked contrast between the Mira population at about 1 kpc from the Galactic center where there are nearly as many long-period oxygen-rich Miras as intermediate-period oxygen-rich Miras. It is hypothesized that, at about 1 kpc from the Galactic center, the main sequence stars with masses larger than 1 solar mass have higher metallicities than main-sequence stars with the same masses in the solar neighborhood. In the solar neighborhood such main sequence stars become carbon-rich on the AGB and in the region near the Galactic center they become long-period oxygen-rich Miras.

BASIC PENTACYSTEINE Proteins Mediate MADS Domain Complex Binding to the DNA for Tissue-Specific Expression of Target Genes in Arabidopsis[W

PubMed Central

Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M.

2012-01-01

BASIC PENTACYSTEINE (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)–rich consensus sequences in the SEEDSTICK (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that SHORT VEGETATIVE PHASE (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs’ wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472

TERRA mimicking ssRNAs prevail over the DNA substrate for telomerase in vitro due to interactions with the alternative binding site.

PubMed

Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga

2016-06-01

Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

Molecular cloning and characterization of rhesus monkey platelet glycoprotein Ibα, a major ligand-binding subunit of GPIb-IX-V complex.

PubMed

Qiao, Jianlin; Shen, Yang; Shi, Meimei; Lu, Yanrong; Cheng, Jingqiu; Chen, Younan

2014-05-01

Through binding to von Willebrand factor (VWF), platelet glycoprotein (GP) Ibα, the major ligand-binding subunit of the GPIb-IX-V complex, initiates platelet adhesion and aggregation in response to exposed VWF or elevated fluid-shear stress. There is little data regarding non-human primate platelet GPIbα. This study cloned and characterized rhesus monkey (Macaca Mullatta) platelet GPIbα. DNAMAN software was used for sequence analysis and alignment. N/O-glycosylation sites and 3-D structure modelling were predicted by online OGPET v1.0, NetOGlyc 1.0 Server and SWISS-MODEL, respectively. Platelet function was evaluated by ADP- or ristocetin-induced platelet aggregation. Rhesus monkey GPIbα contains 2,268 nucleotides with an open reading frame encoding 755 amino acids. Rhesus monkey GPIbα nucleotide and protein sequences share 93.27% and 89.20% homology respectively, with human. Sequences encoding the leucine-rich repeats of rhesus monkey GPIbα share strong similarity with human, whereas PEST sequences and N/O-glycosylated residues vary. The GPIbα-binding residues for thrombin, filamin A and 14-3-3ζ are highly conserved between rhesus monkey and human. Platelet function analysis revealed monkey and human platelets respond similarly to ADP, but rhesus monkey platelets failed to respond to low doses of ristocetin where human platelets achieved 76% aggregation. However, monkey platelets aggregated in response to higher ristocetin doses. Monkey GPIbα shares strong homology with human GPIbα, however there are some differences in rhesus monkey platelet activation through GPIbα engagement, which need to be considered when using rhesus monkey platelet to investigate platelet GPIbα function. Copyright © 2014 Elsevier Ltd. All rights reserved.

Fluorescent DNA-templated silver nanoclusters

NASA Astrophysics Data System (ADS)

Lin, Ruoqian

Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

Vaccatides: Antifungal Glutamine-Rich Hevein-Like Peptides from Vaccaria hispanica

PubMed Central

Wong, Ka H.; Tan, Wei Liang; Kini, Shruthi G.; Xiao, Tianshu; Serra, Aida; Sze, Sui Kwan; Tam, James P.

2017-01-01

Hevein and hevein-like peptides are disulfide-constrained chitin-binding cysteine-rich peptides. They are divided into three subfamilies, 6C-, 8C-, and 10C-hevein-like peptides, based on the number of cysteine residues. In addition, hevein-like peptides can exist in two forms, short and long. The long C-terminal form found in hevein and 10C-hevein-like peptides contain a C-terminal protein cargo. In contrast, the short form without a protein cargo is found in all three subfamilies. Here, we report the discovery and characterization of two novel glutamine-rich and protein cargo-free 8C-hevein-like peptides, vaccatides vH1 and vH2, from Vaccaria hispanica of the Caryophyllaceae family. Proteomic analyses showed that the vaccatides are 40–41 amino acids in length and contain a chitin-binding domain. NMR determination revealed that vaccatide vH2 displays a highly compact structure with a N-terminal cystine knot and an addition C-terminal disulfide bond. Stability studies showed that this compact structure renders vaccatide vH2 resistant to thermal, chemical and proteolytic degradation. The chitin-binding vH2 was shown to inhibit the mycelium growth of four phyto-pathogenic fungal strains with IC50 values in the micromolar range. Our findings show that vaccatides represent a new family of 8C-hevein-like peptides, which are protein cargo-free and glutamine-rich, characteristics that differentiate them from the prototypic hevein and the 10C-hevein-like peptides. In summary, this study enriches the existing library of hevein-like peptides and provides insight into their molecular diversity in sequence, structure and biosynthesis. Additionally, their highly disulfide-constrained structure could be used as a scaffold for developing metabolically and orally active peptidyl therapeutics. PMID:28680440

Vaccatides: Antifungal Glutamine-Rich Hevein-Like Peptides from Vaccaria hispanica.

PubMed

Wong, Ka H; Tan, Wei Liang; Kini, Shruthi G; Xiao, Tianshu; Serra, Aida; Sze, Sui Kwan; Tam, James P

2017-01-01

Hevein and hevein-like peptides are disulfide-constrained chitin-binding cysteine-rich peptides. They are divided into three subfamilies, 6C-, 8C-, and 10C-hevein-like peptides, based on the number of cysteine residues. In addition, hevein-like peptides can exist in two forms, short and long. The long C-terminal form found in hevein and 10C-hevein-like peptides contain a C-terminal protein cargo. In contrast, the short form without a protein cargo is found in all three subfamilies. Here, we report the discovery and characterization of two novel glutamine-rich and protein cargo-free 8C-hevein-like peptides, vaccatides vH1 and vH2, from Vaccaria hispanica of the Caryophyllaceae family. Proteomic analyses showed that the vaccatides are 40-41 amino acids in length and contain a chitin-binding domain. NMR determination revealed that vaccatide vH2 displays a highly compact structure with a N-terminal cystine knot and an addition C-terminal disulfide bond. Stability studies showed that this compact structure renders vaccatide vH2 resistant to thermal, chemical and proteolytic degradation. The chitin-binding vH2 was shown to inhibit the mycelium growth of four phyto-pathogenic fungal strains with IC 50 values in the micromolar range. Our findings show that vaccatides represent a new family of 8C-hevein-like peptides, which are protein cargo-free and glutamine-rich, characteristics that differentiate them from the prototypic hevein and the 10C-hevein-like peptides. In summary, this study enriches the existing library of hevein-like peptides and provides insight into their molecular diversity in sequence, structure and biosynthesis. Additionally, their highly disulfide-constrained structure could be used as a scaffold for developing metabolically and orally active peptidyl therapeutics.

Regulation of Hoxb2 by APL-associated PLZF protein.

PubMed

Ivins, Sarah; Pemberton, Kieran; Guidez, Fabien; Howell, Louise; Krumlauf, Robb; Zelent, Arthur

2003-06-12

The PLZF gene is translocated in a subset of all-trans-retinoic acid resistant acute promyelocytic leukaemia (APL) cases, encodes a DNA binding transcription factor and is expressed highly in haematopoietic progenitor cells as well-developing central nervous system (CNS). The spatially restricted and temporally dynamic pattern of PLZF expression in the developing CNS suggested that it might play a role in the circuitry regulating hindbrain segmentation. We have now identified a PLZF binding site (PLZF-RE) in an enhancer region of Hoxb2 that itself is required for directing high-level expression in rhombomers 3 and 5 of the developing hindbrain. The wild-type r3/r5 enhancer linked to a heterologous promoter was responsive to regulation by PLZF, and this activity was lost in variants containing a mutated PLZF-RE. Compared with the wild-type protein, the binding of the APL-associated reciprocal RARalpha-PLZF fusion to PLZF-RE was much stronger, suggesting that the N-terminal PLZF sequences missing from the fusion may play a role in the regulation of DNA binding. Consistent with this, the N-terminal POZ domain was required for cooperative binding of PLZF to a multimerized PLZF-RE. In the context of the r3/r5 enhancer, the PLZF-RE cooperated for PLZF binding with an additional A/T-rich motif positioned downstream of the PLZF-RE. This A/T motif was previously shown to be essential for the regulation of Hoxb2 expression in r3 and r5 in cooperation with another Krüppel-like zinc finger protein Krox 20. The presence of both the PLZF-RE and the A/T-rich motif was required for a maximal effect of PLZF on a heterologous promoter and was essential in vivo to direct the expression of a lacZ reporter in the chick neural tube. Hence, both PLZF and Krox20 cooperate with a common A/T motif in mediating in vivo activity of the Hoxb2 enhancer. Our findings indicate that Hoxb2 is a direct target for regulation by PLZF in the developing CNS and suggest that deregulation of Hox gene expression may contribute to APL pathogenesis.

Akt-Signal Integration Is Involved in the Differentiation of Embryonal Carcinoma Cells

PubMed Central

Chen, Bo; Xue, Zheng; Yang, Guanghui; Shi, Bingyang; Yang, Ben; Yan, Yuemin; Wang, Xue; Han, Daishu; Huang, Yue; Dong, Wenji

2013-01-01

The mechanism by which Akt modulates stem cell homeostasis is still incompletely defined. Here we demonstrate that Akt phosphorylates special AT-rich sequences binding protein 1 (SATB1) at serine 47 and protects SATB1 from apoptotic cleavage. Meanwhile, Akt phosphorylates Oct4 at threonine 228 and Klf4 at threonine 399, and accelerates their degradation. Moreover, PI3K/Akt signaling enhances the binding of SATB1 to Sox2, thereby probably impairing the formation of Oct4/Sox2 regulatory complexes. During retinoic acid (RA)-induced differentiation of mouse F9 embryonal carcinoma cells (ECCs), the Akt activation profile as well as its substrate spectrum is strikingly correlated with the down-regulation of Oct4, Klf4 and Nanog, which suggests Akt activation is coupled to the onset of differentiation. Accordingly, Akt-mediated phosphorylation is crucial for the capability of SATB1 to repress Nanog expression and to activate transcription of Bcl2 and Nestin genes. Taken together, we conclude that Akt is involved in the differentiation of ECCs through coordinated phosphorylations of pluripotency/differentiation factors. PMID:23762260

Stability and function of interdomain linker variants of glucoamylase 1 from Aspergillus niger.

PubMed

Sauer, J; Christensen, T; Frandsen, T P; Mirgorodskaya, E; McGuire, K A; Driguez, H; Roepstorff, P; Sigurskjold, B W; Svensson, B

2001-08-07

Several variants of glucoamylase 1 (GA1) from Aspergillus niger were created in which the highly O-glycosylated peptide (aa 468--508) connecting the (alpha/alpha)(6)-barrel catalytic domain and the starch binding domain was substituted at the gene level by equivalent segments of glucoamylases from Hormoconis resinae, Humicola grisea, and Rhizopus oryzae encoding 5, 19, and 36 amino acid residues. Variants were constructed in which the H. resinae linker was elongated by proline-rich sequences as this linker itself apparently was too short to allow formation of the corresponding protein variant. Size and isoelectric point of GA1 variants reflected differences in linker length, posttranslational modification, and net charge. While calculated polypeptide chain molecular masses for wild-type GA1, a nonnatural proline-rich linker variant, H. grisea, and R. oryzae linker variants were 65,784, 63,777, 63,912, and 65,614 Da, respectively, MALDI-TOF-MS gave values of 82,042, 73,800, 73,413, and 90,793 Da, respectively, where the latter value could partly be explained by an N-glycosylation site introduced near the linker C-terminus. The k(cat) and K(m) for hydrolysis of maltooligodextrins and soluble starch, and the rate of hydrolysis of barley starch granules were essentially the same for the variants as for wild-type GA1. beta-Cyclodextrin, acarbose, and two heterobidentate inhibitors were found by isothermal titration calorimetry to bind to the catalytic and starch binding domains of the linker variants, indicating that the function of the active site and the starch binding site was maintained. The stability of GA1 linker variants toward GdnHCl and heat, however, was reduced compared to wild-type.

De novo design of RNA-binding proteins with a prion-like domain related to ALS/FTD proteinopathies.

PubMed

Mitsuhashi, Kana; Ito, Daisuke; Mashima, Kyoko; Oyama, Munenori; Takahashi, Shinichi; Suzuki, Norihiro

2017-12-04

Aberrant RNA-binding proteins form the core of the neurodegeneration cascade in spectrums of disease, such as amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD). Six ALS-related molecules, TDP-43, FUS, TAF15, EWSR1, heterogeneous nuclear (hn)RNPA1 and hnRNPA2 are RNA-binding proteins containing candidate mutations identified in ALS patients and those share several common features, including harboring an aggregation-prone prion-like domain (PrLD) containing a glycine/serine-tyrosine-glycine/serine (G/S-Y-G/S)-motif-enriched low-complexity sequence and rich in glutamine and/or asparagine. Additinally, these six molecules are components of RNA granules involved in RNA quality control and become mislocated from the nucleus to form cytoplasmic inclusion bodies (IBs) in the ALS/FTD-affected brain. To reveal the essential mechanisms involved in ALS/FTD-related cytotoxicity associated with RNA-binding proteins containing PrLDs, we designed artificial RNA-binding proteins harboring G/S-Y-G/S-motif repeats with and without enriched glutamine residues and nuclear-import/export-signal sequences and examined their cytotoxicity in vitro. These proteins recapitulated features of ALS-linked molecules, including insoluble aggregation, formation of cytoplasmic IBs and components of RNA granules, and cytotoxicity instigation. These findings indicated that these artificial RNA-binding proteins mimicked features of ALS-linked molecules and allowed the study of mechanisms associated with gain of toxic functions related to ALS/FTD pathogenesis.

Strains of Actinomyces naeslundii and Actinomyces viscosus Exhibit Structurally Variant Fimbrial Subunit Proteins and Bind to Different Peptide Motifs in Salivary Proteins

PubMed Central

Li, Tong; Johansson, Ingegerd; Hay, Donald I.; Strömberg, Nicklas

1999-01-01

Oral strains of Actinomyces spp. express type 1 fimbriae, which are composed of major FimP subunits, and bind preferentially to salivary acidic proline-rich proteins (APRPs) or to statherin. We have mapped genetic differences in the fimP subunit genes and the peptide recognition motifs within the host proteins associated with these differential binding specificities. The fimP genes were amplified by PCR from Actinomyces viscosus ATCC 19246, with preferential binding to statherin, and from Actinomyces naeslundii LY7, P-1-K, and B-1-K, with preferential binding to APRPs. The fimP gene from the statherin-binding strain 19246 is novel and has about 80% nucleotide and amino acid sequence identity to the highly conserved fimP genes of the APRP-binding strains (about 98 to 99% sequence identity). The novel FimP protein contains an amino-terminal signal peptide, randomly distributed single-amino-acid substitutions, and structurally different segments and ends with a cell wall-anchoring and a membrane-spanning region. When agarose beads with CNBr-linked host determinant-specific decapeptides were used, A. viscosus 19246 bound to the Thr42Phe43 terminus of statherin and A. naeslundii LY7 bound to the Pro149Gln150 termini of APRPs. Furthermore, while the APRP-binding A. naeslundii strains originate from the human mouth, A. viscosus strains isolated from the oral cavity of rat and hamster hosts showed preferential binding to statherin and contained the novel fimP gene. Thus, A. viscosus and A. naeslundii display structurally variant fimP genes whose protein products are likely to interact with different peptide motifs and to determine animal host tropism. PMID:10225854

Sterol Binding by the Tombusviral Replication Proteins Is Essential for Replication in Yeast and Plants.

PubMed

Xu, Kai; Nagy, Peter D

2017-04-01

Membranous structures derived from various organelles are important for replication of plus-stranded RNA viruses. Although the important roles of co-opted host proteins in RNA virus replication have been appreciated for a decade, the equally important functions of cellular lipids in virus replication have been gaining full attention only recently. Previous work with Tomato bushy stunt tombusvirus (TBSV) in model host yeast has revealed essential roles for phosphatidylethanolamine and sterols in viral replication. To further our understanding of the role of sterols in tombusvirus replication, in this work we showed that the TBSV p33 and p92 replication proteins could bind to sterols in vitro The sterol binding by p33 is supported by cholesterol recognition/interaction amino acid consensus (CRAC) and CARC-like sequences within the two transmembrane domains of p33. Mutagenesis of the critical Y amino acids within the CRAC and CARC sequences blocked TBSV replication in yeast and plant cells. We also showed the enrichment of sterols in the detergent-resistant membrane (DRM) fractions obtained from yeast and plant cells replicating TBSV. The DRMs could support viral RNA synthesis on both the endogenous and exogenous templates. A lipidomic approach showed the lack of enhancement of sterol levels in yeast and plant cells replicating TBSV. The data support the notion that the TBSV replication proteins are associated with sterol-rich detergent-resistant membranes in yeast and plant cells. Together, the results obtained in this study and the previously published results support the local enrichment of sterols around the viral replication proteins that is critical for TBSV replication. IMPORTANCE One intriguing aspect of viral infections is their dependence on efficient subcellular assembly platforms serving replication, virion assembly, or virus egress via budding out of infected cells. These assembly platforms might involve sterol-rich membrane microdomains, which are heterogeneous and highly dynamic nanoscale structures usurped by various viruses. Here, we demonstrate that TBSV p33 and p92 replication proteins can bind to sterol in vitro Mutagenesis analysis of p33 within the CRAC and CARC sequences involved in sterol binding shows the important connection between the abilities of p33 to bind to sterol and to support TBSV replication in yeast and plant cells. Together, the results further strengthen the model that cellular sterols are essential as proviral lipids during viral replication. Copyright © 2017 American Society for Microbiology.

Molecular cloning and characterization of human trabeculin-alpha, a giant protein defining a new family of actin-binding proteins.

PubMed

Sun, Y; Zhang, J; Kraeft, S K; Auclair, D; Chang, M S; Liu, Y; Sutherland, R; Salgia, R; Griffin, J D; Ferland, L H; Chen, L B

1999-11-19

We describe the molecular cloning and characterization of a novel giant human cytoplasmic protein, trabeculin-alpha (M(r) = 614,000). Analysis of the deduced amino acid sequence reveals homologies with several putative functional domains, including a pair of alpha-actinin-like actin binding domains; regions of homology to plakins at either end of the giant polypeptide; 29 copies of a spectrin-like motif in the central region of the protein; two potential Ca(2+)-binding EF-hand motifs; and a Ser-rich region containing a repeated GSRX motif. With similarities to both plakins and spectrins, trabeculin-alpha appears to have evolved as a hybrid of these two families of proteins. The functionality of the actin binding domains located near the N terminus was confirmed with an F-actin binding assay using glutathione S-transferase fusion proteins comprising amino acids 9-486 of the deduced peptide. Northern and Western blotting and immunofluorescence studies suggest that trabeculin is ubiquitously expressed and is distributed throughout the cytoplasm, though the protein was found to be greatly up-regulated upon differentiation of myoblasts into myotubes. Finally, the presence of cDNAs similar to, yet distinct from, trabeculin-alpha in both human and mouse suggests that trabeculins may form a new subfamily of giant actin-binding/cytoskeletal cross-linking proteins.

Supramolecular approach to enantioselective DNA recognition using enantiomerically resolved cationic 4-amino-1,8-naphthalimide-based Tröger's bases.

PubMed

Banerjee, Swagata; Bright, Sandra A; Smith, Jayden A; Burgeat, Jeremy; Martinez-Calvo, Miguel; Williams, D Clive; Kelly, John M; Gunnlaugsson, Thorfinnur

2014-10-03

The synthesis and photophysical studies of two cationic Tröger's base (TB)-derived bis-naphthalimides 1 and 2 and the TB derivative 6, characterized by X-ray crystallography, are presented. The enantiomers of 1 and 2 are separated by cation-exchange chromatography on Sephadex C25 using sodium (-)-dibenzoyl-l-tartarate as the chiral mobile phase. The binding of enantiomers with salmon testes (st)-DNA and synthetic polynucleotides are studied by a variety of spectroscopic methods including UV/vis absorbance, circular dichroism, linear dichroism, and ethidium bromide displacement assays, which demonstrated binding of these compounds to the DNA grooves with very high affinity (K ∼ 10(6) M(-1)) and preferential binding of (-)-enantiomer. In all cases, binding to DNA resulted in a significant stabilization of the double-helical structure of DNA against thermal denaturation. Compound (±)-2 and its enantiomers possessed significantly higher binding affinity for double-stranded DNA compared to 1, possibly due to the presence of the methyl group, which allows favorable hydrophobic and van der Waals interactions with DNA. The TB derivatives exhibited marked preference for AT rich sequences, where the binding affinities follow the order (-)-enantiomer > (±) > (+)-enantiomer. The compounds exhibited significant photocleavage of plasmid DNA upon visible light irradiation and are rapidly internalized into malignant cell lines.

Deep sequencing-based transcriptome analysis of Plutella xylostella larvae parasitized by Diadegma semiclausum

PubMed Central

2011-01-01

Background Parasitoid insects manipulate their hosts' physiology by injecting various factors into their host upon parasitization. Transcriptomic approaches provide a powerful approach to study insect host-parasitoid interactions at the molecular level. In order to investigate the effects of parasitization by an ichneumonid wasp (Diadegma semiclausum) on the host (Plutella xylostella), the larval transcriptome profile was analyzed using a short-read deep sequencing method (Illumina). Symbiotic polydnaviruses (PDVs) associated with ichneumonid parasitoids, known as ichnoviruses, play significant roles in host immune suppression and developmental regulation. In the current study, D. semiclausum ichnovirus (DsIV) genes expressed in P. xylostella were identified and their sequences compared with other reported PDVs. Five of these genes encode proteins of unknown identity, that have not previously been reported. Results De novo assembly of cDNA sequence data generated 172,660 contigs between 100 and 10000 bp in length; with 35% of > 200 bp in length. Parasitization had significant impacts on expression levels of 928 identified insect host transcripts. Gene ontology data illustrated that the majority of the differentially expressed genes are involved in binding, catalytic activity, and metabolic and cellular processes. In addition, the results show that transcription levels of antimicrobial peptides, such as gloverin, cecropin E and lysozyme, were up-regulated after parasitism. Expression of ichnovirus genes were detected in parasitized larvae with 19 unique sequences identified from five PDV gene families including vankyrin, viral innexin, repeat elements, a cysteine-rich motif, and polar residue rich protein. Vankyrin 1 and repeat element 1 genes showed the highest transcription levels among the DsIV genes. Conclusion This study provides detailed information on differential expression of P. xylostella larval genes following parasitization, DsIV genes expressed in the host and also improves our current understanding of this host-parasitoid interaction. PMID:21906285

MDC9, a widely expressed cellular disintegrin containing cytoplasmic SH3 ligand domains

PubMed Central

1996-01-01

Cellular disintegrins are a family of proteins that are related to snake venom integrin ligands and metalloproteases. We have cloned and sequenced the mouse and human homologue of a widely expressed cellular disintegrin, which we have termed MDC9 (for metalloprotease/disintegrin/cysteine-rich protein 9). The deduced mouse and human protein sequences are 82% identical. MDC9 contains several distinct protein domains: a signal sequence is followed by a prodomain and a domain with sequence similarity to snake venom metalloproteases, a disintegrin domain, a cysteine-rich region, an EGF repeat, a membrane anchor, and a cytoplasmic tail. The cytoplasmic tail of MDC9 has two proline-rich sequences which can bind the SH3 domain of Src, and may therefore function as SH3 ligand domains. Western blot analysis shows that MDC9 is an approximately 84-kD glycoprotein in all mouse tissues examined, and in NIH 3T3 fibroblast and C2C12 myoblast mouse cell lines. MDC9 can be both cell surface biotinylated and 125I-labeled in NIH 3T3 mouse fibroblasts, indicating that the protein is present on the plasma membrane. Expression of MDC9 in COS-7 cells yields an 84-kD protein, and immunofluorescence analysis of COS-7 cells expressing MDC9 shows a staining pattern that is consistent with a plasma membrane localization. The apparent molecular mass of 84 kD suggests that MDC9 contains a membrane-anchored metalloprotease and disintegrin domain. We propose that MDC9 might function as a membrane-anchored integrin ligand or metalloprotease, or that MDC9 may combine both activities in one protein. PMID:8647900

Genetic and molecular characterization of the maize rp3 rust resistance locus.

PubMed Central

Webb, Craig A; Richter, Todd E; Collins, Nicholas C; Nicolas, Marie; Trick, Harold N; Pryor, Tony; Hulbert, Scot H

2002-01-01

In maize, the Rp3 gene confers resistance to common rust caused by Puccinia sorghi. Flanking marker analysis of rust-susceptible rp3 variants suggested that most of them arose via unequal crossing over, indicating that rp3 is a complex locus like rp1. The PIC13 probe identifies a nucleotide binding site-leucine-rich repeat (NBS-LRR) gene family that maps to the complex. Rp3 variants show losses of PIC13 family members relative to the resistant parents when probed with PIC13, indicating that the Rp3 gene is a member of this family. Gel blots and sequence analysis suggest that at least 9 family members are at the locus in most Rp3-carrying lines and that at least 5 of these are transcribed in the Rp3-A haplotype. The coding regions of 14 family members, isolated from three different Rp3-carrying haplotypes, had DNA sequence identities from 93 to 99%. Partial sequencing of clones of a BAC contig spanning the rp3 locus in the maize inbred line B73 identified five different PIC13 paralogues in a region of approximately 140 kb. PMID:12242248

PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

PubMed

Belotserkovskii, Boris P; Hanawalt, Philip C

2015-11-01

Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.

A Tomato Nucleotide Binding Sites-Leucine-Rich Repeat Gene Is Positively Involved in Plant Resistance to Phytophthora infestans.

PubMed

Jiang, Ning; Cui, Jun; Meng, Jun; Luan, Yushi

2018-06-14

The nucleotide binding sites-leucine-rich repeat (NBS-LRR) genes are key regulatory components of plant to pathogens. Phytophthora infestans-inducible coding sequence encoding an NBS-LRR (SpNBS-LRR) protein in tomato (Solanum pimpinellifolium L3708) was cloned and characterized based on our RNA-Seq data and tomato genome. After sequence analysis, SpNBS-LRR was identified as a hydrophilic protein with no transmembrane topological structure and no signal peptide. SpNBS-LRR had a close genetic relationship to RPS2 of Arabidopsis thaliana by phylogenetic analysis. In addition, SpNBS-LRR gene was mainly expressed in root, with low expression observed in leaf and stem. To further investigate the role of SpNBS-LRR in tomato-P. infestans interaction, SpNBS-LRR was introduced in susceptible tomatoes and three transgenic lines with higher expression level of SpNBS-LRR were selected. These transgenic tomato plants that overexpressed SpNBS-LRR displayed greater resistance than wild-type tomato plants after infection with P. infestans, as shown by decreased disease index, lesion diameters, number of necrotic cells, P. infestans abundance, and higher expression levels of the defense-related genes. This information provides insight into SpNBS-LRR involved in the resistance of tomato to P. infestans infection and candidate for breeding to enhance biotic stress-resistance in tomato.

Hyperdiversity of Genes Encoding Integral Light-Harvesting Proteins in the Dinoflagellate Symbiodinium sp

PubMed Central

Boldt, Lynda; Yellowlees, David; Leggat, William

2012-01-01

The superfamily of light-harvesting complex (LHC) proteins is comprised of proteins with diverse functions in light-harvesting and photoprotection. LHC proteins bind chlorophyll (Chl) and carotenoids and include a family of LHCs that bind Chl a and c. Dinophytes (dinoflagellates) are predominantly Chl c binding algal taxa, bind peridinin or fucoxanthin as the primary carotenoid, and can possess a number of LHC subfamilies. Here we report 11 LHC sequences for the chlorophyll a-chlorophyll c 2-peridinin protein complex (acpPC) subfamily isolated from Symbiodinium sp. C3, an ecologically important peridinin binding dinoflagellate taxa. Phylogenetic analysis of these proteins suggests the acpPC subfamily forms at least three clades within the Chl a/c binding LHC family; Clade 1 clusters with rhodophyte, cryptophyte and peridinin binding dinoflagellate sequences, Clade 2 with peridinin binding dinoflagellate sequences only and Clades 3 with heterokontophytes, fucoxanthin and peridinin binding dinoflagellate sequences. PMID:23112815

Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

PubMed

Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

1991-06-01

The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

Actinomyces naeslundii Displays Variant fimP and fimA Fimbrial Subunit Genes Corresponding to Different Types of Acidic Proline-Rich Protein and β-Linked Galactosamine Binding Specificity

PubMed Central

Hallberg, K.; Holm, C.; Öhman, U.; Strömberg, N.

1998-01-01

Actinomyces naeslundii genospecies 1 and 2 bind to acidic proline-rich proteins (APRPs) and statherin via type 1 fimbriae and to β-linked galactosamine (GalNAcβ) structures via type 2 fimbriae. In addition, A. naeslundii displays two types of binding specificity for both APRPs-statherin and GalNAcβ, while Actinomyces odontolyticus binds to unknown structures. To study the molecular basis for these binding specificities, DNA fragments spanning the entire or central portions of fimP (type 1) and fimA (type 2) fimbrial subunit genes were amplified by PCR from strains of genospecies 1 and 2 and hybridized with DNA from two independent collections of oral Actinomyces isolates. Isolates of genospecies 1 and 2 and A. odontolyticus, but no other Actinomyces species, were positive for hybridization with fimP and fimA full-length probes irrespective of binding to APRPs and statherin, GalNAcβ, or unknown structures. Isolates of genospecies 1 and 2, with deviating patterns of GalNAcβ1-3Galα-O-ethyl-inhibitable coaggregation with Streptococcus oralis Ss34 and MPB1, were distinguished by a fimA central probe from genospecies 1 and 2, respectively. Furthermore, isolates of genospecies 1 and 2 displaying preferential binding to APRPs over statherin were positive with a fimP central probe, while a genospecies 2 strain with the opposite binding preference was not. The sequences of fimP and fimA central gene segments were highly conserved among isolates with the same, but diversified between those with a variant, binding specificity. In conclusion, A. naeslundii exhibits variant fimP and fimA genes corresponding to diverse APRP and GalNAcβ specificities, respectively, while A. odontolyticus has a genetically related but distinct adhesin binding specificity. PMID:9712794

The Recombinant Sea Urchin Immune Effector Protein, rSpTransformer-E1, Binds to Phosphatidic Acid and Deforms Membranes

PubMed Central

Lun, Cheng Man; Samuel, Robin L.; Gillmor, Susan D.; Boyd, Anthony; Smith, L. Courtney

2017-01-01

The purple sea urchin, Strongylocentrotus purpuratus, possesses a sophisticated innate immune system that functions without adaptive capabilities and responds to pathogens effectively by expressing the highly diverse SpTransformer gene family (formerly the Sp185/333 gene family). The swift gene expression response and the sequence diversity of SpTransformer cDNAs suggest that the encoded proteins have immune functions. Individual sea urchins can express up to 260 distinct SpTransformer proteins, and their diversity suggests that different versions may have different functions. Although the deduced proteins are diverse, they share an overall structure of a hydrophobic leader, a glycine-rich N-terminal region, a histidine-rich region, and a C-terminal region. Circular dichroism analysis of a recombinant SpTransformer protein, rSpTransformer-E1 (rSpTrf-E1) demonstrates that it is intrinsically disordered and transforms to α helical in the presence of buffer additives and binding targets. Although native SpTrf proteins are associated with the membranes of perinuclear vesicles in the phagocyte class of coelomocytes and are present on the surface of small phagocytes, they have no predicted transmembrane region or conserved site for glycophosphatidylinositol linkage. To determine whether native SpTrf proteins associate with phagocyte membranes through interactions with lipids, when rSpTrf-E1 is incubated with lipid-embedded nylon strips, it binds to phosphatidic acid (PA) through both the glycine-rich region and the histidine-rich region. Synthetic liposomes composed of PA and phosphatidylcholine show binding between rSpTrf-E1 and PA by fluorescence resonance energy transfer, which is associated with leakage of luminal contents suggesting changes in lipid organization and perhaps liposome lysis. Interactions with liposomes also change membrane curvature leading to liposome budding, fusion, and invagination, which is associated with PA clustering induced by rSpTrf-E1 binding. Longer incubations result in the extraction of PA from the liposomes, which form disorganized clusters. CD shows that when rSpTrf-E1 binds to PA, it changes its secondary structure from disordered to α helical. These results provide evidence for how SpTransformer proteins may associate with molecules that have exposed phosphates including PA on cell membranes and how the characteristic of protein multimerization may drive changes in the organization of membrane lipids. PMID:28553283

Sequence analysis of DBL2β domain of vargene of Indonesian Plasmodium falciparum

NASA Astrophysics Data System (ADS)

Sulistyaningsih, E.; Romadhon, B. D.; Palupi, I.; Hidayah, F.; Dewi, R.; Prasetyo, A.

2018-03-01

Malaria is a major health problem in tropical countries including Indonesia. The most deadly agent is Plasmodium falciparum. In P. falciparum infection, PfEMP1 is supposed to play an important role in the pathogenesis of malaria. PfEMP1 is encoded by var gene family, it is a polymorphic protein where the extra-cellular portion contains of three distinct binding domains: Duffy binding-like (DBL), Cysteine-rich interdomain regions (CIDR) and C2. PfEMP1 varies in domain composition and binding specificity. The study explored the characteristic of Indonesian DBL2β-var genes and investigated its role to the malaria outcome. Twenty blood samples from clinically mild to severe malaria patients in Jember, East Java were collected for DNA extraction. Diagnosis was confirmed by Giemsa-stained thick blood smear. PCR was conducted using specific primer targeting on the full-length of DBL2ß and resulted approximately single band of 1,7 kb in a sample. This band was observed only from severe malaria sample. Sequence analysis directly from PCR product showed 74-99% similarities with previous sequences in Gene Bank. In conclusion, the DBL2β domain of vargene of Indonesian isolates was 1603 nucleotides in length and there was a possible association of the existence of DBL2β domain with the severity of malaria outcome.

Definition of a high-affinity Gag recognition structure mediating packaging of a retroviral RNA genome

PubMed Central

Gherghe, Cristina; Lombo, Tania; Leonard, Christopher W.; Datta, Siddhartha A. K.; Bess, Julian W.; Gorelick, Robert J.; Rein, Alan; Weeks, Kevin M.

2010-01-01

All retroviral genomic RNAs contain a cis-acting packaging signal by which dimeric genomes are selectively packaged into nascent virions. However, it is not understood how Gag (the viral structural protein) interacts with these signals to package the genome with high selectivity. We probed the structure of murine leukemia virus RNA inside virus particles using SHAPE, a high-throughput RNA structure analysis technology. These experiments showed that NC (the nucleic acid binding domain derived from Gag) binds within the virus to the sequence UCUG-UR-UCUG. Recombinant Gag and NC proteins bound to this same RNA sequence in dimeric RNA in vitro; in all cases, interactions were strongest with the first U and final G in each UCUG element. The RNA structural context is critical: High-affinity binding requires base-paired regions flanking this motif, and two UCUG-UR-UCUG motifs are specifically exposed in the viral RNA dimer. Mutating the guanosine residues in these two motifs—only four nucleotides per genomic RNA—reduced packaging 100-fold, comparable to the level of nonspecific packaging. These results thus explain the selective packaging of dimeric RNA. This paradigm has implications for RNA recognition in general, illustrating how local context and RNA structure can create information-rich recognition signals from simple single-stranded sequence elements in large RNAs. PMID:20974908

Morintides: cargo-free chitin-binding peptides from Moringa oleifera.

PubMed

Kini, Shruthi G; Wong, Ka H; Tan, Wei Liang; Xiao, Tianshu; Tam, James P

2017-03-31

Hevein-like peptides are a family of cysteine-rich and chitin-binding peptides consisting of 29-45 amino acids. Their chitin-binding property is essential for plant defense against fungi. Based on the number of cysteine residues in their sequences, they are divided into three sub-families: 6C-, 8C- and 10C-hevein-like peptides. All three subfamilies contain a three-domain precursor comprising a signal peptide, a mature hevein-like peptide and a C-terminal domain comprising a hinge region with protein cargo in 8C- and 10C-hevein-like peptides. Here we report the isolation and characterization of two novel 8C-hevein-like peptides, designated morintides (mO1 and mO2), from the drumstick tree Moringa oleifera, a drought-resistant tree belonging to the Moringaceae family. Proteomic analysis revealed that morintides comprise 44 amino acid residues and are rich in cysteine, glycine and hydrophilic amino acid residues such as asparagine and glutamine. Morintides are resistant to thermal and enzymatic degradation, able to bind to chitin and inhibit the growth of phyto-pathogenic fungi. Transcriptomic analysis showed that they contain a three-domain precursor comprising an endoplasmic reticulum (ER) signal sequence, a mature peptide domain and a C-terminal domain. A striking feature distinguishing morintides from other 8C-hevein-like peptides is a short and protein-cargo-free C-terminal domain. Previously, a similar protein-cargo-free C-terminal domain has been observed only in ginkgotides, the 8C-hevein-like peptides from a gymnosperm Ginkgo biloba. Thus, morintides, with a cargo-free C-terminal domain, are a stand-alone class of 8C-hevein-like peptides from angiosperms. Our results expand the existing library of hevein-like peptides and shed light on molecular diversity within the hevein-like peptide family. Our work also sheds light on the anti-fungal activity and stability of 8C-hevein-like peptides.

Alternative Polyadenylation Regulates CELF1/CUGBP1 Target Transcripts Following T Cell Activation

PubMed Central

Beisang, Daniel; Reilly, Cavan; Bohjanen, Paul R.

2014-01-01

Alternative polyadenylation (APA) is an evolutionarily conserved mechanism for regulating gene expression. Transcript 3′ end shortening through changes in polyadenylation site usage occurs following T cell activation, but the consequences of APA on gene expression are poorly understood. We previously showed that GU-rich elements (GREs) found in the 3′ untranslated regions of select transcripts mediate rapid mRNA decay by recruiting the protein CELF1/CUGBP1. Using a global RNA sequencing approach, we found that a network of CELF1 target transcripts involved in cell division underwent preferential 3′ end shortening via APA following T cell activation, resulting in decreased inclusion of CELF1 binding sites and increased transcript expression. We present a model whereby CELF1 regulates APA site selection following T cell activation through reversible binding to nearby GRE sequences. These findings provide insight into the role of APA in controlling cellular proliferation during biological processes such as development, oncogenesis and T cell activation PMID:25123787

Computational biology of RNA interactions.

PubMed

Dieterich, Christoph; Stadler, Peter F

2013-01-01

The biodiversity of the RNA world has been underestimated for decades. RNA molecules are key building blocks, sensors, and regulators of modern cells. The biological function of RNA molecules cannot be separated from their ability to bind to and interact with a wide space of chemical species, including small molecules, nucleic acids, and proteins. Computational chemists, physicists, and biologists have developed a rich tool set for modeling and predicting RNA interactions. These interactions are to some extent determined by the binding conformation of the RNA molecule. RNA binding conformations are approximated with often acceptable accuracy by sequence and secondary structure motifs. Secondary structure ensembles of a given RNA molecule can be efficiently computed in many relevant situations by employing a standard energy model for base pair interactions and dynamic programming techniques. The case of bi-molecular RNA-RNA interactions can be seen as an extension of this approach. However, unbiased transcriptome-wide scans for local RNA-RNA interactions are computationally challenging yet become efficient if the binding motif/mode is known and other external information can be used to confine the search space. Computational methods are less developed for proteins and small molecules, which bind to RNA with very high specificity. Binding descriptors of proteins are usually determined by in vitro high-throughput assays (e.g., microarrays or sequencing). Intriguingly, recent experimental advances, which are mostly based on light-induced cross-linking of binding partners, render in vivo binding patterns accessible yet require new computational methods for careful data interpretation. The grand challenge is to model the in vivo situation where a complex interplay of RNA binders competes for the same target RNA molecule. Evidently, bioinformaticians are just catching up with the impressive pace of these developments. Copyright © 2012 John Wiley & Sons, Ltd.

An RRM–ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion

PubMed Central

Collins, Katherine M.; Kainov, Yaroslav A.; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A.

2017-01-01

Abstract RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1–ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. PMID:28379442

An RRM-ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion.

PubMed

Collins, Katherine M; Kainov, Yaroslav A; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A; Makeyev, Eugene V; Ramos, Andres

2017-06-20

RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1-ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis

PubMed Central

Yap, Hui-Yeng Y.; Chooi, Yit-Heng; Fung, Shin-Yee; Ng, Szu-Ting; Tan, Chon-Seng; Tan, Nget-Hong

2015-01-01

Lignosus rhinocerotis (Cooke) Ryvarden (tiger milk mushroom) has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications. PMID:26606395

Variation and Evolution in the Glutamine-Rich Repeat Region of Drosophila Argonaute-2

PubMed Central

Palmer, William H.; Obbard, Darren J.

2016-01-01

RNA interference pathways mediate biological processes through Argonaute-family proteins, which bind small RNAs as guides to silence complementary target nucleic acids . In insects and crustaceans Argonaute-2 silences viral nucleic acids, and therefore acts as a primary effector of innate antiviral immunity. Although the function of the major Argonaute-2 domains, which are conserved across most Argonaute-family proteins, are known, many invertebrate Argonaute-2 homologs contain a glutamine-rich repeat (GRR) region of unknown function at the N-terminus . Here we combine long-read amplicon sequencing of Drosophila Genetic Reference Panel (DGRP) lines with publicly available sequence data from many insect species to show that this region evolves extremely rapidly and is hyper-variable within species. We identify distinct GRR haplotype groups in Drosophila melanogaster, and suggest that one of these haplotype groups has recently risen to high frequency in a North American population. Finally, we use published data from genome-wide association studies of viral resistance in D. melanogaster to test whether GRR haplotypes are associated with survival after virus challenge. We find a marginally significant association with survival after challenge with Drosophila C Virus in the DGRP, but we were unable to replicate this finding using lines from the Drosophila Synthetic Population Resource panel. PMID:27317784

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

PubMed Central

De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George

2014-01-01

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro.

PubMed

De Avila, Miguel; Vassall, Kenrick A; Smith, Graham S T; Bamm, Vladimir V; Harauz, George

2014-12-08

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92-R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP-Fyn-SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62-L68), and demonstrate further that residues (V83-P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn-SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex.

Stability and free energy calculation of LNA modified quadruplex: a molecular dynamics study

NASA Astrophysics Data System (ADS)

Chaubey, Amit Kumar; Dubey, Kshatresh Dutta; Ojha, Rajendra Prasad

2012-03-01

Telomeric ends of chromosomes, which comprise noncoding repeat sequences of guanine-rich DNA, which are the fundamental in protecting the cell from recombination and degradation. Telomeric DNA sequences can form four stranded quadruplex structures, which are involved in the structure of telomere ends. The formation and stabilization of telomeric quadruplexes has been shown to inhibit the activity of telomerase, thus establishing telomeric DNA quadrulex as an attractive target for cancer therapeutic intervention. Molecular dynamic simulation offers the prospects of detailed description of the dynamical structure with ion and water at molecular level. In this work we have taken a oligomeric part of human telomeric DNA, d(TAGGGT) to form different monomeric quadruplex structures d(TAGGGT)4. Here we report the relative stabilities of these structures under K+ ion conditions and binding interaction between the strands, as determined by molecular dynamic simulations followed by energy calculation. We have taken locked nucleic acid (LNA) in this study. The free energy molecular mechanics Poission Boltzman surface area calculations are performed for the determination of most stable complex structure between all modified structures. We calculated binding free energy for the combination of different strands as the ligand and receptor for all structures. The energetic study shows that, a mixed hybrid type quadruplex conformation in which two parallel strands are bind with other two antiparallel strands, are more stable than other conformations. The possible mechanism for the inhibition of the cancerous growth has been discussed. Such studies may be helpful for the rational drug designing.

Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

PubMed

Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

2008-08-15

The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

PubMed Central

2017-01-01

Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

KM+, a mannose-binding lectin from Artocarpus integrifolia: amino acid sequence, predicted tertiary structure, carbohydrate recognition, and analysis of the beta-prism fold.

PubMed Central

Rosa, J. C.; De Oliveira, P. S.; Garratt, R.; Beltramini, L.; Resing, K.; Roque-Barreira, M. C.; Greene, L. J.

1999-01-01

The complete amino acid sequence of the lectin KM+ from Artocarpus integrifolia (jackfruit), which contains 149 residues/mol, is reported and compared to those of other members of the Moraceae family, particularly that of jacalin, also from jackfruit, with which it shares 52% sequence identity. KM+ presents an acetyl-blocked N-terminus and is not posttranslationally modified by proteolytic cleavage as is the case for jacalin. Rather, it possesses a short, glycine-rich linker that unites the regions homologous to the alpha- and beta-chains of jacalin. The results of homology modeling implicate the linker sequence in sterically impeding rotation of the side chain of Asp141 within the binding site pocket. As a consequence, the aspartic acid is locked into a conformation adequate only for the recognition of equatorial hydroxyl groups on the C4 epimeric center (alpha-D-mannose, alpha-D-glucose, and their derivatives). In contrast, the internal cleavage of the jacalin chain permits free rotation of the homologous aspartic acid, rendering it capable of accepting hydrogen bonds from both possible hydroxyl configurations on C4. We suggest that, together with direct recognition of epimeric hydroxyls and the steric exclusion of disfavored ligands, conformational restriction of the lectin should be considered to be a new mechanism by which selectivity may be built into carbohydrate binding sites. Jacalin and KM+ adopt the beta-prism fold already observed in two unrelated protein families. Despite presenting little or no sequence similarity, an analysis of the beta-prism reveals a canonical feature repeatedly present in all such structures, which is based on six largely hydrophobic residues within a beta-hairpin containing two classic-type beta-bulges. We suggest the term beta-prism motif to describe this feature. PMID:10210179

Evolution of Alternative Adaptive Immune Systems in Vertebrates.

PubMed

Boehm, Thomas; Hirano, Masayuki; Holland, Stephen J; Das, Sabyasachi; Schorpp, Michael; Cooper, Max D

2018-04-26

Adaptive immunity in jawless fishes is based on antigen recognition by three types of variable lymphocyte receptors (VLRs) composed of variable leucine-rich repeats, which are differentially expressed by two T-like lymphocyte lineages and one B-like lymphocyte lineage. The T-like cells express either VLRAs or VLRCs of yet undefined antigen specificity, whereas the VLRB antibodies secreted by B-like cells bind proteinaceous and carbohydrate antigens. The incomplete VLR germline genes are assembled into functional units by a gene conversion-like mechanism that employs flanking variable leucine-rich repeat sequences as templates in association with lineage-specific expression of cytidine deaminases. B-like cells develop in the hematopoietic typhlosole and kidneys, whereas T-like cells develop in the thymoid, a thymus-equivalent region at the gill fold tips. Thus, the dichotomy between T-like and B-like cells and the presence of dedicated lymphopoietic tissues emerge as ancestral vertebrate features, whereas the somatic diversification of structurally distinct antigen receptor genes evolved independently in jawless and jawed vertebrates.

Phosphorylation of poly(rC) binding protein 1 (PCBP1) contributes to stabilization of mu opioid receptor (MOR) mRNA via interaction with AU-rich element RNA-binding protein 1 (AUF1) and poly A binding protein (PABP)

PubMed Central

Hwang, Cheol Kyu; Wagley, Yadav; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

2016-01-01

Gene regulation at the post-transcriptional level is frequently based on cis- and trans-acting factors on target mRNAs. We found a C-rich element (CRE) in mu-opioid receptor (MOR) 3′-untranslated region (UTR) to which poly (rC) binding protein 1 (PCBP1) binds, resulting in MOR mRNA stabilization. RNA immunoprecipitation and RNA EMSA revealed the formation of PCBP1-RNA complexes at the element. Knockdown of PCBP1 decreased MOR mRNA half-life and protein expression. Stimulation by forskolin increased cytoplasmic localization of PCBP1 and PCBP1/MOR 3′-UTR interactions via increased serine phosphorylation that was blocked by protein kinase A (PKA) or (phosphatidyl inositol-3) PI3-kinase inhibitors. The forskolin treatment also enhanced serine- and tyrosine-phosphorylation of AU-rich element binding protein (AUF1), concurrent with its increased binding to the CRE, and led to an increased interaction of poly A binding protein (PABP) with the CRE and poly(A) sites. AUF1 phosphorylation also led to an increased interaction with PCBP1. These findings suggest that a single co-regulator, PCBP1, plays a crucial role in stabilizing MOR mRNA, and is induced by PKA signaling by conforming to AUF1 and PABP. PMID:27836661

Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

PubMed

Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

2008-05-01

SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Krüppel protein.

PubMed Central

Licht, J D; Hanna-Rose, W; Reddy, J C; English, M A; Ro, M; Grossel, M; Shaknovich, R; Hansen, U

1994-01-01

We previously demonstrated that the Drosophila Krüppel protein is a transcriptional repressor with separable DNA-binding and transcriptional repression activities. In this study, the minimal amino (N)-terminal repression region of the Krüppel protein was defined by transferring regions of the Krüppel protein to a heterologous DNA-binding protein, the lacI protein. Fusion of a predicted alpha-helical region from amino acids 62 to 92 in the N terminus of the Krüppel protein was sufficient to transfer repression activity. This putative alpha-helix has several hydrophobic surfaces, as well as a glutamine-rich surface. Mutants containing multiple amino acid substitutions of the glutamine residues demonstrated that this putative alpha-helical region is essential for repression activity of a Krüppel protein containing the entire N-terminal and DNA-binding regions. Furthermore, one point mutant with only a single glutamine on this surface altered to lysine abolished the ability of the Krüppel protein to repress, indicating the importance of the amino acid at residue 86 for repression. The N terminus also contained an adjacent activation region localized between amino acids 86 and 117. Finally, in accordance with predictions from primary amino acid sequence similarity, a repression region from the Drosophila even-skipped protein, which was six times more potent than that of the Krüppel protein in the mammalian cells, was characterized. This segment included a hydrophobic stretch of 11 consecutive alanine residues and a proline-rich region. Images PMID:8196644

Amino acid sequence of the human fibronectin receptor

PubMed Central

1987-01-01

The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481

Phase-separation mechanism for C-terminal hyperphosphorylation of RNA polymerase II.

PubMed

Lu, Huasong; Yu, Dan; Hansen, Anders S; Ganguly, Sourav; Liu, Rongdiao; Heckert, Alec; Darzacq, Xavier; Zhou, Qiang

2018-06-01

Hyperphosphorylation of the C-terminal domain (CTD) of the RPB1 subunit of human RNA polymerase (Pol) II is essential for transcriptional elongation and mRNA processing 1-3 . The CTD contains 52 heptapeptide repeats of the consensus sequence YSPTSPS. The highly repetitive nature and abundant possible phosphorylation sites of the CTD exert special constraints on the kinases that catalyse its hyperphosphorylation. Positive transcription elongation factor b (P-TEFb)-which consists of CDK9 and cyclin T1-is known to hyperphosphorylate the CTD and negative elongation factors to stimulate Pol II elongation 1,4,5 . The sequence determinant on P-TEFb that facilitates this action is currently unknown. Here we identify a histidine-rich domain in cyclin T1 that promotes the hyperphosphorylation of the CTD and stimulation of transcription by CDK9. The histidine-rich domain markedly enhances the binding of P-TEFb to the CTD and functional engagement with target genes in cells. In addition to cyclin T1, at least one other kinase-DYRK1A 6 -also uses a histidine-rich domain to target and hyperphosphorylate the CTD. As a low-complexity domain, the histidine-rich domain also promotes the formation of phase-separated liquid droplets in vitro, and the localization of P-TEFb to nuclear speckles that display dynamic liquid properties and are sensitive to the disruption of weak hydrophobic interactions. The CTD-which in isolation does not phase separate, despite being a low-complexity domain-is trapped within the cyclin T1 droplets, and this process is enhanced upon pre-phosphorylation by CDK7 of transcription initiation factor TFIIH 1-3 . By using multivalent interactions to create a phase-separated functional compartment, the histidine-rich domain in kinases targets the CTD into this environment to ensure hyperphosphorylation and efficient elongation of Pol II.

Allergenic characterization of a novel allergen, homologous to chymotrypsin, from german cockroach.

PubMed

Jeong, Kyoung Yong; Son, Mina; Lee, Jae Hyun; Hong, Chein Soo; Park, Jung Won

2015-05-01

Cockroach feces are known to be rich in IgE-reactive components. Various protease allergens were identified by proteomic analysis of German cockroach fecal extract in a previous study. In this study, we characterized a novel allergen, a chymotrypsin-like serine protease. A cDNA sequence homologous to chymotrypsin was obtained by analysis of German cockroach expressed sequence tag (EST) clones. The recombinant chymotrypsins from the German cockroach and house dust mite (Der f 6) were expressed in Escherichia coli using the pEXP5NT/TOPO vector system, and their allergenicity was investigated by ELISA. The deduced amino acid sequence of German cockroach chymotrypsin showed 32.7 to 43.1% identity with mite group 3 (trypsin) and group 6 (chymotrypsin) allergens. Sera from 8 of 28 German cockroach allergy subjects (28.6%) showed IgE binding to the recombinant protein. IgE binding to the recombinant cockroach chymotrypsin was inhibited by house dust mite chymotrypsin Der f 6, while it minimally inhibited the German cockroach whole body extract. A novel allergen homologous to chymotrypsin was identified from the German cockroach and was cross-reactive with Der f 6.

The Cu(II) affinity of the N-terminus of human copper transporter CTR1: Comparison of human and mouse sequences.

PubMed

Bossak, Karolina; Drew, Simon C; Stefaniak, Ewelina; Płonka, Dawid; Bonna, Arkadiusz; Bal, Wojciech

2018-05-01

Copper Transporter 1 (CTR1) is a homotrimeric membrane protein providing the main route of copper transport into eukaryotic cells from the extracellular milieu. Its N-terminal extracellular domain, rich in His and Met residues, is considered responsible for directing copper into the transmembrane channel. Most of vertebrate CTR1 proteins contain the His residue in position three from N-terminus, creating a well-known Amino Terminal Cu(II)- and Ni(II)-Binding (ATCUN) site. CTR1 from humans, primates and many other species contains the Met-Asp-His (MDH) sequence, while some rodents including mouse have the Met-Asn-His (MNH) N-terminal sequence. CTR1 is thought to collect Cu(II) ions from blood copper transport proteins, including albumin, but previous reports indicated that the affinity of N-terminal peptide/domain of CTR1 is significantly lower than that of albumin, casting serious doubt on this aspect of CTR1 function. Using potentiometry and spectroscopic techniques we demonstrated that MDH-amide, a tripeptide model of human CTR1 N-terminus, binds Cu(II) with K of 1.3 × 10 13  M -1 at pH 7.4, ~13 times stronger than Human Serum Albumin (HSA), and MNH-amide is even stronger, K of 3.2 × 10 14  M -1 at pH 7.4. These results indicate that the N-terminus of CTR1 may serve as intermediate binding site during Cu(II) transfer from blood copper carriers to the transporter. MDH-amide, but not MNH-amide also forms a low abundance complex with non-ATCUN coordination involving the Met amine, His imidazole and Asp carboxylate. This species might assist Cu(II) relay down the peptide chain or its reduction to Cu(I), both steps necessary for the CTR1 function. Copyright © 2018 Elsevier Inc. All rights reserved.

Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

PubMed

Rohs, Remo; Sklenar, Heinz

2004-04-01

The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

PubMed

Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

2016-09-01

Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

SATB2 expression increased anchorage-independent growth and cell migration in human bronchial epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Feng; Jordan, Ashley; Kluz, Thomas

The special AT-rich sequence-binding protein 2 (SATB2) is a protein that binds to the nuclear matrix attachment region of the cell and regulates gene expression by altering chromatin structure. In our previous study, we reported that SATB2 gene expression was induced in human bronchial epithelial BEAS-2B cells transformed by arsenic, chromium, nickel and vanadium. In this study, we show that ectopic expression of SATB2 in the normal human bronchial epithelial cell-line BEAS-2B increased anchorage-independent growth and cell migration, meanwhile, shRNA-mediated knockdown of SATB2 significantly decreased anchorage-independent growth in Ni transformed BEAS-2B cells. RNA sequencing analyses of SATB2 regulated genes revealedmore » the enrichment of those involved in cytoskeleton, cell adhesion and cell-movement pathways. Our evidence supports the hypothesis that SATB2 plays an important role in BEAS-2B cell transformation. - Highlights: • We performed SATB2 overexpression in the BEAS-2B cell line. • We performed SATB2 knockdown in a Ni transformed BEAS-2B cell line. • SATB2 induced anchorage-independent growth and increased cell migration. • SATB2 knockdown significantly decreased anchorage-independent growth. • We identified alterations in gene involved in cytoskeleton, cell adhesion.« less

A high-fat diet and the threonine-encoding allele (Thr54) polymorphism of fatty acid–binding protein 2 reduce plasma triglyceride–rich lipoproteins

USDA-ARS?s Scientific Manuscript database

The Thr54 allele of the fatty acid binding protein 2 (FABP2) DNA polymorphism is associated with increased triglyceride-rich lipoproteins and insulin resistance. We investigated whether the triglyceride-rich lipoprotein response to diets of varied fat content is affected by the fatty acid binding pr...

The RCAN carboxyl end mediates calcineurin docking-dependent inhibition via a site that dictates binding to substrates and regulators

PubMed Central

Martínez-Martínez, Sara; Genescà, Lali; Rodríguez, Antonio; Raya, Alicia; Salichs, Eulàlia; Were, Felipe; López-Maderuelo, María Dolores; Redondo, Juan Miguel; de la Luna, Susana

2009-01-01

Specificity of signaling kinases and phosphatases toward their targets is usually mediated by docking interactions with substrates and regulatory proteins. Here, we characterize the motifs involved in the physical and functional interaction of the phosphatase calcineurin with a group of modulators, the RCAN protein family. Mutation of key residues within the hydrophobic docking-cleft of the calcineurin catalytic domain impairs binding to all human RCAN proteins and to the calcineurin interacting proteins Cabin1 and AKAP79. A valine-rich region within the RCAN carboxyl region is essential for binding to the docking site in calcineurin. Although a peptide containing this sequence compromises NFAT signaling in living cells, it does not inhibit calcineurin catalytic activity directly. Instead, calcineurin catalytic activity is inhibited by a motif at the extreme C-terminal region of RCAN, which acts in cis with the docking motif. Our results therefore indicate that the inhibitory action of RCAN on calcineurin-NFAT signaling results not only from the inhibition of phosphatase activity but also from competition between NFAT and RCAN for binding to the same docking site in calcineurin. Thus, competition by substrates and modulators for a common docking site appears to be an essential mechanism in the regulation of Ca2+-calcineurin signaling. PMID:19332797

Human CST Facilitates Genome-wide RAD51 Recruitment to GC-Rich Repetitive Sequences in Response to Replication Stress.

PubMed

Chastain, Megan; Zhou, Qing; Shiva, Olga; Fadri-Moskwik, Maria; Whitmore, Leanne; Jia, Pingping; Dai, Xueyu; Huang, Chenhui; Ye, Ping; Chai, Weihang

2016-08-02

The telomeric CTC1/STN1/TEN1 (CST) complex has been implicated in promoting replication recovery under replication stress at genomic regions, yet its precise role is unclear. Here, we report that STN1 is enriched at GC-rich repetitive sequences genome-wide in response to hydroxyurea (HU)-induced replication stress. STN1 deficiency exacerbates the fragility of these sequences under replication stress, resulting in chromosome fragmentation. We find that upon fork stalling, CST proteins form distinct nuclear foci that colocalize with RAD51. Furthermore, replication stress induces physical association of CST with RAD51 in an ATR-dependent manner. Strikingly, CST deficiency diminishes HU-induced RAD51 foci formation and reduces RAD51 recruitment to telomeres and non-telomeric GC-rich fragile sequences. Collectively, our findings establish that CST promotes RAD51 recruitment to GC-rich repetitive sequences in response to replication stress to facilitate replication restart, thereby providing insights into the mechanism underlying genome stability maintenance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

The major resistance gene cluster in lettuce is highly duplicated and spans several megabases.

PubMed Central

Meyers, B C; Chin, D B; Shen, K A; Sivaramakrishnan, S; Lavelle, D O; Zhang, Z; Michelmore, R W

1998-01-01

At least 10 Dm genes conferring resistance to the oomycete downy mildew fungus Bremia lactucae map to the major resistance cluster in lettuce. We investigated the structure of this cluster in the lettuce cultivar Diana, which contains Dm3. A deletion breakpoint map of the chromosomal region flanking Dm3 was saturated with a variety of molecular markers. Several of these markers are components of a family of resistance gene candidates (RGC2) that encode a nucleotide binding site and a leucine-rich repeat region. These motifs are characteristic of plant disease resistance genes. Bacterial artificial chromosome clones were identified by using duplicated restriction fragment length polymorphism markers from the region, including the nucleotide binding site-encoding region of RGC2. Twenty-two distinct members of the RGC2 family were characterized from the bacterial artificial chromosomes; at least two additional family members exist. The RGC2 family is highly divergent; the nucleotide identity was as low as 53% between the most distantly related copies. These RGC2 genes span at least 3.5 Mb. Eighteen members were mapped on the deletion breakpoint map. A comparison between the phylogenetic and physical relationships of these sequences demonstrated that closely related copies are physically separated from one another and indicated that complex rearrangements have shaped this region. Analysis of low-copy genomic sequences detected no genes, including RGC2, in the Dm3 region, other than sequences related to retrotransposons and transposable elements. The related but divergent family of RGC2 genes may act as a resource for the generation of new resistance phenotypes through infrequent recombination or unequal crossing over. PMID:9811791

Changes in the folding landscape of the WW domain provide a molecular mechanism for an inherited genetic syndrome.

PubMed

Pucheta-Martinez, Encarna; D'Amelio, Nicola; Lelli, Moreno; Martinez-Torrecuadrada, Jorge L; Sudol, Marius; Saladino, Giorgio; Gervasio, Francesco Luigi

2016-07-26

WW domains are small domains present in many human proteins with a wide array of functions and acting through the recognition of proline-rich sequences. The WW domain belonging to polyglutamine tract-binding protein 1 (PQBP1) is of particular interest due to its direct involvement in several X chromosome-linked intellectual disabilities, including Golabi-Ito-Hall (GIH) syndrome, where a single point mutation (Y65C) correlates with the development of the disease. The mutant cannot bind to its natural ligand WBP11, which regulates mRNA processing. In this work we use high-field high-resolution NMR and enhanced sampling molecular dynamics simulations to gain insight into the molecular causes the disease. We find that the wild type protein is partially unfolded exchanging among multiple beta-strand-like conformations in solution. The Y65C mutation further destabilizes the residual fold and primes the protein for the formation of a disulphide bridge, which could be at the origin of the loss of function.

Changes in the folding landscape of the WW domain provide a molecular mechanism for an inherited genetic syndrome

NASA Astrophysics Data System (ADS)

Pucheta-Martinez, Encarna; D'Amelio, Nicola; Lelli, Moreno; Martinez-Torrecuadrada, Jorge L.; Sudol, Marius; Saladino, Giorgio; Gervasio, Francesco Luigi

2016-07-01

WW domains are small domains present in many human proteins with a wide array of functions and acting through the recognition of proline-rich sequences. The WW domain belonging to polyglutamine tract-binding protein 1 (PQBP1) is of particular interest due to its direct involvement in several X chromosome-linked intellectual disabilities, including Golabi-Ito-Hall (GIH) syndrome, where a single point mutation (Y65C) correlates with the development of the disease. The mutant cannot bind to its natural ligand WBP11, which regulates mRNA processing. In this work we use high-field high-resolution NMR and enhanced sampling molecular dynamics simulations to gain insight into the molecular causes the disease. We find that the wild type protein is partially unfolded exchanging among multiple beta-strand-like conformations in solution. The Y65C mutation further destabilizes the residual fold and primes the protein for the formation of a disulphide bridge, which could be at the origin of the loss of function.

Transcriptome-Wide Identification of RNA Targets of Arabidopsis SERINE/ARGININE-RICH45 Uncovers the Unexpected Roles of This RNA Binding Protein in RNA Processing[OPEN

PubMed Central

Wang, Yajun; Hamilton, Michael; Ben-Hur, Asa; Reddy, Anireddy S.N.

2015-01-01

Plant SR45 and its metazoan ortholog RNPS1 are serine/arginine-rich (SR)-like RNA binding proteins that function in splicing/postsplicing events and regulate diverse processes in eukaryotes. Interactions of SR45 with both RNAs and proteins are crucial for regulating RNA processing. However, in vivo RNA targets of SR45 are currently unclear. Using RNA immunoprecipitation followed by high-throughput sequencing, we identified over 4000 Arabidopsis thaliana RNAs that directly or indirectly associate with SR45, designated as SR45-associated RNAs (SARs). Comprehensive analyses of these SARs revealed several roles for SR45. First, SR45 associates with and regulates the expression of 30% of abscisic acid (ABA) signaling genes at the postsplicing level. Second, although most SARs are derived from intron-containing genes, surprisingly, 340 SARs are derived from intronless genes. Expression analysis of the SARs suggests that SR45 differentially regulates intronless and intron-containing SARs. Finally, we identified four overrepresented RNA motifs in SARs that likely mediate SR45’s recognition of its targets. Therefore, SR45 plays an unexpected role in mRNA processing of intronless genes, and numerous ABA signaling genes are targeted for regulation at the posttranscriptional level. The diverse molecular functions of SR45 uncovered in this study are likely applicable to other species in view of its conservation across eukaryotes. PMID:26603559

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

Sequence2Vec: a novel embedding approach for modeling transcription factor binding affinity landscape.

PubMed

Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

2017-11-15

An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

PubMed Central

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Amyloid fibril formation in vitro from halophilic metal binding protein: Its high solubility and reversibility minimized formation of amorphous protein aggregations

PubMed Central

Tokunaga, Yuhei; Matsumoto, Mitsuharu; Tokunaga, Masao; Arakawa, Tsutomu; Sugimoto, Yasushi

2013-01-01

Halophilic proteins are characterized by high net negative charges and relatively small fraction of hydrophobic amino acids, rendering them aggregation resistant. These properties are also shared by histidine-rich metal binding protein (HP) from moderate halophile, Chromohalobacter salexigens, used in this study. Here, we examined how halophilic proteins form amyloid fibrils in vitro. His-tagged HP, incubated at pH 2.0 and 58°C, readily formed amyloid fibrils, as observed by thioflavin fluorescence, CD spectra, and transmission or atomic force microscopies. Under these low-pH harsh conditions, however, His-HP was promptly hydrolyzed to smaller peptides most likely responsible for rapid formation of amyloid fibril. Three major acid-hydrolyzed peptides were isolated from fibrils and turned out to readily form fibrils. The synthetic peptides predicted to form fibrils in these peptide sequences by Waltz software also formed fibrils. Amyloid fibril was also readily formed from full-length His-HP when incubated with 10–20% 2,2,2-trifluoroethanol at pH 7.8 and 25°C without peptide bond cleavage. PMID:24038709

Computational determination of the binding mode of α-conotoxin to nicotinic acetylcholine receptor

NASA Astrophysics Data System (ADS)

Tabassum, Nargis; Yu, Rilei; Jiang, Tao

2016-12-01

Conotoxins belong to the large families of disulfide-rich peptide toxins from cone snail venom, and can act on a broad spectrum of ion channels and receptors. They are classified into different subtypes based on their targets. The α-conotoxins selectively inhibit the current of the nicotinic acetylcholine receptors. Because of their unique selectivity towards distinct nAChR subtypes, α-conotoxins become valuable tools in nAChR study. In addition to the X-ray structures of α-conotoxins in complex with acetylcholine-binding protein, a homolog of the nAChR ligand-binding domain, the high-resolution crystal structures of the extracellular domain of the α1 and α9 subunits are also obtained. Such structures not only revealed the details of the configuration of nAChR, but also provided higher sequence identity templates for modeling the binding modes of α-conotoxins to nAChR. This mini-review summarizes recent modeling studies for the determination of the binding modes of α-conotoxins to nAChR. As there are not crystal structures of the nAChR in complex with conotoxins, computational modeling in combination of mutagenesis data is expected to reveal the molecular recognition mechanisms that govern the interactions between α-conotoxins and nAChR at molecular level. An accurate determination of the binding modes of α-conotoxins on AChRs allows rational design of α-conotoxin analogues with improved potency or selectivity to nAChRs.

Involvement of Hu and heterogeneous nuclear ribonucleoprotein K in neuronal differentiation through p21 mRNA post-transcriptional regulation.

PubMed

Yano, Masato; Okano, Hirotaka J; Okano, Hideyuki

2005-04-01

The Hu family is a group of neuronal RNA-binding proteins required for neuronal differentiation in the developing nervous system. Previously, Hu proteins have been shown to enhance the stabilization and/or translation of target mRNAs, such as p21 (CIP1), by binding to AU-rich elements in untranslated regions (UTRs). In this study, we show that Hu induces p21 expression, cell cycle arrest, and neuronal differentiation in mouse neuroblastoma N1E-115 cells. p21 expression is also up-regulated during Me2SO-induced differentiation in N1E-115 cells and is controlled by post-transcriptional mechanisms through its 3'-UTR. To investigate the molecular mechanisms of Hu functions, we used a proteomics strategy to isolate Hu-interacting proteins and identified heterogeneous nuclear ribonucleoprotein (hnRNP) K. hnRNP K also specifically binds to CU-rich sequences in p21 mRNA 3'-UTR and represses its translation in both nonneuronal and neuronal cells. Further, using RNA interference experiments, we show that the Hu-p21 pathway contributes to the regulation of neurite outgrowth and proliferation in N1E-115 cells, and this pathway is antagonized by hnRNP K. Our results suggest a model in which the mutually antagonistic action of two RNA-binding proteins, Hu and hnRNP K, control the timing of the switch from proliferation to neuronal differentiation through the post-transcriptional regulation of p21 mRNA.

G-quadruplex-interacting compounds alter latent DNA replication and episomal persistence of KSHV

PubMed Central

Madireddy, Advaitha; Purushothaman, Pravinkumar; Loosbroock, Christopher P.; Robertson, Erle S.; Schildkraut, Carl L.; Verma, Subhash C.

2016-01-01

Kaposi's sarcoma associated herpesvirus (KSHV) establishes life-long latent infection by persisting as an extra-chromosomal episome in the infected cells and by maintaining its genome in dividing cells. KSHV achieves this by tethering its epigenome to the host chromosome by latency associated nuclear antigen (LANA), which binds in the terminal repeat (TR) region of the viral genome. Sequence analysis of the TR, a GC-rich DNA element, identified several potential Quadruplex G-Rich Sequences (QGRS). Since quadruplexes have the tendency to obstruct DNA replication, we used G-quadruplex stabilizing compounds to examine their effect on latent DNA replication and the persistence of viral episomes. Our results showed that these G-quadruplex stabilizing compounds led to the activation of dormant origins of DNA replication, with preferential bi-directional pausing of replications forks moving out of the TR region, implicating the role of the G-rich TR in the perturbation of episomal DNA replication. Over time, treatment with PhenDC3 showed a loss of viral episomes in the infected cells. Overall, these data show that G-quadruplex stabilizing compounds retard the progression of replication forks leading to a reduction in DNA replication and episomal maintenance. These results suggest a potential role for G-quadruplex stabilizers in the treatment of KSHV-associated diseases. PMID:26837574

Thermodynamic dissection of the binding energetics of proline-rich peptides to the Abl-SH3 domain: implications for rational ligand design.

PubMed

Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene

2004-02-13

The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

SATB1 Expression Governs Epigenetic Repression of PD-1 in Tumor-Reactive T Cells.

PubMed

Stephen, Tom L; Payne, Kyle K; Chaurio, Ricardo A; Allegrezza, Michael J; Zhu, Hengrui; Perez-Sanz, Jairo; Perales-Puchalt, Alfredo; Nguyen, Jenny M; Vara-Ailor, Ana E; Eruslanov, Evgeniy B; Borowsky, Mark E; Zhang, Rugang; Laufer, Terri M; Conejo-Garcia, Jose R

2017-01-17

Despite the importance of programmed cell death-1 (PD-1) in inhibiting T cell effector activity, the mechanisms regulating its expression remain poorly defined. We found that the chromatin organizer special AT-rich sequence-binding protein-1 (Satb1) restrains PD-1 expression induced upon T cell activation by recruiting a nucleosome remodeling deacetylase (NuRD) complex to Pdcd1 regulatory regions. Satb1 deficienct T cells exhibited a 40-fold increase in PD-1 expression. Tumor-derived transforming growth factor β (Tgf-β) decreased Satb1 expression through binding of Smad proteins to the Satb1 promoter. Smad proteins also competed with the Satb1-NuRD complex for binding to Pdcd1 enhancers, releasing Pdcd1 expression from Satb1-mediated repression, Satb1-deficient tumor-reactive T cells lost effector activity more rapidly than wild-type lymphocytes at tumor beds expressing PD-1 ligand (CD274), and these differences were abrogated by sustained CD274 blockade. Our findings suggest that Satb1 functions to prevent premature T cell exhaustion by regulating Pdcd1 expression upon T cell activation. Dysregulation of this pathway in tumor-infiltrating T cells results in diminished anti-tumor immunity. Copyright © 2017 Elsevier Inc. All rights reserved.

Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

PubMed Central

2010-01-01

Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. Conclusions A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana. PMID:20637079

Contacts between the factor TUF and RPG sequences.

PubMed

Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

1990-08-25

The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

Ultrasensitive detection of uranyl by graphene oxide-based background reduction and RCDzyme-based enzyme strand recycling signal amplification.

PubMed

Li, Ming-Hui; Wang, Yong-Sheng; Cao, Jin-Xiu; Chen, Si-Han; Tang, Xian; Wang, Xiao-Feng; Zhu, Yu-Feng; Huang, Yan-Qin

2015-10-15

We proposed a novel strategy which combines graphene oxide-based background reduction with RCDzyme-based enzyme strand recycling amplification for ultrahigh sensitive detection of uranyl. The RCDzyme is designed to contain a guanine (G)-rich sequence that replaces the partial sequence in an uranyl-specific DNAzyme. This multifunctional probe can act as the target recognition element, DNAzyme and the primer of signal amplification. The presence of UO2(2+) can induce the cleavage of the substrate strands in RCDzyme. Then, each released enzyme strand can hybridize with another substrate strands to trigger many cycles of the cleavage by binding uranyl, leading to the formation of more G-quadruplexes by split guanine-rich oligonucleotide fragments. The resulting G-quadruplexes could bind to N-methyl-mesoporphyrin IX (NMM), causing an amplified detection signal for the target uranyl. Next, graphene oxide-based background reduction strategy was further employed for adsorbing free ssDNA and NMM, thereby providing a proximalis zero-background signal. The combination of RCDzyme signal amplification and proximalis zero-background signal remarkably improves the sensitivity of this method, achieving a dynamic range of two orders of magnitude and giving a detection limit down to 86 pM, which is much lower than those of related literature reports. These achievements might be helpful in the design of highly sensitive analytical platform for wide applications in environmental and biomedical fields. Copyright © 2015 Elsevier B.V. All rights reserved.

A novel antifungal peptide from leaves of the weed Stellaria media L.

PubMed

Rogozhin, Eugene A; Slezina, Marina P; Slavokhotova, Anna A; Istomina, Ekaterina A; Korostyleva, Tatyana V; Smirnov, Alexey N; Grishin, Eugene V; Egorov, Tsezi A; Odintsova, Tatyana I

2015-09-01

A novel peptide named SmAMP3 was isolated from leaves of common chickweed (Stellaria media L.) by a combination of acidic extraction and a single-step reversed-phase HPLC and sequenced. The peptide is basic and cysteine-rich, consists of 35 amino acids, and contains three disulphide bridges. Homology search revealed that SmAMP3 belongs to the family of hevein-like antimicrobial peptides carrying a conserved chitin-binding site. Efficient binding of chitin by SmAMP3 was proved by in vitro assays. Molecular modeling confirmed conservation of the chitin-binding module in SmAMP3 locating the variable amino acid residues to the solvent-exposed loops of the molecule. The peptide exhibits potent antifungal activity against important plant pathogens in the micromolar range, although it is devoid of antibacterial activity at concentrations below 10 μM. As judged by chromatographic behavior and mass spectrometric data, the peptide is constitutively expressed in above-ground organs and seeds of S. media plants, thus representing an important player in the preformed branch of the plant immune system. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Structural requirements for fibromodulin binding to collagen and the control of type I collagen fibrillogenesis--critical roles for disulphide bonding and the C-terminal region.

PubMed

Font, B; Eichenberger, D; Goldschmidt, D; Boutillon, M M; Hulmes, D J

1998-06-15

Fibromodulin belongs to the family of small, leucine-rich proteoglycans which have been reported to interact with collagens and to inhibit type I collagen fibrillogenesis. Decorin and fibromodulin exhibit a noticeable degree of sequence similarity. However, as previously reported [Font, B., Eichenberger, D., Rosenberg, L. M. & van der Rest, M. (1996) Matrix Biol. 15, 341-348] the domains of these molecules implicated in the interactions with type XII and type XIV collagens are different, these being the dermatan sulphate/chondroitin sulphate chain for decorin and the core protein for fibromodulin. At the present time the fibromodulin domains implicated in the interactions with fibrillar collagens remain unknown. In experiments reported here, we have sought to identify the structural requirements for fibromodulin interaction with collagen and for the control of type I collagen fibrillogenesis. Circular dichroism spectra and fibrillogenesis inhibition studies show that fibromodulin structure and its collagen fibrillogenesis control function are strictly dependent on the presence of intact disulphide bridge(s). In addition, we show that the binding of fibromodulin (or fibromodulin-derived fragments) to type I collagen is not necessarily correlated with fibrillogenesis inhibition. To isolate fibromodulin domains, the native proteoglycan was submitted to mild proteolysis. We have isolated an alpha-chymotrypsin-resistant fragment which contains the bulk of the N-terminal and central region of the molecule including the leucine-rich repeats 4 and 6 reported for decorin to be involved in type I collagen binding. This fragment does not bind to type I collagen. Using enzymes with different specificities, a number of large fragments of fibromodulin were obtained, suggesting a compact structure for this molecule which is relatively resistant to proteolysis. None of these N-glycosylated fragments were able to bind to type I collagen in co-sedimentation experiments. Taken together these results suggest that fibromodulin-type I collagen interactions leading to fibrillogenesis inhibition require more than one binding domain. One of these domains could be the C-terminal end of the molecule containing the disulphide loop which is absent in the chymotrypsin-resistant fragment.

Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

PubMed Central

Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

2013-01-01

Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

Preattentive binding of auditory and visual stimulus features.

PubMed

Winkler, István; Czigler, István; Sussman, Elyse; Horváth, János; Balázs, Lászlo

2005-02-01

We investigated the role of attention in feature binding in the auditory and the visual modality. One auditory and one visual experiment used the mismatch negativity (MMN and vMMN, respectively) event-related potential to index the memory representations created from stimulus sequences, which were either task-relevant and, therefore, attended or task-irrelevant and ignored. In the latter case, the primary task was a continuous demanding within-modality task. The test sequences were composed of two frequently occurring stimuli, which differed from each other in two stimulus features (standard stimuli) and two infrequently occurring stimuli (deviants), which combined one feature from one standard stimulus with the other feature of the other standard stimulus. Deviant stimuli elicited MMN responses of similar parameters across the different attentional conditions. These results suggest that the memory representations involved in the MMN deviance detection response encoded the frequently occurring feature combinations whether or not the test sequences were attended. A possible alternative to the memory-based interpretation of the visual results, the elicitation of the McCollough color-contingent aftereffect, was ruled out by the results of our third experiment. The current results are compared with those supporting the attentive feature integration theory. We conclude that (1) with comparable stimulus paradigms, similar results have been obtained in the two modalities, (2) there exist preattentive processes of feature binding, however, (3) conjoining features within rich arrays of objects under time pressure and/or longterm retention of the feature-conjoined memory representations may require attentive processes.

SSMART: Sequence-structure motif identification for RNA-binding proteins.

PubMed

Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

2018-06-11

RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

PubMed

Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

2017-10-01

Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

PubMed Central

Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

2011-01-01

The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

HuR binding to cytoplasmic mRNA is perturbed by heat shock

PubMed Central

Gallouzi, Imed-Eddine; Brennan, Christopher M.; Stenberg, Myrna G.; Swanson, Maurice S.; Eversole, Ashley; Maizels, Nancy; Steitz, Joan A.

2000-01-01

AU-rich elements (AREs) located in the 3′ untranslated region target the mRNAs encoding many protooncoproteins, cytokines, and lymphokines for rapid degradation. HuR, a ubiquitously expressed member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, binds ARE sequences and selectively stabilizes ARE-containing reporter mRNAs when overexpressed in transiently transfected cells. HuR appears predominantly nucleoplasmic but has been shown to shuttle between the nucleus and cytoplasm via a novel shuttling sequence HNS. We report generation of a mouse monoclonal antibody 3A2 that both immunoblots and immunoprecipitates HuR protein; it recognizes an epitope located in the first of HuR's three RNA recognition motifs. This antibody was used to probe HuR interactions with mRNA before and after heat shock, a condition that has been reported to stabilize ARE-containing mRNAs. At 37°C, approximately one-third of the cytoplasmic HuR appears polysome associated, and in vivo UV crosslinking reveals that HuR interactions with poly(A)+ RNA are predominantly cytoplasmic rather than nuclear. This comprises evidence that HuR directly interacts with mRNA in vivo. After heat shock, 12–15% of HuR accumulates in discrete foci in the cytoplasm, but surprisingly the majority of HuR crosslinks instead to nuclear poly(A)+ RNA, whose levels are dramatically increased in the stressed cells. This behavior of HuR differs from that of another ARE-binding protein, hnRNP D, which has been implicated as an effector of mRNA decay rather than mRNA stabilization and of the general pre-RNA-binding protein hnRNP A1. We interpret these differences to mean that the temporal association of HuR with ARE-containing mRNAs is different from that of these other two proteins. PMID:10737787

The Tyrosine Sulfate Domain of Fibromodulin Binds Collagen and Enhances Fibril Formation.

PubMed

Tillgren, Viveka; Mörgelin, Matthias; Önnerfjord, Patrik; Kalamajski, Sebastian; Aspberg, Anders

2016-11-04

Small leucine-rich proteoglycans interact with other extracellular matrix proteins and are important regulators of matrix assembly. Fibromodulin has a key role in connective tissues, binding collagen through two identified binding sites in its leucine-rich repeat domain and regulating collagen fibril formation in vitro and in vivo Some nine tyrosine residues in the fibromodulin N-terminal domain are O-sulfated, a posttranslational modification often involved in protein interactions. The N-terminal domain mimics heparin, binding proteins with clustered basic amino acid residues. Because heparin affects collagen fibril formation, we investigated whether tyrosine sulfate is involved in fibromodulin interactions with collagen. Using full-length fibromodulin and its N-terminal tyrosine-sulfated domain purified from tissue, as well as recombinant fibromodulin fragments, we found that the N-terminal domain binds collagen. The tyrosine-sulfated domain and the leucine-rich repeat domain both bound to three specific sites along the collagen type I molecule, at the N terminus and at 100 and 220 nm from the N terminus. The N-terminal domain shortened the collagen fibril formation lag phase and tyrosine sulfation was required for this effect. The isolated leucine-rich repeat domain inhibited the fibril formation rate, and full-length fibromodulin showed a combination of these effects. The fibrils formed in the presence of fibromodulin or its fragments showed more organized structure. Fibromodulin and its tyrosine sulfate domain remained bound on the formed fiber. Taken together, this suggests a novel, regulatory function for tyrosine sulfation in collagen interaction and control of fibril formation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Ni(ii)/Cu(ii)/Zn(ii) 5,5-diethylbarbiturate complexes with 1,10-phenanthroline and 2,2'-dipyridylamine: synthesis, structures, DNA/BSA binding, nuclease activity, molecular docking, cellular uptake, cytotoxicity and the mode of cell death.

PubMed

Yilmaz, Veysel T; Icsel, Ceyda; Suyunova, Feruza; Aygun, Muhittin; Aztopal, Nazlihan; Ulukaya, Engin

2016-06-21

New 5,5-diethylbarbiturate (barb) complexes of Ni(ii), Cu(ii) and Zn(ii) with 1,10-phenanthroline (phen) and 2,2'-dipyridylamine (dpya), namely [Ni(phen-κN,N')3]Cl(barb)·7H2O (), [Cu(barb-κN)(barb-κ(2)N,O)(phen-κN,N')]·H2O (), [Cu(barb-κN)2(phen-κN,N')] (), [Zn(barb-κN)2(phen-κN,N')]·H2O (), [Ni(barb-κ(2)N,O)(dpya-κN,N')2]Cl·2H2O (), [Cu(barb-κ(2)N,O)2(dpya-κN,N')]·2H2O () and [Zn(barb-κN)2(dpya-κN,N')] (), were synthesized and characterized by elemental analysis, UV-vis, FT-IR and ESI-MS. The structures of the complexes were determined by X-ray crystallography. Notably, and were fluorescent in MeOH : H2O at rt. The interaction of the complexes with fish sperm (FS) DNA and bovine serum albumin (BSA) was investigated in detail by various techniques. The complexes exhibited groove binding along with a partial intercalative interaction with DNA, while the hydrogen bonding and hydrophobic interactions played a major role in binding to BSA. It is noteworthy that exhibited the highest affinity towards DNA and BSA. Enzyme inhibition assay showed that show a preference for both A/T and G/C rich sequences in pUC19 DNA, while and display a binding specificity to the G/C and A/T rich regions, respectively. These findings were further supported by molecular docking. The cellular uptake studies suggested that was deposited mostly in the membrane fraction of the cells. Among the present complexes, exhibited a very strong cytotoxic effect on A549, MCF-7, HT-29 and DU-145 cancer cells, being more potent than cisplatin. Moreover, induces cell death through the apoptotic mode obtained by flow cytometry.

Characterization of Three Novel Fatty Acid- and Retinoid-Binding Protein Genes (Ha-far-1, Ha-far-2 and Hf-far-1) from the Cereal Cyst Nematodes Heterodera avenae and H. filipjevi.

PubMed

Qiao, Fen; Luo, Lilian; Peng, Huan; Luo, Shujie; Huang, Wenkun; Cui, Jiangkuan; Li, Xin; Kong, Lingan; Jiang, Daohong; Chitwood, David J; Peng, Deliang

2016-01-01

Heterodera avenae and H. filipjevi are major parasites of wheat, reducing production worldwide. Both are sedentary endoparasitic nematodes, and their development and parasitism depend strongly on nutrients obtained from hosts. Secreted fatty acid- and retinol-binding (FAR) proteins are nematode-specific lipid carrier proteins used for nutrient acquisition as well as suppression of plant defenses. In this study, we obtained three novel FAR genes Ha-far-1 (KU877266), Ha-far-2 (KU877267), Hf-far-1 (KU877268). Ha-far-1 and Ha-far-2 were cloned from H. avenae, encoding proteins of 191 and 280 amino acids with molecular masses about 17 and 30 kDa, respectively and sequence identity of 28%. Protein Blast in NCBI revealed that Ha-FAR-1 sequence is 78% similar to the Gp-FAR-1 protein from Globodera pallida, while Ha-FAR-2 is 30% similar to Rs-FAR-1 from Radopholus similis. Only one FAR protein Hf-FAR-1was identified in H. filipjevi; it had 96% sequence identity to Ha-FAR-1. The three proteins are alpha-helix-rich and contain the conserved domain of Gp-FAR-1, but Ha-FAR-2 had a remarkable peptide at the C-terminus which was random-coil-rich. Both Ha-FAR-1 and Hf-FAR-1 had casein kinase II phosphorylation sites, while Ha-FAR-2 had predicted N-glycosylation sites. Phylogenetic analysis showed that the three proteins clustered together, though Ha-FAR-1 and Hf-FAR-1 adjoined each other in a plant-parasitic nematode branch, but Ha-FAR-2 was distinct from the other proteins in the group. Fluorescence-based ligand binding analysis showed the three FAR proteins bound to a fluorescent fatty acid derivative and retinol and with dissociation constants similar to FARs from other species, though Ha-FAR-2 binding ability was weaker than that of the two others. In situ hybridization detected mRNAs of Ha-far-1 and Ha-far-2 in the hypodermis. The qRT-PCR results showed that the Ha-far-1and Ha-far-2 were expressed in all developmental stages; Ha-far-1 expressed 70 times more than Ha-far-2 in all stages. The highest expression level of Ha-far-1 was observed in fourth-stage juvenile (J4), whereas the highest expression level of Ha-far-2 occurred in second-stage juvenile (J2). In conclusion, we have identified two novel far genes from H. avenae and one from H. filipjevi and have provided further indication that nematode far genes are present in a variety of nematode species, where the FAR proteins share similar basic structure, expression pattern and biochemical activities.

Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

PubMed

Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

2015-07-01

The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

Solution structure, backbone dynamics and chitin binding of the anti-fungal protein from Streptomyces tendae TU901.

PubMed

Campos-Olivas, R; Hörr, I; Bormann, C; Jung, G; Gronenborn, A M

2001-05-11

AFP1 is a recently discovered anti-fungal, chitin-binding protein from Streptomyces tendae Tü901. Mature AFP1 comprises 86 residues and exhibits limited sequence similarity to the cellulose-binding domains of bacterial cellulases and xylanases. No similarity to the Cys and Gly-rich domains of plant chitin-binding proteins (e.g. agglutinins, lectins, hevein) is observed. AFP1 is the first chitin-binding protein from a bacterium for which anti-fungal activity was shown. Here, we report the three-dimensional solution structure of AFP1, determined by nuclear magnetic resonance spectroscopy. The protein contains two antiparallel beta-sheets (five and four beta-strands each), that pack against each other in a parallel beta-sandwich. This type of architecture is conserved in the functionally related family II of cellulose-binding domains, albeit with different connectivity. A similar fold is also observed in other unrelated proteins (spore coat protein from Myxococcus xanthus, beta-B2 and gamma-B crystallins from Bos taurus, canavalin from Jack bean). AFP1 is therefore classified as a new member of the betagamma-crystallin superfamily. The dynamics of the protein was characterized by NMR using amide 15N relaxation and solvent exchange data. We demonstrate that the protein exhibits an axially symmetric (oblate-like) rotational diffusion tensor whose principal axis coincides to within 15 degrees with that of the inertial tensor. After completion of the present structure of AFP1, an identical fold was reported for a Streptomyces killer toxin-like protein. Based on sequence comparisons and clustering of conserved residues on the protein surface for different cellulose and chitin-binding proteins, we postulate a putative sugar-binding site for AFP1. The inability of the protein to bind short chitin fragments suggests that certain particular architectural features of the solid chitin surface are crucial for the interaction. Copyright 2001 Academic Press.

Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

PubMed

Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

2011-09-23

Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity

PubMed Central

Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.

2017-01-01

Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111

Structural and Functional Studies of a Phosphatidic Acid-Binding Antifungal Plant Defensin MtDef4: Identification of an RGFRRR Motif Governing Fungal Cell Entry

PubMed Central

Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghu S.; Smith, Thomas J.; Shah, Dilip M.

2013-01-01

MtDef4 is a 47-amino acid cysteine-rich evolutionary conserved defensin from a model legume Medicago truncatula. It is an apoplast-localized plant defense protein that inhibits the growth of the ascomycetous fungal pathogen Fusarium graminearum in vitro at micromolar concentrations. Little is known about the mechanisms by which MtDef4 mediates its antifungal activity. In this study, we show that MtDef4 rapidly permeabilizes fungal plasma membrane and is internalized by the fungal cells where it accumulates in the cytoplasm. Furthermore, analysis of the structure of MtDef4 reveals the presence of a positively charged γ-core motif composed of β2 and β3 strands connected by a positively charged RGFRRR loop. Replacement of the RGFRRR sequence with AAAARR or RGFRAA abolishes the ability of MtDef4 to enter fungal cells, suggesting that the RGFRRR loop is a translocation signal required for the internalization of the protein. MtDef4 binds to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Amino acid substitutions in the RGFRRR sequence which abolish the ability of MtDef4 to enter fungal cells also impair its ability to bind PA. These findings suggest that MtDef4 is a novel antifungal plant defensin capable of entering into fungal cells and affecting intracellular targets and that these processes are mediated by the highly conserved cationic RGFRRR loop via its interaction with PA. PMID:24324798

CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

PubMed Central

Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

1995-01-01

Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

Heterologous Expression of Two Ferulic Acid Esterases from Penicillium Funiculosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knoshaug, E. P.; Selig, M. J.; Baker, J. O.

2008-01-01

Two recombinant ferulic acid esterases from Penicillium funiculosum produced in Aspergillus awamori were evaluated for their ability to improve the digestibility of pretreated corn stover. The genes, faeA and faeB, were cloned from P. funiculosum and expressed in A. awamori using their native signal sequences. Both enzymes contain a catalytic domain connected to a family 1 carbohydrate-binding module by a threonine-rich linker peptide. Interestingly, the carbohydrate binding-module is N-terminal in FaeA and C-terminal in FaeB. The enzymes were purified to homogeneity using column chromatography, and their thermal stability was characterized by differential scanning microcalorimetry. We evaluated both enzymes for theirmore » potential to enhance the cellulolytic activity of purified Trichoderma reesei Cel7A on pretreated corn stover.« less

Heterologous Expression of Two Ferulic Acid Esterases from Penicillium funiculosum

NASA Astrophysics Data System (ADS)

Knoshaug, Eric P.; Selig, Michael J.; Baker, John O.; Decker, Stephen R.; Himmel, Michael E.; Adney, William S.

Two recombinant ferulic acid esterases from Penicillium funiculosum produced in Aspergillus awamori were evaluated for their ability to improve the digestibility of pretreated corn stover. The genes, faeA and faeB, were cloned from P. funiculosum and expressed in A. awamori using their native signal sequences. Both enzymes contain a catalytic domain connected to a family 1 carbohydrate-binding module by a threonine-rich linker peptide. Interestingly, the carbohydrate binding-module is N-terminal in FaeA and C-terminal in FaeB. The enzymes were purified to homogeneity using column chromatography, and their thermal stability was characterized by differential scanning microcalorimetry. We evaluated both enzymes for their potential to enhance the cellulolytic activity of purified Trichoderma reesei Cel7A on pretreated corn stover.

Molecular interactions between single-stranded DNA-binding proteins associated with an essential MCAT element in the mouse smooth muscle alpha-actin promoter.

PubMed

Kelm, R J; Cogan, J G; Elder, P K; Strauch, A R; Getz, M J

1999-05-14

Transcriptional activity of the mouse vascular smooth muscle alpha-actin gene in fibroblasts is regulated, in part, by a 30-base pair asymmetric polypurine-polypyrimidine tract containing an essential MCAT enhancer motif. The double-stranded form of this sequence serves as a binding site for a transcription enhancer factor 1-related protein while the separated single strands interact with two distinct DNA binding activities termed VACssBF1 and 2 (Cogan, J. G., Sun, S., Stoflet, E. S., Schmidt, L. J., Getz, M. J., and Strauch, A. R. (1995) J. Biol. Chem. 270, 11310-11321; Sun, S., Stoflet, E. S., Cogan, J. G., Strauch, A. R., and Getz, M. J. (1995) Mol. Cell. Biol. 15, 2429-2936). VACssBF2 has been recently cloned and shown to consist of two closely related proteins, Puralpha and Purbeta (Kelm, R. J., Elder, P. K., Strauch, A. R., and Getz, M. J. (1997) J. Biol. Chem. 272, 26727-26733). In this study, we demonstrate that Puralpha and Purbeta interact with each other via highly specific protein-protein interactions and bind to the purine-rich strand of the MCAT enhancer in the form of both homo- and heteromeric complexes. Moreover, both Pur proteins interact with MSY1, a VACssBF1-like protein cloned by virtue of its affinity for the pyrimidine-rich strand of the enhancer. Interactions between Puralpha, Purbeta, and MSY1 do not require the participation of DNA. Combinatorial interactions between these three single-stranded DNA-binding proteins may be important in regulating activity of the smooth muscle alpha-actin MCAT enhancer in fibroblasts.

Insight into the coordination and the binding sites of Cu(2+) by the histidyl-6-tag using experimental and computational tools.

PubMed

Watly, Joanna; Simonovsky, Eyal; Wieczorek, Robert; Barbosa, Nuno; Miller, Yifat; Kozlowski, Henryk

2014-07-07

His-tags are specific sequences containing six to nine subsequent histydyl residues, and they are used for purification of recombinant proteins by use of IMAC chromatography. Such polyhistydyl tags, often used in molecular biology, can be also found in nature. Proteins containing histidine-rich domains play a critical role in many life functions in both prokaryote and eukaryote organisms. Binding mode and the thermodynamic properties of the system depend on the specific metal ion and the histidine sequence. Despite the wide application of the His-tag for purification of proteins, little is known about the properties of metal-binding to such tag domains. This inspired us to undertake detailed studies on the coordination of Cu(2+) ion to hexa-His-tag. Experiments were performed using the potentiometric, UV-visible, CD, and EPR techniques. In addition, molecular dynamics (MD) simulations and density functional theory (DFT) calculations were applied. The experimental studies have shown that the Cu(2+) ion binds most likely to two imidazoles and one, two, or three amide nitrogens, depending on the pH. The structures and stabilities of the complexes for the Cu(2+)-Ac-(His)6-NH2 system using experimental and computational tools were established. Polymorphic binding states are suggested, with a possibility of the formation of α-helix structure induced by metal ion coordination. Metal ion is bound to various pairs of imidazole moieties derived from the tag with different efficiencies. The coordination sphere around the metal ion is completed by molecules of water. Finally, the Cu(2+) binding by Ac-(His)6-NH2 is much more efficient compared to other multihistidine protein domains.

Modification of Streptococcus mutans Cnm by PgfS Contributes to Adhesion, Endothelial Cell Invasion, and Virulence

PubMed Central

Avilés-Reyes, Alejandro; Miller, James H.; Simpson-Haidaris, Patricia J.; Hagen, Fred K.

2014-01-01

Expression of the surface protein Cnm has been directly implicated in the ability of certain strains of Streptococcus mutans to bind to collagen and to invade human coronary artery endothelial cells (HCAEC) and in the killing of Galleria mellonella. Sequencing analysis of Cnm+ strains revealed that cnm is located between the core genes SMU.2067 and SMU.2069. Reverse transcription-PCR (RT-PCR) analysis showed that cnm is cotranscribed with SMU.2067, encoding a putative glycosyltransferase referred to here as PgfS (protein glycosyltransferase of streptococci). Notably, Cnm contains a threonine-rich domain predicted to undergo O-linked glycosylation. The previously shown abnormal migration pattern of Cnm, the presence of the threonine-rich domain, and the molecular linkage of cnm with pgfS lead us to hypothesize that PgfS modifies Cnm. A ΔpgfS strain showed defects in several traits associated with Cnm expression, including collagen binding, HCAEC invasion, and killing of G. mellonella. Western blot analysis revealed that Cnm from the ΔpgfS mutant migrated at a lower molecular weight than that from the parent strain. In addition, Cnm produced by ΔpgfS was highly susceptible to proteinase K degradation, in contrast to the high-molecular-weight Cnm version found in the parent strain. Lectin-binding analyses confirmed the glycosylated nature of Cnm and strongly suggested the presence of N-acetylglucosamine residues attached to Cnm. Based on these findings, the phenotypes observed in ΔpgfS are most likely associated with defects in Cnm glycosylation that affects protein function, stability, or both. In conclusion, this study demonstrates that Cnm is a glycoprotein and that posttranslational modification mediated by PgfS contributes to the virulence-associated phenotypes linked to Cnm. PMID:24837294

Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

PubMed Central

Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

2016-01-01

DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

The genome of melon (Cucumis melo L.)

PubMed Central

Garcia-Mas, Jordi; Benjak, Andrej; Sanseverino, Walter; Bourgeois, Michael; Mir, Gisela; González, Víctor M.; Hénaff, Elizabeth; Câmara, Francisco; Cozzuto, Luca; Lowy, Ernesto; Alioto, Tyler; Capella-Gutiérrez, Salvador; Blanca, Jose; Cañizares, Joaquín; Ziarsolo, Pello; Gonzalez-Ibeas, Daniel; Rodríguez-Moreno, Luis; Droege, Marcus; Du, Lei; Alvarez-Tejado, Miguel; Lorente-Galdos, Belen; Melé, Marta; Yang, Luming; Weng, Yiqun; Navarro, Arcadi; Marques-Bonet, Tomas; Aranda, Miguel A.; Nuez, Fernando; Picó, Belén; Gabaldón, Toni; Roma, Guglielmo; Guigó, Roderic; Casacuberta, Josep M.; Arús, Pere; Puigdomènech, Pere

2012-01-01

We report the genome sequence of melon, an important horticultural crop worldwide. We assembled 375 Mb of the double-haploid line DHL92, representing 83.3% of the estimated melon genome. We predicted 27,427 protein-coding genes, which we analyzed by reconstructing 22,218 phylogenetic trees, allowing mapping of the orthology and paralogy relationships of sequenced plant genomes. We observed the absence of recent whole-genome duplications in the melon lineage since the ancient eudicot triplication, and our data suggest that transposon amplification may in part explain the increased size of the melon genome compared with the close relative cucumber. A low number of nucleotide-binding site–leucine-rich repeat disease resistance genes were annotated, suggesting the existence of specific defense mechanisms in this species. The DHL92 genome was compared with that of its parental lines allowing the quantification of sequence variability in the species. The use of the genome sequence in future investigations will facilitate the understanding of evolution of cucurbits and the improvement of breeding strategies. PMID:22753475

Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of Rat Liver-Derived Cell Lines

DTIC Science & Technology

2010-05-22

member B8 Blue 1370939_at Acsl1 acyl-CoA synthetase long-chain family member 1 Yellow 1372006_at --- --- Blue 1372101_at Ppap2b phosphatidic acid ...Stress L-ascorbic Acid Binding Cation Binding Identical Protein Binding Protein Dimerization Activity Dioxygenase Activity Oxidoreductase...Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts, and proteins. Nucleic Acid Research. 35: D61-65. Ryter SW

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

G-Boxes, Bigfoot Genes, and Environmental Response: Characterization of Intragenomic Conserved Noncoding Sequences in Arabidopsis[W

PubMed Central

Freeling, Michael; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Thomas, Brian C.

2007-01-01

A tetraploidy left Arabidopsis thaliana with 6358 pairs of homoeologs that, when aligned, generated 14,944 intragenomic conserved noncoding sequences (CNSs). Our previous work assembled these phylogenetic footprints into a database. We show that known transcription factor (TF) binding motifs, including the G-box, are overrepresented in these CNSs. A total of 254 genes spanning long lengths of CNS-rich chromosomes (Bigfoot) dominate this database. Therefore, we made subdatabases: one containing Bigfoot genes and the other containing genes with three to five CNSs (Smallfoot). Bigfoot genes are generally TFs that respond to signals, with their modal CNS positioned 3.1 kb 5′ from the ATG. Smallfoot genes encode components of signal transduction machinery, the cytoskeleton, or involve transcription. We queried each subdatabase with each possible 7-nucleotide sequence. Among hundreds of hits, most were purified from CNSs, and almost all of those significantly enriched in CNSs had no experimental history. The 7-mers in CNSs are not 5′- to 3′-oriented in Bigfoot genes but are often oriented in Smallfoot genes. CNSs with one G-box tend to have two G-boxes. CNSs were shared with the homoeolog only and with no other gene, suggesting that binding site turnover impedes detection. Bigfoot genes may function in adaptation to environmental change. PMID:17496117

G-boxes, bigfoot genes, and environmental response: characterization of intragenomic conserved noncoding sequences in Arabidopsis.

PubMed

Freeling, Michael; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Thomas, Brian C

2007-05-01

A tetraploidy left Arabidopsis thaliana with 6358 pairs of homoeologs that, when aligned, generated 14,944 intragenomic conserved noncoding sequences (CNSs). Our previous work assembled these phylogenetic footprints into a database. We show that known transcription factor (TF) binding motifs, including the G-box, are overrepresented in these CNSs. A total of 254 genes spanning long lengths of CNS-rich chromosomes (Bigfoot) dominate this database. Therefore, we made subdatabases: one containing Bigfoot genes and the other containing genes with three to five CNSs (Smallfoot). Bigfoot genes are generally TFs that respond to signals, with their modal CNS positioned 3.1 kb 5' from the ATG. Smallfoot genes encode components of signal transduction machinery, the cytoskeleton, or involve transcription. We queried each subdatabase with each possible 7-nucleotide sequence. Among hundreds of hits, most were purified from CNSs, and almost all of those significantly enriched in CNSs had no experimental history. The 7-mers in CNSs are not 5'- to 3'-oriented in Bigfoot genes but are often oriented in Smallfoot genes. CNSs with one G-box tend to have two G-boxes. CNSs were shared with the homoeolog only and with no other gene, suggesting that binding site turnover impedes detection. Bigfoot genes may function in adaptation to environmental change.

Computer-Aided Design of RNA Origami Structures.

PubMed

Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

2017-01-01

RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

Unlocking hidden genomic sequence

PubMed Central

Keith, Jonathan M.; Cochran, Duncan A. E.; Lala, Gita H.; Adams, Peter; Bryant, Darryn; Mitchelson, Keith R.

2004-01-01

Despite the success of conventional Sanger sequencing, significant regions of many genomes still present major obstacles to sequencing. Here we propose a novel approach with the potential to alleviate a wide range of sequencing difficulties. The technique involves extracting target DNA sequence from variants generated by introduction of random mutations. The introduction of mutations does not destroy original sequence information, but distributes it amongst multiple variants. Some of these variants lack problematic features of the target and are more amenable to conventional sequencing. The technique has been successfully demonstrated with mutation levels up to an average 18% base substitution and has been used to read previously intractable poly(A), AT-rich and GC-rich motifs. PMID:14973330

Maximum entropy methods for extracting the learned features of deep neural networks.

PubMed

Finnegan, Alex; Song, Jun S

2017-10-01

New architectures of multilayer artificial neural networks and new methods for training them are rapidly revolutionizing the application of machine learning in diverse fields, including business, social science, physical sciences, and biology. Interpreting deep neural networks, however, currently remains elusive, and a critical challenge lies in understanding which meaningful features a network is actually learning. We present a general method for interpreting deep neural networks and extracting network-learned features from input data. We describe our algorithm in the context of biological sequence analysis. Our approach, based on ideas from statistical physics, samples from the maximum entropy distribution over possible sequences, anchored at an input sequence and subject to constraints implied by the empirical function learned by a network. Using our framework, we demonstrate that local transcription factor binding motifs can be identified from a network trained on ChIP-seq data and that nucleosome positioning signals are indeed learned by a network trained on chemical cleavage nucleosome maps. Imposing a further constraint on the maximum entropy distribution also allows us to probe whether a network is learning global sequence features, such as the high GC content in nucleosome-rich regions. This work thus provides valuable mathematical tools for interpreting and extracting learned features from feed-forward neural networks.

HIV-1 Tat binds to SH3 domains: cellular and viral outcome of Tat/Grb2 interaction

PubMed Central

Rom, Slava; Pacifici, Marco; Passiatore, Giovanni; Aprea, Susanna; Waligorska, Agnieszka; Valle, Luis Del; Peruzzi, Francesca

2011-01-01

The Src-homology 3 (SH3) domain is one of the most frequent protein recognition modules (PRMs), being represented in signal transduction pathways and in several pathologies such as cancer and AIDS. Grb2 (growth factor receptor-bound protein 2) is an adaptor protein that contains two SH3 domains and is involved in receptor tyrosine kinase (RTK) signal transduction pathways. The HIV-1 transactivator factor Tat is required for viral replication and it has been shown to bind directly or indirectly to several host proteins, deregulating their functions. In this study, we show interaction between the cellular factor Grb2 and the HIV-1 trans-activating protein Tat. The binding is mediated by the proline-rich sequence of Tat and the SH3 domain of Grb2. As the adaptor protein Grb2 participates in a wide variety of signaling pathways, we characterized at least one of the possible downstream effects of the Tat/Grb2 interaction on the well-known IGF-1R/Raf/MAPK cascade. We show that the binding of Tat to Grb2 impairs activation of the Raf/MAPK pathway, while potentiating the PKA/Raf inhibitory pathway. The Tat/Grb2 interaction affects also viral function by inhibiting the Tat-mediated transactivation of HIV-1 LTR and viral replication in infected primary microglia. PMID:21745501

Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

PubMed

Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

2005-08-05

The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

Galectins are human milk glycan receptors

PubMed Central

Noll, Alexander J; Gourdine, Jean-Philippe; Yu, Ying; Lasanajak, Yi; Smith, David F; Cummings, Richard D

2016-01-01

The biological recognition of human milk glycans (HMGs) is poorly understood. Because HMGs are rich in galactose we explored whether they might interact with human galectins, which bind galactose-containing glycans and are highly expressed in epithelial cells and other cell types. We screened a number of human galectins for their binding to HMGs on a shotgun glycan microarray consisting of 247 HMGs derived from human milk, as well as to a defined HMG microarray. Recombinant human galectins (hGal)-1, -3, -4, -7, -8 and -9 bound selectively to glycans, with each galectin recognizing a relatively unique binding motif; by contrast hGal-2 did not recognize HMGs, but did bind to the human blood group A Type 2 determinants on other microarrays. Unlike other galectins, hGal-7 preferentially bound to glycans expressing a terminal Type 1 (Galβ1-3GlcNAc) sequence, a motif that had eluded detection on non-HMG glycan microarrays. Interactions with HMGs were confirmed in a solution setting by isothermal titration microcalorimetry and hapten inhibition experiments. These results demonstrate that galectins selectively bind to HMGs and suggest the possibility that galectin–HMG interactions may play a role in infant immunity. PMID:26747425

Use of eluted peptide sequence data to identify the binding characteristics of peptides to the insulin-dependent diabetes susceptibility allele HLA-DQ8 (DQ 3.2).

PubMed

Godkin, A; Friede, T; Davenport, M; Stevanovic, S; Willis, A; Jewell, D; Hill, A; Rammensee, H G

1997-06-01

HLA-DQ8 (A1*0301, B1*0302) and -DQ2 (A1*0501, B1*0201) are both associated with diseases such as insulin-dependent diabetes mellitus and coeliac disease. We used the technique of pool sequencing to look at the requirements of peptides binding to HLA-DQ8, and combined these data with naturally sequenced ligands and in vitro binding assays to describe a novel motif for HLA-DQ8. The motif, which has the same basic format as many HLA-DR molecules, consists of four or five anchor regions, in the positions from the N-terminus of the binding core of n, n + 3, n + 5/6 and n + 8, i.e. P1, P4, P6/7 and P9. P1 and P9 require negative or polar residues, with mainly aliphatic residues at P4 and P6/7. The features of the HLA-DQ8 motif were then compared to a pool sequence of peptides eluted from HLA-DQ2. A consensus motif for the binding of a common peptide which may be involved in disease pathogenesis is described. Neither of the disease-associated alleles HLA-DQ2 and -DQ8 have Asp at position 57 of the beta-chain. This Asp, if present, may form a salt bridge with an Arg at position 79 of the alpha-chain and so alter the binding specificity of P9. HLA-DQ2 and -DQ8 both appear to prefer negatively charged amino acids at P9. In contrast, HLA-DQ7 (A1*0301, B1*0301), which is not associated with diabetes, has Asp at beta 57, allowing positively charged amino acids at P9. This analysis of the sequence features of DQ-binding peptides suggests molecular characteristics which may be useful to predict epitopes involved in disease pathogenesis.

cWINNOWER algorithm for finding fuzzy dna motifs

NASA Technical Reports Server (NTRS)

Liang, S.; Samanta, M. P.; Biegel, B. A.

2004-01-01

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if a clique consisting of a sufficiently large number of mutated copies of the motif (i.e., the signals) is present in the DNA sequence. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum detectable clique size qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12,000 for (l, d) = (15, 4). Copyright Imperial College Press.

cWINNOWER Algorithm for Finding Fuzzy DNA Motifs

NASA Technical Reports Server (NTRS)

Liang, Shoudan

2003-01-01

The cWINNOWER algorithm detects fuzzy motifs in DNA sequences rich in protein-binding signals. A signal is defined as any short nucleotide pattern having up to d mutations differing from a motif of length l. The algorithm finds such motifs if multiple mutated copies of the motif (i.e., the signals) are present in the DNA sequence in sufficient abundance. The cWINNOWER algorithm substantially improves the sensitivity of the winnower method of Pevzner and Sze by imposing a consensus constraint, enabling it to detect much weaker signals. We studied the minimum number of detectable motifs qc as a function of sequence length N for random sequences. We found that qc increases linearly with N for a fast version of the algorithm based on counting three-member sub-cliques. Imposing consensus constraints reduces qc, by a factor of three in this case, which makes the algorithm dramatically more sensitive. Our most sensitive algorithm, which counts four-member sub-cliques, needs a minimum of only 13 signals to detect motifs in a sequence of length N = 12000 for (l,d) = (15,4).

GSK3β phosphorylates newly identified site in the proline-alanine-rich region of cardiac myosin-binding protein C and alters cross-bridge cycling kinetics in human: short communication.

PubMed

Kuster, Diederik W D; Sequeira, Vasco; Najafi, Aref; Boontje, Nicky M; Wijnker, Paul J M; Witjas-Paalberends, E Rosalie; Marston, Steven B; Dos Remedios, Cristobal G; Carrier, Lucie; Demmers, Jeroen A A; Redwood, Charles; Sadayappan, Sakthivel; van der Velden, Jolanda

2013-02-15

Cardiac myosin-binding protein C (cMyBP-C) regulates cross-bridge cycling kinetics and, thereby, fine-tunes the rate of cardiac muscle contraction and relaxation. Its effects on cardiac kinetics are modified by phosphorylation. Three phosphorylation sites (Ser275, Ser284, and Ser304) have been identified in vivo, all located in the cardiac-specific M-domain of cMyBP-C. However, recent work has shown that up to 4 phosphate groups are present in human cMyBP-C. To identify and characterize additional phosphorylation sites in human cMyBP-C. Cardiac MyBP-C was semipurified from human heart tissue. Tandem mass spectrometry analysis identified a novel phosphorylation site on serine 133 in the proline-alanine-rich linker sequence between the C0 and C1 domains of cMyBP-C. Unlike the known sites, Ser133 was not a target of protein kinase A. In silico kinase prediction revealed glycogen synthase kinase 3β (GSK3β) as the most likely kinase to phosphorylate Ser133. In vitro incubation of the C0C2 fragment of cMyBP-C with GSK3β showed phosphorylation on Ser133. In addition, GSK3β phosphorylated Ser304, although the degree of phosphorylation was less compared with protein kinase A-induced phosphorylation at Ser304. GSK3β treatment of single membrane-permeabilized human cardiomyocytes significantly enhanced the maximal rate of tension redevelopment. GSK3β phosphorylates cMyBP-C on a novel site, which is positioned in the proline-alanine-rich region and increases kinetics of force development, suggesting a noncanonical role for GSK3β at the sarcomere level. Phosphorylation of Ser133 in the linker domain of cMyBP-C may be a novel mechanism to regulate sarcomere kinetics.

G-quadruplex-interacting compounds alter latent DNA replication and episomal persistence of KSHV.

PubMed

Madireddy, Advaitha; Purushothaman, Pravinkumar; Loosbroock, Christopher P; Robertson, Erle S; Schildkraut, Carl L; Verma, Subhash C

2016-05-05

Kaposi's sarcoma associated herpesvirus (KSHV) establishes life-long latent infection by persisting as an extra-chromosomal episome in the infected cells and by maintaining its genome in dividing cells. KSHV achieves this by tethering its epigenome to the host chromosome by latency associated nuclear antigen (LANA), which binds in the terminal repeat (TR) region of the viral genome. Sequence analysis of the TR, a GC-rich DNA element, identified several potential Quadruplex G-Rich Sequences (QGRS). Since quadruplexes have the tendency to obstruct DNA replication, we used G-quadruplex stabilizing compounds to examine their effect on latent DNA replication and the persistence of viral episomes. Our results showed that these G-quadruplex stabilizing compounds led to the activation of dormant origins of DNA replication, with preferential bi-directional pausing of replications forks moving out of the TR region, implicating the role of the G-rich TR in the perturbation of episomal DNA replication. Over time, treatment with PhenDC3 showed a loss of viral episomes in the infected cells. Overall, these data show that G-quadruplex stabilizing compounds retard the progression of replication forks leading to a reduction in DNA replication and episomal maintenance. These results suggest a potential role for G-quadruplex stabilizers in the treatment of KSHV-associated diseases. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

Solution Model of the Intrinsically Disordered Polyglutamine Tract-Binding Protein-1

PubMed Central

Rees, Martin; Gorba, Christian; de Chiara, Cesira; Bui, Tam T.T.; Garcia-Maya, Mitla; Drake, Alex F.; Okazawa, Hitoshi; Pastore, Annalisa; Svergun, Dmitri; Chen, Yu Wai

2012-01-01

Polyglutamine tract-binding protein-1 (PQBP-1) is a 265-residue nuclear protein that is involved in transcriptional regulation. In addition to its role in the molecular pathology of the polyglutamine expansion diseases, mutations of the protein are associated with X-linked mental retardation. PQBP-1 binds specifically to glutamine repeat sequences and proline-rich regions, and interacts with RNA polymerase II and the spliceosomal protein U5-15kD. In this work, we obtained a biophysical characterization of this protein by employing complementary structural methods. PQBP-1 is shown to be a moderately compact but largely disordered molecule with an elongated shape, having a Stokes radius of 3.7 nm and a maximum molecular dimension of 13 nm. The protein is monomeric in solution, has residual β-structure, and is in a premolten globule state that is unaffected by natural osmolytes. Using small-angle x-ray scattering data, we were able to generate a low-resolution, three-dimensional model of PQBP-1. PMID:22500761

Copper metallothioneins.

PubMed

Calvo, Jenifer; Jung, Hunmin; Meloni, Gabriele

2017-04-01

Metallothioneins (MTs) are a class of low molecular weight and cysteine-rich metal binding proteins present in all the branches of the tree of life. MTs efficiently bind with high affinity several essential and toxic divalent and monovalent transition metals by forming characteristic polynuclear metal-thiolate clusters within their structure. MTs fulfil multiple biological functions related to their metal binding properties, with essential roles in both Zn(II) and Cu(I) homeostasis as well as metal detoxification. Depending on the organism considered, the primary sequence, and the specific physiological and metabolic status, Cu(I)-bound MT isoforms have been isolated, and their chemistry and biology characterized. Besides the recognized role in the biochemistry of divalent metals, it is becoming evident that unique biological functions in selectively controlling copper levels, its reactivity as well as copper-mediated biochemical processes have evolved in some members of the MT superfamily. Selected examples are reviewed to highlight the peculiar chemical properties and biological functions of copper MTs. © 2016 IUBMB Life, 69(4):236-245, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

PubMed

Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

2014-06-01

RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

PubMed

Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

2017-09-30

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species

PubMed Central

Andersen, Ethan J.; Neupane, Surendra; Benson, Benjamin V.

2017-01-01

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis, we investigated nTNL orthologs in the genomes of common bean, Medicago, soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis, common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence. PMID:28973974

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

PubMed Central

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

Molecular and functional characterization of Toll-like receptor (Tlr)1 and Tlr2 in common carp (Cyprinus carpio).

PubMed

Fink, Inge R; Pietretti, Danilo; Voogdt, Carlos G P; Westphal, Adrie H; Savelkoul, Huub F J; Forlenza, Maria; Wiegertjes, Geert F

2016-09-01

Toll-like receptors (TLRs) are fundamental components of innate immunity that play significant roles in the defence against pathogen invasion. In this study, we present the molecular characterization of the full-length coding sequence of tlr1, tlr2a and tlr2b from common carp (Cyprinus carpio). Each is encoded within a single exon and contains a conserved number of leucine-rich repeats, a transmembrane region and an intracellular TIR domain for signalling. Indeed, sequence, phylogenetic and synteny analysis of carp tlr1, tlr2a and tlr2b support that these genes are orthologues of mammalian TLR1 and TLR2. The tlr genes are expressed in various immune organs and cell types. Furthermore, the carp sequences exhibited a good three-dimensional fit with the heterodimer structure of human TLR1-TLR2, including the potential to bind to the ligand Pam3CSK4. This supports the possible formation of carp Tlr1-Tlr2 heterodimers. However, we were unable to demonstrate Tlr1/Tlr2-mediated ligand binding in transfected cell lines through NF-κB activation, despite showing the expression and co-localization of Tlr1 and Tlr2. We discuss possible limitations when studying ligand-specific activation of NF-κB after expression of Tlr1 and/or Tlr2 in human but also fish cell lines and we propose alternative future strategies for studying ligand-binding properties of fish Tlrs. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Ca(2+) -complex stability of GAPAGPLIVPY peptide in gas and aqueous phase, investigated by affinity capillary electrophoresis and molecular dynamics simulations and compared to mass spectrometric results.

PubMed

Nachbar, Markus; El Deeb, Sami; Mozafari, Mona; Alhazmi, Hassan A; Preu, Lutz; Redweik, Sabine; Lehmann, Wolf Dieter; Wätzig, Hermann

2016-03-01

Strong, sequence-specific gas-phase bindings between proline-rich peptides and alkaline earth metal ions in nanoESI-MS experiments were reported by Lehmann et al. (Rapid Commun. Mass Spectrom. 2006, 20, 2404-2410), however its relevance for physiological-like aqueous phase is uncertain. Therefore, the complexes should also be studied in aqueous solution and the relevance of the MS method for binding studies be evaluated. A mobility shift ACE method was used for determining the binding between the small peptide GAPAGPLIVPY and various metal ions in aqueous solution. The findings were compared to the MS results and further explained using computational methods. While the MS data showed a strong alkaline earth ion binding, the ACE results showed nonsignificant binding. The proposed vacuum state complex also decomposed during a molecular dynamic simulation in aqueous solution. This study shows that the formed stable peptide-metal ion adducts in the gas phase by ESI-MS does not imply the existence of analogous adducts in the aqueous phase. Comparing peptide-metal ion interaction under the gaseous MS and aqueous ACE conditions showed huge difference in binding behavior. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

NASA Astrophysics Data System (ADS)

Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

2015-02-01

In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Comparative genomics and evolution of the amylase-binding proteins of oral streptococci.

PubMed

Haase, Elaine M; Kou, Yurong; Sabharwal, Amarpreet; Liao, Yu-Chieh; Lan, Tianying; Lindqvist, Charlotte; Scannapieco, Frank A

2017-04-20

Successful commensal bacteria have evolved to maintain colonization in challenging environments. The oral viridans streptococci are pioneer colonizers of dental plaque biofilm. Some of these bacteria have adapted to life in the oral cavity by binding salivary α-amylase, which hydrolyzes dietary starch, thus providing a source of nutrition. Oral streptococcal species bind α-amylase by expressing a variety of amylase-binding proteins (ABPs). Here we determine the genotypic basis of amylase binding where proteins of diverse size and function share a common phenotype. ABPs were detected in culture supernatants of 27 of 59 strains representing 13 oral Streptococcus species screened using the amylase-ligand binding assay. N-terminal sequences from ABPs of diverse size were obtained from 18 strains representing six oral streptococcal species. Genome sequencing and BLAST searches using N-terminal sequences, protein size, and key words identified the gene associated with each ABP. Among the sequenced ABPs, 14 matched amylase-binding protein A (AbpA), 6 matched amylase-binding protein B (AbpB), and 11 unique ABPs were identified as peptidoglycan-binding, glutamine ABC-type transporter, hypothetical, or choline-binding proteins. Alignment and phylogenetic analyses performed to ascertain evolutionary relationships revealed that ABPs cluster into at least six distinct, unrelated families (AbpA, AbpB, and four novel ABPs) with no phylogenetic evidence that one group evolved from another, and no single ancestral gene found within each group. AbpA-like sequences can be divided into five subgroups based on the N-terminal sequences. Comparative genomics focusing on the abpA gene locus provides evidence of horizontal gene transfer. The acquisition of an ABP by oral streptococci provides an interesting example of adaptive evolution.

Changes in the folding landscape of the WW domain provide a molecular mechanism for an inherited genetic syndrome

PubMed Central

Pucheta-Martinez, Encarna; D’Amelio, Nicola; Lelli, Moreno; Martinez-Torrecuadrada, Jorge L.; Sudol, Marius; Saladino, Giorgio; Gervasio, Francesco Luigi

2016-01-01

WW domains are small domains present in many human proteins with a wide array of functions and acting through the recognition of proline-rich sequences. The WW domain belonging to polyglutamine tract-binding protein 1 (PQBP1) is of particular interest due to its direct involvement in several X chromosome-linked intellectual disabilities, including Golabi-Ito-Hall (GIH) syndrome, where a single point mutation (Y65C) correlates with the development of the disease. The mutant cannot bind to its natural ligand WBP11, which regulates mRNA processing. In this work we use high-field high-resolution NMR and enhanced sampling molecular dynamics simulations to gain insight into the molecular causes the disease. We find that the wild type protein is partially unfolded exchanging among multiple beta-strand-like conformations in solution. The Y65C mutation further destabilizes the residual fold and primes the protein for the formation of a disulphide bridge, which could be at the origin of the loss of function. PMID:27456546

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-08-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals

PubMed Central

2008-01-01

Background The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) α, β and γ subunits. Further investigation of 14 α-like (Abpa) and 13 β- or γ-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Results Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. Conclusion We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification. PMID:18269759

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

PubMed

Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

2008-02-12

The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

Efficient Identification of Murine M2 Macrophage Peptide Targeting Ligands by Phage Display and Next-Generation Sequencing.

PubMed

Liu, Gary W; Livesay, Brynn R; Kacherovsky, Nataly A; Cieslewicz, Maryelise; Lutz, Emi; Waalkes, Adam; Jensen, Michael C; Salipante, Stephen J; Pun, Suzie H

2015-08-19

Peptide ligands are used to increase the specificity of drug carriers to their target cells and to facilitate intracellular delivery. One method to identify such peptide ligands, phage display, enables high-throughput screening of peptide libraries for ligands binding to therapeutic targets of interest. However, conventional methods for identifying target binders in a library by Sanger sequencing are low-throughput, labor-intensive, and provide a limited perspective (<0.01%) of the complete sequence space. Moreover, the small sample space can be dominated by nonspecific, preferentially amplifying "parasitic sequences" and plastic-binding sequences, which may lead to the identification of false positives or exclude the identification of target-binding sequences. To overcome these challenges, we employed next-generation Illumina sequencing to couple high-throughput screening and high-throughput sequencing, enabling more comprehensive access to the phage display library sequence space. In this work, we define the hallmarks of binding sequences in next-generation sequencing data, and develop a method that identifies several target-binding phage clones for murine, alternatively activated M2 macrophages with a high (100%) success rate: sequences and binding motifs were reproducibly present across biological replicates; binding motifs were identified across multiple unique sequences; and an unselected, amplified library accurately filtered out parasitic sequences. In addition, we validate the Multiple Em for Motif Elicitation tool as an efficient and principled means of discovering binding sequences.

A Non-Invasive NMR Method Based on Histidine Imidazoles to Analyze the pH-Modulation of Protein-Nucleic Acid Interfaces.

PubMed

Cruz-Gallardo, Isabel; Del Conte, Rebecca; Velázquez-Campoy, Adrián; García-Mauriño, Sofía M; Díaz-Moreno, Irene

2015-05-11

A useful (2) J(N-H) coupling-based NMR spectroscopic approach is proposed to unveil, at the molecular level, the contribution of the imidazole groups of histidines from RNA/DNA-binding proteins on the modulation of binding to nucleic acids by pH. Such protonation/deprotonation events have been monitored on the single His96 located at the second RNA/DNA recognition motif (RRM2) of T-cell intracellular antigen-1 (TIA-1) protein. The pKa values of the His96 ionizable groups were substantially higher in the complexes with short U-rich RNA and T-rich DNA oligonucleotides than those of the isolated TIA-1 RRM2. Herein, the methodology applied to determine changes in pKa of histidine side chains upon DNA/RNA binding, gives valuable information to understand the pH effect on multidomain DNA/RNA-binding proteins that shuttle among different cellular compartments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Optimizing Illumina next-generation sequencing library preparation for extremely AT-biased genomes.

PubMed

Oyola, Samuel O; Otto, Thomas D; Gu, Yong; Maslen, Gareth; Manske, Magnus; Campino, Susana; Turner, Daniel J; Macinnis, Bronwyn; Kwiatkowski, Dominic P; Swerdlow, Harold P; Quail, Michael A

2012-01-03

Massively parallel sequencing technology is revolutionizing approaches to genomic and genetic research. Since its advent, the scale and efficiency of Next-Generation Sequencing (NGS) has rapidly improved. In spite of this success, sequencing genomes or genomic regions with extremely biased base composition is still a great challenge to the currently available NGS platforms. The genomes of some important pathogenic organisms like Plasmodium falciparum (high AT content) and Mycobacterium tuberculosis (high GC content) display extremes of base composition. The standard library preparation procedures that employ PCR amplification have been shown to cause uneven read coverage particularly across AT and GC rich regions, leading to problems in genome assembly and variation analyses. Alternative library-preparation approaches that omit PCR amplification require large quantities of starting material and hence are not suitable for small amounts of DNA/RNA such as those from clinical isolates. We have developed and optimized library-preparation procedures suitable for low quantity starting material and tolerant to extremely high AT content sequences. We have used our optimized conditions in parallel with standard methods to prepare Illumina sequencing libraries from a non-clinical and a clinical isolate (containing ~53% host contamination). By analyzing and comparing the quality of sequence data generated, we show that our optimized conditions that involve a PCR additive (TMAC), produces amplified libraries with improved coverage of extremely AT-rich regions and reduced bias toward GC neutral templates. We have developed a robust and optimized Next-Generation Sequencing library amplification method suitable for extremely AT-rich genomes. The new amplification conditions significantly reduce bias and retain the complexity of either extremes of base composition. This development will greatly benefit sequencing clinical samples that often require amplification due to low mass of DNA starting material.

Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

PubMed Central

Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

2016-01-01

Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

MutaBind estimates and interprets the effects of sequence variants on protein-protein interactions.

PubMed

Li, Minghui; Simonetti, Franco L; Goncearenco, Alexander; Panchenko, Anna R

2016-07-08

Proteins engage in highly selective interactions with their macromolecular partners. Sequence variants that alter protein binding affinity may cause significant perturbations or complete abolishment of function, potentially leading to diseases. There exists a persistent need to develop a mechanistic understanding of impacts of variants on proteins. To address this need we introduce a new computational method MutaBind to evaluate the effects of sequence variants and disease mutations on protein interactions and calculate the quantitative changes in binding affinity. The MutaBind method uses molecular mechanics force fields, statistical potentials and fast side-chain optimization algorithms. The MutaBind server maps mutations on a structural protein complex, calculates the associated changes in binding affinity, determines the deleterious effect of a mutation, estimates the confidence of this prediction and produces a mutant structural model for download. MutaBind can be applied to a large number of problems, including determination of potential driver mutations in cancer and other diseases, elucidation of the effects of sequence variants on protein fitness in evolution and protein design. MutaBind is available at http://www.ncbi.nlm.nih.gov/projects/mutabind/. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

PubMed

Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

2017-07-18

Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-02-15

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed Central

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-01-01

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation

PubMed Central

Huska, Matthew R.; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R.; Schwahn, Kevin; Cooper, Samantha B.; Yamamoto, Keith R.; Thomas-Chollier, Morgane; Vingron, Martin

2017-01-01

Abstract The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter–proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. PMID:27903902

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The Drosophila Tis11 protein and its effects on mRNA expression in flies.

PubMed

Choi, Youn-Jeong; Lai, Wi S; Fedic, Robert; Stumpo, Deborah J; Huang, Weichun; Li, Leping; Perera, Lalith; Brewer, Brandy Y; Wilson, Gerald M; Mason, James M; Blackshear, Perry J

2014-12-19

Members of the mammalian tristetraprolin family of CCCH tandem zinc finger proteins can bind to certain AU-rich elements (AREs) in mRNAs, leading to their deadenylation and destabilization. Mammals express three or four members of this family, but Drosophila melanogaster and other insects appear to contain a single gene, Tis11. We found that recombinant Drosophila Tis11 protein could bind to ARE-containing RNA oligonucleotides with low nanomolar affinity. Remarkably, co-expression in mammalian cells with "target" RNAs demonstrated that Tis11 could promote destabilization of ARE-containing mRNAs and that this was partially dependent on a conserved C-terminal sequence resembling the mammalian NOT1 binding domain. Drosophila Tis11 promoted both deadenylation and decay of a target transcript in this heterologous cell system. We used chromosome deletion/duplication and P element insertion to produce two types of Tis11 deficiency in adult flies, both of which were viable and fertile. To address the hypothesis that Tis11 deficiency would lead to the abnormal accumulation of potential target transcripts, we analyzed gene expression in adult flies by deep mRNA sequencing. We identified 69 transcripts from 56 genes that were significantly up-regulated more than 1.5-fold in both types of Tis11-deficient flies. Ten of the up-regulated transcripts encoded probable proteases, but many other functional classes of proteins were represented. Many of the up-regulated transcripts contained potential binding sites for tristetraprolin family member proteins that were conserved in other Drosophila species. Tis11 is thus an ARE-binding, mRNA-destabilizing protein that may play a role in post-transcriptional gene expression in Drosophila and other insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The Drosophila Tis11 Protein and Its Effects on mRNA Expression in Flies*

PubMed Central

Choi, Youn-Jeong; Lai, Wi S.; Fedic, Robert; Stumpo, Deborah J.; Huang, Weichun; Li, Leping; Perera, Lalith; Brewer, Brandy Y.; Wilson, Gerald M.; Mason, James M.; Blackshear, Perry J.

2014-01-01

Members of the mammalian tristetraprolin family of CCCH tandem zinc finger proteins can bind to certain AU-rich elements (AREs) in mRNAs, leading to their deadenylation and destabilization. Mammals express three or four members of this family, but Drosophila melanogaster and other insects appear to contain a single gene, Tis11. We found that recombinant Drosophila Tis11 protein could bind to ARE-containing RNA oligonucleotides with low nanomolar affinity. Remarkably, co-expression in mammalian cells with “target” RNAs demonstrated that Tis11 could promote destabilization of ARE-containing mRNAs and that this was partially dependent on a conserved C-terminal sequence resembling the mammalian NOT1 binding domain. Drosophila Tis11 promoted both deadenylation and decay of a target transcript in this heterologous cell system. We used chromosome deletion/duplication and P element insertion to produce two types of Tis11 deficiency in adult flies, both of which were viable and fertile. To address the hypothesis that Tis11 deficiency would lead to the abnormal accumulation of potential target transcripts, we analyzed gene expression in adult flies by deep mRNA sequencing. We identified 69 transcripts from 56 genes that were significantly up-regulated more than 1.5-fold in both types of Tis11-deficient flies. Ten of the up-regulated transcripts encoded probable proteases, but many other functional classes of proteins were represented. Many of the up-regulated transcripts contained potential binding sites for tristetraprolin family member proteins that were conserved in other Drosophila species. Tis11 is thus an ARE-binding, mRNA-destabilizing protein that may play a role in post-transcriptional gene expression in Drosophila and other insects. PMID:25342740

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

A pH-sensitive heparin-binding sequence from Baculovirus gp64 protein is important for binding to mammalian cells but not to Sf9 insect cells.

PubMed

Wu, Chunxiao; Wang, Shu

2012-01-01

Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.

Galectin-3 in angiogenesis and metastasis

PubMed Central

Funasaka, Tatsuyoshi; Raz, Avraham; Nangia-Makker, Pratima

2014-01-01

Galectin-3 is a member of the family of β-galactoside-binding lectins characterized by evolutionarily conserved sequences defined by structural similarities in their carbohydrate-recognition domains. Galectin-3 is a unique, chimeric protein consisting of three distinct structural motifs: (i) a short NH2 terminal domain containing a serine phosphorylation site; (ii) a repetitive proline-rich collagen-α-like sequence cleavable by matrix metalloproteases; and (iii) a globular COOH-terminal domain containing a carbohydrate-binding motif and an NWGR anti-death motif. It is ubiquitously expressed and has diverse biological functions depending on its subcellular localization. Galectin-3 is mainly found in the cytoplasm, also seen in the nucleus and can be secreted by non-classical, secretory pathways. In general, secreted galectin-3 mediates cell migration, cell adhesion and cell–cell interactions through the binding with high affinity to galactose-containing glycoproteins on the cell surface. Cytoplasmic galectin-3 exhibits anti-apoptotic activity and regulates several signal transduction pathways, whereas nuclear galectin-3 has been associated with pre-mRNA splicing and gene expression. Its unique chimeric structure enables it to interact with a plethora of ligands and modulate diverse functions such as cell growth, adhesion, migration, invasion, angiogenesis, immune function, apoptosis and endocytosis emphasizing its significance in the process of tumor progression. In this review, we have focused on the role of galectin-3 in tumor metastasis with special emphasis on angiogenesis. PMID:25138305

Conserved interdomain linker promotes phase separation of the multivalent adaptor protein Nck

PubMed Central

Banjade, Sudeep; Wu, Qiong; Mittal, Anuradha; Peeples, William B.; Pappu, Rohit V.; Rosen, Michael K.

2015-01-01

The organization of membranes, the cytosol, and the nucleus of eukaryotic cells can be controlled through phase separation of lipids, proteins, and nucleic acids. Collective interactions of multivalent molecules mediated by modular binding domains can induce gelation and phase separation in several cytosolic and membrane-associated systems. The adaptor protein Nck has three SRC-homology 3 (SH3) domains that bind multiple proline-rich segments in the actin regulatory protein neuronal Wiskott-Aldrich syndrome protein (N-WASP) and an SH2 domain that binds to multiple phosphotyrosine sites in the adhesion protein nephrin, leading to phase separation. Here, we show that the 50-residue linker between the first two SH3 domains of Nck enhances phase separation of Nck/N-WASP/nephrin assemblies. Two linear motifs within this element, as well as its overall positively charged character, are important for this effect. The linker increases the driving force for self-assembly of Nck, likely through weak interactions with the second SH3 domain, and this effect appears to promote phase separation. The linker sequence is highly conserved, suggesting that the sequence determinants of the driving forces for phase separation may be generally important to Nck functions. Our studies demonstrate that linker regions between modular domains can contribute to the driving forces for self-assembly and phase separation of multivalent proteins. PMID:26553976

GuiTope: an application for mapping random-sequence peptides to protein sequences.

PubMed

Halperin, Rebecca F; Stafford, Phillip; Emery, Jack S; Navalkar, Krupa Arun; Johnston, Stephen Albert

2012-01-03

Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC) at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs

PubMed Central

Morita, Teppei; Nishino, Ryo; Aiba, Hiroji

2017-01-01

Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3′ end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. PMID:28606943

An Immunogram for the Cancer-Immunity Cycle: Towards Personalized Immunotherapy of Lung Cancer.

PubMed

Karasaki, Takahiro; Nagayama, Kazuhiro; Kuwano, Hideki; Nitadori, Jun-Ichi; Sato, Masaaki; Anraku, Masaki; Hosoi, Akihiro; Matsushita, Hirokazu; Morishita, Yasuyuki; Kashiwabara, Kosuke; Takazawa, Masaki; Ohara, Osamu; Kakimi, Kazuhiro; Nakajima, Jun

2017-05-01

The interaction of immune cells and cancer cells shapes the immunosuppressive tumor microenvironment. For successful cancer immunotherapy, comprehensive knowledge of antitumor immunity as a dynamic spatiotemporal process is required for each individual patient. To this end, we developed an immunogram for the cancer-immunity cycle by using next-generation sequencing. Whole exome sequencing and RNA sequencing were performed in 20 patients with NSCLC (12 with adenocarcinoma, seven with squamous cell carcinoma, and one with large cell neuroendocrine carcinoma). Mutated neoantigens and cancer germline antigens expressed in the tumor were assessed for predicted binding to patients' human leukocyte antigen molecules. The expression of genes related to cancer immunity was assessed and normalized to construct a radar chart composed of eight axes reflecting seven steps in the cancer-immunity cycle. Three immunogram patterns were observed in patients with lung cancer: T-cell-rich, T-cell-poor, and intermediate. The T-cell-rich pattern was characterized by gene signatures of abundant T cells, regulatory T cells, myeloid-derived suppressor cells, checkpoint molecules, and immune-inhibitory molecules in the tumor, suggesting the presence of antitumor immunity dampened by an immunosuppressive microenvironment. The T-cell-poor phenotype reflected lack of antitumor immunity, inadequate dendritic cell activation, and insufficient antigen presentation in the tumor. Immunograms for both the patients with adenocarcinoma and the patients with nonadenocarcinoma tumors included both T-cell-rich and T-cell-poor phenotypes, suggesting that histologic type does not necessarily reflect the cancer immunity status of the tumor. The patient-specific landscape of the tumor microenvironment can be appreciated by using immunograms as integrated biomarkers, which may thus become a valuable resource for optimal personalized immunotherapy. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Sp1 upregulates the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes.

PubMed

Watanabe, Keijirou; Hida, Mariko; Sasaki, Takako; Yano, Hiroyuki; Kawano, Kenji; Yoshioka, Hidekatsu; Matsuo, Noritaka

2016-02-01

Type XI collagen is a cartilage-specific extracellular matrix, and is important for collagen fibril formation and skeletal morphogenesis. We have previously reported that NF-Y regulated the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes (Hida et. al. In Vitro Cell. Dev. Biol. Anim. 2014). However, the mechanism of the Col11a1 gene regulation in chondrocytes has not been fully elucidated. In this study, we further characterized the proximal promoter activity of the mouse Col11a1 gene in chondrocytes. Cell transfection experiments with deletion and mutation constructs indicated that the downstream region of the NF-Y binding site (-116 to +1) is also necessary to regulate the proximal promoter activity of the mouse Col11a1 gene. This minimal promoter region has no TATA box and GC-rich sequence; we therefore examined whether the GC-rich sequence (-96 to -67) is necessary for the transcription regulation of the Col11a1 gene. Luciferase assays using a series of mutation constructs exhibited that the GC-rich sequence is a critical element of Col11a1 promoter activity in chondrocytes. Moreover, in silico analysis of this region suggested that one of the most effective candidates was transcription factor Sp1. Consistent with the prediction, overexpression of Sp1 significantly increased the promoter activity. Furthermore, knockdown of Sp1 expression by siRNA transfection suppressed the proximal promoter activity and the expression of endogenous transcript of the mouse Col11a1 gene. Taken together, these results indicate that the transcription factor Sp1 upregulates the proximal promoter activity of the mouse Col11a1 gene in chondrocytes.

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

PubMed

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-22

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

NASA Astrophysics Data System (ADS)

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-01

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

Site-specific labeling of RNA at internal ribose hydroxyl groups: terbium-assisted deoxyribozymes at work.

PubMed

Büttner, Lea; Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

2014-06-04

A general and efficient single-step method was established for site-specific post-transcriptional labeling of RNA. Using Tb(3+) as accelerating cofactor for deoxyribozymes, various labeled guanosines were site-specifically attached to 2'-OH groups of internal adenosines in in vitro transcribed RNA. The DNA-catalyzed 2',5'-phosphodiester bond formation proceeded efficiently with fluorescent, spin-labeled, biotinylated, or cross-linker-modified guanosine triphosphates. The sequence context of the labeling site was systematically analyzed by mutating the nucleotides flanking the targeted adenosine. Labeling of adenosines in a purine-rich environment showed the fastest reactions and highest yields. Overall, practically useful yields >70% were obtained for 13 out of 16 possible nucleotide (nt) combinations. Using this approach, we demonstrate preparative labeling under mild conditions for up to ~160-nt-long RNAs, including spliceosomal U6 small nuclear RNA and a cyclic-di-AMP binding riboswitch RNA.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Sequence-specific binding of counterions to B-DNA

PubMed Central

Denisov, Vladimir P.; Halle, Bertil

2000-01-01

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Preferential binding of daunomycin to 5'ATCG and 5'ATGC sequences revealed by footprinting titration experiments.

PubMed

Chaires, J B; Herrera, J E; Waring, M J

1990-07-03

Results from a high-resolution deoxyribonuclease I (DNase I) footprinting titration procedure are described that identify preferred daunomycin binding sites within the 160 bp tyr T DNA fragment. We have obtained single-bond resolution at 65 of the 160 potential binding sites within the tyr T fragment and have examined the effect of 0-3.0 microM total daunomycin concentration on the susceptibility of these sites toward digestion by DNase I. Four types of behavior are observed: (i) protection from DNase I cleavage; (ii) protection, but only after reaching a critical total daunomycin concentration; (iii) enhanced cleavage; (iv) no effect of added drug. Ten sites were identified as the most strongly protected on the basis of the magnitude of the reduction of their digestion product band areas in the presence of daunomycin. These were identified as the preferred daunomycin binding sites. Seven of these 10 sites are found at the end of the triplet sequences 5'ATGC and 5'ATCG, where the notation AT indicates that either A or T may occupy the position. The remaining three strongly protected sites are found at the ends of the triplet sequence 5'ATCAT. Of the preferred daunomycin binding sites we identify in this study, the sequence 5'ATCG is consistent with the specificity predicted by the theoretical studies of Chen et al. [Chen, K.-X., Gresh, N., & Pullman, B. (1985) J. Biomol. Struct. Dyn. 3, 445-466] and is the very sequence to which daunomycin is observed to be bound in two recent X-ray crystallographic studies. Solution studies, theoretical studies, and crystallographic studies have thus converged to provide a consistent and coherent picture of the sequence preference of this important anticancer antibiotic.

DNA sequence-specific dimeric bisbenzimidazoles DBP(n) and DBPA(n) as inhibitors of H-NS silencing in bacterial cells.

PubMed

Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B

2018-03-01

DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.

Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

PubMed Central

Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

2007-01-01

Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

The visualCMAT: A web-server to select and interpret correlated mutations/co-evolving residues in protein families.

PubMed

Suplatov, Dmitry; Sharapova, Yana; Timonina, Daria; Kopylov, Kirill; Švedas, Vytas

2018-04-01

The visualCMAT web-server was designed to assist experimental research in the fields of protein/enzyme biochemistry, protein engineering, and drug discovery by providing an intuitive and easy-to-use interface to the analysis of correlated mutations/co-evolving residues. Sequence and structural information describing homologous proteins are used to predict correlated substitutions by the Mutual information-based CMAT approach, classify them into spatially close co-evolving pairs, which either form a direct physical contact or interact with the same ligand (e.g. a substrate or a crystallographic water molecule), and long-range correlations, annotate and rank binding sites on the protein surface by the presence of statistically significant co-evolving positions. The results of the visualCMAT are organized for a convenient visual analysis and can be downloaded to a local computer as a content-rich all-in-one PyMol session file with multiple layers of annotation corresponding to bioinformatic, statistical and structural analyses of the predicted co-evolution, or further studied online using the built-in interactive analysis tools. The online interactivity is implemented in HTML5 and therefore neither plugins nor Java are required. The visualCMAT web-server is integrated with the Mustguseal web-server capable of constructing large structure-guided sequence alignments of protein families and superfamilies using all available information about their structures and sequences in public databases. The visualCMAT web-server can be used to understand the relationship between structure and function in proteins, implemented at selecting hotspots and compensatory mutations for rational design and directed evolution experiments to produce novel enzymes with improved properties, and employed at studying the mechanism of selective ligand's binding and allosteric communication between topologically independent sites in protein structures. The web-server is freely available at https://biokinet.belozersky.msu.ru/visualcmat and there are no login requirements.

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Characterization of Three Novel Fatty Acid- and Retinoid-Binding Protein Genes (Ha-far-1, Ha-far-2 and Hf-far-1) from the Cereal Cyst Nematodes Heterodera avenae and H. filipjevi

PubMed Central

Peng, Huan; Luo, Shujie; Huang, Wenkun; Cui, Jiangkuan; Li, Xin; Kong, Lingan; Jiang, Daohong; Chitwood, David J.; Peng, Deliang

2016-01-01

Heterodera avenae and H. filipjevi are major parasites of wheat, reducing production worldwide. Both are sedentary endoparasitic nematodes, and their development and parasitism depend strongly on nutrients obtained from hosts. Secreted fatty acid- and retinol-binding (FAR) proteins are nematode-specific lipid carrier proteins used for nutrient acquisition as well as suppression of plant defenses. In this study, we obtained three novel FAR genes Ha-far-1 (KU877266), Ha-far-2 (KU877267), Hf-far-1 (KU877268). Ha-far-1 and Ha-far-2 were cloned from H. avenae, encoding proteins of 191 and 280 amino acids with molecular masses about 17 and 30 kDa, respectively and sequence identity of 28%. Protein Blast in NCBI revealed that Ha-FAR-1 sequence is 78% similar to the Gp-FAR-1 protein from Globodera pallida, while Ha-FAR-2 is 30% similar to Rs-FAR-1 from Radopholus similis. Only one FAR protein Hf-FAR-1was identified in H. filipjevi; it had 96% sequence identity to Ha-FAR-1. The three proteins are alpha-helix-rich and contain the conserved domain of Gp-FAR-1, but Ha-FAR-2 had a remarkable peptide at the C-terminus which was random-coil-rich. Both Ha-FAR-1 and Hf-FAR-1 had casein kinase II phosphorylation sites, while Ha-FAR-2 had predicted N-glycosylation sites. Phylogenetic analysis showed that the three proteins clustered together, though Ha-FAR-1 and Hf-FAR-1 adjoined each other in a plant-parasitic nematode branch, but Ha-FAR-2 was distinct from the other proteins in the group. Fluorescence-based ligand binding analysis showed the three FAR proteins bound to a fluorescent fatty acid derivative and retinol and with dissociation constants similar to FARs from other species, though Ha-FAR-2 binding ability was weaker than that of the two others. In situ hybridization detected mRNAs of Ha-far-1 and Ha-far-2 in the hypodermis. The qRT-PCR results showed that the Ha-far-1and Ha-far-2 were expressed in all developmental stages; Ha-far-1 expressed 70 times more than Ha-far-2 in all stages. The highest expression level of Ha-far-1 was observed in fourth-stage juvenile (J4), whereas the highest expression level of Ha-far-2 occurred in second-stage juvenile (J2). In conclusion, we have identified two novel far genes from H. avenae and one from H. filipjevi and have provided further indication that nematode far genes are present in a variety of nematode species, where the FAR proteins share similar basic structure, expression pattern and biochemical activities. PMID:27479008

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Efficient DNA binding and nuclear uptake by distamycin derivatives conjugated to octa-arginine sequences.

PubMed

Vázquez, Olalla; Blanco-Canosa, Juan B; Vázquez, M Eugenio; Martínez-Costas, Jose; Castedo, Luis; Mascareñas, José L

2008-11-24

Efficient targeting of DNA by designed molecules requires not only careful fine-tuning of their DNA-recognition properties, but also appropriate cell internalization of the compounds so that they can reach the cell nucleus in a short period of time. Previous observations in our group on the relatively high affinity displayed by conjugates between distamycin derivatives and bZIP basic regions for A-rich DNA sites, led us to investigate whether the covalent attachment of a positively charged cell-penetrating peptide to a distamycin-like tripyrrole might yield high affinity DNA binders with improved cell internalization properties. Our work has led to the discovery of synthetic tripyrrole-octa-arginine conjugates that are capable of targeting specific DNA sites that contain A-rich tracts with low nanomolar affinity; they simultaneously exhibit excellent membrane and nuclear translocation properties in living HeLa cells.

Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee Jialing; Klase, Zachary; Gao Xiaoqi

An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J.more » Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription.« less

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Binding constants of phenylalanine for the four mononucleotides

NASA Technical Reports Server (NTRS)

Khaled, M. A.; Mullins, D. W., Jr.; Lacey, J. C., Jr.

1984-01-01

Earlier work has shown that several properties of amino acids correlate directly with properties of their anticodonic nucleotides. Furthermore, in precipitation studies with thermal proteinoids and homopolyribonucleotides, an anticodonic preference was displayed between Lys-rich, Pro-rich and Gly-rich thermal proteinoids and their anticodonic polyribonucleotides. However, Phe-rich thermal proteinoid displayed a preference for its codonic nucleotide, poly U. This inconsistency seemed to be explained by a folding in of the hydrophobic residues of Phe causing the proteinoid to appear more hydrophilic. The present work used nuclear magnetic resonance techniques to resolve a limited question: to which of the four nucleotides does Phe bind most strongly? The results show quite clearly that Phe binds most strongly to its anticodonic nucleotide, AMP.

Augmenting β-augmentation: structural basis of how BamB binds BamA and may support folding of outer membrane proteins.

PubMed

Heuck, Alexander; Schleiffer, Alexander; Clausen, Tim

2011-03-11

β-Barrel proteins are frequently found in the outer membrane of mitochondria, chloroplasts and Gram-negative bacteria. In Escherichia coli, these proteins are inserted in the outer membrane by the Bam (β-barrel assembly machinery) complex, a multiprotein machinery formed by the β-barrel protein BamA and the four peripheral membrane proteins BamB, BamC, BamD and BamE. The periplasmic part of BamA binds prefolded β-barrel proteins by a β-augmentation mechanism, thereby stabilizing the precursors prior to their membrane insertion. However, the role of the associated proteins within the Bam complex remains unknown. Here, we describe the crystal structure of BamB, a nonessential component of the Bam complex. The structure shows a typical eight-bladed β-propeller fold. Two sequence stretches of BamB were previously identified to be important for interaction with BamA. In our structure, both motifs are located in close proximity to each other and contribute to a conserved region forming a narrow groove on the top of the propeller. Moreover, crystal contacts reveal two interaction modes of how BamB might bind unfolded β-barrel proteins. In the crystal lattice, BamB binds to exposed β-strands by β-augmentation, whereas peptide stretches rich in aromatic residues can be accommodated in hydrophobic pockets located at the bottom of the propeller. Thus, BamB could simultaneously bind to BamA and prefolded β-barrel proteins, thereby enhancing the folding and membrane insertion capability of the Bam complex. Copyright © 2011 Elsevier Ltd. All rights reserved.

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Global regulation of alternative RNA splicing by the SR-rich protein RBM39.

PubMed

Mai, Sanyue; Qu, Xiuhua; Li, Ping; Ma, Qingjun; Cao, Cheng; Liu, Xuan

2016-08-01

RBM39 is a serine/arginine-rich RNA-binding protein that is highly homologous to the splicing factor U2AF65. However, the role of RBM39 in alternative splicing is poorly understood. In this study, RBM39-mediated global alternative splicing was investigated using RNA-Seq and genome-wide RBM39-RNA interactions were mapped via cross-linking and immunoprecipitation coupled with deep sequencing (CLIP-Seq) in wild-type and RBM39-knockdown MCF-7 cells. RBM39 was involved in the up- or down-regulation of the transcript levels of various genes. Hundreds of alternative splicing events regulated by endogenous RBM39 were identified. The majority of these events were cassette exons. Genes containing RBM39-regulated alternative exons were found to be linked to G2/M transition, cellular response to DNA damage, adherens junctions and endocytosis. CLIP-Seq analysis showed that the binding site of RBM39 was mainly in proximity to 5' and 3' splicing sites. Considerable RBM39 binding to mRNAs encoding proteins involved in translation was observed. Of particular importance, ~20% of the alternative splicing events that were significantly regulated by RBM39 were similarly regulated by U2AF65. RBM39 is extensively involved in alternative splicing of RNA and helps regulate transcript levels. RBM39 may modulate alternative splicing similarly to U2AF65 by either directly binding to RNA or recruiting other splicing factors, such as U2AF65. The current study offers a genome-wide view of RBM39's regulatory function in alternative splicing. RBM39 may play important roles in multiple cellular processes by regulating both alternative splicing of RNA molecules and transcript levels. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of polyproline II regions derived from the proline-rich nuclear receptor coactivators PNRC and PNRC2: new insights for ERα coactivator interactions.

PubMed

Byrne, C; Miclet, E; Broutin, I; Gallo, D; Pelekanou, V; Kampa, M; Castanas, E; Leclercq, G; Jacquot, Y

2013-10-01

Protein-protein interactions are crucial for signal transductions required for cell differentiation and proliferation. Their modulation is therefore key to the development of therapeutic alternatives, particularly in the context of cancer. According to literature data, the polyproline-rich nuclear receptor coactivators PNRC and PNRC2 interact with estrogen receptor (ERα) through their PxxP SH3-binding motifs. In a search to identify the molecular features governing this interaction, we explored using electronic circular dichroism (ECD) spectroscopy and molecular dynamics (MD) calculations, the capacity of a range of putative biologically active peptides derived from these proteins and containing this PxxP motif(s) to form polyproline II (PPII) domains. An additional more exhaustive structural study on a lead PPII peptide was also performed using 2D nuclear magnetic resonance (NMR) spectroscopy. With the exception of one of all the investigated peptides (PNRC-D), binding assays failed to detect any affinity for Grb2 SH3 domains, suggesting that PPII motifs issued from Grb2 antagonists have a binding mode distinct from those derived from Grb2 agonists. Instead, the peptides revealed a competitive binding ability against a synthetic peptide (ERα17p) with a putative PPII-cognate domain located within a coregulator recruitment region of ERα (AF-2 site). Our work, which constitutes the first structure-related interaction study concerning PNRC and PNRC2, supports not only the existence of PxxP-induced PPII sequences in these coregulators, but also confirms the presence of a PPII recognition site in the AF-2 of the steroid receptor ERα, a region important for transcription regulation. © 2013 Wiley Periodicals, Inc.

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

PubMed

Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

2015-01-01

Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

Use of Chimeras, Point Mutants, and Molecular Modeling to Map the Antagonist-binding Site of 4,4′,4″,4‴-(Carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic Acid (NF449) at P2X1 Receptors for ATP*

PubMed Central

Farmer, Louise K.; Schmid, Ralf; Evans, Richard J.

2015-01-01

P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. PMID:25425641

Use of chimeras, point mutants, and molecular modeling to map the antagonist-binding site of 4,4',4″,4‴-(carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic acid (NF449) at P2X1 receptors for ATP.

PubMed

Farmer, Louise K; Schmid, Ralf; Evans, Richard J

2015-01-16

P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed Central

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-01-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

PubMed Central

Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

1997-01-01

A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

Identification of amino acids in the nicotinic acetylcholine receptor agonist binding site and ion channel photolabeled by 4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine, a novel photoaffinity antagonist.

PubMed

Chiara, David C; Trinidad, Jonathan C; Wang, Dong; Ziebell, Michael R; Sullivan, Deirdre; Cohen, Jonathan B

2003-01-21

[(3)H]4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine (TDBzcholine) was synthesized and used as a photoaffinity probe to map the orientation of an aromatic choline ester within the agonist binding sites of the Torpedo nicotinic acetylcholine receptor (nAChR). TDBzcholine acts as a nAChR competitive antagonist that binds at equilibrium with equal affinity to both agonist sites (K(D) approximately 10 microM). Upon UV irradiation (350 nm), nAChR-rich membranes equilibrated with [(3)H]TDBzcholine incorporate (3)H into the alpha, gamma, and delta subunits in an agonist-inhibitable manner. The specific residues labeled by [(3)H]TDBzcholine were determined by N-terminal sequence analysis of subunit fragments produced by enzymatic cleavage and purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and/or reversed-phase high-performance liquid chromatography. For the alpha subunit, [(3)H]TDBzcholine photoincorporated into alphaCys-192, alphaCys-193, and alphaPro-194. For the gamma and delta subunits, [(3)H]TDBzcholine incorporated into homologous leucine residues, gammaLeu-109 and deltaLeu-111. The photolabeling of these amino acids suggests that when the antagonist TDBzcholine occupies the agonist binding sites, the Cys-192-193 disulfide and Pro-194 from the alpha subunit Segment C are oriented toward the agonist site and are in proximity to gammaLeu-109/deltaLeu-111 in Segment E, a conclusion consistent with the structure of the binding site in the molluscan acetylcholine binding protein, a soluble protein that is homologous to the nAChR extracellular domain.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.

PubMed

Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl

2017-01-01

Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

A TATA binding protein mutant with increased affinity for DNA directs transcription from a reversed TATA sequence in vivo.

PubMed

Spencer, J Vaughn; Arndt, Karen M

2002-12-01

The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.

Selective turnover of p62/A170/SQSTM1 by autophagy.

PubMed

Ichimura, Yoshinobu; Kominami, Eiki; Tanaka, Keiji; Komatsu, Masaaki

2008-11-01

Loss of autophagy causes liver injury, cardiomyopathy and neurodegeneration, associated with the formation of ubiquitin-positive inclusion bodies. However, the pathogenic mechanism and molecular machinery involved in inclusion formation are not fully understood. We recently identified a ubiquitin-binding protein, p62/A170/SQSTM1, as a molecule involved in inclusion formation. p62 interacts with LC3 which regulates autophagosome formation, through an 11 amino acid sequence rich in acidic and hydrophobic residues, named the LC3-recognition sequence (LRS), and the LC3-p62 complex is degraded by autophagy. Furthermore, structural analysis reveals an interaction of Trp-340 and Leu-343 of p62 with different hydrophobic pockets in the ubiquitin-fold of LC3. p62 mutants, defective in binding the LRS, escape efficient turnover by autophagy, forming ubiquitin- and p62-positive inclusions. Importantly, such ubiquitin- and p62-positive inclusions are identified in various human diseases, implying the involvement of autophagy in their pathogenic mechanisms. Our reports identify an important role for autophagy in the selective turnover of p62, and demonstrate that in addition to the essential role of LC3 in autophagosome formation, LC3 is also involved in sorting autophagy-specific substrate(s).

Principles for computational design of binding antibodies

PubMed Central

Pszolla, M. Gabriele; Lapidoth, Gideon D.; Norn, Christoffer; Dym, Orly; Unger, Tamar; Albeck, Shira; Tyka, Michael D.; Fleishman, Sarel J.

2017-01-01

Natural proteins must both fold into a stable conformation and exert their molecular function. To date, computational design has successfully produced stable and atomically accurate proteins by using so-called “ideal” folds rich in regular secondary structures and almost devoid of loops and destabilizing elements, such as cavities. Molecular function, such as binding and catalysis, however, often demands nonideal features, including large and irregular loops and buried polar interaction networks, which have remained challenging for fold design. Through five design/experiment cycles, we learned principles for designing stable and functional antibody variable fragments (Fvs). Specifically, we (i) used sequence-design constraints derived from antibody multiple-sequence alignments, and (ii) during backbone design, maintained stabilizing interactions observed in natural antibodies between the framework and loops of complementarity-determining regions (CDRs) 1 and 2. Designed Fvs bound their ligands with midnanomolar affinities and were as stable as natural antibodies, despite having >30 mutations from mammalian antibody germlines. Furthermore, crystallographic analysis demonstrated atomic accuracy throughout the framework and in four of six CDRs in one design and atomic accuracy in the entire Fv in another. The principles we learned are general, and can be implemented to design other nonideal folds, generating stable, specific, and precise antibodies and enzymes. PMID:28973872

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

PubMed Central

Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

2012-01-01

Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

PubMed

Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

PubMed Central

Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

Functional characterisation of the Schizosaccharomyces pombe homologue of the leukaemia-associated translocation breakpoint binding protein translin and its binding partner, TRAX.

PubMed

Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J

2008-02-01

Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.

Structure of Rot, a global regulator of virulence genes in Staphylococcus aureus.

PubMed

Zhu, Yuwei; Fan, Xiaojiao; Zhang, Xu; Jiang, Xuguang; Niu, Liwen; Teng, Maikun; Li, Xu

2014-09-01

Staphylococcus aureus is a highly versatile pathogen that can infect human tissue by producing a large arsenal of virulence factors that are tightly regulated by a complex regulatory network. Rot, which shares sequence similarity with SarA homologues, is a global regulator that regulates numerous virulence genes. However, the recognition model of Rot for the promoter region of target genes and the putative regulation mechanism remain elusive. In this study, the 1.77 Å resolution X-ray crystal structure of Rot is reported. The structure reveals that two Rot molecules form a compact homodimer, each of which contains a typical helix-turn-helix module and a β-hairpin motif connected by a flexible loop. Fluorescence polarization results indicate that Rot preferentially recognizes AT-rich dsDNA with ~30-base-pair nucleotides and that the conserved positively charged residues on the winged-helix motif are vital for binding to the AT-rich dsDNA. It is proposed that the DNA-recognition model of Rot may be similar to that of SarA, SarR and SarS, in which the helix-turn-helix motifs of each monomer interact with the major grooves of target dsDNA and the winged motifs contact the minor grooves. Interestingly, the structure shows that Rot adopts a novel dimerization model that differs from that of other SarA homologues. As expected, perturbation of the dimer interface abolishes the dsDNA-binding ability of Rot, suggesting that Rot functions as a dimer. In addition, the results have been further confirmed in vivo by measuring the transcriptional regulation of α-toxin, a major virulence factor produced by most S. aureus strains.

GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

PubMed Central

Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.

2014-01-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708

GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

PubMed

Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

2014-03-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

In Vivo Ligands of MDA5 and RIG-I in Measles Virus-Infected Cells

PubMed Central

Hembach, Katharina; Baum, Alina; García-Sastre, Adolfo; Söding, Johannes; Conzelmann, Karl-Klaus

2014-01-01

RIG-I-like receptors (RLRs: RIG-I, MDA5 and LGP2) play a major role in the innate immune response against viral infections and detect patterns on viral RNA molecules that are typically absent from host RNA. Upon RNA binding, RLRs trigger a complex downstream signaling cascade resulting in the expression of type I interferons and proinflammatory cytokines. In the past decade extensive efforts were made to elucidate the nature of putative RLR ligands. In vitro and transfection studies identified 5′-triphosphate containing blunt-ended double-strand RNAs as potent RIG-I inducers and these findings were confirmed by next-generation sequencing of RIG-I associated RNAs from virus-infected cells. The nature of RNA ligands of MDA5 is less clear. Several studies suggest that double-stranded RNAs are the preferred agonists for the protein. However, the exact nature of physiological MDA5 ligands from virus-infected cells needs to be elucidated. In this work, we combine a crosslinking technique with next-generation sequencing in order to shed light on MDA5-associated RNAs from human cells infected with measles virus. Our findings suggest that RIG-I and MDA5 associate with AU-rich RNA species originating from the mRNA of the measles virus L gene. Corresponding sequences are poorer activators of ATP-hydrolysis by MDA5 in vitro, suggesting that they result in more stable MDA5 filaments. These data provide a possible model of how AU-rich sequences could activate type I interferon signaling. PMID:24743923

Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

PubMed Central

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2016-01-01

Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation.

PubMed

Love, Michael I; Huska, Matthew R; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R; Schwahn, Kevin; Cooper, Samantha B; Yamamoto, Keith R; Thomas-Chollier, Morgane; Vingron, Martin; Meijsing, Sebastiaan H

2017-02-28

The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter-proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Frog secretions and hunting magic in the upper Amazon: identification of a peptide that interacts with an adenosine receptor.

PubMed Central

Daly, J W; Caceres, J; Moni, R W; Gusovsky, F; Moos, M; Seamon, K B; Milton, K; Myers, C W

1992-01-01

A frog used for "hunting magic" by several groups of Panoan-speaking Indians in the borderline between Brazil and Peru is identified as Phyllomedusa bicolor. This frog's skin secretion, which the Indians introduce into the body through fresh burns, is rich in peptides. These include vasoactive peptides, opioid peptides, and a peptide that we have named adenoregulin, with the sequence GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAV as determined from mass spectrometry and Edman degradation. The natural peptide may contain a D amino acid residue, since it is not identical in chromatographic properties to the synthetic peptide. Adenoregulin enhances binding of agonists to A1 adenosine receptors; it is accompanied in the skin secretion by peptides that inhibit binding. The vasoactive peptide sauvagine, the opioid peptides, and adenoregulin and related peptides affect behavior in mice and presumably contribute to the behavioral sequelae observed in humans. Images PMID:1438301

Frog secretions and hunting magic in the upper Amazon: identification of a peptide that interacts with an adenosine receptor.

PubMed

Daly, J W; Caceres, J; Moni, R W; Gusovsky, F; Moos, M; Seamon, K B; Milton, K; Myers, C W

1992-11-15

A frog used for "hunting magic" by several groups of Panoan-speaking Indians in the borderline between Brazil and Peru is identified as Phyllomedusa bicolor. This frog's skin secretion, which the Indians introduce into the body through fresh burns, is rich in peptides. These include vasoactive peptides, opioid peptides, and a peptide that we have named adenoregulin, with the sequence GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAV as determined from mass spectrometry and Edman degradation. The natural peptide may contain a D amino acid residue, since it is not identical in chromatographic properties to the synthetic peptide. Adenoregulin enhances binding of agonists to A1 adenosine receptors; it is accompanied in the skin secretion by peptides that inhibit binding. The vasoactive peptide sauvagine, the opioid peptides, and adenoregulin and related peptides affect behavior in mice and presumably contribute to the behavioral sequelae observed in humans.

The surface glycoprotein of a natural feline leukemia virus subgroup A variant, FeLV-945, as a determinant of disease outcome.

PubMed

Bolin, Lisa L; Ahmad, Shamim; Levy, Laura S

2011-10-15

Feline leukemia virus (FeLV) is a natural retrovirus of domestic cats associated with degenerative, proliferative and malignant diseases. Studies of FeLV infection in a cohort of naturally infected cats were undertaken to examine FeLV variation, the selective pressures operative in FeLV infection that lead to predominance of natural variants, and the consequences for infection and disease progression. A unique variant, designated FeLV-945, was identified as the predominant isolate in the cohort and was associated with non-T-cell diseases including multicentric lymphoma. FeLV-945 was assigned to the FeLV-A subgroup based on sequence analysis and receptor utilization, but was shown to differ in sequence from a prototype member of FeLV-A, designated FeLV-A/61E, in the long terminal repeat (LTR) and the surface glycoprotein gene (SU). A unique sequence motif in the FeLV-945 LTR was shown to function as a transcriptional enhancer and to confer a replicative advantage. The FeLV-945 SU protein was observed to differ in sequence as compared to FeLV-A/61E within functional domains known to determine receptor selection and binding. Experimental infection of newborn cats was performed using wild type FeLV-A/61E or recombinant FeLV-A/61E in which the LTR (61E/945L) or LTR and SU (61E/945SL) were exchanged for that of FeLV-945. Infection with either FeLV-A/61E or 61E/945L resulted in T-cell lymphoma of the thymus, although 61E/945L caused disease significantly more rapidly. In contrast, infection with 61E/945SL resulted in the rapid induction of a multicentric lymphoma of B-cell origin, thus recapitulating the outcome of natural infection and implicating FeLV-945 SU as a determinant of disease outcome. Recombinant FeLV-B was detected infrequently and at low levels in multicentric lymphomas, and was thereby not implicated in disease induction. Preliminary studies of receptor interaction indicated that virus particles bearing FeLV-945 SU bind to the FeLV-A receptor more efficiently than do particles bearing FeLV-A/61E SU, and that soluble SU proteins expressed from the viruses demonstrate the same differential binding phenotype. Preliminary mutational analysis of FeLV-945 was performed by exchanging regions containing either the primary receptor binding determinant, VRA, the secondary determinant, VRB, or a proline-rich region, PRR, with that of FeLV-A/61E. Results implicated a region containing VRA as a minor contributor, while a region containing VRB largely conferred increased binding efficiency. Copyright © 2011 Elsevier B.V. All rights reserved.

A comprehensive analysis of 3′ end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation

PubMed Central

Gruber, Andreas J.; Schmidt, Ralf; Gruber, Andreas R.; Martin, Georges; Ghosh, Souvik; Belmadani, Manuel; Keller, Walter

2016-01-01

Alternative polyadenylation (APA) is a general mechanism of transcript diversification in mammals, which has been recently linked to proliferative states and cancer. Different 3′ untranslated region (3′ UTR) isoforms interact with different RNA-binding proteins (RBPs), which modify the stability, translation, and subcellular localization of the corresponding transcripts. Although the heterogeneity of pre-mRNA 3′ end processing has been established with high-throughput approaches, the mechanisms that underlie systematic changes in 3′ UTR lengths remain to be characterized. Through a uniform analysis of a large number of 3′ end sequencing data sets, we have uncovered 18 signals, six of which are novel, whose positioning with respect to pre-mRNA cleavage sites indicates a role in pre-mRNA 3′ end processing in both mouse and human. With 3′ end sequencing we have demonstrated that the heterogeneous ribonucleoprotein C (HNRNPC), which binds the poly(U) motif whose frequency also peaks in the vicinity of polyadenylation (poly(A)) sites, has a genome-wide effect on poly(A) site usage. HNRNPC-regulated 3′ UTRs are enriched in ELAV-like RBP 1 (ELAVL1) binding sites and include those of the CD47 gene, which participate in the recently discovered mechanism of 3′ UTR–dependent protein localization (UDPL). Our study thus establishes an up-to-date, high-confidence catalog of 3′ end processing sites and poly(A) signals, and it uncovers an important role of HNRNPC in regulating 3′ end processing. It further suggests that U-rich elements mediate interactions with multiple RBPs that regulate different stages in a transcript's life cycle. PMID:27382025

A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers.

PubMed

Quail, Michael A; Smith, Miriam; Coupland, Paul; Otto, Thomas D; Harris, Simon R; Connor, Thomas R; Bertoni, Anna; Swerdlow, Harold P; Gu, Yong

2012-07-24

Next generation sequencing (NGS) technology has revolutionized genomic and genetic research. The pace of change in this area is rapid with three major new sequencing platforms having been released in 2011: Ion Torrent's PGM, Pacific Biosciences' RS and the Illumina MiSeq. Here we compare the results obtained with those platforms to the performance of the Illumina HiSeq, the current market leader. In order to compare these platforms, and get sufficient coverage depth to allow meaningful analysis, we have sequenced a set of 4 microbial genomes with mean GC content ranging from 19.3 to 67.7%. Together, these represent a comprehensive range of genome content. Here we report our analysis of that sequence data in terms of coverage distribution, bias, GC distribution, variant detection and accuracy. Sequence generated by Ion Torrent, MiSeq and Pacific Biosciences technologies displays near perfect coverage behaviour on GC-rich, neutral and moderately AT-rich genomes, but a profound bias was observed upon sequencing the extremely AT-rich genome of Plasmodium falciparum on the PGM, resulting in no coverage for approximately 30% of the genome. We analysed the ability to call variants from each platform and found that we could call slightly more variants from Ion Torrent data compared to MiSeq data, but at the expense of a higher false positive rate. Variant calling from Pacific Biosciences data was possible but higher coverage depth was required. Context specific errors were observed in both PGM and MiSeq data, but not in that from the Pacific Biosciences platform. All three fast turnaround sequencers evaluated here were able to generate usable sequence. However there are key differences between the quality of that data and the applications it will support.

Extensive interactions between HIV TAT and TAF(II)250.

PubMed

Weissman, J D; Hwang, J R; Singer, D S

2001-03-09

The HIV transactivator, Tat, has been shown to be capable of potent repression of transcription initiation. Repression is mediated by the C-terminal segment of Tat, which binds the TFIID component, TAF(II)250, although the site(s) of interaction were not defined previously. We now report that the interaction between Tat and TAF(II)250 is extensive and involves multiple contacts between the Tat protein and TAF(II)250. The C-terminal domain of Tat, which is necessary for repression of transcription initiation, binds to a segment of TAF(II)250 that encompasses its acetyl transferase (AT) domain (885-1034 amino acids (aa)). Surprisingly, the N-terminal segment of Tat, which contains its activation domains, also binds to TAF(II)250 and interacts with two discontinuous segments of TAF(II)250 located between 885 and 984 aa and 1120 and 1279 aa. Binding of Tat to the 885-984 aa segment of TAF(II)250 requires the cysteine-rich domain of Tat, but not the acidic or glutamine-rich domains. Binding by the N-terminal domain of Tat to the 1120-1279 aa TAF(II)250 segment does not involve the acidic, cysteine- or glutamine-rich domains. Repression of transcription initiation by Tat requires functional TAF(II)250. We now demonstrate that transcription of the HIV LTR does not depend on TAF(II)250 which may account for its resistance to Tat mediated repression.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

The SH2-containing inositol polyphosphate 5-phosphatase, SHIP-2, binds filamin and regulates submembraneous actin

PubMed Central

Dyson, Jennifer M.; O'Malley, Cindy J.; Becanovic, Jelena; Munday, Adam D.; Berndt, Michael C.; Coghill, Imogen D.; Nandurkar, Harshal H.; Ooms, Lisa M.; Mitchell, Christina A.

2001-01-01

SHIP-2 is a phosphoinositidylinositol 3,4,5 trisphosphate (PtdIns[3,4,5]P3) 5-phosphatase that contains an NH2-terminal SH2 domain, a central 5-phosphatase domain, and a COOH-terminal proline-rich domain. SHIP-2 negatively regulates insulin signaling. In unstimulated cells, SHIP-2 localized in a perinuclear cytosolic distribution and at the leading edge of the cell. Endogenous and recombinant SHIP-2 localized to membrane ruffles, which were mediated by the COOH-terminal proline–rich domain. To identify proteins that bind to the SHIP-2 proline–rich domain, yeast two-hybrid screening was performed, which isolated actin-binding protein filamin C. In addition, both filamin A and B specifically interacted with SHIP-2 in this assay. SHIP-2 coimmunoprecipitated with filamin from COS-7 cells, and association between these species did not change after epidermal growth factor stimulation. SHIP-2 colocalized with filamin at Z-lines and the sarcolemma in striated muscle sections and at membrane ruffles in COS-7 cells, although the membrane ruffling response was reduced in cells overexpressing SHIP-2. SHIP-2 membrane ruffle localization was dependent on filamin binding, as SHIP-2 was expressed exclusively in the cytosol of filamin-deficient cells. Recombinant SHIP-2 regulated PtdIns(3,4,5)P3 levels and submembraneous actin at membrane ruffles after growth factor stimulation, dependent on SHIP-2 catalytic activity. Collectively these studies demonstrate that filamin-dependent SHIP-2 localization critically regulates phosphatidylinositol 3 kinase signaling to the actin cytoskeleton. PMID:11739414

Predicting RNA-protein binding sites and motifs through combining local and global deep convolutional neural networks.

PubMed

Pan, Xiaoyong; Shen, Hong-Bin

2018-05-02

RNA-binding proteins (RBPs) take over 5∼10% of the eukaryotic proteome and play key roles in many biological processes, e.g. gene regulation. Experimental detection of RBP binding sites is still time-intensive and high-costly. Instead, computational prediction of the RBP binding sites using pattern learned from existing annotation knowledge is a fast approach. From the biological point of view, the local structure context derived from local sequences will be recognized by specific RBPs. However, in computational modeling using deep learning, to our best knowledge, only global representations of entire RNA sequences are employed. So far, the local sequence information is ignored in the deep model construction process. In this study, we present a computational method iDeepE to predict RNA-protein binding sites from RNA sequences by combining global and local convolutional neural networks (CNNs). For the global CNN, we pad the RNA sequences into the same length. For the local CNN, we split a RNA sequence into multiple overlapping fixed-length subsequences, where each subsequence is a signal channel of the whole sequence. Next, we train deep CNNs for multiple subsequences and the padded sequences to learn high-level features, respectively. Finally, the outputs from local and global CNNs are combined to improve the prediction. iDeepE demonstrates a better performance over state-of-the-art methods on two large-scale datasets derived from CLIP-seq. We also find that the local CNN run 1.8 times faster than the global CNN with comparable performance when using GPUs. Our results show that iDeepE has captured experimentally verified binding motifs. https://github.com/xypan1232/iDeepE. xypan172436@gmail.com or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online.

RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

PubMed

Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

2016-06-15

Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Rat leucine-rich protein binds and activates the promoter of the beta isoform of Ca2+/calmodulin-dependent protein kinase II gene.

PubMed

Ochiai, Nagahiro; Masumoto, Shuji; Sakagami, Hiroyuki; Yoshimura, Yoshiyuki; Yamauchi, Takashi

2007-05-01

We previously found the neuronal cell-type specific promoter and binding partner of the beta isoform of Ca(2+)/calmodulin-dependent protein kinase II (beta CaM kinase II) in rat brain [Donai, H., Morinaga, H., Yamauchi, T., 2001. Genomic organization and neuronal cell type specific promoter activity of beta isoform of Ca(2+)/calmodulin-dependent protein kinase II of rat brain. Mol. Brain Res. 94, 35-47]. In the present study, we purified a protein that binds specifically a promoter region of beta CaM kinase II gene from a nuclear extract of the rat cerebellum using DEAE-cellulose column chromatography, ammonium sulfate fractionation, gel filtration and polyacrylamide gel electrophoresis. The purified protein was identified as rat leucine-rich protein 157 (rLRP157) using tandem mass spectrometry. Then, we prepared its cDNA by reverse transcriptase-polymerase chain reaction (RT-PCR) from poly(A)(+)RNA of rat cerebellum. The rLRP157 cDNA was introduced into mouse neuroblastomaxrat glioma hybrid NG108-15 cells, and cells stably expressing rLRP157 (NG/LRP cells) were isolated. Binding of rLRP157 with the promoter sequence was confirmed by electrophoretic mobility shift assay using nuclear extract of NG/LRP cells. A luciferase reporter gene containing a promoter of beta CaM kinase II was transiently expressed in NG/LRP cells. Under the conditions, the promoter activity was enhanced about 2.6-fold in NG/LRP cells as compared with wild-type cells. The expression of rLRP157 mRNA was paralleled with that of beta CaM kinase II in the adult and embryo rat brain detected by in situ hybridization. Nuclear localization of rLRP157 was confirmed using GFP-rLRP157 fusion protein investigated under a confocal microscope. These results indicate that rLRP157 is one of the proteins binding to, and regulating the activity of, the promoter of beta CaM kinase II.

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

PubMed Central

Naz, Sadia; Ngo, Tony; Farooq, Umar

2017-01-01

Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

PubMed

Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

2017-01-01

The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

A putative carbohydrate-binding domain of the lactose-binding Cytisus sessilifolius anti-H(O) lectin has a similar amino acid sequence to that of the L-fucose-binding Ulex europaeus anti-H(O) lectin.

PubMed

Konami, Y; Yamamoto, K; Osawa, T; Irimura, T

1995-04-01

The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

PubMed

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Identification of a novel PSR as the substrate of an SR protein kinase in the true slime mold.

PubMed

Zhang, Yong-Xia; Xing, Miao; Fei, Xuan; Zhang, Jian-Hua; Tian, Sheng-Li; Li, Ming-Hua; Liu, Shi-De

2011-03-01

Here, a novel cDNA encoding a serine/arginine (SR)-rich protein, designated PSR, was isolated from the true slime mold Physarum polycephalum and expressed in Escherichia coli. The deduced amino acid (aa) sequence reveals that PSR contains RS repeats at its C-terminus, similar to the conventional PSRPK substrate ASF/SF2. To study the novel protein, we generated a variety of mutant constructs by PCR and site-directed mutagenesis. Our analysis indicated that the purified recombinant PSR was phosphorylated by PSRPK in vitro and the SR-rich domain (amino acids 460-469) in the PSR protein was required for phosphorylation. In addition, removal of the docking motif (amino acids 424-450) from PSR significantly reduced the overall catalytic efficiency of the phosphorylation reaction. We also found that the conserved ATP-binding region (62)LGWGHFSTVWLAIDEKNGGREVALK(86) and the serine/threonine protein kinases active-site signature (184)IIHTDLKPENVLL(196) of PSRPK played a crucial role in substrate phosphorylation and Lys(86) and Asp(188) were crucial for PSRPK phosphorylation of PSR. These results suggest that PSR is a novel SR-related protein that is phosphorylated by PSRPK.

SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

PubMed Central

Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

2016-01-01

Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

Binding to the DNA Minor Groove by Heterocyclic Dications: From AT Specific Monomers to GC Recognition with Dimers

PubMed Central

Nanjunda, Rupesh; Wilson, W. David

2012-01-01

Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206

The wheat Sr50 gene reveals rich diversity at a cereal disease resistance locus

USDA-ARS?s Scientific Manuscript database

We identify the wheat stem rust resistance gene Sr50 by physical mapping, mutation and complementation as homologous to barley Mla encoding a Coiled-Coil-Nucleotide-Binding-Leucine-Rich Repeat (CC-NB-LRR) protein. We show that Sr50 confers a unique resistance specificity, different from Sr31 and oth...

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The nature of the hydroxyapatite-binding site in salivary acidic proline-rich proteins.

PubMed

Bennick, A; Cannon, M; Madapallimattam, G

1979-10-01

Protein A and C, which are major components of the acidic proline-rich proteins in human saliva, were digested, before or after adsorption to hydroxyapatite, with alkaline phosphatase, trypsin, thermolysin and a proteinase preparation from salivary sediment. The results demonstrate that the binding site is located in the proline-poor N-terminal part of the protein, possibly between residues 3 and 25. Phosphoserine is necessary for maximal adsorption of the proteins to hydroxyapatite. When proteins A and C are adsorbed to hydroxyapatite before proteolytic digestion there is a protection of some of the susceptible bonds in the N-terminal part of the proteins and a gradual removal of the proline-rich C-terminal part. Thermolysin can cleave susceptible bonds in the part of the protein that remains bound to hydroxyapatite, but at least some of the resulting peptides are retained on the mineral. Since the ability of the proteins to inhibit hydroxyapatite formation and to bind calcium is located in the N-terminal proline-poor part, it is possible that these activities are retained after proteolytic digestion of the adsorbed proteins.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

SARNAclust: Semi-automatic detection of RNA protein binding motifs from immunoprecipitation data

PubMed Central

Dotu, Ivan; Adamson, Scott I.; Coleman, Benjamin; Fournier, Cyril; Ricart-Altimiras, Emma; Eyras, Eduardo

2018-01-01

RNA-protein binding is critical to gene regulation, controlling fundamental processes including splicing, translation, localization and stability, and aberrant RNA-protein interactions are known to play a role in a wide variety of diseases. However, molecular understanding of RNA-protein interactions remains limited; in particular, identification of RNA motifs that bind proteins has long been challenging, especially when such motifs depend on both sequence and structure. Moreover, although RNA binding proteins (RBPs) often contain more than one binding domain, algorithms capable of identifying more than one binding motif simultaneously have not been developed. In this paper we present a novel pipeline to determine binding peaks in crosslinking immunoprecipitation (CLIP) data, to discover multiple possible RNA sequence/structure motifs among them, and to experimentally validate such motifs. At the core is a new semi-automatic algorithm SARNAclust, the first unsupervised method to identify and deconvolve multiple sequence/structure motifs simultaneously. SARNAclust computes similarity between sequence/structure objects using a graph kernel, providing the ability to isolate the impact of specific features through the bulge graph formalism. Application of SARNAclust to synthetic data shows its capability of clustering 5 motifs at once with a V-measure value of over 0.95, while GraphClust achieves only a V-measure of 0.083 and RNAcontext cannot detect any of the motifs. When applied to existing eCLIP sets, SARNAclust finds known motifs for SLBP and HNRNPC and novel motifs for several other RBPs such as AGGF1, AKAP8L and ILF3. We demonstrate an experimental validation protocol, a targeted Bind-n-Seq-like high-throughput sequencing approach that relies on RNA inverse folding for oligo pool design, that can validate the components within the SLBP motif. Finally, we use this protocol to experimentally interrogate the SARNAclust motif predictions for protein ILF3. Our results support a newly identified partially double-stranded UUUUUGAGA motif similar to that known for the splicing factor HNRNPC. PMID:29596423

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Binding of dinitrogen to an iron-sulfur-carbon site

NASA Astrophysics Data System (ADS)

Čorić, Ilija; Mercado, Brandon Q.; Bill, Eckhard; Vinyard, David J.; Holland, Patrick L.

2015-10-01

Nitrogenases are the enzymes by which certain microorganisms convert atmospheric dinitrogen (N2) to ammonia, thereby providing essential nitrogen atoms for higher organisms. The most common nitrogenases reduce atmospheric N2 at the FeMo cofactor, a sulfur-rich iron-molybdenum cluster (FeMoco). The central iron sites that are coordinated to sulfur and carbon atoms in FeMoco have been proposed to be the substrate binding sites, on the basis of kinetic and spectroscopic studies. In the resting state, the central iron sites each have bonds to three sulfur atoms and one carbon atom. Addition of electrons to the resting state causes the FeMoco to react with N2, but the geometry and bonding environment of N2-bound species remain unknown. Here we describe a synthetic complex with a sulfur-rich coordination sphere that, upon reduction, breaks an Fe-S bond and binds N2. The product is the first synthetic Fe-N2 complex in which iron has bonds to sulfur and carbon atoms, providing a model for N2 coordination in the FeMoco. Our results demonstrate that breaking an Fe-S bond is a chemically reasonable route to N2 binding in the FeMoco, and show structural and spectroscopic details for weakened N2 on a sulfur-rich iron site.

Logo2PWM: a tool to convert sequence logo to position weight matrix.

PubMed

Gao, Zhen; Liu, Lu; Ruan, Jianhua

2017-10-03

position weight matrix (PWM) and sequence logo are the most widely used representations of transcription factor binding site (TFBS) in biological sequences. Sequence logo - a graphical representation of PWM, has been widely used in scientific publications and reports, due to its easiness of human perception, rich information, and simple format. Different from sequence logo, PWM works great as a precise and compact digitalized form, which can be easily used by a variety of motif analysis software. There are a few available tools to generate sequence logos from PWM; however, no tool does the reverse. Such tool to convert sequence logo back to PWM is needed to scan a TFBS represented in logo format in a publication where the PWM is not provided or hard to be acquired. A major difficulty in developing such tool to convert sequence logo to PWM is to deal with the diversity of sequence logo images. We propose logo2PWM for reconstructing PWM from a large variety of sequence logo images. Evaluation results on over one thousand logos from three sources of different logo format show that the correlation between the reconstructed PWMs and the original PWMs are constantly high, where median correlation is greater than 0.97. Because of the high recognition accuracy, the easiness of usage, and, the availability of both web-based service and stand-alone application, we believe that logo2PWM can readily benefit the study of transcription by filling the gap between sequence logo and PWM.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Regulation of DNA Replication Timing on Human Chromosome by a Cell-Type Specific DNA Binding Protein SATB1

PubMed Central

Oda, Masako; Kanoh, Yutaka; Watanabe, Yoshihisa; Masai, Hisao

2012-01-01

Background Replication timing of metazoan DNA during S-phase may be determined by many factors including chromosome structures, nuclear positioning, patterns of histone modifications, and transcriptional activity. It may be determined by Mb-domain structures, termed as “replication domains”, and recent findings indicate that replication timing is under developmental and cell type-specific regulation. Methodology/Principal Findings We examined replication timing on the human 5q23/31 3.5-Mb segment in T cells and non-T cells. We used two independent methods to determine replication timing. One is quantification of nascent replicating DNA in cell cycle-fractionated stage-specific S phase populations. The other is FISH analyses of replication foci. Although the locations of early- and late-replicating domains were common between the two cell lines, the timing transition region (TTR) between early and late domains were offset by 200-kb. We show that Special AT-rich sequence Binding protein 1 (SATB1), specifically expressed in T-cells, binds to the early domain immediately adjacent to TTR and delays the replication timing of the TTR. Measurement of the chromosome copy number along the TTR during synchronized S phase suggests that the fork movement may be slowed down by SATB1. Conclusions Our results reveal a novel role of SATB1 in cell type-specific regulation of replication timing along the chromosome. PMID:22879953

Regulation of DNA replication timing on human chromosome by a cell-type specific DNA binding protein SATB1.

PubMed

Oda, Masako; Kanoh, Yutaka; Watanabe, Yoshihisa; Masai, Hisao

2012-01-01

Replication timing of metazoan DNA during S-phase may be determined by many factors including chromosome structures, nuclear positioning, patterns of histone modifications, and transcriptional activity. It may be determined by Mb-domain structures, termed as "replication domains", and recent findings indicate that replication timing is under developmental and cell type-specific regulation. We examined replication timing on the human 5q23/31 3.5-Mb segment in T cells and non-T cells. We used two independent methods to determine replication timing. One is quantification of nascent replicating DNA in cell cycle-fractionated stage-specific S phase populations. The other is FISH analyses of replication foci. Although the locations of early- and late-replicating domains were common between the two cell lines, the timing transition region (TTR) between early and late domains were offset by 200-kb. We show that Special AT-rich sequence Binding protein 1 (SATB1), specifically expressed in T-cells, binds to the early domain immediately adjacent to TTR and delays the replication timing of the TTR. Measurement of the chromosome copy number along the TTR during synchronized S phase suggests that the fork movement may be slowed down by SATB1. Our results reveal a novel role of SATB1 in cell type-specific regulation of replication timing along the chromosome.

Splicing factor SFRS1 recognizes a functionally diverse landscape of RNA transcripts.

PubMed

Sanford, Jeremy R; Wang, Xin; Mort, Matthew; Vanduyn, Natalia; Cooper, David N; Mooney, Sean D; Edenberg, Howard J; Liu, Yunlong

2009-03-01

Metazoan genes are encrypted with at least two superimposed codes: the genetic code to specify the primary structure of proteins and the splicing code to expand their proteomic output via alternative splicing. Here, we define the specificity of a central regulator of pre-mRNA splicing, the conserved, essential splicing factor SFRS1. Cross-linking immunoprecipitation and high-throughput sequencing (CLIP-seq) identified 23,632 binding sites for SFRS1 in the transcriptome of cultured human embryonic kidney cells. SFRS1 was found to engage many different classes of functionally distinct transcripts including mRNA, miRNA, snoRNAs, ncRNAs, and conserved intergenic transcripts of unknown function. The majority of these diverse transcripts share a purine-rich consensus motif corresponding to the canonical SFRS1 binding site. The consensus site was not only enriched in exons cross-linked to SFRS1 in vivo, but was also enriched in close proximity to splice sites. mRNAs encoding RNA processing factors were significantly overrepresented, suggesting that SFRS1 may broadly influence the post-transcriptional control of gene expression in vivo. Finally, a search for the SFRS1 consensus motif within the Human Gene Mutation Database identified 181 mutations in 82 different genes that disrupt predicted SFRS1 binding sites. This comprehensive analysis substantially expands the known roles of human SR proteins in the regulation of a diverse array of RNA transcripts.

Higher binding of the dopamine D3 receptor-preferring ligand [11C]-(+)-propyl-hexahydro-naphtho-oxazin in methamphetamine polydrug users: a positron emission tomography study.

PubMed

Boileau, Isabelle; Payer, Doris; Houle, Sylvain; Behzadi, Arian; Rusjan, Pablo M; Tong, Junchao; Wilkins, Diana; Selby, Peter; George, Tony P; Zack, Martin; Furukawa, Yoshiaki; McCluskey, Tina; Wilson, Alan A; Kish, Stephen J

2012-01-25

Positron emission tomography (PET) findings suggesting lower D2-type dopamine receptors and dopamine concentration in brains of stimulant users have prompted speculation that increasing dopamine signaling might help in drug treatment. However, this strategy needs to consider the possibility, based on animal and postmortem human data, that dopaminergic activity at the related D3 receptor might, in contrast, be elevated and thereby contribute to drug-taking behavior. We tested the hypothesis that D3 receptor binding is above normal in methamphetamine (MA) polydrug users, using PET and the D3-preferring ligand [11C]-(+)-propyl-hexahydro-naphtho-oxazin ([11C]-(+)-PHNO). Sixteen control subjects and 16 polydrug users reporting MA as their primary drug of abuse underwent PET scanning after [11C]-(+)-PHNO. Compared with control subjects, drug users had higher [11C]-(+)-PHNO binding in the D3-rich midbrain substantia nigra (SN; +46%; p<0.02) and in the globus pallidus (+9%; p=0.06) and ventral pallidum (+11%; p=0.1), whereas binding was slightly lower in the D2-rich dorsal striatum (approximately -4%, NS; -12% in heavy users, p=0.01) and related to drug-use severity. The [11C]-(+)-PHNO binding ratio in D3-rich SN versus D2-rich dorsal striatum was 55% higher in MA users (p=0.004), with heavy but not moderate users having ratios significantly different from controls. [11C]-(+)-PHNO binding in SN was related to self-reported "drug wanting." We conclude that the dopamine D3 receptor, unlike the D2 receptor, might be upregulated in brains of MA polydrug users, although lower dopamine levels in MA users could have contributed to the finding. Pharmacological studies are needed to establish whether normalization of D3 receptor function could reduce vulnerability to relapse in stimulant abuse.

Higher binding of the dopamine D3 receptor-preferring ligand [11C]-(+)-PHNO in Methamphetamine Polydrug Users: A Positron Emission Tomography Study

PubMed Central

Boileau, Isabelle; Payer, Doris; Houle, Sylvain; Behzadi, Arian; Rusjan, Pablo M.; Tong, Junchao; Wilkins, Diana; Selby, Peter; George, Tony P.; Zack, Martin; Furukawa, Yoshiaki; McCluskey, Tina; Wilson, Alan A.; Kish, Stephen J.

2012-01-01

Positron emission tomography (PET) findings suggesting lower D2-type dopamine receptors and dopamine concentration in brains of stimulant users have prompted speculation that increasing dopamine signaling might help in drug-treatment. However, this strategy needs to consider the possibility, based on animal and postmortem human data, that dopaminergic activity at the related D3 receptor might, in contrast, be elevated, and thereby contribute to drug-taking behavior. We tested the hypothesis that D3 receptor binding is above-normal in methamphetamine (MA) polydrug users, using PET and the D3-preferring ligand [11C]-(+)-PHNO. Sixteen control subjects and 16 polydrug users reporting MA as their primary drug of abuse underwent PET scanning following [11C]-(+)-PHNO. Compared to control subjects, drug users had higher [11C]-(+)-PHNO binding in the D3-rich midbrain substantia nigra (SN, +46%, p<0.02) and in the globus pallidus (+9%, p=0.06) and ventral pallidum (+11%, p=0.1), whereas binding was slightly lower in the D2-rich dorsal striatum (~−4%, NS; −12% in heavy users, p=0.01) and related to drug-use severity. [11C]-(+)-PHNO binding ratio in D3-rich SN vs. D2-rich dorsal striatum was 55% higher in MA users (p=0.004), with heavy but not moderate users having ratios significantly different from controls. [11C]-(+)-PHNO binding in SN was related to self-reported “drug-wanting.” We conclude that the dopamine D3 receptor, unlike the D2 receptor, might be upregulated in brains of MA polydrug users although lower dopamine levels in MA users could have contributed to the finding. Pharmacological studies are needed to establish whether normalization of D3 receptor function could reduce vulnerability to relapse in stimulant abuse. PMID:22279219

Mapping specificity landscapes of RNA-protein interactions by high throughput sequencing.

PubMed

Jankowsky, Eckhard; Harris, Michael E

2017-04-15

To function in a biological setting, RNA binding proteins (RBPs) have to discriminate between alternative binding sites in RNAs. This discrimination can occur in the ground state of an RNA-protein binding reaction, in its transition state, or in both. The extent by which RBPs discriminate at these reaction states defines RBP specificity landscapes. Here, we describe the HiTS-Kin and HiTS-EQ techniques, which combine kinetic and equilibrium binding experiments with high throughput sequencing to quantitatively assess substrate discrimination for large numbers of substrate variants at ground and transition states of RNA-protein binding reactions. We discuss experimental design, practical considerations and data analysis and outline how a combination of HiTS-Kin and HiTS-EQ allows the mapping of RBP specificity landscapes. Copyright © 2017 Elsevier Inc. All rights reserved.

Informative priors based on transcription factor structural class improve de novo motif discovery.

PubMed

Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

2006-07-15

An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

PubMed

Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

2017-05-10

G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

Recognition of p63 by the E3 ligase ITCH: Effect of an ectodermal dysplasia mutant.

PubMed

Bellomaria, A; Barbato, Gaetano; Melino, G; Paci, M; Melino, Sonia

2010-09-15

The E3 ubiquitin ligase Itch mediates the degradation of the p63 protein. Itch contains four WW domains which are pivotal for the substrate recognition process. Indeed, this domain is implicated in several signalling complexes crucially involved in human diseases including Muscular Dystrophy, Alzheimer's Disease and Huntington Disease. WW domains are highly compact protein-protein binding modules that interact with short proline-rich sequences. The four WW domains present in Itch belong to the Group I type, which binds polypeptides with a PY motif characterized by a PP xY consensus sequence, where x can be any residue. Accordingly, the Itch-p63 interaction results from a direct binding of Itch-WW2 domain with the PY motif of p63. Here, we report a structural analysis of the Itch-p63 interaction by fluorescence, CD and NMR spectroscopy. Indeed, we studied the in vitro interaction between Itch-WW2 domain and p63(534-551), an 18-mer peptide encompassing a fragment of the p63 protein including the PY motif. In addition, we evaluated the conformation and the interaction with Itch-WW2 of a site specific mutant of p63, I549T, that has been reported in both Hay-Wells syndrome and Rapp-Hodgkin syndrome. Based on our results, we propose an extended PP xY motif for the Itch recognition motif (P-P-P-Y-x(4)-[ST]-[ILV]), which includes these C-terminal residues to the PP xY motif.

Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System

PubMed Central

Smith, L. Courtney

2012-01-01

The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951

Translational control by cytoplasmic polyadenylation during Xenopus oocyte maturation: characterization of cis and trans elements and regulation by cyclin/MPF.

PubMed

McGrew, L L; Richter, J D

1990-11-01

The expression of certain maternal mRNAs during oocyte maturation is regulated by cytoplasmic polyadenylation. To understand this process, we have focused on a maternal mRNA from Xenopus termed G10. This mRNA is stored in the cytoplasm of stage 6 oocytes until maturation when the process of poly(A) elongation stimulates its translation. Deletion analysis of the 3' untranslated region of G10 RNA has revealed that two sequence elements, UUUUUUAU and AAUAAA were both necessary and sufficient for polyadenylation and polysomal recruitment. In this communication, we have defined the U-rich region that is optimal for polyadenylation as UUUUUUAUAAAG, henceforth referred to as the cytoplasmic polyadenylation element (CPE). We have also identified unique sequence requirements in the 3' terminus of the RNA that can modulate polyadenylation even in the presence of wild-type cis elements. A time course of cytoplasmic polyadenylation in vivo shows that it is an early event of maturation and that it requires protein synthesis within the first 15 min of exposure to progesterone. MPF and cyclin can both induce polyadenylation but, at least with respect to MPF, cannot obviate the requirement for protein synthesis. To identify factors that may be responsible for maturation-specific polyadenylation, we employed extracts from oocytes and unfertilized eggs, the latter of which correctly polyadenylates exogenously added RNA. UV crosslinking demonstrated that an 82 kd protein binds to the U-rich CPE in egg, but not oocyte, extracts. The data suggest that progesterone, either in addition to or through MPF/cyclin, induces the synthesis of a factor during very early maturation that stimulates polyadenylation.(ABSTRACT TRUNCATED AT 250 WORDS)

Principles of regulatory information conservation between mouse and human.

PubMed

Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

2014-11-20

To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

PubMed

Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

2011-02-01

RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

PubMed

Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

2017-01-01

The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

Poly(A) polymerase contains multiple functional domains.

PubMed Central

Raabe, T; Murthy, K G; Manley, J L

1994-01-01

Poly(A) polymerase (PAP) contains regions of similarity with several known protein domains. Through site-directed mutagenesis, we provide evidence that PAP contains a functional ribonucleoprotein-type RNA binding domain (RBD) that is responsible for primer binding, making it the only known polymerase to contain such a domain. The RBD is adjacent to, and probably overlaps with, an apparent catalytic region responsible for polymerization. Despite the presence of sequence similarities, this catalytic domain appears to be distinct from the conserved polymerase module found in a large number of RNA-dependent polymerases. PAP contains two nuclear localization signals (NLSs) in its C terminus, each by itself similar to the consensus bipartite NLS found in many nuclear proteins. Mutagenesis experiments indicate that both signals, which are separated by nearly 140 residues, play important roles in directing PAP exclusively to the nucleus. Surprisingly, basic amino acids in the N-terminal-most NLS are also essential for AAUAAA-dependent polyadenylation but not for nonspecific poly(A) synthesis, suggesting that this region of PAP is involved in interactions both with nuclear targeting proteins and with nuclear polyadenylation factors. The serine/threonine-rich C terminus is multiply phosphorylated, including at sites affected by mutations in either NLS. Images PMID:8164653

Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

2008-06-06

Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

Structural and functional characterization of a calcium-activated cation channel from Tsukamurella paurometabola

NASA Astrophysics Data System (ADS)

Dhakshnamoorthy, Balasundaresan; Rohaim, Ahmed; Rui, Huan; Blachowicz, Lydia; Roux, Benoît

2016-09-01

The selectivity filter is an essential functional element of K+ channels that is highly conserved both in terms of its primary sequence and its three-dimensional structure. Here, we investigate the properties of an ion channel from the Gram-positive bacterium Tsukamurella paurometabola with a selectivity filter formed by an uncommon proline-rich sequence. Electrophysiological recordings show that it is a non-selective cation channel and that its activity depends on Ca2+ concentration. In the crystal structure, the selectivity filter adopts a novel conformation with Ca2+ ions bound within the filter near the pore helix where they are coordinated by backbone oxygen atoms, a recurrent motif found in multiple proteins. The binding of Ca2+ ion in the selectivity filter controls the widening of the pore as shown in crystal structures and in molecular dynamics simulations. The structural, functional and computational data provide a characterization of this calcium-gated cationic channel.

Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs.

PubMed

Morita, Teppei; Nishino, Ryo; Aiba, Hiroji

2017-09-01

Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3' end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. © 2017 Morita et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Genetic variability and natural selection at the ligand domain of the Duffy binding protein in brazilian Plasmodium vivax populations

PubMed Central

2010-01-01

Background Plasmodium vivax malaria is a major public health challenge in Latin America, Asia and Oceania, with 130-435 million clinical cases per year worldwide. Invasion of host blood cells by P. vivax mainly depends on a type I membrane protein called Duffy binding protein (PvDBP). The erythrocyte-binding motif of PvDBP is a 170 amino-acid stretch located in its cysteine-rich region II (PvDBPII), which is the most variable segment of the protein. Methods To test whether diversifying natural selection has shaped the nucleotide diversity of PvDBPII in Brazilian populations, this region was sequenced in 122 isolates from six different geographic areas. A Bayesian method was applied to test for the action of natural selection under a population genetic model that incorporates recombination. The analysis was integrated with a structural model of PvDBPII, and T- and B-cell epitopes were localized on the 3-D structure. Results The results suggest that: (i) recombination plays an important role in determining the haplotype structure of PvDBPII, and (ii) PvDBPII appears to contain neutrally evolving codons as well as codons evolving under natural selection. Diversifying selection preferentially acts on sites identified as epitopes, particularly on amino acid residues 417, 419, and 424, which show strong linkage disequilibrium. Conclusions This study shows that some polymorphisms of PvDBPII are present near the erythrocyte-binding domain and might serve to elude antibodies that inhibit cell invasion. Therefore, these polymorphisms should be taken into account when designing vaccines aimed at eliciting antibodies to inhibit erythrocyte invasion. PMID:21092207

Flexible docking of a ligand peptide to a receptor protein by multicanonical molecular dynamics simulation

NASA Astrophysics Data System (ADS)

Nakajima, Nobuyuki; Higo, Junichi; Kidera, Akinori; Nakamura, Haruki

1997-10-01

A new method for flexible docking by multicanonical molecular dynamics simulation is presented. The method was applied to the binding of a short proline-rich peptide to a Src homology 3 (SH3) domain. The peptide and the side-chains at the ligand binding cleft of SH3 were completely flexible and the large number of possible conformations and dispositions of the peptide were sampled. The reweighted canonical resemble at 300 K resulted in only a few predominant binding modes, one of which was similar to the complex crystal structure. The inverted peptide orientation was also observed in the other binding modes.

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Non-B-Form DNA Is Enriched at Centromeres

PubMed Central

Henikoff, Steven

2018-01-01

Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

Rsp5 WW domains interact directly with the carboxyl-terminal domain of RNA polymerase II.

PubMed

Chang, A; Cheang, S; Espanel, X; Sudol, M

2000-07-07

RSP5 is an essential gene in Saccharomyces cerevisiae and was recently shown to form a physical and functional complex with RNA polymerase II (RNA pol II). The amino-terminal half of Rsp5 consists of four domains: a C2 domain, which binds membrane phospholipids; and three WW domains, which are protein interaction modules that bind proline-rich ligands. The carboxyl-terminal half of Rsp5 contains a HECT (homologous to E6-AP carboxyl terminus) domain that catalytically ligates ubiquitin to proteins and functionally classifies Rsp5 as an E3 ubiquitin-protein ligase. The C2 and WW domains are presumed to act as membrane localization and substrate recognition modules, respectively. We report that the second (and possibly third) Rsp5 WW domain mediates binding to the carboxyl-terminal domain (CTD) of the RNA pol II large subunit. The CTD comprises a heptamer (YSPTSPS) repeated 26 times and a PXY core that is critical for interaction with a specific group of WW domains. An analysis of synthetic peptides revealed a minimal CTD sequence that is sufficient to bind to the second Rsp5 WW domain (Rsp5 WW2) in vitro and in yeast two-hybrid assays. Furthermore, we found that specific "imperfect" CTD repeats can form a complex with Rsp5 WW2. In addition, we have shown that phosphorylation of this minimal CTD sequence on serine, threonine and tyrosine residues acts as a negative regulator of the Rsp5 WW2-CTD interaction. In view of the recent data pertaining to phosphorylation-driven interactions between the RNA pol II CTD and the WW domain of Ess1/Pin1, we suggest that CTD dephosphorylation may be a prerequisite for targeted RNA pol II degradation.

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

New Structural and Functional Contexts of the Dx[DN]xDG Linear Motif: Insights into Evolution of Calcium-Binding Proteins

PubMed Central

Rigden, Daniel J.; Woodhead, Duncan D.; Wong, Prudence W. H.; Galperin, Michael Y.

2011-01-01

Binding of calcium ions (Ca2+) to proteins can have profound effects on their structure and function. Common roles of calcium binding include structure stabilization and regulation of activity. It is known that diverse families – EF-hands being one of at least twelve – use a Dx[DN]xDG linear motif to bind calcium in near-identical fashion. Here, four novel structural contexts for the motif are described. Existing experimental data for one of them, a thermophilic archaeal subtilisin, demonstrate for the first time a role for Dx[DN]xDG-bound calcium in protein folding. An integrin-like embedding of the motif in the blade of a β-propeller fold – here named the calcium blade – is discovered in structures of bacterial and fungal proteins. Furthermore, sensitive database searches suggest a common origin for the calcium blade in β-propeller structures of different sizes and a pan-kingdom distribution of these proteins. Factors favouring the multiple convergent evolution of the motif appear to include its general Asp-richness, the regular spacing of the Asp residues and the fact that change of Asp into Gly and vice versa can occur though a single nucleotide change. Among the known structural contexts for the Dx[DN]xDG motif, only the calcium blade and the EF-hand are currently found intracellularly in large numbers, perhaps because the higher extracellular concentration of Ca2+ allows for easier fixing of newly evolved motifs that have acquired useful functions. The analysis presented here will inform ongoing efforts toward prediction of similar calcium-binding motifs from sequence information alone. PMID:21720552

Calcium binding properties of calcium dependent protein kinase 1 (CaCDPK1) from Cicer arietinum.

PubMed

Dixit, Ajay Kumar; Jayabaskaran, Chelliah

2015-05-01

Calcium plays a crucial role as a secondary messenger in all aspects of plant growth, development and survival. Calcium dependent protein kinases (CDPKs) are the major calcium decoders, which couple the changes in calcium level to an appropriate physiological response. The mechanism by which calcium regulates CDPK protein is not well understood. In this study, we investigated the interactions of Ca(2+) ions with the CDPK1 isoform of Cicer arietinum (CaCDPK1) using a combination of biophysical tools. CaCDPK1 has four different EF hands as predicted by protein sequence analysis. The fluorescence emission spectrum of CaCDPK1 showed quenching with a 5 nm red shift upon addition of calcium, indicating conformational changes in the tertiary structure. The plot of changes in intensity against calcium concentrations showed a biphasic curve with binding constants of 1.29 μM and 120 μM indicating two kinds of binding sites. Isothermal calorimetric (ITC) titration with CaCl2 also showed a biphasic curve with two binding constants of 0.027 μM and 1.7 μM. Circular dichroism (CD) spectra showed two prominent peaks at 208 and 222 nm indicating that CaCDPK1 is a α-helical rich protein. Calcium binding further increased the α-helical content of CaCDPK1 from 75 to 81%. Addition of calcium to CaCDPK1 also increased fluorescence of 8-anilinonaphthalene-1-sulfonic acid (ANS) indicating exposure of hydrophobic surfaces. Thus, on the whole this study provides evidence for calcium induced conformational changes, exposure of hydrophobic surfaces and heterogeneity of EF hands in CaCDPK1. Copyright © 2015 Elsevier GmbH. All rights reserved.

Sequence analysis of serum albumins reveals the molecular evolution of ligand recognition properties.

PubMed

Fanali, Gabriella; Ascenzi, Paolo; Bernardi, Giorgio; Fasano, Mauro

2012-01-01

Serum albumin (SA) is a circulating protein providing a depot and carrier for many endogenous and exogenous compounds. At least seven major binding sites have been identified by structural and functional investigations mainly in human SA. SA is conserved in vertebrates, with at least 49 entries in protein sequence databases. The multiple sequence analysis of this set of entries leads to the definition of a cladistic tree for the molecular evolution of SA orthologs in vertebrates, thus showing the clustering of the considered species, with lamprey SAs (Lethenteron japonicum and Petromyzon marinus) in a separate outgroup. Sequence analysis aimed at searching conserved domains revealed that most SA sequences are made up by three repeated domains (about 600 residues), as extensively characterized for human SA. On the contrary, lamprey SAs are giant proteins (about 1400 residues) comprising seven repeated domains. The phylogenetic analysis of the SA family reveals a stringent correlation with the taxonomic classification of the species available in sequence databases. A focused inspection of the sequences of ligand binding sites in SA revealed that in all sites most residues involved in ligand binding are conserved, although the versatility towards different ligands could be peculiar of higher organisms. Moreover, the analysis of molecular links between the different sites suggests that allosteric modulation mechanisms could be restricted to higher vertebrates.

An Exposed KID-Like Domain in Human T-Cell Lymphotropic Virus Type 1 Tax Is Responsible for the Recruitment of Coactivators CBP/p300

PubMed Central

Harrod, Robert; Tang, Yong; Nicot, Christophe; Lu, Hsieng S.; Vassilev, Alex; Nakatani, Yoshihiro; Giam, Chou-Zen

1998-01-01

Human T-cell lymphotropic virus type 1 (HTLV-1) transcriptional activation is mediated by the viral transactivator, Tax, and three 21-bp repeats (Tax response element [TxRE]) located in the U3 region of the viral long terminal repeat (LTR). Each TxRE contains a core cyclic AMP response element (CRE) flanked by 5′ G-rich and 3′ C-rich sequences. The TxRE binds CREB (CRE-binding protein) and Tax to form a ternary complex and confers Tax-dependent transactivation. Recent data indicate that Tax functions as a specific link to connect CREB-binding protein (CBP)/p300 in a phosphorylation-independent manner to CREB/ATF-1 assembled on the viral 21-bp repeats. Glutathione S-transferase pull-down performed with Tax deletion mutants and peptide competition have localized the site in Tax critical for binding CBP/p300 to a highly protease-sensitive region around amino acid residues 81 to 95 (81QRTSKTLKVLTPPIT95) which lies between the domains previously proposed to be important for CREB binding and Tax subunit dimerization. Amino acid residues around the trypsin- and chymotrypsin-sensitive sites (88KVL90) of Tax bear resemblance to those in the kinase-inducible domain of CREB (129SRRPSYRKILNE140) surrounding Ser-133, which undergoes signal-induced phosphorylation to recruit CBP/p300. Site-directed mutagenesis of residues in this domain (R82A, K85A, K88A, and V89A) resulted in proteins which failed to transactivate from the HTLV-1 LTR in vivo. These mutants (K85A, K88A, and V89A) bind CREB with similar affinities as wild-type Tax, yet interaction with CBP/p300 is abrogated in various biochemical assays, indicating that the recruitment of CBP/p300 is crucial for Tax transactivation. A Tax mutant, M47, defective in the COOH-terminal transactivation domain, continued to interact with CBP/p300, suggesting that interactions with additional cellular factors are required for proper Tax function. PMID:9710589

Binding of the Biogenic Polyamines to Deoxyribonucleic Acids of Varying Base Composition: Base Specificity and the Associated Energetics of the Interaction

PubMed Central

Kabir, Ayesha; Suresh Kumar, Gopinatha

2013-01-01

Background The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Methodology/Principal Findings Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. Conclusion/Significance From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies. PMID:23894663

Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

PubMed

Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

2017-05-01

Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

PubMed

Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

2015-01-01

Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

A peptide sequence on carcinoembryonic antigen binds to a 80kD protein on Kupffer cells.

PubMed

Thomas, P; Petrick, A T; Toth, C A; Fox, E S; Elting, J J; Steele, G

1992-10-30

Clearance of carcinoembryonic antigen (CEA) from the circulation is by binding to Kupffer cells in the liver. We have shown that CEA binding to Kupffer cells occurs via a peptide sequence YPELPK representing amino acids 107-112 of the CEA sequence. This peptide sequence is located in the region between the N-terminal and the first immunoglobulin like loop domain. Using native CEA and peptides containing this sequence complexed with a heterobifunctional crosslinking agent and ligand blotting with biotinylated CEA and NCA we have shown binding to an 80kD protein on the Kupffer cell surface. This binding protein may be important in the development of hepatic metastases.

The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.

PubMed Central

Zubiaga, A M; Belasco, J G; Greenberg, M E

1995-01-01

Labile mRNAs that encode cytokine and immediate-early gene products often contain AU-rich sequences within their 3' untranslated region (UTR). These AU-rich sequences appear to be key determinants of the short half-lives of these mRNAs, although the sequence features of these elements and the mechanism by which they target mRNAs for rapid decay have not been fully defined. We have examined the features of AU-rich elements (AREs) that are crucial for their function as determinants of mRNA instability in mammalian cells by testing the ability of various mutant c-fos AREs and synthetic AREs to direct rapid mRNA deadenylation and decay when inserted within the 3' UTR of the normally stable beta-globin mRNA. Evidence is presented that the pentamer AUUUA, which previously was suggested to be the minimal determinant of instability present in mammalian AREs, cannot direct rapid mRNA deadenylation and decay. Instead, the nonomer UUAUUUAUU is the elemental AU-rich sequence motif that destabilizes mRNA. Removal of one uridine residue from either end of the nonamer (UUAUUUAU or UAUUUAUU) results in a decrease of potency of the element, while removal of a uridine residue from both ends of the nonamer (UAUUUAU) eliminates detectable destabilizing activity. The inclusion of an additional uridine residue at both ends of the nonamer (UUUAUUUAUUU) does not further increase the efficacy of the element. Taken together, these findings suggest that the nonamer UUAUUUAUU is the minimal AU-rich motif that effectively destabilizes mRNA. Additional ARE potency is achieved by combining multiple copies of this nonamer in a single mRNA 3' UTR. Furthermore, analysis of poly(A) shortening rates for ARE-containing mRNAs reveals that the UUAUUUAUU sequence also accelerates mRNA deadenylation and suggests that the UUAUUUAUU motif targets mRNA for rapid deadenylation as an early step in the mRNA decay process. PMID:7891716

Polyphenol-Rich Pomegranate Juice Reduces IgE Binding to Cashew Nut Allergens

USDA-ARS?s Scientific Manuscript database

Cashew nut allergy is mediated by IgE binding to seed-storage proteins including Ana o 1, 2, and 3. Cashew nuts commonly cause severe reactions and only small amounts are needed. Polyphenol rich juices and polyphenol compounds have been demonstrated to complex with peanut allergens. The interacti...